The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025596	Mycobacterium tuberculosis strain GG-27-11 chromosome, complete genome	4411443	888961	947525	4411443	tRNA,transposase,protease,bacteriocin	Burkholderia_virus(16.67%)	54	NA	NA
WP_087902221.1|888961_890222_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009935676.1|890277_891372_+|transposase	IS110-like element IS1547 family transposase	transposase	NA	NA	NA	NA
WP_003404092.1|891361_892159_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003404098.1|892155_893163_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_003404103.1|893207_894509_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_003898592.1|894520_894868_+	VOC family protein	NA	NA	NA	NA	NA
WP_003404111.1|894861_895518_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010924301.1|895709_897974_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.2	1.8e-273
WP_003404117.1|897970_898600_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003404120.1|898720_899677_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_003898594.1|899621_901220_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
WP_003404127.1|901524_901914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404129.1|902000_903584_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|903614_904709_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
WP_003404135.1|904794_904977_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_003404137.1|905123_906230_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003404139.1|906312_907182_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_003898596.1|907227_907908_-	FABP family protein	NA	NA	NA	NA	NA
WP_003404278.1|908070_908373_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_003404293.1|908374_909208_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003898598.1|909500_909923_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003404298.1|909919_910732_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_003898599.1|910861_911629_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|911625_912573_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|912615_913392_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
WP_003404314.1|913447_914089_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003898600.1|914146_916201_-	LCP family protein	NA	NA	NA	NA	NA
WP_003898601.1|916366_917536_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003404321.1|917623_918640_-	acyl-ACP desaturase DesA1	NA	NA	NA	NA	NA
WP_003404326.1|918801_919443_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003898602.1|919523_920579_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_003404335.1|920630_921023_-	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR	NA	NA	NA	NA	NA
WP_003404336.1|921080_921503_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003900218.1|921464_921755_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003404349.1|921859_922765_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404352.1|922783_923599_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_015345040.1|927726_930366_-	PE family protein	NA	NA	NA	NA	NA
WP_003404362.1|930833_931478_+	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_003898607.1|931458_932010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003906455.1|932159_932813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003404368.1|932883_933912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898609.1|934600_935371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404373.1|935457_936270_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404376.1|936337_937198_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_003404379.1|937473_937716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404382.1|937992_939285_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404384.1|939268_940273_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_003404388.1|940336_940987_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003898611.1|941070_942348_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003404392.1|942560_944075_-	multicopper oxidase MmcO	NA	NA	NA	NA	NA
WP_003901025.1|944223_944616_+	lipoprotein LpqS	NA	NA	NA	NA	NA
WP_003404395.1|944818_945937_+	S-sulfocysteine synthase CysK2	NA	NA	NA	NA	NA
WP_003404402.1|945936_947196_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404404.1|947192_947525_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP025596	Mycobacterium tuberculosis strain GG-27-11 chromosome, complete genome	4411443	2941093	2976459	4411443	terminase,tRNA,integrase,transposase,protease,capsid,head	Tupanvirus(11.11%)	42	2969894:2969921	2980876:2980903
WP_003413486.1|2941093_2943172_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2943280_2943508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2943504_2944890_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2945234_2945735_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2945751_2946192_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_010924555.1|2946338_2947016_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2947000_2947354_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2947366_2947792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2947788_2948463_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2948540_2949362_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2949497_2950391_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2950393_2951212_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2951226_2952408_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2952466_2952898_-	hypoxic response protein Hrp1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2953411_2954653_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2954962_2955325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2955671_2956796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2956797_2957337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010924557.1|2957476_2958775_+	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2958813_2959095_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2959239_2959725_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2959751_2960009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023641824.1|2960009_2962346_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2962374_2962617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2962617_2963295_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2963490_2964147_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2964309_2964756_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2964930_2965263_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2965382_2965742_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965843_2966302_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2966437_2966818_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2966814_2968311_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2968500_2968737_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2968809_2968983_+	hypothetical protein	NA	NA	NA	NA	NA
2969894:2969921	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2970027_2970459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2970455_2971454_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2971467_2971932_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_087902221.1|2972064_2973325_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_015630490.1|2973352_2973538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899411.1|2973699_2975139_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2975146_2975680_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2975832_2976459_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980876:2980903	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
