The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025703	Escherichia coli strain BH100N substr. MG2017 chromosome, complete genome	5116034	134853	198761	5116034	bacteriocin,tRNA,protease,transposase	Erysipelothrix_phage(10.0%)	56	NA	NA
WP_000471925.1|134853_135138_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_001311381.1|135305_135545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000282227.1|135545_135836_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_000085117.1|136002_136191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000543774.1|136244_136535_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_000331776.1|136990_137755_+	pyruvate dehydrogenase complex transcriptional repressor PdhR	NA	NA	NA	NA	NA
WP_000003823.1|137915_140579_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_000963500.1|140593_142486_+	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_000102485.1|142693_144118_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
WP_000784420.1|144359_146117_-	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_001295775.1|146470_149068_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_001346485.1|149242_149605_+	YacL family protein	NA	NA	NA	NA	NA
WP_000734302.1|149642_150437_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_000818414.1|150452_151319_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_001295568.1|151424_151772_-	YacC family pilotin-like protein	NA	NA	NA	NA	NA
WP_001189641.1|151937_153488_+	multicopper oxidase CueO	NA	NA	NA	NA	NA
WP_099989771.1|153745_155093_+|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_001298426.1|155180_157571_-	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|157776_158313_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651600.1|158353_159016_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150638.1|159124_160051_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000972203.1|160047_160818_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000901994.1|160922_161363_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000277856.1|161426_162656_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000621507.1|162659_163040_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_000339891.1|163313_164246_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	48.4	6.5e-60
WP_000905378.1|164599_165451_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_000805441.1|165462_166257_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_000846619.1|166368_167631_-	fimbrial-like adhesin	NA	NA	NA	NA	NA
WP_001247914.1|167680_168277_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001298424.1|168303_168912_-	fimbrial-like protein YadL	NA	NA	NA	NA	NA
WP_000591066.1|168923_169490_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000153318.1|169506_172095_-	outer membrane usher protein	NA	NA	NA	NA	NA
WP_000465917.1|172129_172870_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_000038450.1|172978_173569_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000215149.1|173930_174410_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_000174643.1|174406_175825_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937411.1|175863_176790_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|176826_177282_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396047.1|177459_178164_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294708.1|178178_178709_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001298420.1|178782_181212_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	28.8	2.1e-41
WP_000918171.1|181305_183840_+	bifunctional glycosyl transferase/transpeptidase	NA	NA	NA	NA	NA
WP_000035485.1|184059_186303_+	ferrichrome porin FhuA	NA	NA	NA	NA	NA
WP_001158929.1|186353_187151_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
WP_001298425.1|187150_188041_+	Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD	NA	NA	NA	NA	NA
WP_000044106.1|188037_190020_+	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
WP_000045295.1|190054_191335_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_000845408.1|191559_192981_+	H(+)/Cl(-) exchange transporter ClcA	NA	NA	NA	NA	NA
WP_120795373.1|193004_193070_+	protein YadW	NA	NA	NA	NA	NA
WP_001295564.1|193062_193407_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
WP_000964221.1|193453_194077_-	TRIC cation channel family protein	NA	NA	NA	NA	NA
WP_001298427.1|194114_194915_-	vitamin B12 ABC transporter substrate-binding protein BtuF	NA	NA	NA	NA	NA
WP_000689844.1|194907_195606_-	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_000057086.1|195689_197207_+	dGTPase	NA	NA	NA	NA	NA
WP_000753942.1|197336_198761_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
>prophage 2
NZ_CP025703	Escherichia coli strain BH100N substr. MG2017 chromosome, complete genome	5116034	211980	273007	5116034	tRNA,protease,plate,transposase	Emiliania_huxleyi_virus(11.11%)	50	NA	NA
WP_001298422.1|211980_213333_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|213362_215795_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|215916_216402_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139282.1|216405_217431_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|217535_217991_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|217994_218783_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139678.1|218782_219931_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569423.1|219927_220524_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
WP_001294798.1|220560_224043_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	3.7e-209
