The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 2
NZ_CP025985	Ralstonia solanacearum strain RSCM chromosome, complete genome	3788542	204809	216499	3788542	integrase,transposase	Leptospira_phage(50.0%)	8	197811:197827	220289:220305
197811:197827	attL	GCCGGCCAGCAGCTTCG	NA	NA	NA	NA
WP_103025505.1|204809_205274_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_103025506.1|205273_205624_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.3	7.1e-20
WP_071624213.1|205655_207227_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.2	1.3e-73
WP_103025507.1|207294_208425_-|integrase	site-specific integrase	integrase	A0A1S6L1B6	Ralstonia_phage	36.1	1.4e-45
WP_038938784.1|210080_211094_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_103025508.1|211734_212969_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	79.5	2.8e-127
WP_103025509.1|213315_214158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011003443.1|215167_216499_+|transposase	IS701-like element ISRso17 family transposase	transposase	NA	NA	NA	NA
220289:220305	attR	GCCGGCCAGCAGCTTCG	NA	NA	NA	NA
>prophage 3
NZ_CP025985	Ralstonia solanacearum strain RSCM chromosome, complete genome	3788542	219716	284010	3788542	capsid,portal,terminase,head,tail,transposase	Acidithiobacillus_phage(53.66%)	64	NA	NA
WP_103025512.1|219716_220187_-	hypothetical protein	NA	K4I1C7	Acidithiobacillus_phage	54.8	3.2e-39
WP_103025513.1|220183_220558_-	site-specific recombinase resolvase	NA	K4HZX2	Acidithiobacillus_phage	62.2	3.3e-39
WP_103025514.1|220554_221943_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	82.3	3.9e-218
WP_103025515.1|221939_222389_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	71.6	1.1e-54
WP_082240025.1|222388_222607_-	hypothetical protein	NA	K4HZ94	Acidithiobacillus_phage	55.6	3.2e-10
WP_103025516.1|223316_225554_-	hypothetical protein	NA	K4I1D0	Acidithiobacillus_phage	66.5	2.7e-290
WP_103025517.1|225603_226065_-	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	62.1	5.8e-46
WP_071508479.1|226293_226557_+	DNA-binding protein	NA	K4I3X3	Acidithiobacillus_phage	67.9	1.8e-20
WP_103025518.1|226567_227050_+	hypothetical protein	NA	K4HZ96	Acidithiobacillus_phage	59.4	1.4e-45
WP_103025519.1|227046_227907_+	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	71.4	6.5e-107
WP_103025520.1|227903_228545_+	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	73.3	3.0e-80
WP_043885967.1|228552_229029_+	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	65.6	1.5e-52
WP_058907375.1|229028_229766_+	hypothetical protein	NA	K4HZA0	Acidithiobacillus_phage	77.0	6.4e-111
WP_058907374.1|229762_230023_+	hypothetical protein	NA	K4I1D6	Acidithiobacillus_phage	76.8	8.4e-18
WP_058907373.1|230019_232308_+	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	63.1	1.2e-285
WP_103025521.1|232438_232903_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	66.9	2.9e-53
WP_011003115.1|232904_233114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025522.1|233106_233490_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
WP_011003113.1|233544_233811_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_016725630.1|233810_234110_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_071654065.1|234063_234279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025524.1|234660_236049_+	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	61.9	1.1e-164
WP_103025525.1|236045_237314_+	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	79.1	5.0e-196
WP_011003873.1|237321_237978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058908873.1|238231_238597_-	hypothetical protein	NA	A0A2H4JI44	uncultured_Caudovirales_phage	58.0	6.5e-32
WP_089190869.1|238821_239010_-	hypothetical protein	NA	K4HZY7	Acidithiobacillus_phage	64.2	1.0e-12
WP_069079339.1|239106_239457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103025526.1|239584_240079_-	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	56.3	7.0e-21
WP_103025527.1|240175_240712_+	elements of external origin	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	82.0	3.5e-74
WP_103025850.1|240714_242694_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	86.0	0.0e+00
WP_103025528.1|242737_243247_+	hypothetical protein	NA	A0A2I6PHW5	Pseudomonas_phage	42.0	1.4e-21
WP_103025529.1|243257_243650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020833008.1|243650_243872_+	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	57.5	1.3e-11
WP_103025530.1|243871_245419_+|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	57.1	7.3e-149
WP_103025531.1|245428_246679_+	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	41.1	5.1e-60
WP_071653952.1|246688_247066_+|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	48.0	6.7e-24
WP_103025532.1|247072_248077_+|capsid	major capsid protein	capsid	A0A1B2LRS0	Wolbachia_phage	67.5	2.1e-109
WP_103025533.1|248079_248382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025534.1|248387_248834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058908386.1|248959_249733_+	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	43.6	3.1e-47
WP_016723647.1|249741_250137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025851.1|250133_250355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025535.1|250329_250974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025536.1|251016_251304_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_020832996.1|251489_252956_-	type III secretion system YopJ family effector PopP2	NA	NA	NA	NA	NA
WP_103025852.1|253565_254693_+	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	53.4	1.3e-99
WP_103025537.1|254758_258862_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	27.5	1.3e-24
WP_103025538.1|258867_259263_+	hypothetical protein	NA	A0A0M4UTA7	Ralstonia_phage	53.0	1.4e-32
WP_103025539.1|259263_262854_+	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	53.5	0.0e+00
WP_103025540.1|262865_264032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025541.1|264035_264518_+	hypothetical protein	NA	A0A0M4TU90	Ralstonia_phage	42.7	2.6e-12
WP_064820726.1|264514_264913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025542.1|264917_266762_+	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	46.5	8.2e-107
WP_064047651.1|266771_266996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003270772.1|267062_267353_+	membrane protein	NA	K4I011	Acidithiobacillus_phage	47.6	3.1e-13
WP_020832987.1|267349_267826_+	hypothetical protein	NA	K4ICR8	Acidithiobacillus_phage	85.9	1.4e-71
WP_043897848.1|267822_268284_+	lysozyme	NA	K4I410	Acidithiobacillus_phage	83.0	7.8e-67
WP_071615616.1|268351_268648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043897899.1|269677_269995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043897662.1|270275_270614_-	DUF1484 domain-containing protein	NA	NA	NA	NA	NA
WP_081365912.1|271921_272134_-	HrgA protein	NA	NA	NA	NA	NA
WP_103025543.1|272491_282034_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	36.1	2.1e-36
WP_139274337.1|282030_282603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025544.1|282759_284010_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.2	1.2e-40
>prophage 4
NZ_CP025985	Ralstonia solanacearum strain RSCM chromosome, complete genome	3788542	288839	356265	3788542	protease,transposase	Burkholderia_phage(16.67%)	49	NA	NA
WP_087451503.1|288839_289644_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_021156161.1|290177_291983_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_028861115.1|292161_292740_-	adenylyl-sulfate kinase	NA	A0A2P1ELS9	Moumouvirus	38.7	4.5e-19
WP_058908714.1|292736_293639_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_081049985.1|293651_294815_-	glycosyl transferase family 8	NA	NA	NA	NA	NA
WP_058908712.1|297076_300121_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_011003050.1|300285_300981_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_058908711.1|301046_302978_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_058908710.1|303305_304436_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_058908709.1|304476_305754_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011003046.1|306039_306876_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_020831502.1|307368_308697_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_011003045.1|308750_308954_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	63.6	2.1e-16
WP_019718985.1|309281_309488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016724430.1|310075_311254_+	antibiotic hydrolase	NA	NA	NA	NA	NA
WP_016724429.1|311690_312527_+	cytochrome c	NA	NA	NA	NA	NA
WP_103025546.1|314595_315582_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	82.3	2.2e-151
WP_058908555.1|316106_316949_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_058908554.1|317166_319290_-	tryptophan 2-monooxygenase oxidoreductase	NA	NA	NA	NA	NA
WP_011003039.1|320030_320462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016724425.1|321504_321846_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016724424.1|322157_322436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025547.1|322435_323584_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011003035.1|323711_324104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021154951.1|324434_325340_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_103025548.1|325393_326773_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.4	1.8e-13
WP_058908552.1|327088_327688_+	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
WP_016724421.1|327944_328499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028853785.1|328543_329530_+|protease	serine protease	protease	A0A0F6R5W6	Sinorhizobium_phage	30.0	1.4e-07
WP_011003029.1|329919_330399_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019718973.1|330668_331457_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	28.1	5.7e-09
WP_058908557.1|331792_334741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028853783.1|334862_336848_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.5	2.7e-15
WP_016724416.1|336869_337670_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_058908551.1|337891_339145_-	MFS transporter	NA	NA	NA	NA	NA
WP_016724414.1|339335_339884_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_058908550.1|339963_340593_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020832947.1|340696_341692_-	2-hydroxyacid dehydrogenase	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	44.3	1.8e-60
WP_011003020.1|341756_342782_-	alcohol dehydrogenase AdhP	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	28.3	4.3e-33
WP_058908549.1|342849_344763_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_058908548.1|345013_346534_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_058908547.1|346617_348012_+	ethanolamine ammonia-lyase subunit EutB	NA	NA	NA	NA	NA
WP_058908546.1|348020_348833_+	ethanolamine ammonia-lyase subunit EutC	NA	NA	NA	NA	NA
WP_016724407.1|348859_350329_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_086004961.1|350610_351728_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.0	2.0e-47
WP_139274372.1|352044_352380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016723619.1|352950_353916_-|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_103025549.1|353982_355065_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_103025546.1|355278_356265_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	82.3	2.2e-151
>prophage 5
NZ_CP025985	Ralstonia solanacearum strain RSCM chromosome, complete genome	3788542	402419	442146	3788542	capsid,portal,terminase,head,tail,plate,holin,transposase,integrase	Ralstonia_virus(52.08%)	53	399236:399281	442200:442245
399236:399281	attL	TTGGCGCGCCCGGCTGGGATCGAACCAGCAACCCCTGCCTTCGGAG	NA	NA	NA	NA
WP_020832917.1|402419_402830_+	PAAR domain-containing protein	NA	A4PE23	Ralstonia_virus	99.2	2.0e-66
WP_021155085.1|402831_403335_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	98.8	1.0e-91
WP_103025853.1|403344_404277_+	hypothetical protein	NA	A4PE25	Ralstonia_virus	98.7	3.3e-165
WP_052331361.1|404186_405002_+	hypothetical protein	NA	A4PE26	Ralstonia_virus	97.4	1.3e-152
WP_103025556.1|404986_406093_-|portal	phage portal protein	portal	A4PE27	Ralstonia_virus	97.0	9.0e-210
WP_103025557.1|406089_407871_-|terminase	terminase ATPase subunit family protein	terminase	A0A077K8Q7	Ralstonia_phage	98.0	0.0e+00
WP_103025558.1|408012_408852_+|capsid	GPO family capsid scaffolding protein	capsid	A4PE29	Ralstonia_virus	95.7	3.4e-145
WP_011001874.1|408905_409922_+|capsid	phage major capsid protein, P2 family	capsid	A0A077KEQ8	Ralstonia_phage	100.0	4.7e-189
WP_089190560.1|409918_410641_+|terminase	terminase endonuclease subunit	terminase	A0A077K804	Ralstonia_phage	99.6	1.1e-126
WP_011001872.1|410737_411217_+|head	head completion/stabilization protein	head	A4PE32	Ralstonia_virus	100.0	2.3e-85
WP_011001871.1|411216_411423_+|tail	tail protein X	tail	A0A077K8R0	Ralstonia_phage	100.0	1.8e-31
WP_015985092.1|411438_411843_+	phage-related protein	NA	A0A077K9X1	Ralstonia_phage	100.0	2.8e-28
WP_103025559.1|411839_412154_+|holin	phage holin family protein	holin	A4PE35	Ralstonia_virus	96.1	1.1e-48
WP_103025560.1|412150_412957_+	DUF3380 domain-containing protein	NA	A4PE36	Ralstonia_virus	98.5	2.7e-147
WP_103025561.1|412953_413454_+	hypothetical protein	NA	A0A077K9R7	Ralstonia_phage	98.8	2.1e-81
WP_015985096.1|413450_413885_+|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	100.0	2.9e-79
WP_103025562.1|413881_414328_+	phage virion morphogenesis protein	NA	A0A077K9X5	Ralstonia_phage	85.7	3.3e-62
WP_103025563.1|414499_415414_+	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	27.5	1.9e-11
WP_103025546.1|415538_416525_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	82.3	2.2e-151
WP_103025564.1|416938_417604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025565.1|417607_418858_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.2	1.2e-40
WP_103025566.1|419182_419800_+|plate	phage baseplate assembly protein V	plate	A0A077K9S0	Ralstonia_phage	95.1	5.9e-110
WP_103025567.1|419796_420144_+|plate	baseplate assembly protein	plate	A0A077K8R5	Ralstonia_phage	98.2	1.6e-56
WP_103025568.1|420146_421055_+|plate	baseplate assembly protein	plate	A0A077K9X9	Ralstonia_phage	95.7	8.0e-156
WP_023470164.1|421047_421665_+|tail	phage tail protein I	tail	A0A077KER5	Ralstonia_phage	96.2	1.5e-100
WP_103025569.1|421671_423336_+|tail	phage tail protein	tail	A0A077K818	Ralstonia_phage	94.6	2.1e-303
WP_103025570.1|423348_424101_+|tail	phage tail protein	tail	A4PE47	Ralstonia_virus	95.2	1.2e-125
WP_103025571.1|424097_424562_+	hypothetical protein	NA	A0A077K8R9	Ralstonia_phage	92.9	2.8e-80
WP_103025572.1|424655_425831_+|tail	phage tail sheath protein	tail	A0A077K9Y4	Ralstonia_phage	97.4	7.0e-221
WP_103025573.1|425862_426372_+|tail	phage major tail tube protein	tail	A0A077KER7	Ralstonia_phage	87.0	7.3e-82
WP_103025854.1|426447_426774_+|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	97.2	4.0e-49
WP_003267618.1|426770_426872_+|tail	GpE family phage tail protein	tail	A0A077K821	Ralstonia_phage	93.9	2.7e-09
WP_103025574.1|426868_429532_+|tail	phage tail protein	tail	A4PE52	Ralstonia_virus	95.6	0.0e+00
WP_103025575.1|429534_429957_+|tail	phage tail protein	tail	A4PE53	Ralstonia_virus	97.9	8.8e-73
WP_103025576.1|429953_431081_+	phage late control D family protein	NA	A4PE54	Ralstonia_virus	96.5	4.1e-202
WP_071615623.1|431393_431603_+	Com family DNA-binding transcriptional regulator	NA	A0A1S5NPS9	Burkholderia_phage	70.4	2.4e-15
WP_021155111.1|431553_432336_+	site-specific DNA-methyltransferase	NA	A0A1S5NPU0	Burkholderia_phage	67.8	2.4e-92
WP_016727351.1|433156_433579_-	helix-turn-helix domain-containing protein	NA	A4PE57	Ralstonia_virus	100.0	6.7e-73
WP_071615658.1|433654_433855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016727352.1|433874_434066_+	hypothetical protein	NA	E5E3U0	Burkholderia_phage	50.9	3.4e-08
WP_015985115.1|434094_434289_+	hypothetical protein	NA	A4PE59	Ralstonia_virus	100.0	1.8e-25
WP_015985116.1|434285_434534_+	ogr/Delta-like zinc finger family protein	NA	A4PE60	Ralstonia_virus	100.0	1.0e-41
WP_015985117.1|434648_435203_+	Bro-N domain-containing protein	NA	A4PE61	Ralstonia_virus	100.0	1.2e-98
WP_015985118.1|435212_435446_+	hypothetical protein	NA	A4PE62	Ralstonia_virus	100.0	1.5e-34
WP_015985120.1|435603_435810_+	hypothetical protein	NA	A4PE64	Ralstonia_virus	100.0	6.4e-29
WP_015985121.1|435809_436046_+	hypothetical protein	NA	A4PE65	Ralstonia_virus	100.0	2.1e-39
WP_023470166.1|436038_436251_+	hypothetical protein	NA	A4PE66	Ralstonia_virus	94.3	2.3e-29
WP_016725459.1|436270_436579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025577.1|436580_436802_+	hypothetical protein	NA	A4PE67	Ralstonia_virus	94.5	7.1e-34
WP_103025578.1|437189_439967_+	hypothetical protein	NA	A4PE69	Ralstonia_virus	85.9	0.0e+00
WP_158655367.1|439953_440127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158655368.1|440842_441190_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_103025581.1|441057_442146_+|integrase	site-specific integrase	integrase	A4PE72	Ralstonia_virus	77.9	2.1e-158
442200:442245	attR	TTGGCGCGCCCGGCTGGGATCGAACCAGCAACCCCTGCCTTCGGAG	NA	NA	NA	NA
>prophage 6
NZ_CP025985	Ralstonia solanacearum strain RSCM chromosome, complete genome	3788542	553339	616073	3788542	integrase,protease,transposase	uncultured_Mediterranean_phage(20.0%)	59	608716:608732	623624:623640
WP_020831502.1|553339_554668_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_011002881.1|554800_557206_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_011002880.1|557658_558729_+	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_011002879.1|558742_559375_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_020832821.1|559377_560037_+	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_011002877.1|560033_560579_+	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_011002876.1|560575_562720_+	type IV pilus secretin PilQ	NA	R9TEZ5	Vibrio_phage	26.4	5.2e-20
