The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026097	Lacticaseibacillus paracasei strain HDS-01 chromosome, complete genome	3038767	475862	597609	3038767	holin,transposase,integrase	Lactobacillus_phage(37.93%)	106	475843:475902	526079:527131
475843:475902	attL	CCTAGATTGCAATAATAAAGTTACCACCTAGAAAGAGGCTTGCTCACTGCTTGAACTGGG	NA	NA	NA	NA
WP_003574021.1|475862_476783_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003573651.1|478225_478810_-	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	43.9	5.9e-35
WP_103153475.1|479068_481798_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_072671939.1|481790_482507_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003583345.1|482517_483522_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_045137083.1|483595_484672_+	class C sortase	NA	NA	NA	NA	NA
WP_003573657.1|484862_485597_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	6.1e-13
WP_003583347.1|485589_487206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003583352.1|488186_489302_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003583354.1|489404_490286_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.0	3.9e-22
WP_003583356.1|490282_491431_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003583358.1|491459_491999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060417264.1|499427_504857_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_003583362.1|505362_507897_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.7	7.9e-68
WP_003583364.1|508480_509923_+	amino acid permease	NA	NA	NA	NA	NA
WP_003563498.1|510031_510535_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_003583367.1|510713_511607_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	22.3	2.0e-05
WP_003577882.1|511761_512628_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_003563502.1|512644_513478_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_101511936.1|513574_514471_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_103153477.1|514782_515964_+	MFS transporter	NA	NA	NA	NA	NA
WP_103153478.1|515982_516882_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_003573694.1|517326_518142_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_003583378.1|518174_519104_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	63.4	3.9e-105
WP_003577841.1|519335_520580_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	8.8e-12
WP_003577895.1|520763_521309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003577897.1|521629_522799_-|integrase	site-specific integrase	integrase	Q6J1W6	Lactobacillus_phage	97.9	4.3e-218
WP_003573997.1|522911_523172_-	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	40.7	2.5e-09
WP_016368286.1|523261_523882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572180.1|524293_525001_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_003574021.1|525197_526118_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_101511937.1|526214_526637_-	hypothetical protein	NA	A0A0P0IJN5	Lactobacillus_phage	38.4	3.0e-20
WP_003572184.1|526629_526983_-	helix-turn-helix transcriptional regulator	NA	A0A141E1M3	Streptococcus_phage	40.9	7.7e-14
WP_101511938.1|527226_527475_+	hypothetical protein	NA	A0A0P0ID24	Lactobacillus_phage	96.2	1.0e-36
526079:527131	attR	CCCAGTTCAAGCAGTGAGCAAGCCTCTTTCTAGGTGGTAACTTTATTATTGCAATCTAGGAATTAATGACTTTTCCAATTATACTGATATCATCTGCTTTTACCAGTTGGTTGCAAGCTAATTCAACAATGAACAGTCAGTAGTTTTCATAAAACCGTTCAATGCATTGAACGGCAGAATCCTCTAACCATTGCGGTATCGCTAAATCATTCATGAATTGGTCAATGTTTGCTGATTCTTCTGGAATGTCTGCGAAATACATTGGAACGATAATTGATAGCGCACGTTGGTTGGCTCCATTCTTTGTACGGCTTTTAGTGTATTGATTTGTGTATCGAAGCTTACCGTTATCCCCGTTGAGAATATGTGCACATTCATGAGCTGCTTGAAATGGCAACTCATTTGCATTCGGCCATTTGTTGTTAAGAATAATTAGGCGAGCTTCTGTATCAACCAAAGGGCCTTGGTCCTCGTGTAAGGGGATAGTCGAGCAGCCTATATTGTGATCCCAAGCATAGTCAATCACCTGATTCAACAAGTCCTCTATATGATCATTCATGACGATCACGCTTTTTGCTGCTATTATTGCGTCGTTCCAAAATAGCTTGAATGATTTCCCAATCGTCTTGGCGAACAGGCTGTCCTTGATAGGTAAAGATGTTTGTTCCTGACAGATCAACAGGTTTAGAACCTTCATTGTCAGGATTGGGGTTATCCGTATTGCCAAGTAAATAATCCACAGAAACTTGAAGAACATCAGCAACTTTCTGAACATTCTCGGTAGATGGGGTCATCTTTTTCCATCGATAGATGCTGTTAATGCCTATACCTGCTTTCAGAGCTAATTTTTGGAGTGACCACCCTCGATTTGAAGCTAGTGTTTTTATTCTGTCGTAAGTACTCATGAGACGAGTTCTCCCGGTCATGACGAATTATTTATCACAAGTGGTTTACAATTTATCACGTGTGGTTTACTATGAATTCATCAAGTAATTAAGCAAACATCAACAAGCTAATCCATCCATGTCTTTGGCGATAACGGTGGATAAGTAG	NA	NA	NA	NA
WP_101511939.1|527516_527717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572188.1|527687_528521_-	TIGR02391 family protein	NA	A0A1S5SBU1	Streptococcus_phage	37.8	2.8e-46
WP_016368112.1|528581_529340_+	ORF6C domain-containing protein	NA	A0A1B0YEA7	Lactobacillus_phage	48.9	7.1e-41
WP_103153479.1|529512_529764_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_003572199.1|529829_530186_+	DUF771 domain-containing protein	NA	U5U4L9	Lactobacillus_phage	98.3	2.0e-62
WP_003572201.1|530270_530474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003586921.1|530456_531002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003661649.1|531182_531497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003589925.1|532247_533072_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	75.1	6.6e-117
WP_003574016.1|533071_533590_+	exonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_003597560.1|533636_534059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016368116.1|534060_534798_+	hypothetical protein	NA	A0A097BY87	Enterococcus_phage	43.6	3.8e-47