WP_000055741.1|224055_225015_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020992.1|225112_227254_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901082.1|227310_227700_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176517.1|227764_229078_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062311.1|229111_229372_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|229358_229559_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185283.1|229724_230270_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635527.1|230266_230689_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239186.1|230702_231413_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_099989771.1|231581_232929_+|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_000360465.1|233003_233828_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260694.1|233880_235599_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094007.1|235709_236417_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202331.1|236413_236818_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874226.1|236935_237751_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294595.1|237790_238444_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593991.1|238436_239468_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140167.1|239655_240228_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997016.1|245897_246701_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.8	6.0e-38
WP_000648563.1|246697_247612_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|247852_248653_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211721.1|248730_249501_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644691.1|249549_250908_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052743.1|250979_251735_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001298196.1|251768_252491_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917867.1|252487_252955_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	8.0e-51
WP_001298181.1|253019_253751_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	5.8e-40
WP_001049698.1|254288_255074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000013180.1|255413_255893_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000069182.1|255910_257269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023151815.1|257279_260747_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001298176.1|260826_262269_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088598.1|262273_263017_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614309.1|263013_265776_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.1	3.6e-82
WP_001282177.1|265785_266550_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000224521.1|266554_267901_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001013428.1|267903_268428_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000433567.1|268424_269717_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000896716.1|269721_270771_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000863399.1|270734_272576_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001189667.1|272581_273007_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 3
NZ_CP025703	Escherichia coli strain BH100N substr. MG2017 chromosome, complete genome	5116034	291527	327642	5116034	protease,transposase	Streptococcus_phage(20.0%)	33	NA	NA
WP_000006241.1|291527_292025_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_071778446.1|292107_292317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001298188.1|292344_294084_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207578.1|294028_294814_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226168.1|294884_295940_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|295991_296285_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263500.1|296287_296686_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059895.1|296695_297148_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001335538.1|297325_298477_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.8	7.8e-31
WP_000602124.1|298473_299088_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292999.1|299144_300602_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291991.1|300862_301321_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189578.1|301412_302657_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174703.1|302714_303116_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749900.1|303154_304210_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	1.0e-117
WP_001285288.1|304498_305602_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893298.1|305613_306867_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	5.8e-96
WP_001335540.1|307367_307964_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	88.4	1.7e-98
WP_000258743.1|308050_309688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000266639.1|310379_310607_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000120393.1|310712_310940_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000335706.1|311188_312622_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000282079.1|313591_314155_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_089644009.1|314362_315894_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.0	2.8e-44
WP_001298025.1|316839_317862_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	6.0e-200
WP_021573801.1|317861_318641_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	2.2e-138
WP_000273845.1|318691_320443_-	NTPase	NA	NA	NA	NA	NA
WP_071587598.1|321440_321683_-	DUF4158 domain-containing protein	NA	NA	NA	NA	NA
