The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP033599	Pasteurella multocida strain CQ2 chromosome, complete genome	2363600	35036	76297	2363600	head,terminase,holin,integrase,tail	Mannheimia_phage(41.67%)	60	31300:31317	51221:51238
31300:31317	attL	TCGTATTTGTGCTTGCTG	NA	NA	NA	NA
WP_014390695.1|35036_36209_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A059VF45	Pseudomonas_phage	53.1	2.0e-111
WP_051127937.1|36584_36857_-	hypothetical protein	NA	A0A0M3LQA6	Mannheimia_phage	41.1	4.9e-08
WP_016533427.1|37155_37455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016570062.1|37464_37998_-	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	36.6	1.3e-20
WP_014391447.1|38132_38732_-	hypothetical protein	NA	A0A218KC93	Bacillus_phage	37.6	4.6e-19
WP_014391448.1|38782_39571_-	DUF2303 family protein	NA	C5IHK3	Burkholderia_virus	29.2	3.2e-20
WP_016570064.1|39642_39996_-	hypothetical protein	NA	I6XKT1	Burkholderia_virus	31.8	1.7e-05
WP_016533530.1|40038_40230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016570065.1|40241_40706_-	single-stranded DNA-binding protein	NA	A0A2I7RK19	Vibrio_phage	69.0	6.1e-35
WP_064775601.1|40709_41321_-	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	76.4	6.3e-88
WP_016533454.1|41313_42165_-	phage recombination protein Bet	NA	A0A2H4JAQ4	uncultured_Caudovirales_phage	63.9	4.8e-62
WP_102822907.1|42168_43161_-	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	39.6	1.0e-50
WP_016570068.1|43338_43575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064775602.1|43561_43846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014390710.1|43912_44224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156734823.1|44285_44921_-	hypothetical protein	NA	A6XMM0	Bacillus_virus	53.3	2.1e-22
WP_014391102.1|45382_45916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014391456.1|46003_46267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016533507.1|46491_46722_-	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	52.8	3.4e-10
WP_071523842.1|47299_47614_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	49.0	1.9e-19
WP_102822911.1|47610_47901_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	48.8	6.3e-14
WP_078819883.1|47926_48364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016569989.1|48737_49415_-	helix-turn-helix transcriptional regulator	NA	A0A1B1P9J5	Acinetobacter_phage	29.8	3.2e-24
WP_014390719.1|49538_49736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102822910.1|49784_50237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016569986.1|50489_50750_+	hypothetical protein	NA	D0UIL6	Aggregatibacter_phage	70.8	6.5e-18
WP_014390722.1|50746_51100_+	HNH endonuclease	NA	A0A1C9LVX4	Vibrio_phage	33.6	1.3e-08
WP_064964930.1|52002_52692_+	replication protein P	NA	D0UIL4	Aggregatibacter_phage	34.1	1.4e-32
51221:51238	attR	CAGCAAGCACAAATACGA	NA	NA	NA	NA
WP_156734826.1|52701_53232_+	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	59.5	1.6e-55
WP_156734824.1|53221_53680_+	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	53.4	5.8e-38
WP_016533468.1|53753_53966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102822905.1|54053_54656_+	recombinase NinG	NA	H6WRY9	Salmonella_phage	38.2	4.8e-32
WP_016533470.1|54655_55021_+	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	27.3	3.5e-09
WP_143930513.1|55210_55396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016533461.1|55609_55975_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_016533462.1|55946_56531_+	glycoside hydrolase family 19 protein	NA	Q7Y5V0	Haemophilus_phage	55.3	6.5e-58
WP_016569983.1|56533_56857_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_064775648.1|57135_57492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064775649.1|57621_57876_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_064775650.1|57863_58244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064775651.1|58382_59084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016533416.1|59070_59499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081273988.1|59814_60405_+	hypothetical protein	NA	A0A2H4J1J5	uncultured_Caudovirales_phage	39.5	4.9e-21
