The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022361	Bordetella pertussis strain B199 chromosome, complete genome	4314502	27282	70038	4314502	tRNA,transposase	Synechococcus_phage(50.0%)	42	NA	NA
WP_010929577.1|27282_28233_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023995007.1|28314_28650_-	CoA transferase	NA	NA	NA	NA	NA
WP_010929578.1|28674_29109_-	OB-fold domain-containing protein	NA	NA	NA	NA	NA
WP_019247164.1|29141_30359_-	thiolase family protein	NA	NA	NA	NA	NA
WP_010929580.1|30364_30862_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_019247165.1|31069_32005_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929582.1|32214_33006_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010929583.1|33048_34470_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_005012067.1|34625_35576_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814398.1|35572_36763_-	MFS transporter	NA	NA	NA	NA	NA
WP_010929585.1|37012_37924_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_010929586.1|37925_40064_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003814404.1|40060_40600_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_003814405.1|40603_41332_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_010929587.1|41318_42212_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_003814410.1|42282_42678_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_003814412.1|42687_43218_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	35.4	3.7e-12
WP_010930208.1|43663_44614_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929589.1|45200_45749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003815265.1|45720_45957_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003815255.1|46084_46978_+	AEC family transporter	NA	NA	NA	NA	NA
WP_010929590.1|48147_49395_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_003817748.1|49391_50006_+	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_005012067.1|50141_51092_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_029443813.1|51134_52391_+	muropeptide transporter	NA	NA	NA	NA	NA
WP_014906036.1|52502_53567_+	porin	NA	NA	NA	NA	NA
WP_010929592.1|53624_54359_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_019247224.1|54364_54955_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-20
WP_003817737.1|54979_55669_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_023852650.1|55665_56427_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010929594.1|56506_57406_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929626.1|57499_58450_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929595.1|59250_60477_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_047122776.1|60476_60890_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010929597.1|61079_62021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019248755.1|62444_63419_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929599.1|63475_64057_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_010929600.1|64069_64372_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_029443770.1|64490_65549_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_019247832.1|65583_66855_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_010929603.1|67484_68666_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012808.1|69087_70038_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP022361	Bordetella pertussis strain B199 chromosome, complete genome	4314502	185342	243846	4314502	tRNA,transposase	Planktothrix_phage(22.22%)	54	NA	NA
WP_014486111.1|185342_186293_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929608.1|186289_188164_-	O-antigen biosynthesis protein WlbL	NA	A0A2P1ELS8	Moumouvirus	26.9	2.0e-23
WP_003807102.1|189511_190216_-	O-antigen biosynthesis protein WlbI	NA	NA	NA	NA	NA
WP_010929609.1|190212_191385_-	O-antigen biosynthesis protein WlbH	NA	NA	NA	NA	NA
WP_010929610.1|191580_192174_-	O-antigen biosynthesis protein WlbG	NA	NA	NA	NA	NA
WP_010929611.1|192170_193403_-	O-antigen biosynthesis protein WlbF	NA	NA	NA	NA	NA
WP_010929612.1|193420_194680_-	O-antigen biosynthesis protein WlbE	NA	NA	NA	NA	NA
WP_010929613.1|194703_195792_-	O-antigen biosynthesis protein WlbD	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	36.3	4.8e-46
WP_010929614.1|195799_196900_-	O-antigen biosynthesis protein WlbC	NA	A0A2K9L0G1	Tupanvirus	29.7	3.3e-31
WP_003807114.1|196903_197479_-	O-antigen biosynthesis protein WlbB	NA	NA	NA	NA	NA
WP_003807115.1|197482_198535_-	O-antigen biosynthesis protein WlbA	NA	NA	NA	NA	NA
WP_010929615.1|198665_199673_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_010929616.1|199674_200961_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_003807124.1|200977_201133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929617.1|201157_201961_-	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_010929618.1|201957_202824_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_010929619.1|202898_204029_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003807131.1|204028_204868_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.4	9.1e-21
WP_010930208.1|204981_205932_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929620.1|206849_207452_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_010929621.1|207481_208135_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003807138.1|208267_209524_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.5	6.2e-66
WP_010929622.1|209571_210471_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_003818417.1|210546_210822_+	YbeD family protein	NA	NA	NA	NA	NA
WP_010929623.1|210829_211492_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_003807146.1|211553_212555_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_003807148.1|212569_213118_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	53.4	3.7e-47
WP_010929624.1|213175_214072_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_010929625.1|214068_215130_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	44.8	1.6e-78
WP_010929626.1|215165_216116_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929627.1|217015_218209_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_010929628.1|218290_218920_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_010927242.1|218981_219665_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_023853376.1|219674_221357_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003815933.1|221644_221992_+	DUF1840 domain-containing protein	NA	NA	NA	NA	NA
WP_003815930.1|222082_222400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930525.1|222682_223699_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_102970353.1|223774_224575_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_003815927.1|224571_225447_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_019248181.1|225457_226750_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929634.1|226792_227833_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	6.0e-22
WP_010929635.1|227938_228760_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_005012067.1|228860_229811_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014905488.1|229909_230815_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	9.8e-21
WP_003815918.1|230811_231645_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_010929637.1|232481_233492_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_019247800.1|233488_233878_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_010929638.1|234771_236025_+	amidase	NA	NA	NA	NA	NA
WP_010929639.1|236115_237816_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_010929640.1|238242_238890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050457416.1|238888_240328_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_003815905.1|240420_240723_+	bacterioferritin-associated ferredoxin	NA	NA	NA	NA	NA
WP_010929512.1|240750_241629_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|242895_243846_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP022361	Bordetella pertussis strain B199 chromosome, complete genome	4314502	272629	379969	4314502	tRNA,transposase,integrase	Pseudomonas_phage(10.0%)	97	337321:337340	360945:360964
WP_010930892.1|272629_273580_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929659.1|275023_275926_-	YgcG family protein	NA	NA	NA	NA	NA
WP_003815889.1|275903_276533_-	LemA family protein	NA	NA	NA	NA	NA
WP_010929660.1|276815_278246_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	29.8	5.8e-44
WP_010929661.1|278279_278909_+	LysE family transporter	NA	NA	NA	NA	NA
WP_003815895.1|278957_280565_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	37.8	9.3e-14
WP_010929663.1|280589_281273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003815898.1|281354_281831_-	bacterioferritin	NA	NA	NA	NA	NA
WP_005012067.1|282037_282988_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|283086_284037_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929664.1|285152_285680_+	META domain-containing protein	NA	NA	NA	NA	NA
WP_010929665.1|285771_286587_+	META and DUF4377 domain-containing protein	NA	NA	NA	NA	NA
WP_003808370.1|286647_287382_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_010929666.1|287419_289498_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	23.6	1.5e-27
WP_003808374.1|289747_290020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033446322.1|290121_291207_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010929668.1|291210_293115_+	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_014486044.1|293111_296786_+	translocation/assembly module TamB domain-containing protein	NA	NA	NA	NA	NA
WP_010929670.1|296846_297410_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	75.3	2.6e-72
WP_003808385.1|297417_297840_-	VOC family protein	NA	NA	NA	NA	NA
WP_010929671.1|297867_298287_-	VOC family protein	NA	NA	NA	NA	NA
WP_076879599.1|298315_298789_-	GNAT family N-acetyltransferase	NA	Q9AZG4	Lactococcus_phage	31.1	2.2e-11
WP_003808391.1|298888_299386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003808393.1|299540_301811_+	arginine/lysine/ornithine decarboxylase	NA	NA	NA	NA	NA
WP_010929672.1|301859_303092_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005012067.1|303190_304141_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929673.1|304243_304879_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	73.8	2.8e-83
WP_010929674.1|304875_305769_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_010929675.1|306163_307264_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_010929676.1|307345_307720_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_010929677.1|307779_310644_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.4	1.2e-261
WP_010929678.1|310788_311529_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929679.1|311598_312810_+	CoA transferase	NA	NA	NA	NA	NA
WP_010929680.1|312838_313807_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012067.1|314420_315371_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|315469_316420_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003818201.1|316968_317343_-	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_010929807.1|317417_318476_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_005012067.1|318499_319450_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929833.1|321006_321852_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929834.1|321939_323103_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_010929835.1|323521_324493_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929836.1|324531_325959_-	amidase	NA	NA	NA	NA	NA
WP_023853625.1|326078_326870_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010929838.1|326988_329442_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.8	2.3e-112
WP_010929839.1|329536_330646_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	32.6	1.2e-41
WP_010929554.1|330648_332058_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_003816025.1|332463_332598_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_003816026.1|332693_333065_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_003816027.1|333061_333334_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	52.2	7.0e-15
WP_010927254.1|333382_335074_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_005012067.1|335304_336255_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929840.1|336712_337636_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
337321:337340	attL	GCCGCTGACCAACCAGCGCG	NA	NA	NA	NA
WP_003814626.1|337644_338043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929841.1|338284_340255_+	type III secretion system effector BopC	NA	NA	NA	NA	NA
WP_010929843.1|341741_342731_+|integrase	site-specific integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	44.4	4.4e-75
WP_010926403.1|342727_342928_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010929845.1|343040_343382_-	hypothetical protein	NA	A0A0H5ARN8	Pseudomonas_phage	45.3	1.0e-10
WP_019247983.1|343392_344577_-	hypothetical protein	NA	A0A291L9X3	Bordetella_phage	37.8	1.5e-24
WP_010929847.1|344613_345141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929848.1|345198_345846_-	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	41.4	2.0e-31
WP_010929849.1|345842_346829_-	recombinase RecT	NA	H9C0R8	Aeromonas_phage	57.3	2.0e-67
WP_010926410.1|346832_347015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926411.1|347011_347389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929850.1|347622_348090_-	hypothetical protein	NA	Q3HQX1	Burkholderia_phage	71.3	2.1e-43
WP_005013747.1|348125_349076_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010926414.1|349174_349417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929852.1|349583_350225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111735998.1|350328_350616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|350704_351655_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929727.1|351651_352650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003815019.1|352692_353196_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929728.1|353199_354090_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003815015.1|354312_355476_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003815013.1|355572_356493_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003815011.1|356496_357462_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003815010.1|357458_358253_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	23.5	2.6e-09
WP_010929729.1|358246_358951_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.2	1.1e-16
WP_010929730.1|362314_363178_+	enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
360945:360964	attR	GCCGCTGACCAACCAGCGCG	NA	NA	NA	NA
WP_010929731.1|363180_364350_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003814996.1|364390_366040_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	31.2	2.6e-56
WP_003814993.1|366041_366476_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003814990.1|366500_366902_+	RidA family protein	NA	NA	NA	NA	NA
WP_010929732.1|366995_368621_-	DUF342 domain-containing protein	NA	NA	NA	NA	NA
WP_010929733.1|368860_370144_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_003814984.1|370160_370814_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_010929734.1|370810_371659_-	hydroxymethylpyrimidine/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003814980.1|371775_371940_+	rubredoxin	NA	NA	NA	NA	NA
WP_010927118.1|372027_372633_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_010929735.1|372625_373027_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_003820560.1|373040_373994_+	aspartate carbamoyltransferase catalytic subunit	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	35.8	2.5e-30
WP_010929736.1|373990_375166_+	dihydroorotase	NA	NA	NA	NA	NA
WP_010929737.1|375285_376026_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_010929738.1|376062_376896_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_010929739.1|376892_378071_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_003814960.1|378167_378896_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_005013747.1|379018_379969_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP022361	Bordetella pertussis strain B199 chromosome, complete genome	4314502	404353	463822	4314502	tRNA,transposase	Streptococcus_phage(50.0%)	56	NA	NA
WP_005012067.1|404353_405304_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929759.1|405415_406138_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003815420.1|406236_406980_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_010929760.1|407210_408719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003815418.1|408838_409570_+	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_010929761.1|409614_411075_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010929762.1|411099_411579_+	heme-binding protein	NA	NA	NA	NA	NA
WP_003817846.1|411597_412608_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_010929763.1|412822_413563_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929764.1|413769_414744_+	beta-propeller fold lactonase family protein	NA	NA	NA	NA	NA
WP_010930048.1|414740_415691_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|415789_416740_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929766.1|417788_418427_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_014905419.1|418463_419807_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_010929768.1|420229_421018_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	25.7	1.2e-19
WP_010929769.1|421155_421830_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_010929770.1|421943_423398_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_010929771.1|423400_424939_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_010929772.1|424941_425250_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_003815204.1|425480_426524_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_010929773.1|426612_427497_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003815202.1|427483_428047_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003815201.1|428060_430013_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_003815198.1|430009_431146_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_010929775.1|431171_432227_-	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_010929776.1|432237_433731_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_010927138.1|433943_434519_-	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_010929777.1|434568_435315_-	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_010929778.1|435314_436217_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_010929779.1|436478_437267_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003815191.1|437407_437899_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_003815190.1|437895_438639_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_033446211.1|438635_439229_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	34.8	5.6e-17