WP_001335133.1|321963_322998_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	43.4	1.4e-71
WP_065377602.1|323874_324729_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	40.9	2.9e-51
WP_000165816.1|324725_325025_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024186735.1|326500_326779_+	microcin McmA	NA	NA	NA	NA	NA
WP_000406621.1|326955_327642_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP025703	Escherichia coli strain BH100N substr. MG2017 chromosome, complete genome	5116034	1020517	1028240	5116034	integrase	uncultured_Caudovirales_phage(50.0%)	10	1014504:1014518	1026844:1026858
1014504:1014518	attL	GCTCACGGGCCAGAT	NA	NA	NA	NA
WP_000188148.1|1020517_1022464_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|1022536_1022761_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000085201.1|1023165_1024404_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	52.2	2.0e-125
WP_001206970.1|1024813_1025023_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	67.9	2.2e-16
WP_000103622.1|1025161_1025341_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	58.6	1.2e-10
WP_021527564.1|1025474_1025672_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609226.1|1025664_1025976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000543626.1|1025968_1026196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000791981.1|1026201_1026489_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761778.1|1026485_1028240_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.8	2.2e-93
1026844:1026858	attR	ATCTGGCCCGTGAGC	NA	NA	NA	NA
>prophage 5
NZ_CP025703	Escherichia coli strain BH100N substr. MG2017 chromosome, complete genome	5116034	1282273	1327376	5116034	tail,terminase,integrase,capsid,portal,head,tRNA,lysis	Enterobacteria_phage(55.77%)	60	1274908:1274923	1334553:1334568
1274908:1274923	attL	TAGCTTTGGAAAACAG	NA	NA	NA	NA
WP_001298466.1|1282273_1283380_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1283433_1283895_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248675.1|1283904_1284558_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|1284729_1285980_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741330.1|1286093_1287236_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	99.4	3.1e-205
WP_000088653.1|1287225_1287462_-	excisionase	NA	NA	NA	NA	NA
WP_000488406.1|1287601_1287841_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000763364.1|1287888_1288107_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_001308571.1|1288205_1288487_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.2e-46
WP_000548537.1|1288497_1288689_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000682300.1|1288661_1288844_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000186833.1|1288840_1289521_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000100847.1|1289517_1290303_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995491.1|1290308_1290605_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_000233576.1|1290679_1290886_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000866321.1|1291361_1291739_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000380252.1|1291716_1292778_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_001337214.1|1292858_1293551_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
WP_000184665.1|1293661_1293889_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001182882.1|1293919_1294459_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
WP_001546578.1|1294545_1295475_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.7	5.6e-112
WP_000788796.1|1295471_1296185_+	hypothetical protein	NA	G8C7U6	Escherichia_phage	83.4	9.8e-109
WP_000608370.1|1296263_1296692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000182282.1|1296688_1297066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001053041.1|1297333_1297789_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	7.0e-60
WP_000224917.1|1297788_1297959_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	2.0e-12
WP_000774485.1|1297951_1298242_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	9.6e-47
WP_001099712.1|1298238_1298601_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971056.1|1298597_1298738_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204776.1|1298823_1299207_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000737271.1|1299395_1300478_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_000839596.1|1301066_1301282_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135283.1|1301281_1301779_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	2.1e-89
WP_001228695.1|1301995_1302178_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|1302268_1302562_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|1303042_1303369_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881607.1|1303575_1303758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000867568.1|1304321_1304870_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001304453.1|1304841_1306770_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	3.3e-260
WP_023151962.1|1306753_1306960_+|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_000831760.1|1306956_1308549_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	6.5e-185
WP_001253894.1|1308538_1310044_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.2	1.3e-99
WP_000256813.1|1310080_1310428_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.6e-22
WP_000522651.1|1310485_1311514_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.7e-115
