The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025604	Mycobacterium tuberculosis strain GG-129-11 chromosome, complete genome	4411413	888948	947513	4411413	bacteriocin,transposase,tRNA,protease	Burkholderia_virus(16.67%)	53	NA	NA
WP_087902221.1|888948_890209_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009935676.1|890264_891359_+|transposase	IS110-like element IS1547 family transposase	transposase	NA	NA	NA	NA
WP_003404092.1|891348_892146_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003404098.1|892142_893150_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_003404103.1|893194_894496_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_003898592.1|894507_894855_+	VOC family protein	NA	NA	NA	NA	NA
WP_003404111.1|894848_895505_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010924301.1|895696_897961_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.2	1.8e-273
WP_003404117.1|897957_898587_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003404120.1|898707_899664_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_003898594.1|899608_901207_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
WP_003404127.1|901511_901901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404129.1|901987_903571_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|903601_904696_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
WP_003404135.1|904781_904964_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_003404137.1|905110_906217_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003404139.1|906299_907169_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_003898596.1|907214_907895_-	FABP family protein	NA	NA	NA	NA	NA
WP_003404278.1|908057_908360_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_003404293.1|908361_909195_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003898598.1|909487_909910_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003404298.1|909906_910719_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_003898599.1|910848_911616_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|911612_912560_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|912602_913379_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
WP_003404314.1|913434_914076_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_058028325.1|914133_916188_-	LCP family protein	NA	NA	NA	NA	NA
WP_003898601.1|916353_917523_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003404321.1|917610_918627_-	acyl-ACP desaturase DesA1	NA	NA	NA	NA	NA
WP_003404326.1|918788_919430_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003898602.1|919510_920566_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_003404335.1|920617_921010_-	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR	NA	NA	NA	NA	NA
WP_003404336.1|921067_921490_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003900218.1|921451_921742_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003404349.1|921846_922752_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404352.1|922770_923586_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_010924308.1|927713_930353_-	PE family protein	NA	NA	NA	NA	NA
WP_003404362.1|930820_931465_+	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_003898607.1|931445_931997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003906455.1|932146_932800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003404368.1|932870_933899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898609.1|934587_935358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404373.1|935444_936257_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404376.1|936324_937185_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_003404379.1|937460_937703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404382.1|937979_939272_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404384.1|939255_940260_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_003404388.1|940323_940974_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003898611.1|941057_942335_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003404392.1|942547_944062_-	multicopper oxidase MmcO	NA	NA	NA	NA	NA
WP_003901025.1|944210_944603_+	lipoprotein LpqS	NA	NA	NA	NA	NA
WP_003404402.1|945924_947184_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404404.1|947180_947513_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP025604	Mycobacterium tuberculosis strain GG-129-11 chromosome, complete genome	4411413	2941095	2976452	4411413	head,terminase,capsid,transposase,integrase,protease,tRNA	Tupanvirus(11.11%)	41	2969887:2969914	2980869:2980896
WP_003413486.1|2941095_2943174_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2943282_2943510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2943506_2944892_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2945236_2945737_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2945753_2946194_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_010924555.1|2946340_2947018_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2947002_2947356_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2947368_2947794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2947790_2948465_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2948542_2949364_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2949499_2950393_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2950395_2951214_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2951228_2952410_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2952468_2952900_-	hypoxic response protein Hrp1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2953413_2954655_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2954964_2955327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2955673_2956798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2956799_2957339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010924557.1|2957478_2958777_+	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2958815_2959097_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2959241_2959727_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2959753_2960011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102770491.1|2960011_2962339_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2962367_2962610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2962610_2963288_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2963483_2964140_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2964302_2964749_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2964923_2965256_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2965375_2965735_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965836_2966295_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2966430_2966811_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2966807_2968304_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2968493_2968730_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2968802_2968976_+	hypothetical protein	NA	NA	NA	NA	NA
2969887:2969914	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2970020_2970452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2970448_2971447_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2971460_2971925_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_087902221.1|2972057_2973318_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003899411.1|2973692_2975132_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2975139_2975673_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2975825_2976452_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980869:2980896	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