WP_064775652.1|60407_61679_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	61.7	8.6e-148
WP_064775653.1|61688_63092_+	DUF4055 domain-containing protein	NA	A0A0M3LQA1	Mannheimia_phage	59.6	4.4e-153
WP_064775738.1|63081_64683_+|head	phage head morphogenesis protein	head	A0A0M3LQ07	Mannheimia_phage	52.1	3.3e-152
WP_015691070.1|64685_64904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015691071.1|64878_65313_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	D0UIJ3	Aggregatibacter_phage	61.2	3.1e-41
WP_015691073.1|65648_66419_+	hypothetical protein	NA	A0A1V0DY60	Dinoroseobacter_phage	36.2	1.5e-25
WP_015691074.1|66436_67594_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	43.3	8.3e-81
WP_015691075.1|67650_67887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015691076.1|67903_68371_+	hypothetical protein	NA	A0A0M3LSP7	Mannheimia_phage	55.7	1.4e-34
WP_015691077.1|68372_68747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015691078.1|68748_69150_+	HK97 gp10 family phage protein	NA	A0A0M3LPJ5	Mannheimia_phage	61.4	2.1e-39
WP_015691079.1|69149_69542_+	hypothetical protein	NA	A0A0M3LQB6	Mannheimia_phage	46.2	5.5e-29
WP_016533104.1|69554_70571_+	hypothetical protein	NA	A0A0M3LQ19	Mannheimia_phage	69.9	7.6e-131
WP_016533103.1|70643_71060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016533102.1|71429_71759_+|tail	phage tail protein	tail	A0A0M3LQW6	Mannheimia_phage	49.1	4.8e-26
WP_064775655.1|72063_72759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064775657.1|75592_76297_+|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	64.1	1.6e-82
>prophage 2
NZ_CP033599	Pasteurella multocida strain CQ2 chromosome, complete genome	2363600	1485177	1529639	2363600	terminase,transposase,holin,integrase,tail	Mannheimia_phage(41.67%)	67	1488054:1488104	1538090:1538140
WP_005719438.1|1485177_1485678_+	single-stranded DNA-binding protein	NA	I3PUY5	Vibrio_phage	55.6	4.0e-40
WP_014325726.1|1485860_1486325_+|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	36.1	2.3e-13
WP_005725034.1|1486901_1487756_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	40.3	5.8e-31
1488054:1488104	attL	CTTCTAAGCCGTAGGTCATTGGTTCGAATCCAATAGGGCGTGCCATTAATT	NA	NA	NA	NA
WP_014391441.1|1488130_1489186_-|integrase	site-specific integrase	integrase	A0A077KGX2	Edwardsiella_phage	37.9	1.6e-62
WP_075271365.1|1489089_1489392_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014391442.1|1489575_1490298_-	DNA-binding protein	NA	G0ZND1	Cronobacter_phage	52.5	3.3e-35
WP_064775645.1|1490308_1490530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015691048.1|1490774_1491683_-	hypothetical protein	NA	A0A0M4S6X1	Salmonella_phage	36.1	2.5e-40
WP_064775646.1|1491786_1492275_-	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	51.2	3.2e-34
WP_080637896.1|1492286_1492499_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_016533502.1|1492486_1492852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064775647.1|1492848_1493448_-	hypothetical protein	NA	A0A218KC93	Bacillus_phage	34.2	3.9e-18
WP_014391448.1|1493498_1494287_-	DUF2303 family protein	NA	C5IHK3	Burkholderia_virus	29.2	3.2e-20
WP_016570064.1|1494358_1494712_-	hypothetical protein	NA	I6XKT1	Burkholderia_virus	31.8	1.7e-05
WP_016533530.1|1494754_1494946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016570065.1|1494957_1495422_-	single-stranded DNA-binding protein	NA	A0A2I7RK19	Vibrio_phage	69.0	6.1e-35
WP_064775601.1|1495425_1496037_-	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	76.4	6.3e-88
WP_016533454.1|1496029_1496881_-	phage recombination protein Bet	NA	A0A2H4JAQ4	uncultured_Caudovirales_phage	63.9	4.8e-62
WP_102822907.1|1496884_1497877_-	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	39.6	1.0e-50
WP_016570068.1|1498054_1498291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064775602.1|1498277_1498562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014390710.1|1498628_1498940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016570070.1|1499001_1499649_-	hypothetical protein	NA	Q7Y5V4	Haemophilus_phage	64.2	3.5e-36
WP_016533491.1|1499914_1500460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016533507.1|1501051_1501282_-	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	52.8	3.4e-10