WP_000201530.1|1311565_1311940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204540.1|1311932_1312286_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_001007375.1|1312297_1312876_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.2	1.7e-79
WP_000683149.1|1312872_1313268_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	5.0e-70
WP_001577918.1|1313275_1314016_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	6.1e-130
WP_000479163.1|1314031_1314454_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	2.4e-70
WP_000459487.1|1314435_1314870_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	97.5	6.5e-63
WP_023151960.1|1314862_1317424_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.0	0.0e+00
WP_000847349.1|1317420_1317750_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	98.2	2.8e-58
WP_016230622.1|1317749_1318448_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	6.2e-132
WP_044869897.1|1318452_1319196_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	7.7e-149
WP_000090917.1|1319132_1319765_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_052991286.1|1319825_1323224_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.8	0.0e+00
WP_023152091.1|1323290_1323890_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.5	2.3e-111
WP_024179053.1|1323954_1326795_+	membrane protein	NA	A0A0K2FIZ6	Escherichia_phage	92.3	2.5e-54
WP_023152094.1|1326794_1327376_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	1.6e-101
1334553:1334568	attR	TAGCTTTGGAAAACAG	NA	NA	NA	NA
>prophage 6
NZ_CP025703	Escherichia coli strain BH100N substr. MG2017 chromosome, complete genome	5116034	2769308	2845463	5116034	tail,holin,terminase,integrase,capsid,transposase,tRNA	Salmonella_phage(44.23%)	77	NA	NA
WP_000940006.1|2769308_2770049_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553454.1|2770167_2770971_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_001298397.1|2771115_2771970_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000983031.1|2772160_2773441_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_000244186.1|2773432_2774572_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_001298395.1|2774940_2775363_+	DoxX family protein	NA	NA	NA	NA	NA
WP_099156434.1|2775437_2776785_+|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_000158511.1|2776958_2777831_-	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_000700787.1|2777842_2778937_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_001276657.1|2778969_2779968_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000493464.1|2779992_2781504_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
WP_001124927.1|2781526_2782510_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001298394.1|2782606_2785888_-	DUF5107 domain-containing protein	NA	NA	NA	NA	NA
WP_001298408.1|2786005_2787199_+	ROK family protein	NA	NA	NA	NA	NA
WP_000919159.1|2787262_2788516_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_023151811.1|2788844_2790035_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|2790079_2790418_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001298400.1|2790478_2791813_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215878.1|2791802_2792516_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001297612.1|2792680_2794108_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_001298398.1|2794683_2798571_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.4	2.2e-130
WP_001298403.1|2800381_2800918_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000190644.1|2800942_2801578_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001298401.1|2801786_2802635_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001288820.1|2803272_2803920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000904982.1|2804000_2804555_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	87.3	3.7e-87
WP_021548385.1|2804584_2804974_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	43.8	3.6e-12
WP_001106827.1|2805000_2805441_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.7	5.6e-54
WP_000805550.1|2805412_2806006_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	64.9	4.5e-59
WP_029404455.1|2806005_2806800_-	hypothetical protein	NA	K7PH60	Enterobacterial_phage	92.3	6.3e-80
WP_000049952.1|2806799_2807480_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.8	3.4e-103
WP_001197080.1|2807476_2808676_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	83.9	1.7e-185
WP_001270631.1|2808675_2809029_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	88.9	1.5e-54
WP_000301073.1|2809028_2809781_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	65.9	2.5e-86
WP_000718774.1|2810222_2810996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824896.1|2811091_2811424_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	70.5	1.1e-22
WP_000081732.1|2811423_2812488_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	81.1	3.2e-156
WP_000155120.1|2812490_2812793_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	91.0	6.3e-49
WP_001298404.1|2812792_2813380_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.0	3.4e-83
WP_000990889.1|2813379_2815365_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	53.3	3.8e-174
WP_000393960.1|2815542_2815995_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.7	6.1e-56
WP_000109249.1|2815998_2816439_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_000046934.1|2816449_2817595_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.2	5.2e-160
WP_001298391.1|2817598_2818162_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.7	1.3e-79
WP_001142475.1|2818136_2818526_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	95.3	5.6e-66