WP_100208326.1|439237_439714_-	YraN family protein	NA	NA	NA	NA	NA
WP_010929780.1|439838_440777_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	NA	NA	NA	NA
WP_010929781.1|440773_441346_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.5	3.2e-25
WP_005012067.1|441342_442293_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010927231.1|442429_443347_+	reductase	NA	NA	NA	NA	NA
WP_003815842.1|443343_443592_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_019248029.1|443588_444794_+	CoA transferase	NA	NA	NA	NA	NA
WP_014486045.1|444866_445862_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_014906039.1|445884_447105_-	CoA transferase	NA	NA	NA	NA	NA
WP_014486047.1|447101_447746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929483.1|449476_450286_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014486048.1|450590_451544_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.5	5.6e-59
WP_014486049.1|451642_452626_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014486050.1|452552_453254_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_014486051.1|453302_454073_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_019247259.1|454069_455248_-	CoA transferase	NA	NA	NA	NA	NA
WP_014486052.1|455415_457122_-	thiamine pyrophosphate-requiring protein	NA	NA	NA	NA	NA
WP_019248098.1|457118_458015_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014486054.1|458055_459645_-	rhodanese homology domain-containing protein	NA	NA	NA	NA	NA
WP_003807867.1|459694_460687_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003807865.1|460755_461355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014486055.1|461815_462796_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929577.1|462871_463822_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP022361	Bordetella pertussis strain B199 chromosome, complete genome	4314502	567764	677108	4314502	tRNA,transposase	Acinetobacter_phage(27.27%)	91	NA	NA
WP_005012808.1|567764_568715_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929985.1|568816_569245_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010929984.1|569317_571513_+	DUF1156 domain-containing protein	NA	NA	NA	NA	NA
WP_005012067.1|571734_572685_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023852739.1|572644_573169_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003814467.1|573300_574272_+	FecR family protein	NA	NA	NA	NA	NA
WP_010929983.1|574391_576836_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_010929982.1|576851_577442_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_005012067.1|577685_578636_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814462.1|578793_580059_-	saccharopine dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003814461.1|580092_581190_-	carboxynorspermidine decarboxylase	NA	NA	NA	NA	NA
WP_005013747.1|581844_582795_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814459.1|582795_583365_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929980.1|583432_584248_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929978.1|586112_587054_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010929977.1|587053_587938_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010927038.1|587941_589594_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.8	6.0e-16
WP_010929976.1|589633_591031_+	amidase family protein	NA	NA	NA	NA	NA
WP_010929975.1|591072_592452_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003814443.1|592491_592710_-	DUF1059 domain-containing protein	NA	NA	NA	NA	NA
WP_003814441.1|593050_593923_+	oxaloacetate decarboxylase	NA	NA	NA	NA	NA
WP_005012067.1|594082_595033_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814437.1|595764_596142_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_003814436.1|596126_596828_-	membrane protein	NA	NA	NA	NA	NA
WP_010931409.1|596971_597664_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_010931410.1|597663_598767_-	phosphotransferase	NA	NA	NA	NA	NA
WP_010931411.1|598876_601249_+	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_010931412.1|601245_602805_+	chaperone SurA	NA	NA	NA	NA	NA
WP_010931413.1|602829_603627_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_010931414.1|603658_604804_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	42.2	1.7e-41
WP_003814419.1|604908_606351_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_010929184.1|606353_607583_-	spore maturation protein	NA	NA	NA	NA	NA
WP_005012808.1|609720_610671_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010927663.1|610762_611713_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931400.1|612053_613004_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931399.1|615327_616476_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003817794.1|616520_617183_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931397.1|617296_618289_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_003815313.1|618285_619023_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003815315.1|619102_619924_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010931396.1|620012_620876_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_003815317.1|621002_621239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014905459.1|623213_624257_+	succinylglutamate desuccinylase/aspartoacylase family protein	NA	NA	NA	NA	NA
WP_003817805.1|624315_625293_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931394.1|625300_626221_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_023852622.1|626217_627918_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	1.0e-15
WP_010931393.1|627920_628826_+	hydrolase	NA	NA	NA	NA	NA
WP_010931392.1|628869_630003_+	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_005012067.1|630132_631083_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931391.1|631181_633251_-	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	37.3	2.6e-101
WP_019247688.1|633293_635396_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_010931389.1|635702_636779_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_010931388.1|636854_637739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003815341.1|637921_638344_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_010931387.1|638353_639754_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_003817813.1|639796_640702_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_010931386.1|640800_642342_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_003815348.1|642376_642916_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_010931385.1|642928_643399_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_003815363.1|643536_643779_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_003815364.1|643895_644777_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_003815365.1|644849_645170_-	ATP synthase subunit I	NA	NA	NA	NA	NA
WP_005012808.1|646021_646972_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003815367.1|648295_649072_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_010931383.1|649106_650879_+	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_010931382.1|650880_651783_-	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	24.0	1.9e-08
WP_003817821.1|651907_652267_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_010931381.1|652298_653261_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	64.5	4.6e-93
WP_005012067.1|653359_654310_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931380.1|654322_655258_-	D-2-hydroxyacid dehydrogenase family protein	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	27.7	6.4e-15
WP_010931379.1|655317_656157_-	thiol:disulfide interchange protein DsbC	NA	NA	NA	NA	NA
WP_010931378.1|656153_657323_-	UbiH/UbiF family hydroxylase	NA	NA	NA	NA	NA
WP_003815379.1|657319_658609_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_003815381.1|658651_659026_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003815384.1|659131_659869_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_010931377.1|659876_660581_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_019248071.1|660844_662365_+	anthranilate synthase component I	NA	S4VNU7	Pandoravirus	32.0	3.1e-43
WP_003815390.1|662420_662984_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	62.1	1.1e-65
WP_003817833.1|663002_664034_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	42.7	7.4e-73
WP_010931375.1|664030_664819_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	53.0	5.1e-66
WP_019247413.1|664839_664998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014905441.1|664994_665984_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|667740_668691_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931374.1|669913_670816_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814312.1|670817_671672_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_010931373.1|671718_672828_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010931372.1|672838_673357_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_003814302.1|673386_674019_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_003814300.1|674090_674750_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_003814298.1|674746_675967_-	MFS transporter	NA	NA	NA	NA	NA
WP_019247745.1|676235_677108_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP022361	Bordetella pertussis strain B199 chromosome, complete genome	4314502	681522	745355	4314502	tRNA,transposase	Pandoravirus(12.5%)	47	NA	NA
WP_010929632.1|681522_682539_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003814287.1|682810_683437_-	aminotransferase class IV	NA	NA	NA	NA	NA
WP_010931367.1|683492_684620_-	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	37.8	3.8e-38
WP_003814283.1|684625_690343_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	39.5	1.0e-195
WP_003814277.1|690910_691855_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.2	8.4e-07
WP_003814275.1|692043_692979_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_010931365.1|693096_694668_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019247692.1|694747_695956_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_019247693.1|696453_697371_+	DMT family transporter	NA	NA	NA	NA	NA
WP_003814254.1|699731_699953_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_010930525.1|700283_701300_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003814252.1|701384_701636_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_003814250.1|701639_702455_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_010931362.1|702567_703446_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_003820957.1|703557_705321_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	50.0	5.0e-162
WP_010931361.1|705436_706777_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_010927010.1|707846_709271_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_003814239.1|709270_709972_-	response regulator	NA	W8CYM9	Bacillus_phage	36.6	5.6e-32
WP_014905422.1|711476_712427_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023994844.1|712522_713494_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010931357.1|713498_714179_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_003814742.1|714316_714709_+	OsmC family protein	NA	NA	NA	NA	NA
WP_010929632.1|714816_715833_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003814739.1|716072_716858_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_010931356.1|716952_718362_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_010927090.1|718372_719173_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_010931355.1|719193_719964_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010931354.1|720006_720474_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	50.7	5.6e-36
WP_005013747.1|720470_721421_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003818344.1|723369_724248_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_019247959.1|725174_728153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013747.1|728506_729457_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931353.1|729453_730542_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_010931352.1|730577_731441_-	MaoC family dehydratase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010931351.1|732580_732970_-	OB-fold domain-containing protein	NA	NA	NA	NA	NA
WP_014486103.1|732973_733756_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_047122778.1|733789_734575_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010931349.1|734850_735990_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931348.1|735986_736778_+	ATP-binding cassette domain-containing protein	NA	A0A1M7XV31	Cedratvirus	29.4	1.7e-08
WP_010931347.1|736774_737524_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	1.9e-09
WP_010931346.1|737520_738393_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004566224.1|738392_739394_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_019248372.1|739390_740554_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003808193.1|740579_741263_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019248373.1|741216_742551_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_010931344.1|742543_743638_+	CoA transferase	NA	NA	NA	NA	NA
WP_010929591.1|744404_745355_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP022361	Bordetella pertussis strain B199 chromosome, complete genome	4314502	764266	833447	4314502	protease,tRNA,transposase,integrase	Bacillus_phage(20.0%)	53	812452:812470	832340:832358
WP_005013747.1|764266_765217_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931335.1|765315_766791_-	M81 family metallopeptidase	NA	NA	NA	NA	NA
WP_010931334.1|768378_769266_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005012808.1|770095_771046_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931332.1|771304_772870_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931331.1|774647_775973_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_010931330.1|776155_777613_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	21.1	7.6e-15
WP_003816386.1|777576_778074_-	dihydrofolate reductase	NA	A0A140HLG8	Bacillus_phage	38.9	3.0e-24
WP_010931328.1|778104_779076_-	thymidylate synthase	NA	J7KKN7	Erwinia_phage	33.3	4.8e-50
WP_003808444.1|779128_779566_-	OsmC family protein	NA	NA	NA	NA	NA
WP_010931327.1|779689_780358_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_003808448.1|781086_782190_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_171024626.1|782292_783570_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	NA	NA	NA	NA
WP_010930472.1|783581_784607_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosaminuronic acid C-4 epimerase TviC	NA	A0A2K9L4U8	Tupanvirus	44.2	4.7e-72
WP_010931325.1|784608_785979_+	polysaccharide biosynthesis C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010931324.1|785979_787116_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_010931323.1|787162_789088_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A2K9R7N5	Dishui_lake_phycodnavirus	29.0	1.0e-27
WP_010931322.1|789084_790206_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_010931321.1|790202_791357_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_010931320.1|791353_792484_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003808462.1|792491_794057_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_010931319.1|794063_795446_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	6.2e-51
WP_003808465.1|795724_796336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931317.1|796427_797843_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_003818936.1|797860_798571_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_010931316.1|798567_799890_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_010931315.1|799969_801931_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_003818932.1|802056_803370_-	fumarylacetoacetase	NA	NA	NA	NA	NA
WP_003818930.1|803478_804777_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_010931314.1|804959_805868_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003808487.1|805877_806087_-	DUF2783 domain-containing protein	NA	NA	NA	NA	NA
WP_003808489.1|806098_807778_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010931313.1|807879_808833_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_010925978.1|808923_809751_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	NA	NA	NA	NA
WP_010931312.1|809749_811636_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003818921.1|811632_812232_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_010931311.1|812280_813180_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
812452:812470	attL	CTGCCTGGCGTGGCCGAGT	NA	NA	NA	NA
WP_010931310.1|813388_814339_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L8D8	Tupanvirus	35.5	7.3e-43
WP_029443719.1|814461_815076_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_010931308.1|815204_815801_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_010931307.1|815797_816580_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_010931306.1|816652_817744_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_010931305.1|818023_819151_+|integrase	site-specific integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	33.6	1.4e-48
WP_010931304.1|819492_820539_+	Fic family protein	NA	NA	NA	NA	NA
WP_010931303.1|820686_823806_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_010931302.1|823807_826759_+	restriction endonuclease subunit M	NA	G8I4P9	Mycobacterium_phage	25.1	2.9e-21
WP_010931301.1|826774_827986_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_005013747.1|828169_829120_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_077274087.1|829136_829631_+	DUF4276 family protein	NA	NA	NA	NA	NA
WP_019247740.1|829634_829892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019248155.1|830435_831347_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_029443992.1|831428_831713_+	ATP-dependent helicase	NA	A0A1V0SIN4	Klosneuvirus	34.1	6.8e-05
WP_010929577.1|832496_833447_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
832340:832358	attR	ACTCGGCCACGCCAGGCAG	NA	NA	NA	NA
>prophage 9
NZ_CP022361	Bordetella pertussis strain B199 chromosome, complete genome	4314502	948008	1012073	4314502	protease,tRNA,transposase	Pseudomonas_phage(30.0%)	56	NA	NA
WP_005012067.1|948008_948959_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|949057_950008_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931247.1|950106_950970_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_010931246.1|950966_951866_-	TonB family protein	NA	NA	NA	NA	NA
WP_019248069.1|951903_953787_-	RNB domain-containing ribonuclease	NA	NA	NA	NA	NA
WP_010931244.1|953858_954452_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003814955.1|954462_955833_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_023853327.1|955915_956464_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_003814953.1|956542_956977_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_003814952.1|957066_957516_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_003814951.1|957525_958872_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_010931242.1|959837_960935_+	DUF3426 domain-containing protein	NA	NA	NA	NA	NA