WP_103025586.1|562894_563434_+	shikimate kinase	NA	NA	NA	NA	NA
WP_019718894.1|563430_564537_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_058907609.1|564556_565720_+	deoxyguanosinetriphosphate triphosphohydrolase	NA	NA	NA	NA	NA
WP_011002872.1|565869_566544_-	OmpW family protein	NA	NA	NA	NA	NA
WP_019718892.1|566810_567536_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_058907608.1|567786_572535_+	glutamate synthase subunit alpha	NA	NA	NA	NA	NA
WP_011002869.1|572663_574127_+	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_028853722.1|574282_575317_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_011002867.1|575553_576393_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.3	7.4e-15
WP_011002866.1|576389_577157_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_011002865.1|577185_577707_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_011002864.1|577710_578520_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_011002863.1|578674_579310_+	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_028853721.1|579376_579691_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_016725133.1|579925_580891_+	ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	33.3	9.5e-22
WP_016725132.1|580887_581676_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011002859.1|581732_581969_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_103025856.1|582060_583326_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016725130.1|583344_584046_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011002857.1|584042_585371_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_011002856.1|585387_586512_+	histidinol-phosphate transaminase	NA	A0A0H3TLT9	Faustovirus	25.4	3.3e-10
WP_011002855.1|586508_587099_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_011002854.1|587154_587778_+	NAAT family transporter	NA	NA	NA	NA	NA
WP_016725127.1|587774_588428_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_011002852.1|588503_589247_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_028853716.1|589313_590087_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_011002850.1|590089_590512_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_011002849.1|590504_590879_+	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_011002848.1|590925_591300_+	membrane protein	NA	NA	NA	NA	NA
WP_011002847.1|591361_591619_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_011002846.1|591640_592159_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_011002845.1|592215_593019_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.8	2.5e-28
WP_011002844.1|593102_594179_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	5.2e-29
WP_103025587.1|594171_595983_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_058907607.1|596067_597165_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_028861031.1|597282_598785_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_011002840.1|598781_599489_-	response regulator	NA	NA	NA	NA	NA
WP_016724686.1|599583_600726_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011002838.1|601061_602201_+	porin	NA	NA	NA	NA	NA
WP_011002837.1|602658_603870_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	33.6	1.2e-10
WP_011002836.1|603889_604636_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_003263430.1|604649_605075_-	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_011002835.1|605320_605929_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_020832800.1|605931_607335_+	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_011002833.1|607361_608108_+	cytochrome c1	NA	NA	NA	NA	NA
WP_011002832.1|608255_608867_+	transcription modulator protein	NA	NA	NA	NA	NA
608716:608732	attL	TGGCGATCGCGCCGCTG	NA	NA	NA	NA
WP_011002831.1|608925_609423_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	47.6	8.6e-19
WP_103025857.1|609625_610672_+|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	38.4	8.6e-53
WP_103025588.1|610725_610941_-	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_086004961.1|611088_612206_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.0	2.0e-47
WP_103025858.1|613684_613939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025859.1|614621_616073_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
623624:623640	attR	CAGCGGCGCGATCGCCA	NA	NA	NA	NA
>prophage 7
NZ_CP025985	Ralstonia solanacearum strain RSCM chromosome, complete genome	3788542	630657	662961	3788542	transposase	Burkholderia_phage(30.0%)	30	NA	NA
WP_016723619.1|630657_631623_-|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_011000174.1|631778_633005_-	MFS transporter	NA	NA	NA	NA	NA
WP_058908322.1|633066_634095_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011000172.1|634316_635219_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011000171.1|635681_637205_-	thymidine phosphorylase	NA	NA	NA	NA	NA
WP_016722500.1|637227_637506_-	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_016722501.1|637558_638521_-	ribose-phosphate pyrophosphokinase	NA	NA	NA	NA	NA
WP_011000168.1|638523_639882_-	MBL fold metallo-hydrolase	NA	Q331V3	Clostridium_botulinum_C_phage	29.8	3.1e-18
WP_011000167.1|639897_640320_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_103025591.1|641560_642085_+	cytochrome b	NA	NA	NA	NA	NA
WP_011000165.1|642113_642755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025478.1|642798_643601_-|transposase	IS5-like element IS1421 family transposase	transposase	NA	NA	NA	NA
WP_020829879.1|643783_644785_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011000164.1|645067_645688_-	cytochrome c4	NA	NA	NA	NA	NA
WP_011000163.1|645723_647064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103025505.1|647350_647815_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_103025506.1|647814_648165_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.3	7.1e-20
WP_071624213.1|648196_649768_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.2	1.3e-73
WP_103025592.1|650603_653570_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.7	0.0e+00
WP_103025593.1|653729_654020_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_103025594.1|654016_654388_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_103025595.1|654384_654852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025596.1|654845_655403_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.5	1.1e-59
WP_158655369.1|655444_655603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025597.1|655619_655859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025598.1|656207_657449_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	57.1	1.8e-129
WP_103025599.1|657445_657892_-	DNA mismatch endonuclease Vsr	NA	E5E3X5	Burkholderia_phage	77.7	2.6e-67
WP_103025860.1|657891_659157_-	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	85.3	1.5e-221
WP_158655370.1|659288_659696_-	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_103025601.1|659946_662961_-	conjugative relaxase	NA	V5UQN3	Mycobacterium_phage	28.5	3.5e-06
>prophage 8
NZ_CP025985	Ralstonia solanacearum strain RSCM chromosome, complete genome	3788542	875815	1012215	3788542	tRNA,transposase,integrase	uncultured_Mediterranean_phage(17.65%)	107	943309:943368	982857:984175
WP_016723738.1|875815_878449_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.8	6.9e-176
WP_011002650.1|878488_878998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058908285.1|879022_880099_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_011002648.1|880176_881457_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	3.0e-84
WP_011002647.1|881527_881950_+	CopD family protein	NA	NA	NA	NA	NA
WP_011002646.1|881971_883387_+	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_019718258.1|883411_884422_-	response regulator	NA	NA	NA	NA	NA
WP_011002644.1|884483_885608_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_011002643.1|885616_886945_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_011002642.1|886958_888362_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011002641.1|888958_889996_-	response regulator	NA	NA	NA	NA	NA
WP_011002640.1|890161_891622_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_011002639.1|891618_891942_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_011002638.1|892013_892376_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_011002637.1|892446_893586_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_058908284.1|893880_895950_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_058908283.1|895952_897095_+	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_103025620.1|897096_898632_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_028853618.1|898628_899795_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_011002632.1|899870_900344_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016723725.1|900477_900984_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011002630.1|900980_902093_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_103025621.1|902181_903783_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_103025859.1|903874_905326_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_058908281.1|905460_906069_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011002627.1|906302_907676_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.0	3.8e-109
WP_058908280.1|907922_908510_+	cytochrome b	NA	NA	NA	NA	NA
WP_016723720.1|908610_909177_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_028853616.1|909234_909831_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_028853615.1|909906_910875_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.7	8.8e-44
WP_103025622.1|910952_912833_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_020832658.1|912954_913290_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	4.0e-12
WP_016723717.1|913395_914547_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	42.1	9.4e-77
WP_058908293.1|914540_915629_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_043876653.1|915705_917898_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_058908292.1|917916_918120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011002617.1|918131_918572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021154756.1|919115_920246_-	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_058908291.1|920387_921329_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_103025623.1|921519_922743_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_058908277.1|922787_924074_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_020832649.1|924433_924895_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_058908276.1|925105_926302_-	amidohydrolase	NA	NA	NA	NA	NA
WP_049832842.1|926782_927982_-	UDP-glucuronosyltransferase	NA	NA	NA	NA	NA
WP_058908804.1|928590_928926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158655374.1|929015_932957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025478.1|932922_933725_-|transposase	IS5-like element IS1421 family transposase	transposase	NA	NA	NA	NA
WP_158655409.1|933623_938312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071624213.1|938456_940028_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.2	1.3e-73
WP_103025506.1|940059_940410_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.3	7.1e-20
WP_103025505.1|940409_940874_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_158655375.1|941141_942131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103025626.1|942114_943101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016724509.1|943032_943311_+|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	60.0	2.6e-17
943309:943368	attL	TGAACCGCCCCGGCTTTCGAGGAGGCTGGTTGGTTTAAGTTGAGACCACTGCAATGGCCT	NA	NA	NA	NA
WP_103025508.1|943342_944577_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	79.5	2.8e-127
WP_020832465.1|944629_945505_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.1	1.3e-94
WP_043885598.1|945660_946518_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_103025627.1|946514_948479_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_043885887.1|948459_949095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103025628.1|949256_949673_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_058908783.1|949856_950201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103025629.1|950197_953368_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_103025630.1|953364_954897_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_103025631.1|954893_956210_-	TolC family protein	NA	NA	NA	NA	NA
WP_103025632.1|956281_956701_-	copper resistance protein	NA	NA	NA	NA	NA
WP_103025633.1|957152_958124_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_103025634.1|958247_959585_+	MFS transporter	NA	NA	NA	NA	NA
WP_103025635.1|959581_960967_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_103025636.1|960987_961737_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_103025637.1|961791_962727_+	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_103025638.1|962758_963838_+	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_103025639.1|963857_964823_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_103025640.1|964873_965704_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_103025864.1|965757_966705_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_103025641.1|966846_967470_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_103025642.1|967535_967844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025643.1|967898_968810_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_103025644.1|968820_969870_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_103025645.1|970028_970640_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_103025549.1|971449_972532_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_086706442.1|972766_974476_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_071653928.1|976152_976977_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_103025508.1|981647_982881_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	79.5	2.8e-127
WP_103025546.1|983469_984456_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	82.3	2.2e-151
982857:984175	attR	AGGCCATTGCAGTGGTCTCAACTTAAACCAACCAGCCTCCTCGAAAGCCGGGGCGGTTCATTCGAGGGCGACCAAAGATGAGTTGCTGAAGGCGAAACTCATCCGAGAACAGAATGTCGTGTTCGTATCGGAAGCCTTTACCTCTCCACCCAACGAAGCGGACATTGAGGACCTACTTGACCCAGATGTCTACGAGGCTCTCGTGCGAGAGAGCTACGCTGCGGAACTGAGGGGCAAGACGTTGACGCTAAACGTAAACATCCCGCGGGTTGCTAAGCGCATTGAAGCGGGATTGGCTGCTCTCGGAATCCCATTTCACAAGACGCGACCGACACGCCTGTTTCTCAAGAAGATGGCATTGGAGCCCGCGAACGTTGTGCCAGATGACAGCCTTACACGATTTGAGACGCTGTTTGCCTTGATCAACGGGCGGCTGGACAAGCATGTTGCTCGAAATGCCACGCCATTCGAAGGCTAGGGAATCGCTGATCAATGAGGTTTGCGCTTGATGTCGCACAAGCCAAGGACCTCGGATTTCGCAATGCGGGAGAGATGGGCCGATTCAAGCCGTTTTTCTCTCGTTTGCGCCCCTTTCCTGGCGCGCTTTGCGCGCTCAGGACGGATTGCTCCCTCCTGAGGCCAACAACAGCTTCCTGGTCAGCACCAGATTCGCCAGACCAAACAGGCTGAACAACTGCGCTGTGTTCTTGGTCAGGCCCTTGTAGCGAACCTTGCGATGACCAAACAGATTCTTAATGACGTGGAACGGATGCTCGACTCGCGCCCGAATCTGGGCCTTGGCCCGCTCGACGGCGATCAGCAAATCCTTGACGACGCCGTCACGCATCGCCTTGATCTTGCCGCGCTTGACGGCCACCTGCCACTTCACGGACTTGCCTTGCATCTCGTCGCGCTTGTCCACGCCCGTGTAGCCCGCATCGCCAAACGCGTGCTCTTCGTGGCCATGCAGCAAGGCGTGCGCTTGCGACACATCCGACTCGTTGGCCGCGGTGCCCACCACGCTGTGTACCAGCCCGGACGCCGCATCCACGCCGAGATGGGCCTTCATCCCAAAGTGCCAGGCATTTCCCTTCTTCGTCTGGTGCATCTCCGGGTCGCGGCTCTTCTCCTTGTTCTTGGTCGAAGGTGGCGCCTCGATGATGGTGGCATCCACAATCGTGCCTTCCTTCATCATCAGCCCCCGCTCGCACAGCATGATGCCGATCTCGTCGAACAGCTTGCGCGTCAGTTCATGCTCGACGAGCAGGCGGCGAAACTTCAGCAGCGTGGTCGCGTCTGGCACCGCTTCGACTGCCAGG	NA	NA	NA	NA
WP_103025549.1|984541_985624_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011003443.1|985825_987157_-|transposase	IS701-like element ISRso17 family transposase	transposase	NA	NA	NA	NA
WP_158655376.1|987218_988175_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_103025647.1|988483_988867_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_103025648.1|988897_989314_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_103025649.1|989506_990565_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016723619.1|990779_991745_+|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_103025650.1|991937_992354_+	DUF1924 domain-containing protein	NA	NA	NA	NA	NA
WP_103025651.1|992401_992893_+	cytochrome C	NA	NA	NA	NA	NA
WP_103025652.1|992864_993596_+	cytochrome B	NA	NA	NA	NA	NA
WP_103025653.1|993627_994302_+	response regulator	NA	NA	NA	NA	NA
WP_103025654.1|994298_995672_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_103025655.1|995865_996792_+	cation transporter	NA	NA	NA	NA	NA
WP_103025656.1|996862_997333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025657.1|997595_998681_+	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_103025658.1|998680_1001794_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.8	9.1e-58
WP_103025659.1|1001790_1003068_+	TolC family protein	NA	NA	NA	NA	NA
WP_103025660.1|1003113_1003638_+	cytochrome b	NA	NA	NA	NA	NA
WP_103025865.1|1003689_1005981_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	28.7	6.7e-50
WP_103025661.1|1006795_1007257_+	universal stress protein	NA	NA	NA	NA	NA
WP_103025662.1|1008049_1008754_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.7	4.2e-35
WP_103025663.1|1008747_1011117_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_103025478.1|1011413_1012215_+|transposase	IS5-like element IS1421 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP025985	Ralstonia solanacearum strain RSCM chromosome, complete genome	3788542	1159995	1217306	3788542	tRNA,transposase	Ralstonia_phage(22.22%)	55	NA	NA
WP_058908220.1|1159995_1160898_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	31.8	8.9e-14