WP_000008727.1|2818512_2819067_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	83.2	1.7e-79
WP_001125664.1|2819063_2819471_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.8	4.3e-69
WP_000627477.1|2819699_2820641_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.3	3.2e-155
WP_001066729.1|2820652_2821159_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	79.3	1.1e-69
WP_000873175.1|2821162_2822383_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	88.0	3.2e-200
WP_000184961.1|2822397_2823132_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	85.6	1.8e-97
WP_000113489.1|2823022_2824489_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.8	6.7e-261
WP_001130788.1|2824488_2826111_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.4	0.0e+00
WP_000162795.1|2826113_2826686_-|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	69.6	6.1e-61
WP_000779565.1|2826747_2827272_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	66.9	4.5e-42
WP_001194119.1|2827255_2827732_-	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	96.2	2.1e-86
WP_000781776.1|2827735_2828077_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	91.9	2.8e-53
WP_001174015.1|2828522_2828864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001244506.1|2828895_2829318_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	63.3	8.8e-41
WP_001337135.1|2829599_2831792_-	replication protein	NA	B6SCY1	Bacteriophage	71.3	1.2e-173
WP_000170998.1|2831795_2832008_-	helix-turn-helix transcriptional regulator	NA	A0A0R6PHL1	Moraxella_phage	42.9	7.9e-06
WP_000049986.1|2832128_2832752_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	44.8	3.3e-36
WP_000051353.1|2833531_2834434_+	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
WP_001113502.1|2834436_2835738_+	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	56.4	7.2e-134
WP_000769011.1|2835753_2836302_+	DUF2815 family protein	NA	Q775A5	Bordetella_phage	65.9	1.6e-66
WP_001298623.1|2836353_2836992_+	hypothetical protein	NA	H6WRY3	Salmonella_phage	68.8	3.9e-72
WP_000490741.1|2837059_2837329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065468.1|2837385_2839449_+	DNA polymerase	NA	Q775A3	Bordetella_phage	67.8	8.7e-275
WP_000216034.1|2839454_2839658_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	55.4	3.2e-12
WP_000008824.1|2839663_2839885_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000128190.1|2839874_2840357_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.6	3.6e-70
WP_000312950.1|2840356_2840650_+	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	68.2	5.0e-27
WP_085961393.1|2840619_2841651_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	53.0	1.1e-100
WP_000212683.1|2841647_2841968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001127138.1|2842002_2843397_+	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	74.7	7.3e-217
WP_001138328.1|2843590_2844988_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000054755.1|2845202_2845463_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	54.7	1.7e-18
>prophage 7
NZ_CP025703	Escherichia coli strain BH100N substr. MG2017 chromosome, complete genome	5116034	4149186	4160748	5116034	integrase	Enterobacteria_phage(88.89%)	13	4149004:4149026	4159638:4159660
4149004:4149026	attL	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
WP_001218974.1|4149186_4150374_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	91.2	1.5e-207
WP_000281857.1|4150420_4150948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001335488.1|4150954_4152040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000446153.1|4152336_4152909_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	5.0e-95
WP_000638629.1|4152982_4153483_-	transactivation protein	NA	NA	NA	NA	NA
WP_001279711.1|4153479_4154214_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	96.3	1.1e-126
WP_001149160.1|4154766_4155033_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980256.1|4155029_4155620_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	89.6	2.0e-59
WP_001244665.1|4155612_4155900_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459296.1|4155892_4156348_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|4156483_4156804_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783690.1|4156818_4159152_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
WP_001280586.1|4159710_4160748_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	43.6	7.4e-73
4159638:4159660	attR	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
>prophage 8
NZ_CP025703	Escherichia coli strain BH100N substr. MG2017 chromosome, complete genome	5116034	5022652	5089232	5116034	holin,tail,terminase,integrase,portal,protease,transposase,lysis	Enterobacteria_phage(45.83%)	71	5010675:5010709	5098083:5098117
5010675:5010709	attL	GTAGGCCGGATAAGGCGTTCACGCCGCATCCGGCA	NA	NA	NA	NA
WP_099989771.1|5022652_5024000_+|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_001298085.1|5024087_5026238_-	pyruvate/proton symporter BtsT	NA	NA	NA	NA	NA
WP_000919563.1|5026614_5028279_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_000118642.1|5028321_5029593_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_001235678.1|5029589_5030063_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000034589.1|5030126_5031098_-	DctP family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_001298060.1|5031788_5033441_+	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_000091596.1|5033611_5034517_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106005.1|5034655_5035678_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_001292636.1|5035817_5038109_-	phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase	NA	NA	NA	NA	NA