WP_010931241.1|960946_961888_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_010931240.1|962060_962564_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_003814943.1|962844_963084_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_080478561.1|963061_964471_+	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_010931239.1|964600_965728_+	membrane-bound O-acyltransferase	NA	A0A125RNP0	Pseudomonas_phage	30.8	3.7e-25
WP_010931238.1|965738_967202_+	D-alanine--poly(phosphoribitol) ligase	NA	A0A2K9L3I8	Tupanvirus	25.1	7.3e-26
WP_010931237.1|967209_967785_-	YggT family protein	NA	NA	NA	NA	NA
WP_010931236.1|967923_968451_-	histone H1-like DNA-binding protein	NA	NA	NA	NA	NA
WP_003814929.1|968768_969965_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A2H4P762	Pseudomonas_phage	28.9	1.0e-33
WP_010931235.1|969986_972914_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	43.9	3.4e-171
WP_019247415.1|973219_976282_-	indolepyruvate ferredoxin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_192855352.1|976304_976871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814925.1|976843_977296_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_023998238.1|977497_978007_+	lipoprotein	NA	NA	NA	NA	NA
WP_010931233.1|978075_979263_+	MFS transporter	NA	NA	NA	NA	NA
WP_003814917.1|979266_980712_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_010931231.1|980808_983268_+	bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|983264_984215_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931230.1|984313_984988_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931229.1|985284_986781_+	membrane protein	NA	NA	NA	NA	NA
WP_003820592.1|986897_988286_+	ATP-dependent RNA helicase DbpA	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	33.5	4.6e-54
WP_003820593.1|988391_988781_+	VOC family protein	NA	NA	NA	NA	NA
WP_019248167.1|988792_989485_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_010931228.1|989499_990336_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931227.1|990338_991148_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.9	2.6e-33
WP_010931226.1|992404_993079_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023853313.1|993092_993644_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_004567741.1|993702_995067_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_004567739.1|995408_996506_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010927106.1|996801_997230_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_010931224.1|997239_997632_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_003820599.1|997820_998885_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_010931223.1|998921_999668_+	membrane protein	NA	NA	NA	NA	NA
WP_003814883.1|999755_1000127_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	56.9	4.7e-30
WP_010931222.1|1000196_1001333_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_010931221.1|1001338_1002754_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	46.9	1.9e-18
WP_005012067.1|1002845_1003796_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814877.1|1004063_1005293_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003820605.1|1005328_1005985_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_003814873.1|1006201_1007449_+	serine hydroxymethyltransferase	NA	A0A219YCZ0	Aeromonas_phage	52.7	1.1e-99
WP_003814871.1|1007606_1008089_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_023853315.1|1009083_1009647_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_047122802.1|1009852_1010977_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.3	3.8e-38
WP_005015810.1|1011122_1012073_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP022361	Bordetella pertussis strain B199 chromosome, complete genome	4314502	1044183	1112643	4314502	protease,tRNA,transposase	Klebsiella_phage(16.67%)	52	NA	NA
WP_005012067.1|1044183_1045134_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931198.1|1045232_1045604_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_010931197.1|1045728_1046559_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_010931196.1|1046569_1048030_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_003813056.1|1048286_1049360_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	3.9e-77
WP_023853656.1|1049381_1062035_-	hemagglutinin repeat-containing protein	NA	A0A0R6PJK4	Moraxella_phage	30.5	1.2e-15
WP_010931194.1|1062164_1063574_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_010931193.1|1063708_1065208_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_003813049.1|1065219_1066329_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_003813047.1|1066361_1067591_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_010931192.1|1067581_1068493_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010931191.1|1068495_1070709_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_010931190.1|1070863_1071895_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003813039.1|1071938_1073375_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_010931189.1|1073691_1074810_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_010931188.1|1075064_1075940_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_102970355.1|1076000_1076987_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_010931186.1|1077157_1078078_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	30.5	2.7e-26
WP_003813026.1|1078090_1079206_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_003813022.1|1079306_1080125_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_010931185.1|1080222_1080834_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_010931184.1|1080993_1082370_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.5	2.2e-109
WP_003813017.1|1082432_1082891_+	cytochrome c	NA	NA	NA	NA	NA
WP_003813013.1|1082975_1083671_-	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_003813010.1|1083732_1084014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931182.1|1084576_1085329_+	DUF3053 domain-containing protein	NA	NA	NA	NA	NA
WP_003813006.1|1085373_1086450_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012067.1|1086446_1087397_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014486100.1|1087499_1088162_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019249309.1|1088256_1088427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247599.1|1088779_1089781_+	amidase	NA	NA	NA	NA	NA
WP_003818702.1|1089783_1090980_+	CoA transferase	NA	NA	NA	NA	NA
WP_014486098.1|1091000_1091804_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_019247598.1|1091884_1092181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247597.1|1092211_1092775_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014486097.1|1092815_1093673_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003818698.1|1093680_1094430_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.5	6.2e-29
WP_014486096.1|1094451_1095324_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_014486095.1|1095352_1096132_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014486094.1|1096165_1096963_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003808978.1|1099617_1100010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014486091.1|1100003_1100864_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003818691.1|1100867_1101830_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014486089.1|1102606_1103296_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	4.8e-12
WP_010930208.1|1104156_1105107_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929577.1|1105205_1106156_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931181.1|1106268_1107138_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010926062.1|1107208_1107904_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_010931179.1|1107893_1108403_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_010931178.1|1108399_1109620_+	MFS transporter	NA	NA	NA	NA	NA
WP_010931177.1|1109567_1110470_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_023997744.1|1111356_1112643_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP022361	Bordetella pertussis strain B199 chromosome, complete genome	4314502	1126014	1179196	4314502	transposase	uncultured_virus(16.67%)	45	NA	NA
WP_005013747.1|1126014_1126965_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931165.1|1127009_1129436_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	33.8	1.2e-86
WP_010931164.1|1129484_1130177_+	HD domain-containing protein	NA	A0A1D6Y7U0	Golden_Marseillevirus	29.9	4.7e-07
WP_010931163.1|1130249_1131449_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_003819549.1|1131466_1132372_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931162.1|1132487_1133417_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010931161.1|1133442_1134789_+	MFS transporter	NA	NA	NA	NA	NA
WP_010931160.1|1134816_1135566_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.4	1.2e-11
WP_010931159.1|1135579_1136362_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005012067.1|1136554_1137505_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931158.1|1137566_1138676_-	porin	NA	NA	NA	NA	NA
WP_003815281.1|1139188_1140025_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0P0BXC9	Ostreococcus_lucimarinus_virus	33.3	1.6e-33
WP_023997028.1|1140094_1141060_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|1141056_1142007_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247492.1|1142392_1142935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930176.1|1143970_1144921_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247402.1|1145162_1145531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019248356.1|1145576_1146701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931156.1|1147835_1148588_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010931155.1|1148679_1149300_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931154.1|1149301_1151410_-	AsmA family protein	NA	NA	NA	NA	NA
WP_003820814.1|1151554_1152214_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_003820813.1|1152245_1152710_-	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_019248355.1|1152985_1153171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931153.1|1153222_1153975_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_010931152.1|1153981_1155244_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_023852748.1|1155285_1156524_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003820806.1|1157601_1158729_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.3	1.2e-23
WP_003814524.1|1158739_1159567_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_010931150.1|1159553_1160420_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_010931149.1|1161786_1162191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033446288.1|1162553_1163465_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003820799.1|1163479_1164190_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931147.1|1164186_1165431_+	DUF521 domain-containing protein	NA	NA	NA	NA	NA
WP_003820797.1|1165432_1165867_+	DUF126 domain-containing protein	NA	NA	NA	NA	NA
WP_003814535.1|1165895_1166201_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_005012067.1|1166299_1167250_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019248404.1|1167306_1168461_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_010930176.1|1168535_1169486_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931144.1|1170017_1170815_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019248416.1|1170862_1171516_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003814544.1|1171472_1172561_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.4	8.7e-32
WP_003814547.1|1172725_1174951_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_023852715.1|1177228_1178125_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005012067.1|1178245_1179196_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP022361	Bordetella pertussis strain B199 chromosome, complete genome	4314502	1209582	1250941	4314502	protease,transposase	uncultured_Mediterranean_phage(40.0%)	30	NA	NA
WP_005012808.1|1209582_1210533_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003812917.1|1210589_1211702_+	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_005012067.1|1214085_1215036_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931129.1|1215626_1216403_+	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_003812908.1|1216520_1216784_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_010931128.1|1216884_1217889_-	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_010931127.1|1218089_1219691_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_010931126.1|1219716_1220475_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_010931125.1|1220566_1221223_-	adenylate kinase	NA	NA	NA	NA	NA
WP_010931124.1|1221313_1222078_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003812895.1|1222087_1222276_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_010931123.1|1222331_1223375_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_010931122.1|1223371_1223785_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_003812889.1|1223781_1224402_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012067.1|1224682_1225633_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931120.1|1225800_1227192_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	32.0	1.4e-29
WP_010931119.1|1227264_1227843_+	superoxide dismutase [Fe]	NA	NA	NA	NA	NA
WP_019247560.1|1227959_1229357_+	chloride channel protein	NA	NA	NA	NA	NA
WP_010931117.1|1229472_1230678_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_003820399.1|1230777_1231296_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	5.1e-14
WP_003812875.1|1231390_1231636_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	76.6	1.3e-20
WP_003820400.1|1231863_1232178_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.8	1.2e-10
WP_010931116.1|1232267_1237457_+	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_010931115.1|1237453_1239622_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_010931114.1|1239677_1241993_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.9	4.1e-164
WP_003820402.1|1241997_1243317_+	PqiA/YebS family transporter subunit	NA	NA	NA	NA	NA
WP_014905522.1|1243335_1245009_+	MCE family protein	NA	NA	NA	NA	NA
WP_010931111.1|1245013_1245682_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_010931110.1|1245838_1249660_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005015810.1|1249990_1250941_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP022361	Bordetella pertussis strain B199 chromosome, complete genome	4314502	1265416	1322820	4314502	transposase	Pelagibacter_phage(25.0%)	54	NA	NA
WP_005012067.1|1265416_1266367_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|1266465_1267416_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931103.1|1267412_1268744_-	MFS transporter	NA	NA	NA	NA	NA
WP_010931102.1|1270004_1272005_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003819722.1|1271997_1272639_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_003809276.1|1272635_1273043_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_010931101.1|1273039_1273840_+	SURF1 family protein	NA	NA	NA	NA	NA
WP_010931100.1|1273914_1274619_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010931099.1|1274650_1275445_+	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_010929956.1|1275441_1276392_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931085.1|1276526_1277633_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010931086.1|1277643_1278741_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_010931087.1|1278885_1280091_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_010931088.1|1280097_1280619_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_010931089.1|1280615_1281107_-	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_003819740.1|1281103_1281355_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_003819741.1|1281335_1281821_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_010931090.1|1281956_1285418_+	DUF748 domain-containing protein	NA	NA	NA	NA	NA
WP_010931091.1|1285435_1286320_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_010931092.1|1286329_1286761_-	lipoprotein	NA	NA	NA	NA	NA
WP_003809348.1|1287007_1287511_+	peroxiredoxin	NA	M1I839	Pelagibacter_phage	44.1	1.8e-24
WP_010931094.1|1287588_1288989_+	MFS transporter	NA	NA	NA	NA	NA
WP_010931095.1|1289063_1289939_-	membrane protein	NA	NA	NA	NA	NA
WP_023853546.1|1289935_1290943_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_010931097.1|1291410_1291716_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_003819753.1|1291806_1292397_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930525.1|1292587_1293604_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010931098.1|1293795_1296132_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	42.8	3.2e-124
WP_003812014.1|1296214_1296649_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|1296747_1297698_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930243.1|1299568_1301512_+	autotransporter TcfA	NA	NA	NA	NA	NA
WP_010930244.1|1301608_1302304_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930245.1|1302461_1303670_+	Tm-1-like ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_010930246.1|1303679_1304510_+	phosphoenolpyruvate hydrolase family protein	NA	NA	NA	NA	NA
WP_010930247.1|1304577_1305030_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_010930248.1|1305037_1306000_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930249.1|1306104_1307547_+	N-acyl-D-glutamate deacylase	NA	NA	NA	NA	NA
WP_010930250.1|1307597_1308554_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_010930251.1|1308569_1309949_-	flavodoxin domain-containing protein	NA	NA	NA	NA	NA
WP_010930252.1|1309948_1310965_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_014905623.1|1310969_1311770_-	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_010930254.1|1311799_1312315_-	DUF2271 domain-containing protein	NA	NA	NA	NA	NA
WP_003810476.1|1312337_1312967_-	PepSY-associated TM helix domain-containing protein	NA	NA	NA	NA	NA
WP_004568579.1|1313113_1314061_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.0	1.7e-23
WP_003818606.1|1314057_1314843_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003818608.1|1314931_1315492_+	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_003818609.1|1315501_1315888_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	48.1	1.8e-16
WP_010930255.1|1315910_1317242_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010930256.1|1317238_1318102_-	presqualene diphosphate synthase HpnD	NA	NA	NA	NA	NA
WP_003810490.1|1318103_1318934_-	squalene synthase HpnC	NA	NA	NA	NA	NA