WP_058908219.1|1161002_1163177_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_103025549.1|1163508_1164591_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016723380.1|1164587_1165001_-	bacteriohemerythrin	NA	NA	NA	NA	NA
WP_011000732.1|1165085_1165751_-	DsbA family protein	NA	NA	NA	NA	NA
WP_058908218.1|1165759_1166602_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	37.9	1.8e-13
WP_058908217.1|1166788_1168495_+	long-chain fatty acid--CoA ligase	NA	NA	NA	NA	NA
WP_103025670.1|1168550_1169336_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_028852723.1|1169348_1170095_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_011000738.1|1170606_1170960_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011000739.1|1170997_1171546_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_071624043.1|1171758_1174575_+	DUF2339 domain-containing protein	NA	NA	NA	NA	NA
WP_081049964.1|1174571_1175924_+	DUF3999 domain-containing protein	NA	NA	NA	NA	NA
WP_020831449.1|1175982_1176366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016723370.1|1176410_1176632_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_016723369.1|1176639_1177209_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_011000745.1|1177253_1178996_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	55.7	1.3e-183
WP_058908214.1|1179063_1179417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011000747.1|1179479_1180982_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_011000748.1|1180992_1181478_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_016723368.1|1181690_1182143_-	DUF2214 family protein	NA	NA	NA	NA	NA
WP_103025671.1|1182174_1183395_-	CoA transferase	NA	NA	NA	NA	NA
WP_011000751.1|1183580_1186235_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.7	1.0e-78
WP_021155849.1|1186524_1187631_+	purine nucleoside permease	NA	NA	NA	NA	NA
WP_011000753.1|1187627_1188668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058908211.1|1188905_1191014_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_058908210.1|1191040_1191751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011000756.1|1191760_1192510_-	slipin family protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	31.6	3.9e-23
WP_011000757.1|1192521_1193934_-	nodulation protein NfeD	NA	NA	NA	NA	NA
WP_058908209.1|1194008_1194917_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058908233.1|1195025_1196246_+	MFS transporter	NA	NA	NA	NA	NA
WP_058908208.1|1196328_1197114_+	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_011000761.1|1197126_1197315_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_011000762.1|1197367_1198405_+	low specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_011000763.1|1198423_1199005_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003263554.1|1199044_1199272_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_058908207.1|1199285_1199657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058908206.1|1199667_1200918_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_028860303.1|1200989_1201622_-	LysE family translocator	NA	NA	NA	NA	NA
WP_011000768.1|1202010_1202409_+	RcnB family protein	NA	NA	NA	NA	NA
WP_043897895.1|1202898_1203519_+	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_028860305.1|1203906_1204713_+	endoglucanase	NA	NA	NA	NA	NA
WP_071615352.1|1204727_1204943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063612204.1|1205162_1205762_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058908204.1|1205895_1206624_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_011000775.1|1206644_1206950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025866.1|1207033_1208196_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	51.5	1.1e-80
WP_016723619.1|1208296_1209262_+|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_158655382.1|1209345_1209591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103025867.1|1209987_1210203_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_016723619.1|1210670_1211636_-|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_049800424.1|1212049_1212766_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_058908775.1|1213481_1213721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025549.1|1215073_1216156_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_103025546.1|1216319_1217306_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	82.3	2.2e-151
>prophage 10
NZ_CP025985	Ralstonia solanacearum strain RSCM chromosome, complete genome	3788542	1238029	1284527	3788542	capsid,portal,terminase,head,tail,transposase	Acidithiobacillus_phage(33.33%)	44	NA	NA
WP_086004961.1|1238029_1239146_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.0	2.0e-47
WP_103025508.1|1240178_1241413_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	79.5	2.8e-127
WP_003274149.1|1241797_1242610_-	oxidoreductase	NA	NA	NA	NA	NA
WP_016724993.1|1242764_1243370_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021156149.1|1243791_1244076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021156150.1|1244072_1244570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025673.1|1244566_1245439_+	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	65.7	1.4e-101
WP_016724999.1|1245456_1246089_+	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	61.0	7.2e-63
WP_103025674.1|1246161_1246566_+	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	49.6	1.4e-27
WP_103025675.1|1246571_1246961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064047862.1|1246944_1249242_+	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	72.1	0.0e+00
WP_064047861.1|1249476_1249686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058908853.1|1249675_1250083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025676.1|1250580_1251981_+	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	62.1	8.5e-165
WP_103025525.1|1251977_1253246_+	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	79.1	5.0e-196
WP_103025677.1|1254160_1254466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103025526.1|1255510_1256005_-	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	56.3	7.0e-21
WP_103025527.1|1256101_1256638_+	elements of external origin	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	82.0	3.5e-74
WP_103025850.1|1256640_1258620_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	86.0	0.0e+00
WP_103025528.1|1258663_1259173_+	hypothetical protein	NA	A0A2I6PHW5	Pseudomonas_phage	42.0	1.4e-21
WP_103025529.1|1259183_1259576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020833008.1|1259576_1259798_+	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	57.5	1.3e-11
WP_103025530.1|1259797_1261345_+|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	57.1	7.3e-149
WP_103025531.1|1261354_1262605_+	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	41.1	5.1e-60
WP_071653952.1|1262614_1262992_+|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	48.0	6.7e-24
WP_103025532.1|1262998_1264003_+|capsid	major capsid protein	capsid	A0A1B2LRS0	Wolbachia_phage	67.5	2.1e-109
WP_103025533.1|1264005_1264308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025534.1|1264313_1264760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058908386.1|1264885_1265659_+	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	43.6	3.1e-47
WP_103025678.1|1265667_1266057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020833043.1|1266053_1266275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043885690.1|1266249_1266894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025852.1|1269808_1270936_+	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	53.4	1.3e-99
WP_103025537.1|1271001_1275105_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	27.5	1.3e-24
WP_103025538.1|1275110_1275506_+	hypothetical protein	NA	A0A0M4UTA7	Ralstonia_phage	53.0	1.4e-32
WP_103025539.1|1275506_1279097_+	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	53.5	0.0e+00
WP_103025540.1|1279108_1280275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025541.1|1280278_1280761_+	hypothetical protein	NA	A0A0M4TU90	Ralstonia_phage	42.7	2.6e-12
WP_064820726.1|1280757_1281156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025542.1|1281160_1283005_+	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	46.5	8.2e-107
WP_064047651.1|1283014_1283239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003270772.1|1283305_1283596_+	membrane protein	NA	K4I011	Acidithiobacillus_phage	47.6	3.1e-13
WP_020832987.1|1283592_1284069_+	hypothetical protein	NA	K4ICR8	Acidithiobacillus_phage	85.9	1.4e-71
WP_064820722.1|1284065_1284527_+	lysozyme	NA	K4I410	Acidithiobacillus_phage	81.0	8.7e-66
>prophage 11
NZ_CP025985	Ralstonia solanacearum strain RSCM chromosome, complete genome	3788542	1304841	1386329	3788542	tRNA,transposase	Leptospira_phage(33.33%)	56	NA	NA
WP_071624213.1|1304841_1306413_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.2	1.3e-73
WP_103025506.1|1306444_1306795_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.3	7.1e-20
WP_103025505.1|1306794_1307259_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_089190366.1|1307799_1308297_+	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	38.1	2.0e-20
WP_058908852.1|1308293_1309676_+	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	59.6	7.7e-134
WP_081050001.1|1309708_1310149_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_086004752.1|1310430_1311233_-|transposase	IS5-like element IS1421 family transposase	transposase	NA	NA	NA	NA
WP_103025681.1|1312184_1313108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038938784.1|1313952_1314966_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_103025508.1|1315882_1317117_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	79.5	2.8e-127
WP_028861894.1|1317226_1317979_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_011004625.1|1317975_1318278_+	AzlD family protein	NA	NA	NA	NA	NA
WP_146605472.1|1318370_1318622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103025870.1|1318608_1320279_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_103025549.1|1320511_1321594_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_103025546.1|1321679_1322666_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	82.3	2.2e-151
WP_158655383.1|1322909_1323530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139274363.1|1323535_1323781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071615431.1|1334164_1341703_-	type III effector protein skwp2	NA	NA	NA	NA	NA
WP_058908591.1|1342122_1342653_-	nitrous oxide reductase accessory protein NosL	NA	NA	NA	NA	NA
WP_058908592.1|1342649_1343474_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_019719967.1|1343470_1344415_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.7	1.3e-28
WP_016727950.1|1344398_1345670_-	nitrous oxide reductase family maturation protein NosD	NA	NA	NA	NA	NA
WP_058908596.1|1345666_1348285_-	regulatory protein NosR	NA	NA	NA	NA	NA
WP_103025682.1|1348342_1350283_-	nitrous-oxide reductase	NA	NA	NA	NA	NA
WP_011004617.1|1350511_1350919_+	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_058908594.1|1350923_1351946_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_011004615.1|1352058_1352961_+	acyltransferase	NA	NA	NA	NA	NA
WP_103025546.1|1354399_1355386_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	82.3	2.2e-151
WP_028854566.1|1357024_1357402_+	RidA family protein	NA	NA	NA	NA	NA
WP_058908652.1|1357724_1358207_-	ATPase	NA	NA	NA	NA	NA
WP_019719980.1|1358199_1358535_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_028854564.1|1358784_1359369_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058908651.1|1359481_1360363_+	oxidoreductase	NA	NA	NA	NA	NA
WP_019719983.1|1360806_1361301_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_058908650.1|1361404_1362445_+	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_058908649.1|1362486_1362924_+	RidA family protein	NA	NA	NA	NA	NA
WP_058908648.1|1362968_1363928_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_058908647.1|1364162_1364432_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_058908646.1|1364464_1365631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071615426.1|1365968_1366178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071624213.1|1368091_1369663_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.2	1.3e-73
WP_103025506.1|1369694_1370045_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.3	7.1e-20
WP_103025505.1|1370044_1370509_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_158655384.1|1370579_1370726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158655385.1|1370908_1371238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025684.1|1371600_1373349_-	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_103025685.1|1373345_1375388_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_103025686.1|1375450_1378519_-	N-6 DNA methylase	NA	A0A2R2ZGH5	Clostridioides_phage	23.1	3.2e-15
WP_103025871.1|1378515_1380255_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_101838923.1|1380263_1380458_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_081049931.1|1380981_1382007_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_019718510.1|1382124_1382826_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016722823.1|1382806_1383625_-	FprA family A-type flavoprotein	NA	NA	NA	NA	NA
WP_011002139.1|1383860_1385348_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.7	7.9e-52
WP_058907657.1|1385381_1386329_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
>prophage 12
NZ_CP025985	Ralstonia solanacearum strain RSCM chromosome, complete genome	3788542	1443563	1514055	3788542	transposase	Ralstonia_phage(18.18%)	59	NA	NA
WP_103025549.1|1443563_1444646_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_103025546.1|1444859_1445846_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	82.3	2.2e-151
WP_058907636.1|1446122_1447397_-	oxygen-independent coproporphyrinogen III oxidase-like protein	NA	NA	NA	NA	NA
WP_058907664.1|1447403_1448009_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_016722867.1|1448020_1448737_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_011002087.1|1448831_1449746_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_016722868.1|1449842_1450871_-	serine/threonine protein kinase	NA	M1HP99	Paramecium_bursaria_Chlorella_virus	24.7	2.7e-11
WP_011002085.1|1451015_1451951_+	YicC family protein	NA	NA	NA	NA	NA
WP_011002084.1|1451975_1452641_+	guanylate kinase	NA	A0A223FNL1	NY_014_poxvirus	26.5	6.1e-12
WP_003262123.1|1452771_1452975_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_016722870.1|1453213_1455646_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	35.5	2.8e-14
WP_058907634.1|1456018_1456582_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_103025872.1|1456872_1457274_+	BcpO-related WXXGXW repeat protein	NA	NA	NA	NA	NA
WP_016722872.1|1457376_1457682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058907633.1|1457699_1458731_-	PHB depolymerase family esterase	NA	NA	NA	NA	NA
WP_011002078.1|1459022_1459505_+	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
WP_021155724.1|1460096_1460873_+	L-iditol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_058907632.1|1460877_1461834_+	sugar kinase	NA	NA	NA	NA	NA
WP_058907631.1|1461821_1463177_+	D-tagatose-bisphosphate aldolase, class II, non-catalytic subunit	NA	NA	NA	NA	NA
WP_028860772.1|1463228_1464554_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_103025687.1|1464736_1465537_+|transposase	IS5-like element IS1421 family transposase	transposase	NA	NA	NA	NA
WP_103025688.1|1465531_1466464_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_058907630.1|1466460_1467321_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_011002071.1|1467317_1468016_+	HAD family phosphatase	NA	M1H9H9	Acanthocystis_turfacea_Chlorella_virus	42.7	4.3e-08
WP_016722881.1|1468067_1469177_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.1	3.6e-25
WP_103025689.1|1469299_1472503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103025690.1|1473022_1473463_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_103025691.1|1473475_1473940_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_158655386.1|1474055_1474223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103025508.1|1474290_1475524_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	79.5	2.8e-127
WP_058907661.1|1476805_1477063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139274257.1|1477301_1477571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058907627.1|1477696_1477924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103672917.1|1478151_1479546_+	type III secretion system YopJ family effector RipJ	NA	NA	NA	NA	NA
WP_103025692.1|1480365_1482531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058907623.1|1482751_1484149_+	mannitol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_058907622.1|1484241_1485717_+	xylulokinase	NA	NA	NA	NA	NA
WP_016722893.1|1485778_1486726_+	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_028860762.1|1487073_1488090_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.1	1.5e-46
WP_058907621.1|1488139_1490857_-	aminopeptidase N	NA	NA	NA	NA	NA
WP_011002055.1|1491020_1491662_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_011002054.1|1491954_1494276_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_058907620.1|1494691_1495213_-	2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase	NA	NA	NA	NA	NA
WP_043876629.1|1495209_1496172_-	allantoinase PuuE	NA	NA	NA	NA	NA
WP_058907618.1|1496192_1497617_-	8-oxoguanine deaminase	NA	NA	NA	NA	NA
WP_058907617.1|1497621_1499028_-	purine permease	NA	Q9KX94	Enterobacteria_phage	27.1	3.9e-24
WP_058907616.1|1499120_1499873_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011002047.1|1500239_1500593_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_058907615.1|1500605_1501850_+	urate hydroxylase PuuD	NA	NA	NA	NA	NA