WP_003574021.1|535291_536212_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_010493154.1|537119_537563_-	autolysin regulatory protein arpU	NA	A0A0P0IZI6	Lactobacillus_phage	97.3	1.2e-77
WP_032786488.1|538077_538410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003574021.1|538418_539339_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003583407.1|539983_540982_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.5	2.0e-54
WP_003573729.1|541177_541396_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010493173.1|542927_543263_+	ribonucleoside-diphosphate reductase	NA	A0A0N7IRA2	Lactobacillus_phage	90.6	6.8e-52
WP_076626284.1|543382_543715_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016370120.1|543744_544473_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	40.1	7.6e-32
WP_016383324.1|545391_546255_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	4.1e-24
WP_003582220.1|546936_547215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572355.1|547226_547493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572358.1|547511_547688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572360.1|547689_547917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003582223.1|547959_549201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003582225.1|549178_550729_+	DUF5011 domain-containing protein	NA	NA	NA	NA	NA
WP_003582226.1|550738_551158_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_003582228.1|551166_551745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003582234.1|556287_556623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003583424.1|556606_557203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003583426.1|557183_559112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003583427.1|559113_560124_+	C40 family peptidase	NA	A0A1X9SGZ2	Bradyrhizobium_phage	38.6	4.0e-15
WP_003582241.1|560139_560784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003583429.1|560780_561188_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_032800899.1|561177_561999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016383269.1|562601_562781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003593118.1|562821_563076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003593120.1|563065_563503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101511940.1|563495_564740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072672198.1|564781_565027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103153480.1|565013_567551_+	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_011674169.1|567891_567996_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_003583466.1|568285_568540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003582061.1|568542_568686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101511942.1|568678_569128_-	nitroreductase	NA	NA	NA	NA	NA
WP_003582058.1|569141_569432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072672202.1|569441_569888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003586154.1|572546_574481_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_003586156.1|574480_574918_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003586158.1|574931_575252_+	PTS fructose IIB component	NA	NA	NA	NA	NA
WP_003586160.1|575265_576393_+	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_032787044.1|576395_578990_+	glycosyl hydrolase family 38	NA	NA	NA	NA	NA
WP_003586163.1|579110_579974_+	glucose uptake protein	NA	NA	NA	NA	NA
WP_003586165.1|580590_581301_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003586168.1|581314_581797_+	PTS N-acetylgalactosamine transporter subunit IIB	NA	NA	NA	NA	NA
WP_003586170.1|581797_582607_+	PTS N-acetylgalactosamine transporter subunit IIC	NA	NA	NA	NA	NA
WP_003586172.1|582596_583409_+	PTS N-acetylgalactosamine transporter subunit IID	NA	NA	NA	NA	NA
WP_003586174.1|583410_583839_+	N-acetylglucosamine/galactosamine PTS, EIIA	NA	NA	NA	NA	NA
WP_101511943.1|584628_585415_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_002816607.1|586173_586857_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	2.1e-60
WP_072672305.1|587497_588070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016369712.1|588062_588512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016369713.1|588525_588816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032786516.1|589757_590657_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_016370188.1|591111_591783_+	class A sortase	NA	NA	NA	NA	NA
WP_003583502.1|591915_592146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101512327.1|592566_594123_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_002816607.1|594703_595387_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	2.1e-60
WP_005688360.1|595658_596813_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_101511944.1|596821_597609_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP026097	Lacticaseibacillus paracasei strain HDS-01 chromosome, complete genome	3038767	605431	639914	3038767	transposase	Staphylococcus_phage(37.5%)	30	NA	NA
WP_108315962.1|605431_605710_+|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	94.3	3.9e-29
WP_121497124.1|605763_606606_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	97.5	3.4e-153
WP_016374492.1|606833_607394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016374491.1|607657_607783_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	92.7	1.4e-15