WP_003810492.1|1319062_1320190_+	alanine racemase	NA	NA	NA	NA	NA
WP_003810494.1|1320341_1321058_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930257.1|1321071_1321764_-	membrane protein	NA	NA	NA	NA	NA
WP_005013747.1|1321869_1322820_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP022361	Bordetella pertussis strain B199 chromosome, complete genome	4314502	1377470	1445978	4314502	transposase	Planktothrix_phage(33.33%)	58	NA	NA
WP_076879576.1|1377470_1378421_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811244.1|1378519_1379131_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010930290.1|1379365_1380493_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930289.1|1380603_1381692_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	31.2	2.2e-19
WP_003811259.1|1381744_1382596_-	sn-glycerol-3-phosphate ABC transporter permease UgpE	NA	NA	NA	NA	NA
WP_003811262.1|1382615_1383497_-	sn-glycerol-3-phosphate ABC transporter permease UgpA	NA	NA	NA	NA	NA
WP_010930288.1|1383673_1384987_-	sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB	NA	NA	NA	NA	NA
WP_003811267.1|1385197_1386031_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_010930287.1|1386027_1386609_+	queuosine precursor transporter	NA	A0A2I7SAW6	Vibrio_phage	37.3	9.4e-17
WP_005015810.1|1386962_1387913_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930286.1|1387928_1389044_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003811272.1|1389146_1390073_+	high-affinity branched-chain amino acid ABC transporter permease LivH	NA	NA	NA	NA	NA
WP_010930285.1|1390072_1391311_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_003811277.1|1391307_1392075_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	1.2e-14
WP_003811279.1|1392075_1392777_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.4	7.8e-18
WP_019247793.1|1392858_1393305_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_010930283.1|1394194_1394833_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012808.1|1395601_1396552_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811293.1|1396773_1397151_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_003811295.1|1397298_1397796_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_010930291.1|1397792_1398320_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_003811298.1|1398453_1399269_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930292.1|1399281_1400463_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003811301.1|1400510_1401404_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_010930293.1|1401530_1402001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930294.1|1402126_1402954_-	DUF3298 domain-containing protein	NA	NA	NA	NA	NA
WP_003811306.1|1402982_1403759_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_023852802.1|1403755_1404031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930295.1|1404045_1404510_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010930296.1|1404521_1405223_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003811310.1|1405332_1405833_-	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	38.4	4.7e-25
WP_010930297.1|1405915_1407094_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_003811313.1|1408721_1409057_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_010930298.1|1409244_1410693_+	CoA transferase	NA	NA	NA	NA	NA
WP_023852799.1|1410750_1411095_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	58.4	3.0e-31
WP_003811316.1|1411201_1411741_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012067.1|1411833_1412784_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023852768.1|1412882_1413290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019247530.1|1413522_1413954_-	YXWGXW repeat-containing protein	NA	NA	NA	NA	NA
WP_010930300.1|1414135_1414540_-	DoxX family protein	NA	NA	NA	NA	NA
WP_010930301.1|1415776_1416100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926674.1|1416102_1416990_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_003811322.1|1417022_1417448_-	universal stress protein	NA	NA	NA	NA	NA
WP_019247534.1|1417519_1417873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003811324.1|1418112_1418619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930302.1|1418657_1419989_-	transcriptional regulator PtsJ	NA	NA	NA	NA	NA
WP_003811326.1|1420048_1420864_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_010930303.1|1420860_1421715_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_019248253.1|1424777_1427342_-	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_010930305.1|1428708_1430463_-	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_010930306.1|1430459_1432580_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_010930307.1|1432584_1434780_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_010930308.1|1434776_1438118_-	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
WP_010930208.1|1440920_1441871_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811361.1|1441936_1442116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019247449.1|1442232_1442988_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_010930310.1|1442974_1444120_-	DUF3182 family protein	NA	NA	NA	NA	NA
WP_005013747.1|1445027_1445978_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP022361	Bordetella pertussis strain B199 chromosome, complete genome	4314502	1490544	1562061	4314502	protease,transposase	Faecalibacterium_phage(12.5%)	57	NA	NA
WP_005012067.1|1490544_1491495_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930697.1|1491576_1492125_-	OmpA family protein	NA	NA	NA	NA	NA
WP_010930698.1|1492127_1492466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930699.1|1492860_1495452_-	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_029443737.1|1495518_1496262_+	3'-5' exonuclease	NA	A0A2K9V2V7	Faecalibacterium_phage	31.8	4.3e-06
WP_003810206.1|1496274_1496661_+	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_003810207.1|1496667_1496958_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_010930701.1|1497093_1497393_+	YciI family protein	NA	NA	NA	NA	NA
WP_010930702.1|1497461_1498364_+	EamA family transporter	NA	NA	NA	NA	NA
WP_014905596.1|1498367_1499138_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_003810211.1|1499523_1499973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012808.1|1500040_1500991_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010926318.1|1501352_1502264_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_029443885.1|1502489_1504007_+	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_010930705.1|1505238_1506201_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019248843.1|1506289_1506538_+	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_010930866.1|1513116_1515864_+	autotransporter Vag8	NA	NA	NA	NA	NA
WP_010930865.1|1515884_1516508_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_003813199.1|1516519_1516990_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_003813196.1|1517001_1517388_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_010930864.1|1517449_1518043_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_019248139.1|1518033_1518945_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_010930862.1|1518960_1520301_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_010930861.1|1520368_1521100_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_023853666.1|1521254_1522775_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.9	1.7e-78
WP_023853659.1|1522847_1524191_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_076879554.1|1524225_1525551_-	aspartate aminotransferase family protein	NA	A0A1C9EHH3	Mycobacterium_phage	22.5	1.8e-07
WP_019248140.1|1525732_1526665_+	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_010930856.1|1526675_1528169_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010930855.1|1528165_1529089_-	DMT family transporter	NA	NA	NA	NA	NA
WP_010930854.1|1529091_1530354_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_047122810.1|1530373_1531387_-	histone deacetylase family protein	NA	A0A2K9L4C2	Tupanvirus	35.2	1.7e-42
WP_010930852.1|1531459_1531750_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_010930851.1|1531779_1533054_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.9	1.6e-24
WP_005013747.1|1533196_1534147_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930850.1|1534143_1535781_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.6	3.6e-21
WP_003813165.1|1535785_1536625_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010930849.1|1536621_1537638_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010930848.1|1537745_1539320_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930847.1|1539739_1541284_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.4	3.1e-14
WP_010930846.1|1541388_1542456_+	tartrate dehydrogenase	NA	NA	NA	NA	NA
WP_010930845.1|1542474_1544061_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_010930844.1|1544057_1545248_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003813149.1|1546820_1547309_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003813147.1|1547368_1548226_-	DMT family transporter	NA	NA	NA	NA	NA
WP_010930843.1|1548288_1549239_+	DMT family transporter	NA	NA	NA	NA	NA
WP_010930842.1|1549301_1550291_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_003813142.1|1550365_1551247_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_010930841.1|1552304_1553156_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_010930840.1|1553172_1553742_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_010930839.1|1553772_1554636_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930838.1|1554795_1555872_+	putative 2-aminoethylphosphonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.8	1.2e-28
WP_010930837.1|1555936_1557634_+	putative 2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003820286.1|1557650_1558481_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_010930836.1|1558509_1559532_+	putative 2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012067.1|1560061_1561012_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|1561110_1562061_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP022361	Bordetella pertussis strain B199 chromosome, complete genome	4314502	1608379	1691087	4314502	transposase	Klosneuvirus(16.67%)	50	NA	NA
WP_005012067.1|1608379_1609330_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930804.1|1609428_1612029_-	TRAP transporter fused permease subunit	NA	NA	NA	NA	NA
WP_003818658.1|1612135_1613140_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_010930803.1|1613248_1614589_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	22.8	8.8e-18
WP_003818661.1|1614629_1615658_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930802.1|1615853_1616399_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010930801.1|1616395_1616956_+	diaminobutyrate acetyltransferase	NA	NA	NA	NA	NA
WP_005015810.1|1617054_1618005_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003810867.1|1618028_1618493_-	GatB/YqeY domain-containing protein	NA	A0A0K2FLI9	Brevibacillus_phage	32.4	3.9e-05
WP_010930799.1|1618639_1619848_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_010930798.1|1619891_1620329_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930797.1|1620447_1621737_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_005012067.1|1624477_1625428_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930595.1|1625526_1626543_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_010930596.1|1626721_1627756_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_003811733.1|1627752_1628379_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	35.1	1.6e-22
WP_010930597.1|1628375_1629428_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_010930598.1|1629477_1630248_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_010930599.1|1630298_1631135_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_010930600.1|1631330_1632071_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930601.1|1632145_1632889_+	glutamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020699606.1|1633565_1634324_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	6.7e-31
WP_003811716.1|1635461_1636751_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_010930602.1|1638361_1639609_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_010930603.1|1639618_1641328_-	thiamine pyrophosphate-binding protein	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	27.3	5.9e-35
WP_003811709.1|1641324_1642263_-	citrate lyase subunit beta	NA	NA	NA	NA	NA
WP_003811706.1|1642259_1643543_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_010930604.1|1643546_1644029_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_010930605.1|1644029_1645016_-	DctP family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_003811701.1|1645188_1645908_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013747.1|1646024_1646975_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930606.1|1650160_1651510_+	amidase	NA	NA	NA	NA	NA
WP_010930607.1|1651567_1652362_+	putative hydro-lyase	NA	NA	NA	NA	NA
WP_003816497.1|1652495_1653371_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_014486076.1|1653414_1657131_-	virulence factors two-component system sensor histidine kinase BvgS	NA	A0A1V0SGX0	Hokovirus	32.0	4.2e-33
WP_010930609.1|1657139_1657769_-	virulence factors two-component system response regulator BvgA	NA	NA	NA	NA	NA
WP_005012067.1|1661421_1662372_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930611.1|1670773_1671508_+	molecular chaperone FimB	NA	NA	NA	NA	NA
WP_010930612.1|1671570_1674192_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_019247160.1|1674172_1675303_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_010930614.1|1675295_1677050_+	filamentous hemagglutinin transporter protein FhaC	NA	NA	NA	NA	NA
WP_010930615.1|1678367_1678868_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_010930616.1|1678874_1679849_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930617.1|1681405_1681897_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_019248349.1|1681910_1682876_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019247163.1|1682896_1683598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930620.1|1684772_1685285_+	winged helix DNA-binding protein	NA	NA	NA	NA	NA
WP_010930621.1|1685363_1688987_+	hydantoinase B/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_010930622.1|1689000_1690032_-	C45 family peptidase	NA	NA	NA	NA	NA
WP_005012067.1|1690136_1691087_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP022361	Bordetella pertussis strain B199 chromosome, complete genome	4314502	1760891	1801228	4314502	transposase	Brazilian_cedratvirus(25.0%)	34	NA	NA
WP_102970357.1|1760891_1761842_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003810741.1|1763168_1763771_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003810743.1|1764010_1764712_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_003816696.1|1764705_1765488_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	25.8	2.0e-09
WP_005012808.1|1765672_1766623_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930483.1|1766721_1767459_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	46.6	4.1e-41
WP_010926609.1|1767648_1768407_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930482.1|1768453_1769443_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930481.1|1769620_1770589_-	transporter	NA	NA	NA	NA	NA
WP_010930480.1|1772128_1773097_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_010930479.1|1773105_1774047_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_010930478.1|1774520_1775531_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_010930477.1|1775521_1777036_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_010930476.1|1777032_1778379_+	BatD family protein	NA	NA	NA	NA	NA
WP_010930475.1|1778381_1779416_+	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_023852967.1|1779465_1781091_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	52.2	2.0e-149
WP_005012067.1|1781643_1782594_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_170954298.1|1782887_1783625_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.2	1.3e-87
WP_010930504.1|1784048_1785236_-	MFS transporter	NA	NA	NA	NA	NA
WP_019249653.1|1785239_1785620_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010930506.1|1787339_1788311_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930507.1|1788324_1789038_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930508.1|1789042_1789960_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003811452.1|1790066_1790363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065465821.1|1790461_1791412_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930509.1|1792570_1795504_+	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_003810969.1|1795503_1795848_+	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_004568496.1|1795844_1797473_+	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_010930510.1|1797469_1797949_+	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_003810975.1|1797945_1798230_+	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_010930511.1|1798226_1798553_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005013747.1|1798708_1799659_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247780.1|1799702_1800245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012808.1|1800277_1801228_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP022361	Bordetella pertussis strain B199 chromosome, complete genome	4314502	1851458	1917015	4314502	protease,tRNA,transposase	Lake_Baikal_phage(20.0%)	58	NA	NA
WP_076879559.1|1851458_1852409_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930538.1|1852405_1852879_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_033446178.1|1853040_1853979_+	membrane protein	NA	NA	NA	NA	NA
WP_010930540.1|1853980_1855189_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	30.0	3.8e-36
WP_010930541.1|1855293_1855800_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_010930542.1|1855802_1858664_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.5	1.0e-71
WP_010930543.1|1858653_1859619_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_076879560.1|1859678_1861679_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.0	9.7e-21
WP_005012067.1|1861777_1862728_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930545.1|1862724_1863099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003812548.1|1863360_1864569_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_003812546.1|1864565_1866866_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	35.9	9.9e-110
WP_010926400.1|1866918_1869531_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_010930546.1|1869890_1871816_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.8	1.1e-66