WP_011002045.1|1502072_1502804_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016723619.1|1503441_1504407_+|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_103025693.1|1504592_1505912_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011002043.1|1506048_1507377_+	MFS transporter	NA	NA	NA	NA	NA
WP_011002042.1|1507461_1508370_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_058907171.1|1508369_1509878_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_103025694.1|1509991_1510942_+	drug/metabolite DMT transporter permease	NA	NA	NA	NA	NA
WP_058907173.1|1511158_1512304_+	porin	NA	NA	NA	NA	NA
WP_011002038.1|1512459_1512735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016723619.1|1513089_1514055_-|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
>prophage 13
NZ_CP025985	Ralstonia solanacearum strain RSCM chromosome, complete genome	3788542	1756022	1810131	3788542	transposase	Burkholderia_virus(33.33%)	37	NA	NA
WP_016723619.1|1756022_1756988_-|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_071653928.1|1757390_1758215_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011003443.1|1758323_1759655_+|transposase	IS701-like element ISRso17 family transposase	transposase	NA	NA	NA	NA
WP_011003941.1|1773725_1774037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086004755.1|1774249_1774705_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_016725238.1|1774918_1775935_+	1-aminocyclopropane-1-carboxylate deaminase	NA	NA	NA	NA	NA
WP_019719365.1|1776020_1777193_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_019719366.1|1777189_1777990_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_019719367.1|1777986_1778883_-	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_071615411.1|1778904_1780452_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_019719369.1|1780553_1782257_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	33.6	8.2e-53
WP_019719370.1|1782318_1783452_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_139274298.1|1783500_1783749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058908569.1|1783717_1784734_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011003952.1|1784791_1786192_-	heavy metal sensor histidine kinase	NA	NA	NA	NA	NA
WP_016727922.1|1786188_1786875_-	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	3.2e-32
WP_058908570.1|1787071_1788898_+	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_103025705.1|1788894_1789929_+	copper resistance protein B	NA	NA	NA	NA	NA
WP_011003956.1|1789966_1790353_+	copper homeostasis periplasmic binding protein CopC	NA	NA	NA	NA	NA
WP_103025706.1|1790357_1791287_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_071507840.1|1791469_1792534_-	porin	NA	NA	NA	NA	NA
WP_016725486.1|1793375_1793831_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_103025707.1|1794081_1795440_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.5e-38
WP_058908573.1|1795525_1796455_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058908574.1|1796579_1797113_+	phosphonopyruvate decarboxylase	NA	NA	NA	NA	NA
WP_058908586.1|1797118_1797715_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_071507839.1|1797739_1799209_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_058908576.1|1799237_1799870_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058908577.1|1799873_1800785_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058908578.1|1800966_1802145_+	CoA transferase	NA	NA	NA	NA	NA
WP_058908587.1|1802190_1803006_+	CoA ester lyase	NA	NA	NA	NA	NA
WP_139274297.1|1803016_1803592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103025708.1|1803800_1804151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086005422.1|1805272_1806423_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.1	1.7e-94
WP_103025508.1|1806979_1808213_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	79.5	2.8e-127
WP_071615663.1|1808255_1808831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025549.1|1809048_1810131_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP025985	Ralstonia solanacearum strain RSCM chromosome, complete genome	3788542	1894326	1911243	3788542	transposase	Leptospira_phage(66.67%)	10	NA	NA
WP_016723619.1|1894326_1895292_-|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_071615268.1|1896143_1897202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146605530.1|1897198_1897777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011003443.1|1897844_1899176_+|transposase	IS701-like element ISRso17 family transposase	transposase	NA	NA	NA	NA
WP_058908884.1|1899509_1900148_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_103025505.1|1900677_1901142_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_103025506.1|1901141_1901492_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.3	7.1e-20
WP_071624213.1|1901523_1903095_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.2	1.3e-73
WP_038938784.1|1903264_1904278_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_103025505.1|1910778_1911243_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP025985	Ralstonia solanacearum strain RSCM chromosome, complete genome	3788542	2022123	2071766	3788542	tRNA,transposase,integrase	Bacillus_phage(22.22%)	25	2019979:2019993	2058759:2058773
2019979:2019993	attL	CATCGCTGCCGTCGG	NA	NA	NA	NA
WP_019718806.1|2022123_2023614_-|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_019718805.1|2023613_2025002_-	lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein	NA	NA	NA	NA	NA
WP_011001754.1|2025337_2025784_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_058908358.1|2026039_2029024_-	avrbs3 family type III effector protein	NA	NA	NA	NA	NA
WP_020832012.1|2030716_2031628_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016723094.1|2031702_2032119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103025716.1|2032208_2038229_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	26.0	5.0e-28
WP_071615359.1|2038660_2045803_+	KR domain-containing protein	NA	NA	NA	NA	NA
WP_058908439.1|2046103_2047849_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.2	5.7e-33
WP_011001746.1|2047845_2049702_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.7	1.5e-36
WP_058908438.1|2049809_2051885_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_103025875.1|2052093_2055078_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_086706442.1|2055083_2056793_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_103025549.1|2056949_2058032_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016727451.1|2058692_2059100_+	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	32.1	7.3e-08
2058759:2058773	attR	CCGACGGCAGCGATG	NA	NA	NA	NA
WP_020371926.1|2059285_2059852_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_038938484.1|2060051_2060438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025478.1|2062758_2063561_-|transposase	IS5-like element IS1421 family transposase	transposase	NA	NA	NA	NA
WP_103025479.1|2063722_2064154_+	DNA mismatch endonuclease Vsr	NA	I6NSG0	Burkholderia_phage	51.2	1.8e-33
WP_103025480.1|2064256_2064490_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_103025481.1|2064486_2065584_+	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	42.6	6.4e-67
WP_158655360.1|2065628_2068721_+	N-6 DNA methylase	NA	R4TFP1	Halovirus	33.8	2.7e-09
WP_103025505.1|2069348_2069813_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_103025506.1|2069812_2070163_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.3	7.1e-20
WP_071624213.1|2070194_2071766_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.2	1.3e-73
>prophage 16
NZ_CP025985	Ralstonia solanacearum strain RSCM chromosome, complete genome	3788542	2191937	2270522	3788542	capsid,portal,terminase,head,tRNA,tail,protease,transposase	Burkholderia_phage(24.24%)	84	NA	NA
WP_016723619.1|2191937_2192903_+|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_103025722.1|2192986_2195677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058908139.1|2195654_2196788_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_158655387.1|2197140_2197413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103025859.1|2197506_2198958_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_019718748.1|2199119_2200595_-	GDL motif peptide-associated radical SAM/SPASM maturase	NA	NA	NA	NA	NA
WP_058908140.1|2200691_2201273_-	DUF1842 domain-containing protein	NA	NA	NA	NA	NA
WP_011001664.1|2201324_2201951_-	DUF1842 domain-containing protein	NA	NA	NA	NA	NA
WP_011001663.1|2202017_2202209_-	DUF1843 domain-containing protein	NA	NA	NA	NA	NA
WP_158655388.1|2202379_2202823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019718747.1|2203089_2207199_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	73.2	8.9e-178
WP_011001660.1|2207336_2207903_-	winged helix DNA-binding protein	NA	NA	NA	NA	NA
WP_011001659.1|2207977_2209573_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_103025724.1|2209631_2211251_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_011001657.1|2211263_2211974_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.8	7.4e-40
WP_020832084.1|2212047_2212668_+	arylesterase	NA	NA	NA	NA	NA
WP_011001655.1|2212744_2213437_+	signal peptidase I	NA	NA	NA	NA	NA
WP_020831502.1|2213478_2214807_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_058907544.1|2214940_2216887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003267811.1|2217309_2217582_-	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	57.3	1.6e-19
WP_011001653.1|2217755_2220176_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	53.1	4.8e-224
WP_011001652.1|2220346_2221621_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.9	4.9e-135
WP_003267806.1|2221786_2222440_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	54.9	1.8e-53
WP_058907545.1|2222469_2223819_-	trigger factor	NA	NA	NA	NA	NA
WP_058907546.1|2224073_2226047_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_011001649.1|2226118_2226313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103025877.1|2226809_2227847_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_158655389.1|2228412_2228985_+	hypothetical protein	NA	Q3HQY5	Burkholderia_phage	43.4	8.9e-36
WP_158655390.1|2228981_2229173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025565.1|2229299_2230550_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.2	1.2e-40
WP_103025726.1|2230678_2231224_-	hypothetical protein	NA	A0A0H5AUG6	Pseudomonas_phage	35.4	7.0e-06
WP_103025727.1|2231223_2231499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011001642.1|2231501_2231810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011001641.1|2231809_2232301_-	glycoside hydrolase family protein	NA	D5LH07	Escherichia_phage	67.7	8.7e-56
WP_072633591.1|2232369_2233026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103025728.1|2233362_2236518_-	host specificity protein J	NA	A4JX16	Burkholderia_virus	56.8	0.0e+00
WP_072633588.1|2236568_2236823_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_028853154.1|2236819_2237158_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_072633645.1|2237227_2237830_-|tail	tail assembly protein	tail	Q8W6T1	Burkholderia_virus	56.0	4.6e-51
WP_072633587.1|2237833_2238544_-	C40 family peptidase	NA	D6PG99	uncultured_phage	54.5	9.0e-70
WP_103025729.1|2238545_2239247_-|tail	phage minor tail protein L	tail	Q6JIL5	Burkholderia_virus	63.3	8.8e-78
WP_103025730.1|2239243_2239840_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_103025731.1|2239845_2240523_-|tail	phage tail protein	tail	D5LGZ0	Escherichia_phage	50.6	3.9e-30
WP_103025732.1|2240519_2240858_-|tail	phage tail protein	tail	A0A0S2SYI2	Pseudomonas_phage	51.8	3.4e-27
WP_103025733.1|2240860_2243734_-|tail	phage tail tape measure protein	tail	A0A1V0E821	Vibrio_phage	34.0	1.8e-92
WP_081365331.1|2243735_2243996_-	DUF1799 domain-containing protein	NA	A0A2R3UAE2	Siphoviridae_environmental_samples	43.9	2.7e-08
WP_072633580.1|2244043_2244364_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	40.0	3.6e-10
WP_072633579.1|2244370_2245024_-|tail	phage tail protein	tail	A0A0H5BBY3	Pseudomonas_phage	54.0	3.4e-55
WP_103025734.1|2245087_2245441_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_103025735.1|2245430_2245931_-	hypothetical protein	NA	I7GSL4	Xanthomonas_virus	36.5	5.1e-11
WP_103025736.1|2245933_2246260_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	40.7	1.1e-11
WP_103025737.1|2246260_2246815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103025738.1|2246818_2247214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103025739.1|2247251_2248508_-|capsid	phage major capsid protein	capsid	C7BGH0	Burkholderia_phage	60.3	3.2e-139
WP_103025740.1|2248572_2249337_-|protease	Clp protease ClpP	protease	C7BGG9	Burkholderia_phage	66.8	2.1e-69
WP_103025741.1|2249302_2250610_-|portal	phage portal protein	portal	C7BGG8	Burkholderia_phage	52.7	1.9e-113
WP_103025742.1|2250606_2252265_-|terminase	terminase large subunit	terminase	C7BGG7	Burkholderia_phage	58.9	2.8e-199
WP_103025878.1|2252315_2252678_-	hypothetical protein	NA	C7BGG6	Burkholderia_phage	58.3	9.3e-31
WP_103025743.1|2253053_2253491_-	HNH endonuclease	NA	C7BGG5	Burkholderia_phage	53.4	8.9e-28
WP_103025744.1|2253662_2254265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103025745.1|2254288_2254585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103025746.1|2254581_2255616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011001618.1|2255612_2255810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103025747.1|2255818_2256229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072633567.1|2256225_2256729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158655391.1|2256974_2257223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078222094.1|2257285_2257810_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_103025879.1|2258092_2258713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025748.1|2259407_2259782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025749.1|2259778_2260216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025750.1|2260370_2260586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072633562.1|2260595_2261027_+	hypothetical protein	NA	A0A291LIA5	Streptomyces_phage	35.5	4.7e-05
WP_103025751.1|2261023_2261260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025752.1|2261285_2261879_+	PRTRC system protein E	NA	NA	NA	NA	NA
WP_071623742.1|2261891_2262281_+	PRTRC system protein C	NA	NA	NA	NA	NA
WP_103025753.1|2262277_2263327_+	PRTRC system protein F	NA	NA	NA	NA	NA
WP_072633557.1|2263334_2264057_+	PRTRC system protein B	NA	NA	NA	NA	NA
WP_103025754.1|2264058_2264844_+	PRTRC system protein A	NA	NA	NA	NA	NA
WP_103025755.1|2264840_2265641_+	PRTRC system ThiF family protein	NA	NA	NA	NA	NA
WP_103025756.1|2265642_2267121_+	hypothetical protein	NA	Q8W6Q9	Burkholderia_virus	51.9	7.7e-31
WP_071623736.1|2267175_2267484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025505.1|2268104_2268569_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_103025506.1|2268568_2268919_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.3	7.1e-20
WP_071624213.1|2268950_2270522_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.2	1.3e-73
>prophage 17
NZ_CP025985	Ralstonia solanacearum strain RSCM chromosome, complete genome	3788542	2541243	2549479	3788542		Planktothrix_phage(16.67%)	8	NA	NA
WP_011000872.1|2541243_2542296_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	2.6e-33
WP_011000871.1|2542452_2543376_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	35.9	9.3e-43
WP_058907684.1|2543493_2544606_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_011000869.1|2544686_2545589_-	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	40.8	8.2e-52
WP_011000868.1|2545692_2546010_-	ComEA family DNA-binding protein	NA	NA	NA	NA	NA
WP_011000867.1|2546139_2547135_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	32.3	4.1e-28
WP_049842162.1|2547131_2548079_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.6	9.0e-17
WP_016723343.1|2548105_2549479_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.9	1.9e-76
>prophage 18
NZ_CP025985	Ralstonia solanacearum strain RSCM chromosome, complete genome	3788542	2572472	2616153	3788542	integrase,tRNA,transposase	Leptospira_phage(18.18%)	41	2559174:2559192	2622806:2622824
2559174:2559192	attL	GCGCGCGCCTGCGCGAGGA	NA	NA	NA	NA
WP_038938784.1|2572472_2573486_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_058908641.1|2575044_2576304_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014631870.1|2576352_2577222_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_019719997.1|2577218_2578187_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_028861886.1|2578183_2578933_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	1.2e-16
WP_020830396.1|2578929_2579640_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.4	5.0e-12
WP_058908642.1|2579770_2581348_+	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	27.0	5.5e-11
WP_058908643.1|2581361_2582984_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_011004587.1|2583019_2583736_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_014631877.1|2583865_2584228_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_058908644.1|2584265_2584955_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_103025774.1|2585070_2585259_+	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_103025505.1|2585719_2586184_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_103025506.1|2586183_2586534_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.3	7.1e-20
WP_071624213.1|2586565_2588137_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.2	1.3e-73