WP_016533476.1|1501901_1502285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016533477.1|1502281_1502761_-	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	47.1	8.3e-19
WP_016533478.1|1502763_1503027_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_064775603.1|1503172_1503862_-	helix-turn-helix transcriptional regulator	NA	Q7Y5W5	Haemophilus_phage	58.2	1.7e-73
WP_005720263.1|1503989_1504199_+	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	52.3	5.5e-12
WP_014391093.1|1504267_1504495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064775604.1|1504552_1505254_+	DNA-binding protein	NA	A0A2I7RHG4	Vibrio_phage	55.8	7.1e-35
WP_014390722.1|1505250_1505604_+	HNH endonuclease	NA	A0A1C9LVX4	Vibrio_phage	33.6	1.3e-08
WP_016533442.1|1505605_1506508_+	hypothetical protein	NA	A0A0U4JX08	Bacillus_phage	37.7	5.5e-32
WP_016533441.1|1506507_1507197_+	replication protein P	NA	D0UIL4	Aggregatibacter_phage	34.1	1.4e-32
WP_041423202.1|1507206_1507737_+	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	58.9	1.0e-54
WP_016569985.1|1507726_1508185_+	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	53.4	5.8e-38
WP_016533468.1|1508258_1508471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102822905.1|1508558_1509161_+	recombinase NinG	NA	H6WRY9	Salmonella_phage	38.2	4.8e-32
WP_016533470.1|1509160_1509526_+	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	27.3	3.5e-09
WP_143930513.1|1509715_1509901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016533461.1|1510114_1510480_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_016533462.1|1510451_1511036_+	glycoside hydrolase family 19 protein	NA	Q7Y5V0	Haemophilus_phage	55.3	6.5e-58
WP_016569983.1|1511038_1511362_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_014390736.1|1511583_1512018_-	CopG family transcriptional regulator	NA	A0A0R6PJ17	Moraxella_phage	38.0	1.0e-20
WP_016533497.1|1512046_1512229_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	54.2	3.8e-09
WP_014390737.1|1512311_1512809_+|terminase	terminase	terminase	C7U0W1	Enterobacteria_phage	70.7	7.4e-47
WP_102822904.1|1512792_1514019_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LTA2	Mannheimia_phage	76.8	2.7e-191
WP_016533291.1|1514033_1515479_+	DUF1073 domain-containing protein	NA	A0A0M3LPQ5	Mannheimia_phage	58.6	2.4e-146
WP_014390740.1|1515432_1516404_+	hypothetical protein	NA	F1C5D8	Cronobacter_phage	41.0	1.6e-53
WP_016533290.1|1516418_1517765_+	hypothetical protein	NA	A0A0M3LQ78	Mannheimia_phage	55.3	4.0e-127
WP_016533289.1|1517764_1518199_+	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	75.7	1.1e-54
WP_016533288.1|1518210_1519209_+	hypothetical protein	NA	A0A0M3LQZ1	Mannheimia_phage	74.7	9.1e-145
WP_078819881.1|1519559_1519928_+	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	42.1	3.6e-22
WP_014390746.1|1519930_1520275_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	57.9	3.0e-31
WP_014390747.1|1520279_1520651_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	51.2	1.3e-24
WP_016533319.1|1520647_1521019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014390749.1|1521030_1521513_+|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	62.0	2.0e-44
WP_014390750.1|1521566_1522238_+	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	42.4	2.6e-42
WP_078801827.1|1522296_1522671_+	TM2 domain-containing protein	NA	NA	NA	NA	NA
WP_014390752.1|1522746_1523565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014390754.1|1523903_1524728_+	hypothetical protein	NA	A0A0M3LR56	Mannheimia_phage	70.5	6.1e-46
WP_102822903.1|1524779_1527224_+|tail	tail length tape measure protein	tail	A0A0M3LS54	Mannheimia_phage	48.4	3.7e-155
WP_099803088.1|1527226_1527556_+	hypothetical protein	NA	S5MW28	Escherichia_phage	37.1	8.5e-15
WP_156734825.1|1527645_1528359_+|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	63.9	1.5e-80
WP_102827075.1|1528362_1529106_+	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	59.6	4.3e-83
WP_042743292.1|1529048_1529639_+|tail	tail assembly protein	tail	A0A0M3LQC4	Mannheimia_phage	57.1	3.1e-52
1538090:1538140	attR	CTTCTAAGCCGTAGGTCATTGGTTCGAATCCAATAGGGCGTGCCATTAATT	NA	NA	NA	NA