WP_010930547.1|1871812_1872709_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_010930548.1|1872715_1873855_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_003812536.1|1873854_1874676_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_010930549.1|1876246_1876576_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_010930550.1|1876958_1878215_+	autotransporter Phg	NA	NA	NA	NA	NA
WP_003812526.1|1878291_1878573_+	membrane protein	NA	NA	NA	NA	NA
WP_003812524.1|1878614_1878935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930551.1|1879241_1879445_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.1	1.6e-16
WP_003812519.1|1879528_1880095_+	DUF924 family protein	NA	NA	NA	NA	NA
WP_010930553.1|1880440_1880641_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.4	7.4e-14
WP_010930554.1|1880752_1881313_-	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	33.7	1.0e-23
WP_010930555.1|1881509_1882820_+	trigger factor	NA	NA	NA	NA	NA
WP_003812508.1|1882822_1883476_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.5	6.8e-56
WP_010930556.1|1883580_1884885_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	53.8	3.2e-129
WP_010930557.1|1885073_1887527_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.0	1.5e-220
WP_019247936.1|1887650_1888601_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930559.1|1888828_1890052_+	CoA transferase	NA	NA	NA	NA	NA
WP_010930560.1|1890117_1891089_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930561.1|1891155_1891557_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_019248062.1|1891570_1892374_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003812491.1|1892370_1892802_+	OB-fold domain-containing protein	NA	NA	NA	NA	NA
WP_010930563.1|1892798_1893956_+	thiolase	NA	NA	NA	NA	NA
WP_010930564.1|1893977_1894754_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930565.1|1896966_1897635_+	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_003812478.1|1897627_1898269_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_019248063.1|1898303_1899035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247934.1|1899052_1899265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1899835_1900786_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930566.1|1902343_1902994_-	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	3.3e-10
WP_010930567.1|1903122_1904325_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_010930568.1|1904402_1906439_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_010930569.1|1906691_1907183_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_003812463.1|1907398_1907911_+	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_010930570.1|1907928_1909140_+	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_003812460.1|1909177_1909588_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.0	7.5e-53
WP_003812458.1|1909589_1909913_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	52.8	6.8e-25
WP_003812456.1|1909915_1910428_+	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_010930571.1|1910557_1912420_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	42.4	3.0e-101
WP_003812453.1|1912429_1912771_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_003812452.1|1912770_1912965_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_010930572.1|1913089_1913983_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005013747.1|1913979_1914930_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930573.1|1915054_1915864_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010929577.1|1916064_1917015_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP022361	Bordetella pertussis strain B199 chromosome, complete genome	4314502	1944798	2002467	4314502	protease,tRNA,transposase	Klosneuvirus(30.0%)	55	NA	NA
WP_010930590.1|1944798_1947423_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.4	1.7e-81
WP_004568544.1|1947409_1947664_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_010930591.1|1947730_1948312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926757.1|1948615_1948876_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_014905757.1|1949041_1949665_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003816734.1|1949664_1950438_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_010930593.1|1950434_1951643_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_010930594.1|1951668_1952142_-	RidA family protein	NA	NA	NA	NA	NA
WP_010930048.1|1952215_1953166_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930796.1|1953264_1954614_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_023852900.1|1955379_1956135_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_010930794.1|1956227_1959110_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.1	3.7e-138
WP_003810689.1|1959432_1959858_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.2	2.1e-21
WP_004568542.1|1959885_1961034_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_003810693.1|1961030_1961537_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010930793.1|1961543_1962839_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_023995843.1|1962897_1964184_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_010930791.1|1964185_1964824_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003810701.1|1964826_1965987_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_003810703.1|1966013_1967369_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_010930790.1|1967372_1968443_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	25.7	2.5e-15
WP_003810707.1|1968581_1968818_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_010930789.1|1968905_1970012_+	GTPase HflX	NA	NA	NA	NA	NA
WP_010930788.1|1969977_1971282_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_010930787.1|1971300_1972200_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_019248030.1|1972383_1973541_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_023852902.1|1973617_1974913_+	adenylosuccinate synthase	NA	A0A160ER07	Powai_lake_megavirus	33.5	3.0e-63
WP_003810720.1|1975026_1975566_+	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_006218592.1|1975843_1976056_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_033461429.1|1976075_1978106_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.9	1.0e-65
WP_124740709.1|1978131_1978326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930783.1|1978791_1981074_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.1	3.2e-36
WP_003816708.1|1981483_1981783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047122784.1|1982067_1982481_+	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	59.0	3.8e-36
WP_005013747.1|1982440_1983391_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019248114.1|1983590_1984676_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003810400.1|1984691_1985453_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_170954295.1|1985449_1986409_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.6	1.7e-23
WP_010930780.1|1986471_1986972_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_010930779.1|1987004_1987748_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_010930778.1|1987843_1988083_-	membrane protein	NA	NA	NA	NA	NA
WP_010930777.1|1988096_1988249_-	lipoprotein	NA	NA	NA	NA	NA
WP_010930776.1|1988334_1989825_-	cytochrome c oxidase accessory protein CcoG	NA	NA	NA	NA	NA
WP_010930775.1|1989916_1990855_-	cytochrome-c oxidase, cbb3-type subunit III	NA	NA	NA	NA	NA
WP_003818560.1|1990851_1991028_-	cytochrome oxidase	NA	NA	NA	NA	NA
WP_003810383.1|1991030_1991693_-	cytochrome-c oxidase, cbb3-type subunit II	NA	NA	NA	NA	NA
WP_003810379.1|1993314_1993458_-	cbb3-type cytochrome oxidase assembly protein CcoS	NA	NA	NA	NA	NA
WP_010930774.1|1993454_1994429_-	membrane protein	NA	NA	NA	NA	NA
WP_005012067.1|1994595_1995546_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930773.1|1995542_1996817_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	9.6e-14
WP_010930772.1|1996920_1998114_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_010930771.1|1998110_1998764_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010930770.1|1998760_2000197_+	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_010930769.1|2000184_2000544_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_005012067.1|2001516_2002467_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP022361	Bordetella pertussis strain B199 chromosome, complete genome	4314502	2261462	2325647	4314502	protease,tRNA,transposase	Salmonella_phage(16.67%)	60	NA	NA
WP_004566381.1|2261462_2262950_-|protease	DegQ family serine endoprotease	protease	W5SAB9	Pithovirus	31.5	1.2e-07
WP_010930931.1|2262987_2264046_-	MucB/RseB C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_023853242.1|2264045_2264546_-	sigma-E factor negative regulatory protein	NA	NA	NA	NA	NA
WP_003813797.1|2264558_2265158_-	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	26.1	2.2e-05
WP_010930933.1|2265154_2265655_-	membrane protein	NA	NA	NA	NA	NA
WP_003813802.1|2265656_2266886_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_003813816.1|2267075_2267315_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	46.6	5.4e-11
WP_003813819.1|2267497_2268250_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.3	6.9e-12
WP_010930934.1|2268251_2269187_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_010930935.1|2269268_2270255_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_003821347.1|2270254_2271313_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_003813827.1|2271369_2271552_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_010930936.1|2271603_2272197_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_003821345.1|2272305_2272905_+	septum formation protein Maf	NA	NA	NA	NA	NA
WP_010930937.1|2272901_2273612_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010930938.1|2273613_2274441_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_003814009.1|2276247_2277489_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|2277500_2278274_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005012067.1|2278300_2279251_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929577.1|2279349_2280300_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814011.1|2280398_2281181_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_019248324.1|2281269_2282475_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_003814013.1|2283200_2284586_+	alcaligin siderophore biosynthesis protein AlcA	NA	NA	NA	NA	NA
WP_003814014.1|2284604_2285210_+	alcaligin siderophore biosynthesis protein AlcB	NA	NA	NA	NA	NA
WP_010930939.1|2285206_2287063_+	alcaligin siderophore biosynthesis protein AlcC	NA	NA	NA	NA	NA
WP_003814016.1|2287059_2287860_+	alcaligin siderophore biosynthesis protein AlcD	NA	NA	NA	NA	NA
WP_005013753.1|2287874_2289068_+	alcaligin siderophore biosynthesis protein AlcE	NA	NA	NA	NA	NA
WP_003814017.1|2289135_2290110_+	alcaligin siderophore biosynthesis transcriptional regulator AlcR	NA	NA	NA	NA	NA
WP_010930940.1|2290232_2291456_+	alcaligin siderophore export MFS transporter Bcr	NA	S4TR35	Salmonella_phage	29.4	9.8e-24
WP_010930941.1|2291566_2293771_+	TonB-dependent alcaligin siderophore receptor FauA	NA	NA	NA	NA	NA
WP_003814020.1|2294065_2294725_+	NAAT family transporter	NA	NA	NA	NA	NA
WP_019247690.1|2294732_2294939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019248325.1|2295277_2296033_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_003814022.1|2296048_2296210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003814023.1|2296303_2296819_+	hypothetical protein	NA	T1SAR8	Salmonella_phage	44.6	5.1e-06
WP_003814024.1|2297091_2297409_+	virulence factor	NA	NA	NA	NA	NA
WP_170954289.1|2297353_2297998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930944.1|2298123_2299479_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.5	1.6e-83
WP_010930945.1|2299525_2300866_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.9	1.6e-75
WP_010930946.1|2300967_2301600_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_003814032.1|2301599_2303960_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	48.0	7.6e-81
WP_010930948.1|2304001_2304961_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	40.2	3.1e-57
WP_010929073.1|2304947_2305634_+	Smr/MutS family protein	NA	NA	NA	NA	NA
WP_005015014.1|2305630_2305963_+	multidrug transporter	NA	NA	NA	NA	NA
WP_010929577.1|2306078_2307029_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814040.1|2307025_2309092_-	cation acetate symporter	NA	NA	NA	NA	NA
WP_003814042.1|2309091_2309364_-	DUF4212 domain-containing protein	NA	NA	NA	NA	NA
WP_017685545.1|2310058_2310148_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_010930949.1|2310147_2311932_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_010930950.1|2311955_2314121_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	27.1	1.2e-24
WP_003814050.1|2314131_2314731_+	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_003814052.1|2317552_2318248_+	two-component system response regulator KdpE	NA	NA	NA	NA	NA
WP_005013747.1|2318256_2319207_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005015028.1|2319305_2320547_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_003814057.1|2320696_2321677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003814059.1|2321875_2323132_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	64.8	1.2e-11
WP_003814061.1|2323334_2323760_+	DUF1841 family protein	NA	NA	NA	NA	NA
WP_003814063.1|2323801_2324164_-	cytochrome c	NA	NA	NA	NA	NA
WP_003814065.1|2324176_2324530_-	cytochrome c	NA	NA	NA	NA	NA
WP_005013747.1|2324696_2325647_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP022361	Bordetella pertussis strain B199 chromosome, complete genome	4314502	2405324	2445992	4314502	tRNA,transposase	Salmonella_phage(33.33%)	43	NA	NA
WP_010929591.1|2405324_2406275_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_004567479.1|2406385_2406568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931004.1|2406667_2407264_-	lipoprotein	NA	NA	NA	NA	NA
WP_010931005.1|2407447_2408539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003812822.1|2409038_2409449_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931006.1|2409507_2409849_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	42.2	2.8e-13
WP_010931007.1|2409854_2412272_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_010926359.1|2412284_2413307_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.6	1.0e-26
WP_003812832.1|2413381_2413741_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_003812834.1|2413756_2413954_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_010929584.1|2414289_2415240_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931009.1|2415343_2415625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931008.1|2415739_2417188_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005012067.1|2417298_2418249_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003816756.1|2418245_2418695_-	dUTP diphosphatase	NA	S4TNT3	Salmonella_phage	67.2	3.7e-45
WP_010931070.1|2418889_2419840_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003820420.1|2420084_2420798_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_019247724.1|2420920_2421148_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003816758.1|2421442_2422081_-	DedA family protein	NA	NA	NA	NA	NA
WP_010931011.1|2422189_2423224_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_005012067.1|2423220_2424171_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931012.1|2424586_2425111_-	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	32.9	6.5e-09
WP_004567322.1|2425114_2425384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931013.1|2425582_2426644_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_010931014.1|2426727_2428362_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.1	2.9e-15
WP_010931015.1|2428363_2429167_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931016.1|2429195_2430155_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931017.1|2430158_2431673_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019248147.1|2431709_2432714_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_033456131.1|2432721_2432955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931018.1|2433144_2433615_-	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_010931019.1|2433650_2434262_-	LysE family translocator	NA	NA	NA	NA	NA
WP_010931020.1|2434292_2434916_-	FMN-binding negative transcriptional regulator	NA	NA	NA	NA	NA
WP_010931021.1|2434996_2436529_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_010931022.1|2436563_2437805_-	MFS transporter	NA	NA	NA	NA	NA
WP_010931023.1|2437848_2438880_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	27.8	1.8e-26
WP_010931024.1|2438876_2440046_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010931025.1|2440039_2440720_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_010931026.1|2440881_2441724_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931027.1|2441886_2442858_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010931028.1|2443029_2443908_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_010931029.1|2443930_2445001_-	FUSC family protein	NA	NA	NA	NA	NA
WP_005013747.1|2445041_2445992_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP022361	Bordetella pertussis strain B199 chromosome, complete genome	4314502	2495647	2558406	4314502	tRNA,transposase	Cedratvirus(33.33%)	51	NA	NA
WP_010929577.1|2495647_2496598_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930742.1|2497797_2498748_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930661.1|2500453_2501419_-	Bug family tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930660.1|2502173_2504282_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_061363663.1|2504292_2505699_-	ferric reductase-like transmembrane domain-containing protein	NA	NA	NA	NA	NA
WP_010930525.1|2507770_2508787_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010929893.1|2508978_2509596_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_010929892.1|2509611_2510643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050483694.1|2511509_2512211_-	Asp/Glu racemase	NA	NA	NA	NA	NA
WP_010930658.1|2512562_2513714_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_010930657.1|2513790_2514312_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_010930656.1|2516755_2517526_-	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	29.2	3.3e-09
WP_010930655.1|2517522_2518299_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.5	1.3e-13
WP_019248318.1|2518295_2520245_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_019248317.1|2520336_2521545_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012067.1|2521591_2522542_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003820159.1|2522909_2523395_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010930652.1|2523739_2523976_-	membrane protein	NA	NA	NA	NA	NA