WP_158655397.1|2588180_2588759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158655398.1|2589389_2590565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103025777.1|2590561_2590993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103025778.1|2590985_2592884_-	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_103025779.1|2592886_2593111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103025780.1|2593103_2593328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158655399.1|2593371_2594067_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_103025508.1|2594297_2595531_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	79.5	2.8e-127
WP_158655410.1|2595718_2596462_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_103025782.1|2596601_2596814_-	plasmid-related protein	NA	NA	NA	NA	NA
WP_103025783.1|2596897_2597734_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_158655400.1|2597730_2597943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103025784.1|2597955_2599029_-|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	37.0	1.4e-42
WP_038962216.1|2599420_2601907_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.8	4.3e-34
WP_058907659.1|2602219_2604031_-	DNA primase	NA	A0A1S5RH70	Helicobacter_phage	34.2	1.2e-46
WP_011002145.1|2604071_2604521_-	GatB/YqeY domain-containing protein	NA	A0A2I7SAL1	Vibrio_phage	32.8	5.2e-07
WP_058907660.1|2604634_2605873_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011002147.1|2605980_2607024_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	52.0	4.1e-95
WP_011002148.1|2607069_2607876_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_011002149.1|2608116_2610027_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_011002150.1|2610085_2610985_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_028853416.1|2610981_2611266_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_016722814.1|2611598_2612696_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_011002153.1|2612793_2613768_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016722812.1|2613797_2614688_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_020831502.1|2614824_2616153_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
2622806:2622824	attR	GCGCGCGCCTGCGCGAGGA	NA	NA	NA	NA
>prophage 19
NZ_CP025985	Ralstonia solanacearum strain RSCM chromosome, complete genome	3788542	2714187	2731107	3788542	transposase	Ralstonia_phage(50.0%)	17	NA	NA
WP_016721735.1|2714187_2715153_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
WP_155738951.1|2715149_2715299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087451503.1|2715295_2716101_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016722750.1|2716478_2716853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011002241.1|2717155_2718355_-	MFS transporter	NA	NA	NA	NA	NA
WP_071615607.1|2718386_2718935_-	serine hydrolase family protein	NA	NA	NA	NA	NA
WP_011002243.1|2719058_2719514_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011002244.1|2719621_2720581_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_064477942.1|2720914_2721331_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011002246.1|2721350_2722178_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_071507948.1|2722277_2722652_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_064477944.1|2722874_2724440_-	MFS transporter	NA	NA	NA	NA	NA
WP_086005422.1|2725713_2726864_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.1	1.7e-94
WP_011003086.1|2727015_2727552_-	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	50.3	1.8e-46
WP_020831479.1|2727609_2728434_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_103025478.1|2728459_2729262_-|transposase	IS5-like element IS1421 family transposase	transposase	NA	NA	NA	NA
WP_103025508.1|2729872_2731107_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	79.5	2.8e-127
>prophage 20
NZ_CP025985	Ralstonia solanacearum strain RSCM chromosome, complete genome	3788542	2745115	2759480	3788542	tRNA,protease,transposase	Ralstonia_phage(33.33%)	13	NA	NA
WP_020829879.1|2745115_2746117_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_103025787.1|2746250_2747053_-|transposase	IS5-like element IS1421 family transposase	transposase	NA	NA	NA	NA
WP_087451503.1|2747163_2747968_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016721735.1|2748112_2749078_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
WP_071624170.1|2749199_2750165_-|protease	YopT-type cysteine protease domain-containing protein	protease	NA	NA	NA	NA
WP_016726935.1|2750371_2750893_+	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	61.9	1.2e-23
WP_058908760.1|2751021_2751312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016724179.1|2751369_2751708_-	DUF1484 domain-containing protein	NA	NA	NA	NA	NA
WP_103025505.1|2753109_2753574_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_103025506.1|2753573_2753924_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.3	7.1e-20
WP_071624213.1|2753955_2755527_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.2	1.3e-73
WP_016723619.1|2756228_2757194_+|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_016722739.1|2758163_2759480_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.6	6.1e-96
>prophage 21
NZ_CP025985	Ralstonia solanacearum strain RSCM chromosome, complete genome	3788542	2993013	3083104	3788542	protease,coat,transposase	Paramecium_bursaria_Chlorella_virus(12.5%)	84	NA	NA
WP_020832586.1|2993013_2994561_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	33.6	3.6e-23
WP_003271964.1|2994560_2995070_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_011002539.1|2995103_2995748_+	deoxynucleoside kinase	NA	M1IA15	Paramecium_bursaria_Chlorella_virus	27.8	1.7e-06
WP_011002540.1|2995804_2996629_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	31.3	1.9e-34
WP_011002541.1|2996640_2997348_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_058907902.1|2997355_2998042_+	energy-coupling factor ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.2	8.8e-14
WP_028860933.1|2997997_2999878_-	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	A0A0B5J984	Pandoravirus	37.4	4.6e-57
WP_011002544.1|2999913_3001056_-	molecular chaperone DnaJ	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	32.7	2.9e-22
WP_021155204.1|3001190_3003152_-	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.8	1.4e-149
WP_058907913.1|3003515_3003920_-	transcription elongation factor GreAB	NA	NA	NA	NA	NA
WP_011002548.1|3004183_3004606_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_103025798.1|3004621_3005266_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_071615277.1|3005298_3005502_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011002551.1|3005549_3005738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016724062.1|3005751_3006147_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_058907901.1|3006143_3007259_-	ferrochelatase	NA	NA	NA	NA	NA
WP_021155202.1|3007317_3008544_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_058907900.1|3008536_3009520_-	formimidoylglutamase	NA	NA	NA	NA	NA
WP_028853576.1|3009516_3011073_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.3	3.1e-67
WP_016725980.1|3011090_3012896_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_011002558.1|3013028_3013742_+	histidine utilization repressor	NA	NA	NA	NA	NA
WP_011002559.1|3013763_3014822_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_016723658.1|3014936_3015866_+	NAD kinase	NA	NA	NA	NA	NA
WP_011002561.1|3015895_3017605_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_011002562.1|3017686_3018133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058907899.1|3018311_3019943_+|protease	MprA protease, GlyGly-CTERM protein-sorting domain-containing form	protease	NA	NA	NA	NA
WP_058907898.1|3020158_3022201_+|protease	MprA protease, GlyGly-CTERM protein-sorting domain-containing form	protease	A0A1B0T6A2	Bacillus_phage	34.7	6.0e-10
WP_011002565.1|3022256_3022877_-	rhombosortase	NA	NA	NA	NA	NA
WP_058907897.1|3022873_3025741_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_058907896.1|3025920_3030201_+	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_011002568.1|3030206_3031076_+	carbon-nitrogen hydrolase family protein	NA	M1H5W0	Paramecium_bursaria_Chlorella_virus	25.3	8.3e-09
WP_058907895.1|3031103_3032564_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_103025799.1|3032956_3034036_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	45.0	1.5e-76
WP_058907894.1|3034159_3034495_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011002572.1|3034779_3035676_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_020832612.1|3035749_3036307_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_103025800.1|3036427_3037846_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_058907893.1|3037856_3038747_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058907892.1|3038917_3040411_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_058907891.1|3040421_3041540_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_058907890.1|3041549_3042797_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_058907889.1|3042848_3043226_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_028853586.1|3043222_3043945_+	LrgB family protein	NA	NA	NA	NA	NA
WP_016723678.1|3044102_3044498_+	VOC family protein	NA	NA	NA	NA	NA
WP_016726000.1|3044548_3045028_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_016723680.1|3045070_3045769_+	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_011002584.1|3045785_3046283_-	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	40.2	5.5e-26
WP_071623704.1|3046378_3049591_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_011002586.1|3049622_3050159_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_016723683.1|3050162_3051191_-	PilW family protein	NA	NA	NA	NA	NA
WP_028860948.1|3051187_3051778_-	type IV pilus modification protein PilV	NA	NA	NA	NA	NA
WP_016723684.1|3051774_3052263_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_016723685.1|3052266_3052707_-	type IV pilin protein	NA	NA	NA	NA	NA
WP_103025801.1|3052901_3054041_-	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_011002592.1|3054093_3055137_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_011002593.1|3055261_3055984_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_028853591.1|3056018_3056843_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_058907887.1|3056864_3057143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011002596.1|3057139_3058015_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_003271865.1|3058088_3058589_-	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	36.2	2.1e-20
WP_011002597.1|3058747_3058990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058907886.1|3059048_3059297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016723690.1|3059515_3060460_-	hydrogen peroxide-inducible genes activator	NA	A0A2P0ZL89	Lactobacillus_phage	23.9	4.0e-09
WP_011002600.1|3061065_3061608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011002601.1|3061677_3062187_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_058907885.1|3062183_3064448_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_049842205.1|3064497_3065217_-	molecular chaperone	NA	NA	NA	NA	NA
WP_058907884.1|3065335_3065839_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_011002605.1|3065888_3066392_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_103025859.1|3067707_3069159_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_071615274.1|3069392_3069653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011002607.1|3070625_3070922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011002608.1|3071072_3071390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011002609.1|3072728_3073013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011002610.1|3073106_3073433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020831502.1|3073945_3075274_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_071615273.1|3075320_3075485_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	55.1	1.2e-06
WP_103025885.1|3076253_3076508_+	translation initiation factor 1	NA	NA	NA	NA	NA
WP_020832646.1|3076606_3076819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019718280.1|3077300_3077618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038938784.1|3078346_3079360_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_103025549.1|3081015_3082098_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_103025506.1|3082289_3082640_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.3	7.1e-20
WP_103025505.1|3082639_3083104_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP025985	Ralstonia solanacearum strain RSCM chromosome, complete genome	3788542	3311022	3318463	3788542	tail,transposase	Microbacterium_phage(100.0%)	6	NA	NA
WP_019717364.1|3311022_3311544_-|tail	phage tail protein	tail	A0A2R4A082	Microbacterium_phage	36.0	1.2e-15
WP_058908151.1|3311558_3312092_-|tail	phage tail protein	tail	A0A2R3ZZT3	Microbacterium_phage	32.7	1.2e-13
WP_103025827.1|3312101_3312650_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_103025859.1|3314493_3315945_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_103025828.1|3316029_3316813_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011003443.1|3317131_3318463_-|transposase	IS701-like element ISRso17 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP025985	Ralstonia solanacearum strain RSCM chromosome, complete genome	3788542	3333881	3386645	3788542	transposase	Leptospira_phage(28.57%)	38	NA	NA
WP_071624213.1|3333881_3335453_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.2	1.3e-73
WP_103025506.1|3335484_3335835_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.3	7.1e-20
WP_103025505.1|3335834_3336299_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_103025829.1|3337209_3340185_-	conjugative relaxase	NA	NA	NA	NA	NA
WP_103025830.1|3340594_3340876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158655407.1|3341028_3341280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103025832.1|3341339_3342188_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_158655408.1|3342180_3342573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103025834.1|3342722_3343524_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_103025859.1|3343636_3345088_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_058908327.1|3346115_3346958_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.3	3.6e-49
WP_058908328.1|3346999_3348043_+	RNA 3'-terminal phosphate cyclase	NA	NA	NA	NA	NA
WP_080705157.1|3348735_3349014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011000196.1|3349327_3350536_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_011000197.1|3350755_3351952_-	membrane protein	NA	NA	NA	NA	NA
WP_058908329.1|3351959_3352595_-	LysE family translocator	NA	NA	NA	NA	NA
WP_103025546.1|3353041_3354028_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	82.3	2.2e-151
WP_011000199.1|3354225_3355032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071615382.1|3355188_3356169_-	DMT family transporter	NA	NA	NA	NA	NA
WP_058908331.1|3356295_3357042_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_058908332.1|3357592_3357949_-	DUF427 domain-containing protein	NA	NA	NA	NA	NA
WP_058908333.1|3358130_3359201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058908334.1|3359556_3362856_+	methylmalonyl-CoA mutase family protein	NA	NA	NA	NA	NA
WP_011000205.1|3363048_3363759_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_071615379.1|3363748_3365587_-	amidohydrolase	NA	NA	NA	NA	NA
WP_028860116.1|3365591_3366029_-	DoxX family protein	NA	NA	NA	NA	NA
WP_028852503.1|3366043_3366334_-	XapX domain-containing protein	NA	NA	NA	NA	NA
WP_058908336.1|3366428_3367115_-	hydrolase	NA	NA	NA	NA	NA
WP_016722398.1|3367327_3368260_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011000211.1|3368443_3369298_+	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_058908337.1|3369323_3370796_-	type III effector	NA	NA	NA	NA	NA
WP_038938784.1|3371685_3372699_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_058908338.1|3373921_3374386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086005422.1|3376235_3377385_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.1	1.7e-94
WP_139274287.1|3381205_3381607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058908834.1|3382332_3383190_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_058908835.1|3383220_3384744_-	DUF1254 domain-containing protein	NA	M1HNU9	Paramecium_bursaria_Chlorella_virus	23.9	1.4e-19
WP_089190850.1|3385278_3386645_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	53.8	7.2e-76
>prophage 24
NZ_CP025985	Ralstonia solanacearum strain RSCM chromosome, complete genome	3788542	3600709	3662170	3788542	tRNA,transposase	Tupanvirus(33.33%)	53	NA	NA
WP_058907490.1|3600709_3602533_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	26.0	9.2e-10
WP_020831230.1|3602706_3603576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016726635.1|3603652_3604126_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_011000430.1|3604127_3604874_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_011000431.1|3604870_3606139_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_058907483.1|3606174_3607836_+	CoA-transferase	NA	NA	NA	NA	NA
WP_020831236.1|3608264_3608855_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_028852596.1|3608907_3610695_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_019717522.1|3610771_3613255_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011000436.1|3613287_3614487_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011000437.1|3614595_3615360_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_020831502.1|3615498_3616827_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_011000438.1|3616873_3617293_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_028860191.1|3617399_3619226_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.2	4.7e-46