WP_001385190.1|5038362_5038857_-	DUF2501 domain-containing protein	NA	NA	NA	NA	NA
WP_000799911.1|5038905_5039643_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_001298056.1|5039645_5040185_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	3.8e-28
WP_000538188.1|5040292_5040766_-	threonine/serine exporter	NA	NA	NA	NA	NA
WP_001340933.1|5040756_5041527_-	threonine/serine exporter ThrE family protein	NA	NA	NA	NA	NA
WP_000936639.1|5042146_5042872_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001298690.1|5042829_5043507_+	DNA-binding transcriptional activator BglJ	NA	NA	NA	NA	NA
WP_000331596.1|5043544_5044333_-	siderophore-iron reductase FhuF	NA	NA	NA	NA	NA
WP_001350368.1|5044473_5044710_+	DUF1435 domain-containing protein	NA	NA	NA	NA	NA
WP_001272356.1|5045270_5046302_-	16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC	NA	NA	NA	NA	NA
WP_000204030.1|5046404_5046818_+	DNA polymerase III subunit psi	NA	NA	NA	NA	NA
WP_001092461.1|5046786_5047233_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_000870712.1|5047247_5047925_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_001218287.1|5048310_5049525_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	99.3	1.6e-236
WP_000653746.1|5049900_5050896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206728.1|5051463_5052084_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	95.6	1.2e-118
WP_001242728.1|5052083_5052446_-	hypothetical protein	NA	U5P092	Shigella_phage	95.8	1.3e-64
WP_000008232.1|5052436_5052973_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	100.0	7.4e-101
WP_000081256.1|5053100_5053925_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	6.6e-149
WP_000135680.1|5053990_5054353_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000500990.1|5054821_5055334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298691.1|5055649_5056342_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	99.1	7.3e-125
WP_001191672.1|5056439_5056700_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	98.8	9.3e-41
WP_000515840.1|5056692_5057244_+	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	97.8	1.1e-99
WP_001087311.1|5057240_5058077_+	hypothetical protein	NA	Q8SBF3	Shigella_phage	92.4	1.1e-138
WP_024179079.1|5058081_5058306_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	97.3	9.1e-37
WP_000061519.1|5058302_5059121_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.6	4.7e-123
WP_001315196.1|5059117_5059612_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	8.1e-86
WP_000066917.1|5059611_5060265_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210180.1|5060261_5060588_+	LexA family transcriptional regulator	NA	K7PLX6	Enterobacteria_phage	99.1	2.0e-53
WP_000767113.1|5060584_5060974_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061422.1|5060993_5061836_+	KilA-N domain-containing protein	NA	S5MC03	Escherichia_phage	91.8	5.7e-140
WP_001540821.1|5061843_5062833_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	8.1e-194
WP_001205460.1|5062850_5063192_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001131905.1|5063204_5063753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000868396.1|5063739_5064666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917727.1|5064930_5065134_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	3.0e-31
WP_000799673.1|5065284_5066337_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	98.9	2.6e-206
WP_001120490.1|5066413_5066740_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	98.1	2.6e-56
WP_001197768.1|5066743_5067220_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	2.5e-84
WP_001298489.1|5067216_5067660_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	93.9	1.5e-70
WP_000084843.1|5067698_5068073_+	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	87.9	2.5e-55
WP_000373423.1|5068711_5069206_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	99.4	3.8e-83
WP_000934116.1|5069205_5071308_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.6	0.0e+00
WP_001072975.1|5071304_5071517_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_072134767.1|5071444_5073025_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	2.1e-289
WP_001136583.1|5072969_5074997_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_001097050.1|5075083_5075407_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|5075399_5075675_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677099.1|5075686_5076265_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	2.1e-101
WP_001298485.1|5076261_5076663_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	1.6e-71
WP_000211128.1|5076673_5077417_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.0	1.6e-130
WP_001298500.1|5077477_5077864_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
WP_001161009.1|5077872_5078202_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000372054.1|5078173_5081239_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.8	0.0e+00
WP_000447254.1|5081238_5081568_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	5.1e-60
WP_001152410.1|5081577_5082276_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	1.9e-133
WP_000194752.1|5082281_5083025_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.8	2.2e-151
WP_032143682.1|5082922_5083570_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.7	3.0e-112
WP_021518114.1|5083630_5087113_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
WP_021518115.1|5087171_5089232_+	hypothetical protein	NA	A0A0E3M194	Enterobacteria_phage	54.9	5.7e-125
5098083:5098117	attR	GTAGGCCGGATAAGGCGTTCACGCCGCATCCGGCA	NA	NA	NA	NA