WP_010930651.1|2524184_2526170_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_010930650.1|2526175_2528281_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_019248368.1|2528284_2529544_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_015041299.1|2529524_2530163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930648.1|2530167_2531280_-	alkene reductase	NA	NA	NA	NA	NA
WP_003820151.1|2531332_2531632_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010930647.1|2531839_2532289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003820150.1|2532295_2532631_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_010930646.1|2532644_2533121_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_003820147.1|2533124_2533517_+	RidA family protein	NA	NA	NA	NA	NA
WP_080366247.1|2533516_2534542_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930644.1|2534542_2536663_+	acetate--CoA ligase family protein	NA	NA	NA	NA	NA
WP_019247348.1|2536671_2537376_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010930643.1|2537534_2538563_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_010930642.1|2538969_2540061_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.6	9.3e-26
WP_010930641.1|2540057_2540861_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003810039.1|2540857_2541685_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010930640.1|2543322_2544447_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930639.1|2544558_2545512_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003820136.1|2545516_2546155_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930638.1|2546242_2547010_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003820133.1|2547024_2547828_-	aspartate dehydrogenase	NA	NA	NA	NA	NA
WP_010930636.1|2547824_2548634_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_004568037.1|2548630_2549614_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003820128.1|2549642_2550911_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_003810020.1|2550913_2551438_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_010930635.1|2551434_2552376_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003810016.1|2552385_2552700_-	NIPSNAP family protein	NA	NA	NA	NA	NA
WP_010930634.1|2552741_2553242_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_010929632.1|2553585_2554602_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010930633.1|2554995_2556261_-	aspartate kinase	NA	NA	NA	NA	NA
WP_010930632.1|2556360_2557326_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_005013747.1|2557455_2558406_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP022361	Bordetella pertussis strain B199 chromosome, complete genome	4314502	2751430	2895027	4314502	transposase	uncultured_Caudovirales_phage(33.33%)	120	NA	NA
WP_005012067.1|2751430_2752381_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811850.1|2752750_2753323_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_003811852.1|2753325_2754336_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_010930335.1|2754328_2754829_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_003811855.1|2754839_2755181_+	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_015041547.1|2755192_2755984_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_003811859.1|2756000_2756270_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_010930333.1|2756292_2757081_+	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_010930320.1|2757127_2758144_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_014486070.1|2758360_2759803_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	41.8	1.0e-35
WP_010930332.1|2759981_2761601_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.3	1.5e-08
WP_010930331.1|2761721_2763542_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.6	6.4e-11
WP_010930330.1|2763620_2765153_-	flagellar hook-associated protein FlgL	NA	NA	NA	NA	NA
WP_010930329.1|2765186_2766833_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_010930328.1|2766902_2767925_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A088F6W1	Sulfitobacter_phage	31.4	1.9e-12
WP_010930327.1|2767942_2769076_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_010930326.1|2769078_2769768_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_010930325.1|2769767_2770553_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_003817181.1|2770596_2771361_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_003817180.1|2771399_2772821_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_019248229.1|2772886_2773591_-	flagellar basal body rod modification protein FlgD	NA	NA	NA	NA	NA
WP_003817176.1|2773638_2774058_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_010930323.1|2774070_2774478_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_010930322.1|2774661_2775372_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_003817172.1|2775498_2775789_+	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
WP_003817170.1|2775806_2776289_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_010930321.1|2780794_2781949_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_023853536.1|2782254_2783271_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010930319.1|2783517_2784306_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003812020.1|2784372_2785053_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003812022.1|2785049_2785820_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	9.8e-30
WP_005012067.1|2785918_2786869_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811850.1|2787238_2787811_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_003811852.1|2787813_2788824_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_010930335.1|2788816_2789317_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_003811855.1|2789327_2789669_+	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_015041547.1|2789680_2790472_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_003811859.1|2790488_2790758_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_010930333.1|2790780_2791569_+	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_010930320.1|2791615_2792632_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_014486070.1|2792848_2794291_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	41.8	1.0e-35
WP_010930332.1|2794469_2796089_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.3	1.5e-08
WP_010930331.1|2796209_2798030_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.6	6.4e-11
WP_010930330.1|2798108_2799641_-	flagellar hook-associated protein FlgL	NA	NA	NA	NA	NA
WP_010930329.1|2799674_2801321_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_010930328.1|2801390_2802413_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A088F6W1	Sulfitobacter_phage	31.4	1.9e-12
WP_010930327.1|2802430_2803564_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_010930326.1|2803566_2804256_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_010930325.1|2804255_2805041_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_003817181.1|2805084_2805849_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_003817180.1|2805887_2807309_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_019248229.1|2807374_2808079_-	flagellar basal body rod modification protein FlgD	NA	NA	NA	NA	NA
WP_003817176.1|2808126_2808546_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_010930323.1|2808558_2808966_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_010930322.1|2809149_2809860_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_003817172.1|2809986_2810277_+	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
WP_003817170.1|2810294_2810777_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_010930321.1|2815282_2816437_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_023853536.1|2816742_2817759_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010930319.1|2818005_2818794_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003812020.1|2818860_2819541_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003812022.1|2819537_2820308_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	9.8e-30
WP_005012067.1|2820406_2821357_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811850.1|2821726_2822299_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_003811852.1|2822301_2823312_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_010930335.1|2823304_2823805_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_003811855.1|2823815_2824157_+	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_015041547.1|2824168_2824960_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_003811859.1|2824976_2825246_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_010930333.1|2825268_2826057_+	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_010930320.1|2826103_2827120_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_014486070.1|2827336_2828779_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	41.8	1.0e-35
WP_010930332.1|2828957_2830577_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.3	1.5e-08
WP_010930331.1|2830697_2832518_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.6	6.4e-11
WP_010930330.1|2832596_2834129_-	flagellar hook-associated protein FlgL	NA	NA	NA	NA	NA
WP_010930329.1|2834162_2835809_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_010930328.1|2835878_2836901_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A088F6W1	Sulfitobacter_phage	31.4	1.9e-12
WP_010930327.1|2836918_2838052_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_010930326.1|2838054_2838744_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_010930325.1|2838743_2839529_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_003817181.1|2839572_2840337_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_003817180.1|2840375_2841797_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_019248229.1|2841862_2842567_-	flagellar basal body rod modification protein FlgD	NA	NA	NA	NA	NA
WP_003817176.1|2842614_2843034_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_010930323.1|2843046_2843454_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_010930322.1|2843637_2844348_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_003817172.1|2844474_2844765_+	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
WP_003817170.1|2844782_2845265_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_010930321.1|2849770_2850925_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_023853536.1|2851230_2852247_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010930319.1|2852493_2853282_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003812020.1|2853348_2854029_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003812022.1|2854025_2854796_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	9.8e-30
WP_010930208.1|2854894_2855845_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811401.1|2855900_2856818_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_003811400.1|2856828_2858007_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	NA	NA	NA	NA
WP_010930318.1|2858026_2859022_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003811396.1|2860610_2861219_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_003811393.1|2861206_2862247_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003811391.1|2862264_2863227_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003811389.1|2863223_2864417_-	CoA transferase	NA	NA	NA	NA	NA
WP_010930317.1|2864413_2865211_-	citryl-CoA lyase	NA	NA	NA	NA	NA
WP_014486069.1|2865236_2866223_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930316.1|2866241_2868281_-	acetate--CoA ligase family protein	NA	NA	NA	NA	NA
WP_010930315.1|2868482_2869163_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930314.1|2869176_2870088_-	CoA ester lyase	NA	NA	NA	NA	NA
WP_003811381.1|2870084_2870663_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010930313.1|2870801_2871707_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930311.1|2875122_2877723_-	BP1344/BB2830 family autotransporter	NA	NA	NA	NA	NA
WP_003811375.1|2878678_2879311_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003811372.1|2879704_2880463_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_003811370.1|2880459_2881662_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_010930208.1|2881849_2882800_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930368.1|2882978_2884673_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_003809599.1|2884669_2885755_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	6.4e-27
WP_010930367.1|2885802_2886702_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003809593.1|2886712_2887357_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_023852833.1|2891634_2892789_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.4	3.3e-53
WP_010930364.1|2893015_2893978_+	transaldolase	NA	H6WFR1	Cyanophage	29.2	7.5e-11
WP_076879547.1|2894076_2895027_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP022361	Bordetella pertussis strain B199 chromosome, complete genome	4314502	3111337	3179754	4314502	tRNA,transposase	Oenococcus_phage(33.33%)	54	NA	NA
WP_005012067.1|3111337_3112288_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930231.1|3112490_3113480_+	succinylglutamate desuccinylase/aspartoacylase family protein	NA	NA	NA	NA	NA
WP_010930230.1|3113563_3113917_+	NirD/YgiW/YdeI family stress tolerance protein	NA	NA	NA	NA	NA
WP_010930229.1|3113994_3114603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003811662.1|3116276_3116855_-	amino acid synthesis family protein	NA	NA	NA	NA	NA
WP_003811660.1|3116879_3117833_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930228.1|3117872_3118790_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033446252.1|3118911_3119838_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930226.1|3119845_3120592_-	aldolase	NA	NA	NA	NA	NA
WP_010930225.1|3120918_3121860_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_010930224.1|3122086_3123784_-	sodium:solute symporter family protein	NA	NA	NA	NA	NA
WP_010930223.1|3124218_3125640_-	MFS transporter	NA	NA	NA	NA	NA
WP_010930222.1|3125793_3126573_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_019247966.1|3126697_3127576_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930220.1|3127681_3128806_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	28.3	1.5e-31
WP_003811636.1|3128851_3129814_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930219.1|3129806_3130661_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_003811632.1|3130768_3131179_+	VOC family protein	NA	NA	NA	NA	NA
WP_005013747.1|3131175_3132126_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003813574.1|3132224_3133106_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_003821443.1|3133183_3134563_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_010930218.1|3134601_3135447_-	FTR1 family protein	NA	NA	NA	NA	NA
WP_003813580.1|3135462_3135807_-	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_010930217.1|3135809_3136346_-	iron transporter	NA	NA	NA	NA	NA
WP_003813585.1|3136518_3137094_-	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_003813586.1|3137196_3137934_-	acetoacetyl-CoA reductase	NA	NA	NA	NA	NA
WP_010930216.1|3138001_3139639_-	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_019247742.1|3139746_3140502_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_010930214.1|3140489_3141452_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003813594.1|3141553_3142354_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_010930213.1|3142415_3144491_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	30.0	2.4e-75
WP_010930212.1|3144655_3147031_+	RNA-binding transcriptional accessory protein Tex	NA	NA	NA	NA	NA
WP_010930211.1|3147111_3148467_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_010930742.1|3148476_3149427_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003813603.1|3149575_3149902_-	DUF3325 domain-containing protein	NA	NA	NA	NA	NA
WP_003813607.1|3151546_3151855_-	DUF3649 domain-containing protein	NA	NA	NA	NA	NA
WP_003813609.1|3151971_3154449_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_003813612.1|3154542_3155505_-	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_010930209.1|3155497_3156031_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010930208.1|3156752_3157703_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003813618.1|3158170_3158893_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930207.1|3158947_3159931_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012067.1|3160060_3161011_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003813621.1|3161007_3161910_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930206.1|3161997_3162756_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023853245.1|3162768_3163860_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_003813626.1|3163957_3165385_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	2.1e-41
WP_010930204.1|3165614_3166829_-	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_003813631.1|3166874_3169745_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_010930202.1|3172155_3172644_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930201.1|3172769_3175466_+	alpha-ketoglutarate dehydrogenase	NA	NA	NA	NA	NA
WP_010930200.1|3175620_3177903_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_033461500.1|3178081_3178705_+	serotype 2 fimbrial subunit	NA	NA	NA	NA	NA
WP_010930198.1|3178803_3179754_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP022361	Bordetella pertussis strain B199 chromosome, complete genome	4314502	3200623	3313989	4314502	protease,holin,tRNA,transposase	uncultured_Mediterranean_phage(18.75%)	99	NA	NA
WP_010930190.1|3200623_3202144_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.0	1.2e-82
WP_010930189.1|3202186_3202489_+	membrane protein	NA	NA	NA	NA	NA
WP_003812436.1|3202485_3203118_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930188.1|3203196_3205062_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.3	9.3e-50
WP_020699602.1|3205058_3205853_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.3	1.2e-11
WP_010930186.1|3205881_3206997_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930185.1|3207901_3208780_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_019248175.1|3208779_3209604_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	22.7	1.0e-08
WP_005012067.1|3209771_3210722_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019248112.1|3210934_3213784_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_010930182.1|3213765_3214494_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_010930180.1|3216095_3216467_-	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_003812701.1|3216484_3217798_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_003812703.1|3217834_3218293_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005012067.1|3218405_3219356_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930178.1|3219352_3220366_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_003812707.1|3220505_3221492_+	homoserine kinase	NA	NA	NA	NA	NA