WP_020831241.1|3619440_3620385_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011000441.1|3620538_3621840_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_028852598.1|3622377_3623274_+	glutamate/aspartate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020831242.1|3623373_3624102_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_011000444.1|3624122_3624806_+	glutamate/aspartate ABC transporter permease GltK	NA	NA	NA	NA	NA
WP_011000445.1|3624802_3625537_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	8.5e-31
WP_011000446.1|3625604_3626435_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_021156006.1|3626608_3627700_+	tartrate dehydrogenase	NA	NA	NA	NA	NA
WP_058907485.1|3627696_3628995_+	glycerate kinase	NA	NA	NA	NA	NA
WP_011000448.1|3629031_3630066_+	dihydroorotase	NA	NA	NA	NA	NA
WP_011000449.1|3630068_3630881_+	DUF3025 domain-containing protein	NA	NA	NA	NA	NA
WP_058907486.1|3631240_3631687_-	OsmC family protein	NA	NA	NA	NA	NA
WP_103025843.1|3632376_3632793_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_011000451.1|3632802_3633195_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_011000452.1|3633424_3634180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011000453.1|3634214_3634619_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_003265486.1|3634747_3635122_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	56.5	2.6e-28
WP_028852601.1|3635185_3636346_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_016724018.1|3636520_3637792_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011000456.1|3637788_3638289_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_058907487.1|3638306_3638438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011000458.1|3638437_3639121_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011000459.1|3639200_3640274_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.8	1.7e-08
WP_019717529.1|3640337_3640919_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_020831261.1|3640970_3642107_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_016726644.1|3642202_3642748_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_103025478.1|3642886_3643688_+|transposase	IS5-like element IS1421 family transposase	transposase	NA	NA	NA	NA
WP_020829879.1|3643822_3644824_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_071653928.1|3645160_3645985_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_103025859.1|3646196_3647648_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_028852449.1|3651569_3652754_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_019717361.1|3653171_3655067_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_011000079.1|3655080_3656220_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013213874.1|3656216_3656444_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_058908149.1|3656453_3657281_+	thiazole synthase	NA	NA	NA	NA	NA
WP_058908148.1|3657277_3658429_+	thiamine monophosphate synthase	NA	NA	NA	NA	NA
WP_011000074.1|3658555_3659035_+	VOC family protein	NA	A0A2K9L4N3	Tupanvirus	46.0	7.5e-28
WP_058908147.1|3659481_3660306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087451503.1|3661365_3662170_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP025985	Ralstonia solanacearum strain RSCM chromosome, complete genome	3788542	3698356	3756718	3788542	tRNA,protease,transposase	Prochlorococcus_phage(11.11%)	52	NA	NA
WP_011000041.1|3698356_3699217_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_028860038.1|3699335_3699983_-	LysE family translocator	NA	NA	NA	NA	NA
WP_028860037.1|3700017_3701001_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	32.8	2.1e-08
WP_058907960.1|3701046_3703020_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_011000037.1|3703067_3703577_-	peptide deformylase	NA	NA	NA	NA	NA
WP_011000036.1|3703830_3705003_+	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	50.0	2.9e-09
WP_011000035.1|3705020_3706226_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	41.5	4.2e-27
WP_011000034.1|3706266_3706656_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_058907959.1|3706886_3709520_+	DNA topoisomerase III	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	24.8	2.8e-15
WP_011000032.1|3709621_3710560_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058907958.1|3711015_3712710_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	25.2	4.0e-15
WP_011000030.1|3712742_3713885_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_020830846.1|3713908_3716314_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_011000028.1|3716336_3716849_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_011000027.1|3716860_3717901_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_011000026.1|3718078_3719122_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_011000025.1|3719599_3719899_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_058907956.1|3719990_3721478_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_011000023.1|3721518_3722019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071615197.1|3721997_3722975_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_028852425.1|3723060_3724527_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_011000020.1|3724526_3725240_+	DUF484 family protein	NA	NA	NA	NA	NA
WP_058907953.1|3725253_3726243_+	tyrosine recombinase XerC	NA	A0A2H4PCY2	Mycobacterium_phage	29.8	1.1e-12
WP_028860027.1|3726282_3727476_+	class I SAM-dependent rRNA methyltransferase	NA	NA	NA	NA	NA
WP_087451503.1|3727584_3728389_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_058907952.1|3728489_3730016_+	FAD-binding oxidoreductase	NA	S4VXI2	Pandoravirus	26.3	7.9e-23
WP_058907951.1|3730028_3731285_+	lactonase family protein	NA	NA	NA	NA	NA
WP_011000015.1|3731373_3731892_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_016722621.1|3731879_3732968_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_011000013.1|3733377_3733797_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_043876519.1|3733866_3735165_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_071615196.1|3735265_3736858_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011000010.1|3737003_3737540_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_011000009.1|3737574_3738906_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.2	1.3e-42
WP_016726757.1|3739123_3740416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011000007.1|3740613_3741192_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_071615246.1|3741238_3742585_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_016722626.1|3742727_3743231_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_103025845.1|3743279_3743495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058907950.1|3743536_3743734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028852417.1|3743779_3743995_-	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_011000001.1|3744007_3744601_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011000000.1|3744776_3745709_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_020830828.1|3745708_3746572_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_058907949.1|3746610_3747276_+	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_020831502.1|3747403_3748732_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_028852416.1|3748778_3750275_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_010999996.1|3750425_3751706_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.7	2.7e-24
WP_058908841.1|3751710_3753204_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_058908842.1|3753483_3754695_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_010999993.1|3754691_3755339_+	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_020831502.1|3755389_3756718_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP025986	Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence	2212170	94477	161949	2212170	transposase	Ralstonia_phage(28.57%)	47	NA	NA
WP_011003443.1|94477_95809_-|transposase	IS701-like element ISRso17 family transposase	transposase	NA	NA	NA	NA
WP_103025899.1|95890_96715_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_058908857.1|96839_97793_-	oxidoreductase	NA	NA	NA	NA	NA
WP_028853999.1|97804_98833_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_058908858.1|98958_99873_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058908859.1|100063_101449_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_072633681.1|102317_104918_+	FAD-dependent oxidoreductase	NA	A0A2H4UW49	Bodo_saltans_virus	31.0	3.7e-12
WP_103025901.1|105768_107988_-	type III effector protein (hlk2)	NA	NA	NA	NA	NA
WP_011003529.1|108330_109812_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_139274299.1|110245_110782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016723619.1|110848_111814_+|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_011003443.1|112021_113353_+|transposase	IS701-like element ISRso17 family transposase	transposase	NA	NA	NA	NA
WP_103025902.1|113665_115228_-	carotenoid oxygenase family protein	NA	NA	NA	NA	NA
WP_058908747.1|115242_115689_-	DUF2141 domain-containing protein	NA	NA	NA	NA	NA
WP_011003525.1|115920_116142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058908746.1|116268_117060_-	phytanoyl-CoA dioxygenase	NA	NA	NA	NA	NA
WP_058908745.1|117648_119355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071615413.1|119351_120854_+	hypothetical protein	NA	A0A077K801	Ralstonia_phage	58.7	7.3e-21
WP_058908728.1|120900_121167_+	hypothetical protein	NA	R9U4D0	Rhizobium_phage	54.3	6.9e-07
WP_011003518.1|121661_122156_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_011003517.1|123309_124056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058908727.1|125050_127477_+	decarboxylase	NA	NA	NA	NA	NA
WP_103025903.1|127500_130011_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	A0A1V0SKB7	Klosneuvirus	27.6	9.0e-24
WP_011003514.1|130203_130758_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_016724828.1|131563_132154_-	chorismate mutase	NA	NA	NA	NA	NA
WP_028861347.1|132299_133262_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_103025904.1|133334_133655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011003509.1|133777_134899_+	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_103025905.1|135692_136517_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_058908597.1|140601_141126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058908598.1|141702_142494_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_058908599.1|142858_144886_+	FimV family protein	NA	NA	NA	NA	NA
WP_058908600.1|144909_145071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020829558.1|145291_146029_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_071615442.1|146640_147873_+	lactonase family protein	NA	NA	NA	NA	NA
WP_058908610.1|147928_149245_+	MFS transporter	NA	NA	NA	NA	NA
WP_058908601.1|149515_149920_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_011003495.1|149983_150406_+	DUF4259 domain-containing protein	NA	NA	NA	NA	NA
WP_038938725.1|150450_150915_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_058908602.1|150944_151727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058908603.1|151838_154061_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_016724813.1|154062_154614_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_058908604.1|154637_155474_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_058908605.1|155501_158390_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	23.1	5.2e-15
WP_016724810.1|158607_159432_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_058908606.1|159428_160598_-	cysteine desulfurase	NA	NA	NA	NA	NA
WP_103025546.1|160962_161949_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	82.3	2.2e-151
>prophage 2
NZ_CP025986	Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence	2212170	275238	348449	2212170	transposase	Brucella_phage(25.0%)	55	NA	NA
WP_016723619.1|275238_276204_+|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_011003443.1|276411_277743_+|transposase	IS701-like element ISRso17 family transposase	transposase	NA	NA	NA	NA
WP_016726511.1|277913_278399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058907724.1|278729_279011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011003391.1|279142_279427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058907723.1|280115_280784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019719758.1|280889_282167_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.2	6.4e-42
WP_016722339.1|282415_282721_-	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	49.5	1.4e-16
WP_058907722.1|282717_283026_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	46.9	1.1e-19
WP_058907721.1|283101_284301_-	MFS transporter	NA	NA	NA	NA	NA
WP_011003398.1|284427_285249_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011003399.1|285426_285978_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071507364.1|286110_286710_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_071507365.1|287068_290452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020425354.1|290482_292594_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_019719753.1|295040_295814_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011003424.1|295827_297126_-	MFS transporter	NA	NA	NA	NA	NA
WP_058907717.1|297293_297944_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058907716.1|298048_299014_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_058907755.1|299033_300080_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_058907754.1|300076_302122_+	DUF3488 domain-containing protein	NA	NA	NA	NA	NA
WP_058907715.1|302602_303247_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_103025912.1|303367_304930_+	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_011003431.1|305197_305980_+	membrane protein	NA	NA	NA	NA	NA
WP_028853948.1|306033_306441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058907713.1|307059_308328_+	hemagglutinin	NA	NA	NA	NA	NA
WP_028861309.1|308648_308852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011003435.1|308936_309320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071507368.1|309448_310639_-	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_058907711.1|310635_313233_-	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_011003438.1|313320_314484_-	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_038962849.1|314535_315432_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_058907710.1|315624_317574_+	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_103025913.1|317624_317969_+	toxin	NA	NA	NA	NA	NA
WP_020425351.1|317965_318277_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_043885575.1|318416_319226_-	DUF2242 domain-containing protein	NA	NA	NA	NA	NA
WP_071615383.1|320470_322309_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_103025505.1|324064_324529_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_103025506.1|324528_324879_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.3	7.1e-20
WP_071624213.1|324910_326482_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.2	1.3e-73
WP_103025914.1|326577_327708_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_063612211.1|329732_330671_+	DMT family transporter	NA	NA	NA	NA	NA
WP_019719061.1|330750_331836_-	FUSC family protein	NA	NA	NA	NA	NA
WP_043897990.1|332070_333120_-	lyase	NA	NA	NA	NA	NA
WP_058908670.1|333315_334551_-	NADH:flavin oxidoreductase/NADH oxidase family protein	NA	NA	NA	NA	NA
WP_058908671.1|334626_335085_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086005422.1|335461_336611_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.1	1.7e-94
WP_058908802.1|336940_337756_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011004883.1|337853_338747_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016726476.1|338847_339888_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_020830597.1|339931_340849_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011004880.1|340976_342173_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_019719806.1|342178_343723_-	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	7.5e-13
WP_011004877.1|344854_346225_-	porin	NA	NA	NA	NA	NA
WP_038938784.1|347435_348449_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP025986	Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence	2212170	443610	481768	2212170	transposase,protease	uncultured_Mediterranean_phage(25.0%)	29	NA	NA
WP_019719842.1|443610_445083_+|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.3	1.6e-25
WP_011004797.1|445272_445635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058908007.1|445733_446255_+	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_058908008.1|446419_446749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028854674.1|446906_447419_-	DUF1993 family protein	NA	NA	NA	NA	NA
WP_016725060.1|447645_447861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087451503.1|456998_457803_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_139274350.1|457835_458186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058908830.1|458175_458418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016723619.1|458593_459559_-|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_158655411.1|459557_460082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020829879.1|460396_461398_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_103025478.1|461531_462334_-|transposase	IS5-like element IS1421 family transposase	transposase	NA	NA	NA	NA
WP_058908828.1|462411_462930_+	DUF2247 family protein	NA	NA	NA	NA	NA
WP_071615620.1|462978_463185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071615618.1|463349_463703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025920.1|464537_464906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025921.1|464955_467496_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	30.8	1.8e-16
WP_103026038.1|467593_468208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025922.1|468212_469982_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_103025923.1|469999_470839_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_028854671.1|471081_471468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071092600.1|471467_471935_+	DUF2846 domain-containing protein	NA	NA	NA	NA	NA
WP_103025924.1|472549_474697_+	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_016723605.1|474811_475849_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_103026039.1|476198_476720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025925.1|476882_478133_-	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_058907850.1|478158_479484_-	DUF3500 domain-containing protein	NA	Q7Y402	Yersinia_phage	45.5	4.5e-06
WP_058907849.1|480058_481768_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP025986	Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence	2212170	780826	847095	2212170	transposase	Ralstonia_phage(16.67%)	44	NA	NA
WP_016723619.1|780826_781792_+|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_103025937.1|781875_782409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058907943.1|782405_784112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019719249.1|784120_786859_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.4	1.0e-84
WP_019719248.1|787300_788344_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.3	8.4e-16
WP_020831502.1|788552_789881_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_019719247.1|790059_791388_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_103025938.1|791553_793335_+	molecular chaperone HscC	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.3	3.5e-86
WP_058908667.1|793345_795199_+	J domain-containing protein	NA	NA	NA	NA	NA
WP_011003826.1|795333_795999_+	response regulator	NA	NA	NA	NA	NA
WP_019719244.1|795995_797474_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	26.5	3.3e-18
WP_019719243.1|797603_798215_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011003829.1|798317_798749_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_058908668.1|798919_799429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011003831.1|799537_800893_+	TolC family protein	NA	NA	NA	NA	NA
WP_043885717.1|800934_802107_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_058908666.1|802103_805253_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	24.9	1.8e-66
WP_011003834.1|805249_805573_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_020829729.1|805664_807911_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.3	2.6e-54
WP_028861513.1|808573_809014_-	hypothetical protein	NA	A4PE55	Ralstonia_virus	55.2	6.4e-34
WP_028861514.1|809515_810295_+	phosphohydrolase	NA	NA	NA	NA	NA
WP_020829725.1|810447_811359_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	47.3	5.3e-75
WP_011003839.1|811523_812849_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	50.0	6.1e-104
WP_058908665.1|813180_813582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011003842.1|813846_814989_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_103025859.1|818175_819627_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_058908860.1|827485_827986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081050002.1|828256_828565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016723619.1|828870_829836_-|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_071615653.1|831222_831744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058908692.1|831786_833556_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_058908691.1|834223_835591_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_058908690.1|835883_837017_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_011003854.1|837118_837391_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_058908689.1|837523_838495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011003856.1|838513_839719_+	chromate transporter	NA	NA	NA	NA	NA
WP_016725380.1|839772_840279_+	chromate resistance protein	NA	NA	NA	NA	NA
WP_155739017.1|840825_840969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089191131.1|841210_841531_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011003864.1|841897_842455_-	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_058908418.1|842444_843488_-	transporter	NA	NA	NA	NA	NA
WP_058908419.1|843578_843956_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_103025859.1|844228_845680_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_103025940.1|845897_847095_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	61.8	1.3e-92
>prophage 5
NZ_CP025986	Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence	2212170	1264993	1385556	2212170	transposase,protease,integrase	Hokovirus(12.5%)	86	1273857:1273874	1381416:1381432
WP_058907312.1|1264993_1266382_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_103025978.1|1266516_1268784_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_016722003.1|1268783_1269338_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_103025979.1|1269348_1270419_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_011001364.1|1270415_1270910_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_011001365.1|1270906_1271722_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_011001366.1|1271718_1272891_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_011001367.1|1272895_1273606_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.6	1.4e-25
WP_011001368.1|1273625_1274405_+	RNA methyltransferase	NA	NA	NA	NA	NA
1273857:1273874	attL	CTGCTGGCCGACAGCCTG	NA	NA	NA	NA
WP_011001369.1|1274718_1275558_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
1273857:1273874	attL	CTGCTGGCCGACAGCCTG	NA	NA	NA	NA
WP_011001370.1|1275761_1278149_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.2	7.0e-167
WP_011001371.1|1278295_1278724_+	NfeD family protein	NA	NA	NA	NA	NA
WP_011001372.1|1278748_1279675_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_011001373.1|1279701_1280148_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	41.8	1.1e-25
WP_011001374.1|1280269_1280707_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_103025980.1|1280693_1281050_+	RnfH family protein	NA	NA	NA	NA	NA
WP_028853038.1|1281060_1281582_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_058907310.1|1281736_1282678_-	DMT family transporter	NA	NA	NA	NA	NA
WP_011001378.1|1282819_1284283_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.7	8.8e-96
WP_020749223.1|1284408_1284984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058907309.1|1284958_1286578_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.5	4.6e-13
WP_103025981.1|1286878_1288135_+|integrase	site-specific integrase	integrase	A0A1X9TCT6	Enterobacter_phage	52.5	3.9e-116
WP_103025982.1|1288195_1288471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025983.1|1288475_1289000_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	35.3	9.1e-11
WP_103025505.1|1294564_1295029_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_103025506.1|1295028_1295379_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.3	7.1e-20
WP_071624213.1|1295410_1296982_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.2	1.3e-73
WP_038938784.1|1298982_1299996_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_103025549.1|1301714_1302797_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_086706442.1|1302953_1304663_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_103025875.1|1304668_1307653_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_103025984.1|1307658_1308507_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
1308466:1308483	attR	CTGCTGGCCGACAGCCTG	NA	NA	NA	NA
WP_081365374.1|1308571_1312744_-	type III effector protein	NA	NA	NA	NA	NA
1308466:1308483	attR	CTGCTGGCCGACAGCCTG	NA	NA	NA	NA
WP_081049917.1|1313041_1316611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071507263.1|1316930_1320920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011004146.1|1321082_1321460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011004147.1|1321780_1322290_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_058907531.1|1322286_1323237_+	FecR family protein	NA	NA	NA	NA	NA
WP_011004149.1|1323423_1323948_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020831502.1|1324016_1325345_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_103025546.1|1325497_1326484_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	82.3	2.2e-151
WP_016723157.1|1326727_1327468_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_103025985.1|1327670_1328126_-	molecular chaperone Tir	NA	NA	NA	NA	NA
WP_016723156.1|1328166_1328394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016723155.1|1328583_1328832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011004154.1|1328956_1329202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023470397.1|1329235_1330207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103025986.1|1330212_1331205_-	type III secretion protein HrpV	NA	NA	NA	NA	NA
WP_003263753.1|1331214_1331475_-	EscS/YscS/HrcS family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_011004157.1|1331482_1332136_-	EscR/YscR/HrcR family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_058907532.1|1332122_1333187_-	YscQ/HrcQ family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_058907533.1|1333204_1333798_-	type III secretion protein HpaP	NA	NA	NA	NA	NA
WP_011004160.1|1333808_1335881_-	EscV/YscV/HrcV family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_019719521.1|1335899_1336973_-	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_011004162.1|1337254_1337731_+	HrpB1 family type III secretion system apparatus protein	NA	NA	NA	NA	NA
WP_058907543.1|1337751_1338138_+	type III secretion protein HrpB2	NA	NA	NA	NA	NA
WP_020830094.1|1338134_1338944_+	EscJ/YscJ/HrcJ family type III secretion inner membrane ring protein	NA	NA	NA	NA	NA
WP_028861692.1|1338940_1339570_+	type III secretion protein HrpB4	NA	NA	NA	NA	NA
WP_020830092.1|1339554_1340466_+	HrpE/YscL family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_011004167.1|1340462_1341782_+	EscN/YscN/HrcN family type III secretion system ATPase	NA	NA	NA	NA	NA
WP_019719525.1|1341778_1342279_+	type III secretion protein HrpB7	NA	NA	NA	NA	NA
WP_011004169.1|1342290_1343139_+	EscT/YscT/HrcT family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_011004170.1|1343271_1344705_+	transcriptional regulator HrpB	NA	NA	NA	NA	NA
WP_020830091.1|1344851_1346558_+	EscC/YscC/HrcC family type III secretion system outer membrane ring protein	NA	NA	NA	NA	NA
WP_029240527.1|1346686_1349761_-	protein popC	NA	NA	NA	NA	NA
WP_016727614.1|1349769_1350294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019719527.1|1350366_1351383_-	hypersensitive response elicitor PopA1	NA	NA	NA	NA	NA
WP_058907536.1|1351806_1354119_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_058907537.1|1354409_1355855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081049919.1|1355877_1357467_-	glycoside hydrolase family 28 protein	NA	NA	NA	NA	NA
WP_058907539.1|1357699_1360003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011004179.1|1360296_1361196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038938578.1|1361200_1361497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103025987.1|1361871_1364712_+	cell division protein FtsK	NA	S5VNE3	Mycobacterium_phage	47.6	6.7e-84
WP_081049918.1|1364754_1366866_+	type III effector protein	NA	NA	NA	NA	NA
WP_071653928.1|1366906_1367731_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_103026046.1|1367774_1369250_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_103026047.1|1370515_1371577_+	peptidase C55	NA	NA	NA	NA	NA
WP_103025988.1|1371666_1374630_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.6	0.0e+00
WP_103025989.1|1374786_1375344_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	62.4	2.4e-54
WP_072633711.1|1376119_1376305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058908707.1|1376303_1378004_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011004204.1|1378466_1378850_-	DUF4437 domain-containing protein	NA	NA	NA	NA	NA
WP_086005422.1|1380359_1381510_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.1	1.7e-94
WP_103025508.1|1382066_1383300_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	79.5	2.8e-127
WP_016723619.1|1384590_1385556_-|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
>prophage 6
NZ_CP025986	Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence	2212170	1516587	1562889	2212170	transposase,tRNA	Klosneuvirus(20.0%)	38	NA	NA
WP_058907497.1|1516587_1518540_-|tRNA	class I tRNA ligase family protein	tRNA	A0A1V0SK04	Klosneuvirus	24.7	1.5e-42
WP_071507247.1|1518526_1520068_-	PLP-dependent transferase	NA	NA	NA	NA	NA
WP_071507246.1|1520290_1522300_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_028854274.1|1522441_1522996_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016723217.1|1523207_1523924_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016723220.1|1525689_1525971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158655416.1|1526088_1527048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103025546.1|1527171_1528158_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	82.3	2.2e-151
WP_011003443.1|1528582_1529914_+|transposase	IS701-like element ISRso17 family transposase	transposase	NA	NA	NA	NA
WP_071653928.1|1530012_1530837_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011004250.1|1531261_1531933_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_058908455.1|1532098_1533631_+	nitric oxide reductase transcriptional regulator NorR	NA	NA	NA	NA	NA
WP_011004252.1|1533729_1534686_-	L-threonine 3-dehydrogenase	NA	NA	NA	NA	NA
WP_016723017.1|1534685_1535885_-	glycine C-acetyltransferase	NA	G9E4Q1	Emiliania_huxleyi_virus	30.0	2.4e-38
WP_028854372.1|1535999_1536605_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_058908459.1|1536996_1539042_+	ribonucleoside triphosphate reductase	NA	D9ZNH0	Clostridium_phage	45.4	9.6e-141
WP_011004256.1|1539038_1539215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103026000.1|1539177_1539897_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	NA	NA	NA	NA
WP_011004258.1|1539901_1540579_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_058908454.1|1540612_1541032_-	zinc-binding protein	NA	NA	NA	NA	NA
WP_011004260.1|1541046_1541478_-	SCP2 domain-containing protein	NA	NA	NA	NA	NA
WP_058908453.1|1541474_1542359_-	U32 family peptidase	NA	NA	NA	NA	NA
WP_011004262.1|1542378_1543398_-	U32 family peptidase	NA	NA	NA	NA	NA
WP_058908452.1|1543442_1544717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058908451.1|1544971_1546285_+	NarK/NasA family nitrate transporter	NA	NA	NA	NA	NA
WP_058908458.1|1546337_1547723_+	NarK family nitrate/nitrite MFS transporter	NA	NA	NA	NA	NA
WP_058908450.1|1547891_1551629_+	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_016727493.1|1551625_1553173_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	43.1	3.4e-21
WP_011004268.1|1553190_1553871_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_019719643.1|1553878_1554562_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_011004270.1|1554563_1555085_+	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_029240555.1|1555146_1557102_+	nitrate/nitrite sensor histidine kinase	NA	NA	NA	NA	NA
WP_016727496.1|1557137_1557806_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016723001.1|1558272_1558776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016723000.1|1558978_1559263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011003443.1|1559796_1561128_-|transposase	IS701-like element ISRso17 family transposase	transposase	NA	NA	NA	NA
WP_071653928.1|1561236_1562061_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_103025478.1|1562086_1562889_-|transposase	IS5-like element IS1421 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP025986	Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence	2212170	1579052	1649836	2212170	transposase	Burkholderia_phage(22.22%)	55	NA	NA
WP_103025546.1|1579052_1580039_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	82.3	2.2e-151
WP_103026002.1|1580108_1580282_+	MbtH family NRPS accessory protein	NA	NA	NA	NA	NA
WP_058908631.1|1580509_1582123_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_058908630.1|1582232_1583900_+	cyclic peptide export ABC transporter	NA	G3M9Y6	Bacillus_virus	24.7	4.3e-06
WP_011003935.1|1584267_1584699_+	YciI family protein	NA	NA	NA	NA	NA
WP_058908629.1|1584729_1586004_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_058908628.1|1586093_1587272_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	30.4	6.1e-23
WP_016723619.1|1587421_1588387_-|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_016723619.1|1588713_1589679_+|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_158655415.1|1589845_1594321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103025546.1|1594374_1595361_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	82.3	2.2e-151
WP_103025565.1|1595425_1596676_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.2	1.2e-40
WP_058908769.1|1596974_1598210_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_058908765.1|1599042_1600041_-	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_019719314.1|1600551_1601202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071615603.1|1601295_1601589_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_103025859.1|1602147_1603599_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_058908766.1|1604569_1606561_-	phospholipase	NA	NA	NA	NA	NA