WP_161633091.1|3221850_3222558_-	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_005012067.1|3223138_3224089_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003809618.1|3224240_3224843_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_010930175.1|3224861_3225494_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_162096758.1|3225538_3225790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930174.1|3225731_3227618_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	41.5	1.4e-109
WP_010930173.1|3227636_3228479_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	3.2e-26
WP_003819875.1|3228475_3229834_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_003809629.1|3230054_3230849_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010930172.1|3231079_3232573_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_010930171.1|3232808_3234890_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_014486066.1|3235084_3236125_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	40.2	2.1e-51
WP_010930169.1|3236259_3237276_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_003809638.1|3237297_3238155_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_010930167.1|3238199_3238976_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	28.7	4.3e-17
WP_005012067.1|3239343_3240294_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|3240392_3241343_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003809441.1|3241369_3241834_-	barstar family protein	NA	NA	NA	NA	NA
WP_010930165.1|3245445_3246318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930164.1|3246360_3247515_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_010930163.1|3247549_3248380_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_023853525.1|3248463_3250008_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_010930161.1|3250050_3250410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003819794.1|3250411_3250825_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_003809432.1|3250865_3251183_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_003809431.1|3251267_3251984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930160.1|3252247_3253669_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_033461720.1|3253735_3256468_-	pertactin autotransporter	NA	NA	NA	NA	NA
WP_010930525.1|3256800_3257817_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010930157.1|3258152_3258794_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003809423.1|3258884_3260321_-	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_023853534.1|3260478_3261552_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_010930155.1|3261548_3262685_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.4	1.9e-85
WP_003809416.1|3262829_3263174_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.4	1.0e-10
WP_010930154.1|3263240_3265121_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_003809411.1|3265170_3266106_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.5	3.0e-41
WP_010930525.1|3266437_3267454_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_015041211.1|3268391_3269819_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_010930151.1|3269815_3270838_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.4	8.7e-50
WP_003809396.1|3270827_3271301_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_010930149.1|3271441_3272329_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_014486064.1|3272325_3273969_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_010930148.1|3273965_3275015_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_010930525.1|3275803_3276820_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003817162.1|3276919_3277552_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_003811911.1|3277560_3277950_-	chemotaxis response regulator CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	33.3	5.7e-10
WP_010930146.1|3278002_3279055_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_010930145.1|3279918_3281625_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.7	1.4e-12
WP_003811919.1|3281698_3282199_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_010930144.1|3282213_3284271_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_019247393.1|3284297_3284591_-	response regulator	NA	NA	NA	NA	NA
WP_003817154.1|3284692_3285640_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_003811927.1|3285652_3286528_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_003811929.1|3286648_3287209_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_010930143.1|3287243_3287567_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_003811933.1|3288002_3288740_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_005012067.1|3289038_3289989_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|3290087_3291038_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003809486.1|3291281_3291545_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_003819817.1|3291618_3291900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930142.1|3291916_3292777_-	M23 family metallopeptidase	NA	A0A292GJG6	Xanthomonas_phage	36.1	2.6e-15
WP_003809479.1|3292773_3293109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930141.1|3293162_3293813_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_005015810.1|3294018_3294969_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_033461972.1|3295052_3296522_+	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_019247197.1|3296542_3297487_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_003809467.1|3297532_3297850_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930139.1|3297852_3298791_-	DnaJ domain-containing protein	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	24.1	5.6e-11
WP_003819814.1|3298968_3299454_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010930138.1|3299472_3300021_+	DinB family protein	NA	NA	NA	NA	NA
WP_023994624.1|3300052_3300205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023853531.1|3300297_3301431_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930137.1|3301534_3302176_+	glutathione transferase	NA	NA	NA	NA	NA
WP_010930136.1|3302330_3304679_+	DUF3141 domain-containing protein	NA	NA	NA	NA	NA
WP_003809454.1|3304675_3305614_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_010930135.1|3305639_3306830_+	acetate kinase	NA	NA	NA	NA	NA
WP_010930134.1|3306826_3307600_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_010930133.1|3307629_3308823_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_010930132.1|3308940_3309951_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_010930131.1|3309968_3312005_-	transketolase	NA	NA	NA	NA	NA
WP_010930130.1|3312199_3312940_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_005012808.1|3313038_3313989_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP022361	Bordetella pertussis strain B199 chromosome, complete genome	4314502	3379811	3449437	4314502	transposase	Staphylococcus_phage(28.57%)	58	NA	NA
WP_005012808.1|3379811_3380762_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_004566317.1|3380891_3381284_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PJ17	Moraxella_phage	45.0	4.8e-25
WP_003821497.1|3381560_3382472_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	27.6	4.4e-05
WP_010930088.1|3382596_3383571_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930087.1|3383605_3383965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930086.1|3385211_3385634_+	OB-fold domain-containing protein	NA	NA	NA	NA	NA
WP_010930085.1|3385638_3386622_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930084.1|3386633_3388292_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	24.9	2.3e-20
WP_003821488.1|3388385_3388961_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_010930083.1|3388985_3389975_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_029443845.1|3390110_3391088_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_004566323.1|3391213_3392287_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_010930081.1|3392364_3393225_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_003813501.1|3393279_3394176_-	TrmB family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930080.1|3394217_3395033_-	phosphosulfolactate synthase	NA	NA	NA	NA	NA
WP_003821482.1|3395146_3396379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162892901.1|3396451_3397606_+	tricarballylate utilization 4Fe-4S protein TcuB	NA	NA	NA	NA	NA
WP_010930077.1|3397626_3399030_+	FAD-dependent tricarballylate dehydrogenase TcuA	NA	NA	NA	NA	NA
WP_010930076.1|3399079_3400534_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_162096761.1|3400638_3402051_-	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_003821476.1|3402962_3403790_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010930074.1|3403786_3404659_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003821473.1|3404678_3405653_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930073.1|3406930_3407482_+	decarboxylase	NA	NA	NA	NA	NA
WP_010929626.1|3407569_3408520_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003810865.1|3408618_3409704_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_010930072.1|3409801_3410212_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_003810859.1|3410827_3412741_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_010930070.1|3415491_3416226_-	metallophosphoesterase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	49.6	3.8e-63
WP_003810851.1|3416389_3417571_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_003810850.1|3417567_3417780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003810847.1|3417776_3418757_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_010930068.1|3418802_3419630_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	47.4	1.7e-67
WP_023852913.1|3419779_3421594_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	27.9	5.7e-44
WP_003810840.1|3421648_3422032_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_005012067.1|3422028_3422979_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003810839.1|3423090_3423342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003810835.1|3423847_3424966_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_003810832.1|3425085_3425298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930064.1|3425457_3425679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|3425731_3426682_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930062.1|3427858_3429229_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_010930061.1|3429261_3430053_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930060.1|3430065_3431121_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_019247557.1|3431146_3432022_-	amidohydrolase	NA	NA	NA	NA	NA
WP_023852826.1|3432127_3432376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003819989.1|3432410_3433865_-	carboxylase	NA	NA	NA	NA	NA
WP_004568140.1|3433861_3434383_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_010930057.1|3434411_3435764_-	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_010930056.1|3441028_3442330_+	phospholipase A	NA	NA	NA	NA	NA
WP_010930055.1|3442344_3443061_-	flagellar brake protein	NA	NA	NA	NA	NA
WP_010930054.1|3443342_3444023_+	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_003809770.1|3444034_3444202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023852837.1|3444310_3444457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930052.1|3444550_3445210_-	thiopurine S-methyltransferase	NA	NA	NA	NA	NA
WP_010930051.1|3445608_3447441_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.4	1.3e-27
WP_005012067.1|3447437_3448388_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|3448486_3449437_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP022361	Bordetella pertussis strain B199 chromosome, complete genome	4314502	3487771	3537024	4314502	holin,transposase	Vibrio_phage(50.0%)	39	NA	NA
WP_005012067.1|3487771_3488722_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247352.1|3488739_3489294_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003813949.1|3489295_3489730_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_003813951.1|3489726_3490161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003813952.1|3490144_3490948_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003813954.1|3490964_3491780_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_020699608.1|3491776_3492592_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_010930033.1|3492738_3493440_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003813960.1|3493467_3495426_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	30.3	8.0e-28
WP_005013747.1|3495508_3496459_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930032.1|3496679_3497348_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_010930031.1|3497471_3498578_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_010930029.1|3501689_3503183_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_010926969.1|3503197_3503869_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003813974.1|3503912_3504407_-	azurin	NA	NA	NA	NA	NA
WP_010930027.1|3504547_3505195_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023853163.1|3505298_3507347_+	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_010930025.1|3507343_3509356_+	hydantoinase B/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_010930024.1|3509381_3510716_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_003813981.1|3510824_3511817_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003813982.1|3511883_3513968_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_019248051.1|3513992_3514964_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930022.1|3515092_3516124_-	succinylglutamate desuccinylase/aspartoacylase family protein	NA	NA	NA	NA	NA
WP_010930021.1|3516127_3517279_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_076879542.1|3517449_3518373_+	transcriptional regulator LrhA	NA	NA	NA	NA	NA
WP_003813987.1|3518450_3519275_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023853536.1|3519471_3520488_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003813988.1|3520684_3521668_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930019.1|3523266_3524655_-	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_003813991.1|3524685_3525675_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003813992.1|3525785_3527018_-	methylaspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_003813993.1|3527299_3528100_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930018.1|3528122_3530354_-|holin	choline BCCT transporter BetT	holin	NA	NA	NA	NA
WP_010930017.1|3531141_3531588_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_003813996.1|3531609_3532356_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_003813997.1|3532499_3533477_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_010930016.1|3534110_3534722_+	PIN domain-containing protein	NA	K4HZX4	Acidithiobacillus_phage	32.5	3.3e-12
WP_003813999.1|3534715_3535933_-	threonine ammonia-lyase	NA	NA	NA	NA	NA
WP_005013747.1|3536073_3537024_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP022361	Bordetella pertussis strain B199 chromosome, complete genome	4314502	3549062	3593217	4314502	protease,terminase,tRNA,transposase	Bacillus_phage(25.0%)	45	NA	NA
WP_010931443.1|3549062_3549665_-	hypothetical protein	NA	R9TF81	Synechococcus_phage	43.6	7.9e-27
WP_010931444.1|3549787_3550030_-	hypothetical protein	NA	A0A0H5AUE5	Pseudomonas_phage	53.2	5.6e-16
WP_010931445.1|3550035_3551091_-	hypothetical protein	NA	A0A0H5BBX3	Pseudomonas_phage	50.6	2.6e-97
WP_010931446.1|3551119_3552538_-	DUF4055 domain-containing protein	NA	R9TF43	Synechococcus_phage	42.1	2.2e-99
WP_010931447.1|3552540_3553818_-|terminase	terminase large subunit	terminase	A0A1B1P9C9	Acinetobacter_phage	64.7	2.4e-150
WP_019247942.1|3553804_3554290_-|transposase	transposase	transposase	C7U0W1	Enterobacteria_phage	61.5	7.3e-39
WP_005012067.1|3554929_3555880_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_161633094.1|3556136_3556826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023853179.1|3556818_3557070_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010931451.1|3557624_3558236_+	S24 family peptidase	NA	NA	NA	NA	NA
WP_019247378.1|3558307_3558514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|3558765_3559716_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019248926.1|3559814_3560888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931475.1|3561055_3561850_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010925795.1|3561889_3562414_-	DUF934 domain-containing protein	NA	NA	NA	NA	NA
WP_010931474.1|3562406_3564149_-	nitrite/sulfite reductase	NA	NA	NA	NA	NA
WP_010931473.1|3564358_3565117_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.4	4.4e-14
WP_010931472.1|3565119_3565827_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.4	8.2e-07
WP_014905407.1|3565843_3566725_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_019247734.1|3566735_3567494_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_019248554.1|3567462_3568218_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931468.1|3568287_3569706_+	amidase	NA	NA	NA	NA	NA
WP_003819076.1|3569727_3570378_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_033446132.1|3570511_3570847_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_005015810.1|3570935_3571886_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931467.1|3571962_3573783_+	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	3.1e-74
WP_010931466.1|3573787_3574861_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.7	2.3e-08
WP_003814230.1|3574983_3575952_+	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_010927008.1|3576025_3576937_+	complex I NDUFA9 subunit family protein	NA	NA	NA	NA	NA
WP_003814226.1|3576955_3577528_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_010931465.1|3577608_3578157_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_010931464.1|3578156_3579746_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.2	8.7e-65
WP_003814221.1|3579815_3580055_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_023995141.1|3580095_3581121_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003814217.1|3581186_3582368_-	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_010931463.1|3582464_3582917_+	membrane protein	NA	NA	NA	NA	NA
WP_010931462.1|3582926_3584267_-	aminopeptidase P N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010931461.1|3584583_3585621_+	sodium:calcium antiporter	NA	NA	NA	NA	NA
WP_003814209.1|3586002_3586362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013747.1|3586445_3587396_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931401.1|3587494_3588445_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814206.1|3588705_3589800_+	porin	NA	NA	NA	NA	NA
WP_003814205.1|3589881_3590763_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_003814203.1|3590784_3591624_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.9	1.1e-66