WP_058908771.1|1606590_1607829_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_103026003.1|1607901_1609911_-	phospholipase	NA	NA	NA	NA	NA
WP_071507931.1|1613411_1614485_+	HoxN/HupN/NixA family nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_016723929.1|1614481_1614811_+	ferredoxin protein	NA	NA	NA	NA	NA
WP_103026004.1|1614807_1618935_+	cobaltochelatase subunit CobN	NA	NA	NA	NA	NA
WP_058908661.1|1618931_1620848_+	putative cobaltochelatase	NA	NA	NA	NA	NA
WP_086005422.1|1621348_1622498_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.1	1.7e-94
WP_011003922.1|1622765_1623473_+	cobalt-precorrin-7 (C(5))-methyltransferase	NA	NA	NA	NA	NA
WP_058908660.1|1623469_1625074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021155658.1|1625076_1626228_+	cobalamin biosynthesis protein CbiD	NA	NA	NA	NA	NA
WP_011003919.1|1626224_1626956_+	precorrin-2 C(20)-methyltransferase	NA	NA	NA	NA	NA
WP_019719324.1|1626952_1627768_+	precorrin-4 C(11)-methyltransferase	NA	NA	NA	NA	NA
WP_058908659.1|1627764_1628529_+	cobalamin biosynthesis protein CbiG	NA	NA	NA	NA	NA
WP_058908658.1|1628525_1630085_+	precorrin-3B C(17)-methyltransferase	NA	NA	NA	NA	NA
WP_058908657.1|1630089_1631193_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_011003914.1|1631224_1631827_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_103026005.1|1631823_1633146_+	cobyrinate a,c-diamide synthase	NA	NA	NA	NA	NA
WP_011003912.1|1633142_1633793_+	5,6-dimethylbenzimidazole synthase	NA	NA	NA	NA	NA
WP_058908664.1|1634013_1634631_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_135006099.1|1634634_1635006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058908655.1|1635033_1635402_+	DUF2784 domain-containing protein	NA	NA	NA	NA	NA
WP_028854186.1|1635718_1637026_+	MFS transporter	NA	NA	NA	NA	NA
WP_058908654.1|1637083_1637686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016723918.1|1637798_1638131_-	DUF2322 family protein	NA	NA	NA	NA	NA
WP_058908653.1|1638383_1638890_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_087451503.1|1638919_1639724_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_058908822.1|1639769_1640105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081049997.1|1640467_1640989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058908821.1|1641143_1641524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016727726.1|1641545_1642637_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	E3SNZ1	Prochlorococcus_phage	37.7	1.1e-07
WP_058908820.1|1642669_1643224_-	phenylacetate-CoA oxygenase subunit PaaJ	NA	NA	NA	NA	NA
WP_011003904.1|1643217_1644024_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_011003903.1|1644033_1644321_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_019719336.1|1644332_1645361_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_058908819.1|1645925_1647917_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_103026006.1|1648491_1648881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087451503.1|1649030_1649836_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP025986	Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence	2212170	1765305	1902476	2212170	transposase,integrase	Tupanvirus(17.65%)	107	1778792:1778851	1846613:1847716
WP_103025546.1|1765305_1766292_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	82.3	2.2e-151
WP_103025549.1|1766455_1767538_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_058908115.1|1768068_1768812_+	acetoacetate decarboxylase	NA	NA	NA	NA	NA
WP_016724741.1|1768856_1769642_+	3-hydroxybutyrate dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.1	3.8e-05
WP_058908116.1|1769673_1770942_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_058908117.1|1770958_1772056_-	oxidoreductase	NA	NA	NA	NA	NA
WP_029240547.1|1772321_1774454_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_038938784.1|1775665_1776679_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_103025546.1|1777673_1778660_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	82.3	2.2e-151
1778792:1778851	attL	TTCCCTAAGAAAGGCAAACATTCGGTTGGCGTGGCACGCCAATATTGCGGCCAGCTTGGC	NA	NA	NA	NA
WP_011004363.1|1786316_1786877_-	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_058908461.1|1786885_1788622_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_058908462.1|1789152_1790307_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_011004366.1|1790359_1790656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049832947.1|1790917_1791703_-	DUF2968 domain-containing protein	NA	NA	NA	NA	NA
WP_103026014.1|1793223_1794885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011004370.1|1794931_1795261_-	DUF3613 domain-containing protein	NA	NA	NA	NA	NA
WP_058908475.1|1795257_1796169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021155625.1|1797158_1798085_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_103026015.1|1798077_1799430_-	CpaF family protein	NA	NA	NA	NA	NA
WP_011004375.1|1799426_1800746_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_021155626.1|1800764_1802129_-	type II and III secretion system protein family protein	NA	NA	NA	NA	NA
WP_058908463.1|1802121_1803063_-	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_011004379.1|1803114_1803606_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_038962604.1|1803683_1804235_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_011004381.1|1804244_1804421_-	Flp family type IVb pilin	NA	NA	NA	NA	NA
WP_058908464.1|1804996_1806058_-	collagen-like triple helix repeat-containing protein	NA	NA	NA	NA	NA
WP_058908465.1|1806532_1807912_+	hemagglutinin	NA	NA	NA	NA	NA
WP_019719717.1|1808209_1809883_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_021155630.1|1810005_1811298_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_058908466.1|1811537_1813625_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	A0A127AWB9	Bacillus_phage	25.4	7.5e-08
WP_011004387.1|1814013_1814322_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_028854447.1|1814427_1815969_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.3	3.5e-10
WP_058908467.1|1816105_1817542_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_011004390.1|1817592_1818618_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.4	1.4e-79
WP_058908468.1|1818777_1819749_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011004393.1|1820536_1821325_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_011004394.1|1821321_1822719_+	alpha,alpha-trehalose-phosphate synthase (UDP-forming)	NA	NA	NA	NA	NA
WP_011004395.1|1822783_1823245_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011004396.1|1823391_1823817_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_058908469.1|1823863_1824883_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	38.3	3.8e-53
WP_020829910.1|1824973_1825747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019719712.1|1825851_1826799_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058908470.1|1827080_1828154_+	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	25.1	1.1e-15
WP_058908472.1|1829801_1833011_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.1	3.4e-68
WP_028854458.1|1833030_1834557_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_058908473.1|1834734_1835550_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_103026016.1|1835763_1836861_+	low specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_103025859.1|1837160_1838612_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_038938784.1|1839836_1840850_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_071624213.1|1842073_1843645_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.2	1.3e-73
WP_103025506.1|1843676_1844027_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.3	7.1e-20
WP_103025505.1|1844026_1844491_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011004407.1|1844634_1845042_-	DUF2000 family protein	NA	NA	NA	NA	NA
WP_011004408.1|1845119_1845608_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_058908878.1|1845674_1846172_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_011003443.1|1846306_1847638_+|transposase	IS701-like element ISRso17 family transposase	transposase	NA	NA	NA	NA
WP_020371865.1|1849112_1849817_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	31.8	6.1e-10
1846613:1847716	attR	TTCCCTAAGAAAGGCAAACATTCGGTTGGCGTGGCACGCCAATATTGCGGCCAGCTTGGCAAACAGGACAACTGCCAGGTGGCAGTCAGCCTGTCGCTGGCCACAGAGCAAGGCAGCCTTCCGATTGCCTATCAGCTTTATCTCCCCAAGGAATGGGCCGACGATGCGACTCGCCGCCAGAAGGCCGGCGTGCCTGACGATATCGTGTTCGCCACCAAGCCGGAGATTGCCCTGGCGCAAGTGCGCGAGGCGATCGCAGCCGGGGTGCCAGCCGGAGTCGTGCTGGCCGACGCTGCATATGGCGATGAAACCGGGTTTCGCGAAAATCTGACCGAGTTGGGTCTGCTTTACGCCGTCGGGATTCGCTCCACGACGACGGTGTGGCCGCCGGGCGTTTCGCCACTGCCGGCCAAACCGGCGAGCGGTCCGGGTAGGCCACCGAAGTTGTTGCGTCGCGCACCGGGCCATGAGCCGGTTTCAGTGAAGACCCTGGCGATGGCATTACCCTCGAGCGCTTACCAAGTGGTGACTTGGCGGGAAGGCATCAATACAGCCCTTTCATCGCGATTTGCGGCCGTGCGGGTTCGCCCGGCGCATCGGGACTATTGGCGCAGCACCTTGCGCGACGAAGAATGGTTGCTGGTTGAGTGGCCGGGGGGCGAAGCGGAGCCAACCAAATACTTCTTGTCCACAGCACCAGCCGATGCGCTGATAGAACAACTGGTGTTCGTGACCAAAATGCGTTGGCGTATTGAGCGCGATTACCAGGACTTGAAACAAGAGCTCGGCCTTGGTCACTACGAAGGCCGGGGCTGGCGCGGATTCCACCATCATGCGACGCTGAGTATCGCAGCCTATGGCTTCCTGATGGCCGAACGACTCGCTGCAGACAAGCCCGTGGGGAATAAAAAAAACTTCCTCGAATGCCAGATACCTGCGCTTCCCGCGGATTACATCCCCCGTGGCAGCCCTGCGTGCGCAGCGACACGTGACGAATTCAATCCCCACACTCCGTCATCAACTTAGCTACCACCTGATGCGCAGCCTTGGGCTTTGCCCATGCTGCGCGTCGGGCTGATCAATCACATTTGTGACACAGTAAGA	NA	NA	NA	NA
WP_020829900.1|1849819_1850752_-	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_016726919.1|1850772_1851141_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_028861799.1|1851288_1852293_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058907295.1|1852530_1852830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028861801.1|1852853_1853918_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	41.9	3.2e-79
WP_103026017.1|1853914_1854604_+	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016726916.1|1854605_1855586_+	amidohydrolase	NA	NA	NA	NA	NA
WP_016726915.1|1855702_1856080_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_058907293.1|1856760_1857498_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_058907292.1|1858309_1858903_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058907291.1|1859114_1860203_+	hydrolase	NA	NA	NA	NA	NA
WP_058907290.1|1860284_1861205_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011004413.1|1861228_1862296_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	47.2	3.2e-87
WP_058907289.1|1862644_1863616_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016726143.1|1863788_1864454_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_103026018.1|1864459_1864954_-	arsenate reductase ArsC	NA	NA	NA	NA	NA
WP_011004418.1|1865051_1865375_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_058907288.1|1865697_1867122_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_058907287.1|1867319_1867787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016724496.1|1867910_1868312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058907286.1|1868441_1868870_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_103026019.1|1869109_1869688_-	suppressor of fused domain protein	NA	NA	NA	NA	NA
WP_103026020.1|1869689_1869893_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_016723619.1|1870050_1871016_-|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_020829882.1|1875446_1875869_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_058907283.1|1875920_1878203_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_016724492.1|1878681_1879578_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011004430.1|1879853_1880387_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011004432.1|1881764_1882679_+	glutaminase	NA	NA	NA	NA	NA
WP_019719674.1|1882935_1883622_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016726158.1|1883618_1884356_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.8	2.0e-19
WP_058907282.1|1884399_1885296_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011004436.1|1885399_1886026_+	NADPH-dependent F420 reductase	NA	NA	NA	NA	NA
WP_072633714.1|1886057_1887779_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011004439.1|1887890_1888088_+	tautomerase	NA	NA	NA	NA	NA
WP_019719669.1|1888176_1888986_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058907281.1|1889074_1889569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011004442.1|1889673_1892421_-	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	31.0	8.1e-10
WP_016726161.1|1893118_1893424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011004443.1|1893420_1893852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058907279.1|1893902_1894877_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011004445.1|1894851_1895100_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_011004446.1|1895331_1895772_+	universal stress protein	NA	NA	NA	NA	NA
WP_011004447.1|1895845_1896373_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_011004448.1|1896508_1897168_-	response regulator	NA	NA	NA	NA	NA
WP_058907278.1|1897151_1898690_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_058907277.1|1898743_1899007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038937866.1|1899139_1899841_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011003443.1|1900194_1901526_+|transposase	IS701-like element ISRso17 family transposase	transposase	NA	NA	NA	NA
WP_071653928.1|1901651_1902476_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP025986	Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence	2212170	2087075	2144887	2212170	transposase	Burkholderia_virus(16.67%)	50	NA	NA
WP_087451503.1|2087075_2087881_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_139180419.1|2088201_2088588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074960931.1|2088751_2090050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103025508.1|2090233_2091467_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	79.5	2.8e-127
WP_016725410.1|2091564_2092023_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_089190850.1|2092499_2093865_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	53.8	7.2e-76
WP_058908294.1|2093939_2094413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058908295.1|2094676_2096056_+	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	32.1	6.6e-61
WP_011004631.1|2096138_2096480_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_016724601.1|2096579_2097137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011004633.1|2097444_2098449_+	sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_058908296.1|2098472_2101106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016723494.1|2101415_2101967_+	YggT family protein	NA	NA	NA	NA	NA
WP_058908297.1|2102088_2102271_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_016723495.1|2102280_2102517_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_058908298.1|2103254_2104394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058908299.1|2104533_2105622_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011004640.1|2105652_2106414_-	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_011004641.1|2106423_2107191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058908300.1|2107206_2109066_-	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_011004643.1|2109062_2111153_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_011004644.1|2111359_2112523_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_016723501.1|2112763_2113438_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_103026031.1|2113460_2114786_-	MFS transporter	NA	NA	NA	NA	NA
WP_011004647.1|2114862_2115327_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_058908302.1|2115470_2116418_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_071507757.1|2116535_2117579_+	porin	NA	NA	NA	NA	NA
WP_071507747.1|2117591_2119472_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_011004651.1|2119547_2120210_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_011004652.1|2120209_2120611_-	chemotaxis protein CheY	NA	Q8QKV4	Ectocarpus_siliculosus_virus	46.2	8.8e-06
WP_019719938.1|2120785_2121925_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_011004654.1|2121945_2122647_-	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_011004655.1|2122643_2123522_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_058908304.1|2124137_2125961_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.2	7.8e-09
WP_011004657.1|2126128_2126620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058908305.1|2126689_2128864_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_103026032.1|2128882_2129296_-	response regulator	NA	NA	NA	NA	NA
WP_011004660.1|2129340_2130285_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_003263511.1|2130369_2131230_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_011004661.1|2131681_2132242_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_003263508.1|2132316_2132634_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_081049967.1|2133386_2133746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011004663.1|2133802_2134249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103026033.1|2134334_2135948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058908307.1|2136162_2137566_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_011004666.1|2137640_2138480_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_058908308.1|2138497_2141311_-	non-ribosomal peptide synthetase	NA	NA	NA	NA	NA
WP_103025546.1|2141445_2142432_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	82.3	2.2e-151
WP_011003443.1|2142649_2143981_-|transposase	IS701-like element ISRso17 family transposase	transposase	NA	NA	NA	NA
WP_071653928.1|2144062_2144887_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