WP_010931459.1|3591699_3593217_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
>prophage 29
NZ_CP022361	Bordetella pertussis strain B199 chromosome, complete genome	4314502	3721331	3785955	4314502	tail,tRNA,transposase	uncultured_Caudovirales_phage(22.22%)	61	NA	NA
WP_010931534.1|3721331_3722579_+|tRNA	bifunctional tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB/ribosomal protein alanine acetyltransferase RimI	tRNA	NA	NA	NA	NA
WP_010931535.1|3722565_3723462_+	uracil-DNA glycosylase	NA	L7TNG6	Rhizobium_phage	26.5	5.2e-06
WP_010931536.1|3723480_3724791_-	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
WP_010931537.1|3725053_3728581_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_003821312.1|3728625_3729684_+	membrane protein	NA	NA	NA	NA	NA
WP_010931538.1|3729683_3731774_+	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	44.9	5.6e-144
WP_003821314.1|3731858_3732635_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_010931539.1|3732660_3732945_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_003813872.1|3732966_3733536_-	septation protein A	NA	NA	NA	NA	NA
WP_010931540.1|3733532_3733934_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_003813870.1|3733985_3734663_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.5	3.4e-10
WP_010931541.1|3734659_3735259_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_010931542.1|3735302_3735860_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_010931543.1|3736092_3737256_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931544.1|3737417_3738443_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010931545.1|3738448_3740245_+	branched-chain amino acid ABC transporter ATP-binding protein/permease	NA	A0A2R8FG22	Brazilian_cedratvirus	26.9	9.1e-10
WP_003813863.1|3740291_3741131_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_003821320.1|3741162_3742161_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931546.1|3742256_3743234_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010931547.1|3743230_3744118_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010931548.1|3744209_3745424_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003813858.1|3745482_3746193_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	26.3	1.2e-05
WP_003821323.1|3746189_3746963_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.3	5.4e-12
WP_003813856.1|3747221_3747857_-	endonuclease III	NA	NA	NA	NA	NA
WP_010929011.1|3747853_3748495_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_003821325.1|3748550_3749777_-	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
WP_010931550.1|3749922_3750720_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_010931551.1|3750765_3751089_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_023995174.1|3751255_3752431_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	33.4	1.4e-48
WP_003813850.1|3752482_3752833_+	RidA family protein	NA	NA	NA	NA	NA
WP_003821327.1|3752991_3753501_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003821329.1|3753497_3754331_-	zinc-dependent peptidase	NA	NA	NA	NA	NA
WP_010931553.1|3754414_3756628_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_019247175.1|3756704_3757856_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_010931555.1|3757965_3759165_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_003821334.1|3759168_3760026_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_003813843.1|3760062_3760941_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_010930179.1|3761934_3762885_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929827.1|3763001_3764069_+	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_010929828.1|3764144_3767273_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_023853155.1|3767780_3768746_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_010929830.1|3768748_3769420_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_010929831.1|3769576_3770536_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_003821340.1|3770543_3771206_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_005013747.1|3771202_3772153_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929956.1|3772251_3773202_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931442.1|3773876_3774128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247789.1|3774190_3774673_+	hypothetical protein	NA	A0A2H4JE38	uncultured_Caudovirales_phage	37.1	1.8e-13
WP_010931440.1|3774674_3774875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931439.1|3774874_3775270_+	hypothetical protein	NA	A0A2D2W284	Stenotrophomonas_phage	35.0	7.8e-07
WP_010931438.1|3775266_3775665_+	hypothetical protein	NA	I6PCW1	Cronobacter_phage	38.0	4.2e-16
WP_010931437.1|3775661_3776084_+	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_010931436.1|3776091_3776592_+	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	45.1	4.4e-31
WP_010931435.1|3776846_3777365_+|tail	phage tail protein	tail	A0A1S5R1H0	Pseudomonas_phage	38.3	5.4e-24
WP_003813412.1|3777374_3777704_+|tail	phage tail assembly chaperone	tail	A0A2H4J121	uncultured_Caudovirales_phage	44.0	2.9e-15
WP_010931434.1|3777721_3778012_+	DUF1799 domain-containing protein	NA	A0A2H4JBP7	uncultured_Caudovirales_phage	45.2	3.7e-14
WP_010931433.1|3778037_3780650_+|tail	phage tail tape measure protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	38.6	4.9e-105
WP_010931432.1|3780659_3781019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931431.1|3781086_3781620_+	DUF1833 family protein	NA	A5A3Q9	Burkholderia_phage	46.9	1.1e-40
WP_010931430.1|3781616_3782006_+	C40 family peptidase	NA	A0A0G3EYJ9	Achromobacter_phage	50.0	3.0e-35
WP_010931429.1|3781998_3785955_+	DUF1983 domain-containing protein	NA	A0A0B5A1N2	Achromobacter_phage	40.8	3.9e-215
>prophage 30
NZ_CP022361	Bordetella pertussis strain B199 chromosome, complete genome	4314502	3974051	4032265	4314502	protease,tRNA,transposase	Prochlorococcus_phage(11.11%)	55	NA	NA
WP_010929873.1|3974051_3974990_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-09
WP_010929872.1|3975012_3975639_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_003818481.1|3975635_3976292_-	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_010929871.1|3976288_3976891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929870.1|3976897_3977485_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	23.3	1.1e-07
WP_010929869.1|3977665_3978235_+	bacterioferritin	NA	NA	NA	NA	NA
WP_003807313.1|3978305_3979625_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_003807315.1|3979731_3979923_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_010929868.1|3980174_3981464_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_010929867.1|3981618_3982614_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003807322.1|3982698_3983373_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013747.1|3983369_3984320_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003816336.1|3984481_3985723_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.2	4.0e-25
WP_010929866.1|3985719_3986664_+	arginase	NA	A0A0N9R043	Chrysochromulina_ericina_virus	33.3	9.5e-27
WP_005012067.1|3986782_3987733_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023853484.1|3987692_3988622_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003807759.1|3988675_3989011_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_010929865.1|3989055_3989820_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010929864.1|3989843_3990584_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929863.1|3990591_3992145_-	acyl--CoA ligase	NA	A0A2K9L3I8	Tupanvirus	22.6	1.5e-13
WP_010929862.1|3992179_3993157_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_023853476.1|3993429_3994011_-	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_100208399.1|3994062_4000965_-	autotransporter BatB	NA	NA	NA	NA	NA
WP_003807750.1|4001411_4001543_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_010929858.1|4001808_4002015_-	DUF3596 domain-containing protein	NA	NA	NA	NA	NA
WP_010929857.1|4003019_4003679_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_010929856.1|4003706_4004852_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_003807743.1|4004992_4005328_+	YegP family protein	NA	NA	NA	NA	NA
WP_010929855.1|4005402_4006263_-	hypothetical protein	NA	A0A2C9D0H9	Yersinia_phage	53.6	1.7e-51
WP_010929854.1|4006526_4007228_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_003807740.1|4007397_4007793_+	RidA family protein	NA	NA	NA	NA	NA
WP_005013747.1|4007902_4008853_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_004566083.1|4008912_4009473_+	5'-3'-deoxyribonucleotidase	NA	A0A1E1EUN3	Acanthamoeba_castellanii_mimivirus	30.8	3.2e-14
WP_004566082.1|4010975_4011857_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929725.1|4011970_4013173_+	MFS transporter	NA	NA	NA	NA	NA
WP_003819105.1|4013301_4015161_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_003819104.1|4015238_4016048_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010929724.1|4016118_4017120_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_003807710.1|4017151_4018012_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010929723.1|4018211_4019216_+	alpha/beta hydrolase	NA	A0A2L2DMU8	Acanthamoeba_polyphaga_mimivirus	31.5	7.5e-30
WP_003819100.1|4019212_4020799_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003807706.1|4020807_4021734_+	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_003807705.1|4021756_4022383_+	FMN-binding negative transcriptional regulator	NA	NA	NA	NA	NA
WP_005015810.1|4022481_4023432_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014906092.1|4023428_4024565_-	trypsin-like peptidase domain-containing protein	NA	W5SAB9	Pithovirus	31.2	1.2e-07
WP_010927226.1|4024618_4025395_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_010929721.1|4025419_4025878_-	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_003815815.1|4026017_4026659_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_003815816.1|4026723_4028106_+	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_019247426.1|4028125_4028980_+	cytochrome c1	NA	NA	NA	NA	NA
WP_003815819.1|4029138_4029750_+	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003815821.1|4029759_4030209_+|protease	ClpXP protease specificity-enhancing factor	protease	NA	NA	NA	NA
WP_010929719.1|4030727_4030868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929718.1|4030875_4031037_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_005012067.1|4031314_4032265_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP022361	Bordetella pertussis strain B199 chromosome, complete genome	4314502	4042881	4096452	4314502	tRNA,transposase	uncultured_Caudovirales_phage(20.0%)	45	NA	NA
WP_005012067.1|4042881_4043832_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929711.1|4044562_4045543_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929710.1|4045556_4046681_+	CoA transferase	NA	NA	NA	NA	NA
WP_003814321.1|4046688_4048443_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_010929709.1|4048549_4049449_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814324.1|4049513_4050497_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_010929708.1|4050632_4051613_+	AEC family transporter	NA	NA	NA	NA	NA
WP_010929707.1|4051629_4053021_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_010929706.1|4053172_4053709_+|tRNA	bifunctional alanine racemase/tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_019247543.1|4053639_4055025_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	30.3	4.5e-17
WP_003814332.1|4055167_4055806_-	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_033461782.1|4055892_4057782_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	32.8	2.5e-79
WP_003814337.1|4057778_4058720_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003814339.1|4058825_4059875_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.6	5.6e-68
WP_010929704.1|4060127_4060829_+	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
WP_010929703.1|4060825_4061524_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_010929702.1|4061524_4062880_+	polynucleotide adenylyltransferase PcnB	NA	A0A1B1IVF3	uncultured_Mediterranean_phage	36.8	3.4e-25
WP_010929701.1|4062876_4063368_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003814351.1|4063386_4064343_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003814355.1|4065753_4067856_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_003814356.1|4068026_4069070_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003814358.1|4069113_4069857_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814363.1|4070878_4071289_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_010929700.1|4072238_4073036_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005012808.1|4073134_4074085_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_039251057.1|4074057_4074999_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|4074995_4075946_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929681.1|4076060_4077062_-	HindIII family type II restriction endonuclease	NA	NA	NA	NA	NA
WP_010929682.1|4077152_4077719_-	preprotein translocase subunit SecD	NA	NA	NA	NA	NA
WP_010929683.1|4078037_4079951_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_010929684.1|4079992_4081423_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_019247308.1|4081535_4082948_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_003818947.1|4082964_4083660_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|4083878_4084829_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931680.1|4085375_4086638_-	CoA transferase	NA	NA	NA	NA	NA
WP_003819309.1|4086695_4087475_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010931679.1|4087471_4088479_-	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
WP_003808010.1|4088652_4089339_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023853488.1|4089419_4090181_-	nitroreductase	NA	M1I6Q5	Acanthocystis_turfacea_Chlorella_virus	31.0	2.0e-19
WP_010931677.1|4090177_4091002_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_019247370.1|4091003_4091870_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931675.1|4091994_4093407_-	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_010931674.1|4093446_4094601_-	CoA transferase	NA	NA	NA	NA	NA
WP_077274100.1|4094590_4095613_-	CoA transferase	NA	NA	NA	NA	NA
WP_010929577.1|4095501_4096452_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 32
NZ_CP022361	Bordetella pertussis strain B199 chromosome, complete genome	4314502	4215735	4283162	4314502	protease,transposase	uncultured_Mediterranean_phage(20.0%)	51	NA	NA
WP_005012067.1|4215735_4216686_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931563.1|4216682_4217873_-	voltage-gated potassium channel protein	NA	NA	NA	NA	NA
WP_010931562.1|4217994_4218759_-	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_003807735.1|4218845_4219949_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_010930525.1|4220140_4221157_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003815102.1|4221438_4221927_+	D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	34.1	1.6e-17
WP_003817656.1|4223270_4223951_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	34.8	3.5e-15
WP_010931560.1|4224012_4224864_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_010931559.1|4224860_4225658_-	thiazole synthase	NA	NA	NA	NA	NA
WP_010931558.1|4225761_4226655_-	cobalamin-binding protein	NA	NA	NA	NA	NA
WP_102970361.1|4226666_4228556_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	30.8	7.6e-07
WP_010931556.1|4228892_4232666_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	50.8	8.6e-10
WP_005012067.1|4232662_4233613_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|4233711_4234662_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929826.1|4234970_4235663_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	41.6	6.3e-36
WP_003818232.1|4236036_4236537_-	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_023853391.1|4236643_4237564_+	bestrophin	NA	NA	NA	NA	NA
WP_010929823.1|4237580_4238057_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929822.1|4238150_4240001_+	biosynthetic-type acetolactate synthase large subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	30.4	2.2e-59
WP_010929821.1|4240056_4240815_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010929820.1|4240842_4242276_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003818225.1|4242349_4243129_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010929819.1|4243141_4243975_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_020699616.1|4243983_4244754_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.9	8.1e-24
WP_010929818.1|4244753_4245818_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929817.1|4245969_4248597_-	DNA topoisomerase III	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	25.4	6.1e-23
WP_010929816.1|4248660_4251282_+	GDYXXLXY domain-containing protein	NA	NA	NA	NA	NA
WP_003815964.1|4252209_4252668_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_010929815.1|4252946_4255190_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_010929814.1|4255386_4257411_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_019248007.1|4257534_4258497_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_010929812.1|4258708_4259848_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_010929811.1|4259870_4260836_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_004565905.1|4261031_4262222_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.7	4.4e-21
WP_003815955.1|4262235_4262481_+	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
WP_010929810.1|4262509_4264531_-	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_003815953.1|4264577_4266185_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	57.3	5.4e-22
WP_010929808.1|4266285_4267455_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_005013747.1|4270336_4271287_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929699.1|4271443_4271767_+	phosphate starvation-inducible protein	NA	NA	NA	NA	NA
WP_023853200.1|4271871_4272912_-	cyclase family protein	NA	NA	NA	NA	NA
WP_010929697.1|4272917_4273697_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_003807672.1|4273742_4274039_-	YciI family protein	NA	NA	NA	NA	NA
WP_003807674.1|4274064_4274340_-	muconolactone Delta-isomerase	NA	NA	NA	NA	NA
WP_003819086.1|4274396_4275041_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_010929696.1|4275040_4275727_-	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_010929695.1|4275856_4276708_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929694.1|4276758_4277484_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010929693.1|4277515_4278865_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
WP_010929692.1|4278976_4279909_-	3-hydroxyacyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_033454003.1|4280366_4283162_-|protease	serine protease autotransporter SphB1	protease	NA	NA	NA	NA