WP_003582354.1|609103_610021_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_003582352.1|610167_610776_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	52.8	1.4e-50
WP_003582350.1|610786_612055_+	NADPH-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	48.2	2.2e-50
WP_003582348.1|612323_612752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003582346.1|612879_613056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016386656.1|613925_614609_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.3	1.8e-59
WP_004563097.1|615579_615996_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	56.9	3.9e-33
WP_003582108.1|616018_616354_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_003582109.1|616390_617686_-	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	61.9	2.0e-144
WP_016368213.1|617728_619459_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_003582114.1|619510_619834_-	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	42.7	5.2e-17
WP_003582117.1|619956_620553_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	36.5	5.1e-26
WP_101511946.1|621049_621837_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003574021.1|622535_623456_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003581836.1|624655_625399_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.5	1.5e-27
WP_016366710.1|625376_626624_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003581839.1|626628_627300_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016386656.1|627391_628075_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.3	1.8e-59
WP_003581966.1|628628_628892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016368446.1|628852_629503_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.8	4.3e-18
WP_003581973.1|630376_631699_-	MFS transporter	NA	NA	NA	NA	NA
WP_101511947.1|634061_634845_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_081528680.1|635120_636653_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_003567800.1|636652_637612_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.9	8.8e-28
WP_060417290.1|637617_638943_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003574021.1|638993_639914_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
>prophage 3
NZ_CP026097	Lacticaseibacillus paracasei strain HDS-01 chromosome, complete genome	3038767	1161868	1212758	3038767	holin,integrase,tail,head,portal,terminase,transposase,capsid	Lactobacillus_phage(86.54%)	67	1180255:1180268	1187477:1187490
WP_003577841.1|1161868_1163113_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	8.8e-12
WP_003566504.1|1163234_1163804_-	branched-chain amino acid ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_003585070.1|1163813_1164560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003569886.1|1164645_1166901_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	44.7	9.5e-158
WP_003569888.1|1167366_1167972_+	VanZ family protein	NA	NA	NA	NA	NA
WP_003566496.1|1168143_1169001_+	GRP family sugar transporter	NA	NA	NA	NA	NA
WP_003566494.1|1169214_1170555_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_101511974.1|1170681_1171866_-|integrase	site-specific integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	99.2	9.6e-226
WP_101511975.1|1171998_1172184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101511976.1|1172180_1172918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101511977.1|1173012_1173216_-	hypothetical protein	NA	A0A0P0IQK8	Lactobacillus_phage	91.0	4.4e-30
WP_003574518.1|1173239_1173665_-	pyridoxamine 5'-phosphate oxidase family protein	NA	A0A0P0I7K6	Lactobacillus_phage	86.5	2.7e-61
WP_101511978.1|1173999_1174590_-	DUF5067 domain-containing protein	NA	Q6SEF8	Lactobacillus_prophage	56.2	8.0e-40
WP_003605890.1|1174613_1175477_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_189260173.1|1175500_1175947_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_003582691.1|1175965_1176424_-	helix-turn-helix transcriptional regulator	NA	A0A0B5CYL9	Listeria_phage	34.1	5.7e-17
WP_003605888.1|1176587_1176851_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003574526.1|1176847_1177159_+	hypothetical protein	NA	A0A1B0Y2Q8	Lactobacillus_phage	100.0	2.2e-52
WP_016373289.1|1177155_1177365_-	hypothetical protein	NA	A0A1B0Y3M6	Lactobacillus_phage	98.6	1.1e-31
WP_164886371.1|1177452_1177599_+	hypothetical protein	NA	A0A1B0YC03	Lactobacillus_phage	97.9	5.0e-20
WP_003582311.1|1177664_1178213_+	hypothetical protein	NA	A0A1B0YE60	Lactobacillus_phage	98.9	4.1e-99
WP_003582309.1|1178191_1178413_+	helix-turn-helix domain-containing protein	NA	A0A0P0ID64	Lactobacillus_phage	100.0	1.4e-37
WP_101512331.1|1178653_1179061_+	hypothetical protein	NA	A0A0P0IXE5	Lactobacillus_phage	94.8	7.1e-72
WP_101511979.1|1179073_1179937_+	recombinase RecT	NA	A0A0P0IJP1	Lactobacillus_phage	95.8	7.9e-153
WP_101511980.1|1179917_1180718_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	91.3	7.6e-142
1180255:1180268	attL	GCGAAAAAGAAGAG	NA	NA	NA	NA
WP_060417211.1|1180733_1181585_+	DnaD domain protein	NA	A0A1B0Y2R2	Lactobacillus_phage	93.6	2.7e-105
WP_003585034.1|1181571_1182354_+	ATP-binding protein	NA	Q6J1V5	Lactobacillus_phage	91.9	1.1e-132
WP_101511981.1|1182350_1182683_+	hypothetical protein	NA	Q6J1V4	Lactobacillus_phage	78.2	4.5e-40
WP_060417213.1|1182679_1183129_+	hypothetical protein	NA	A0A0P0ID70	Lactobacillus_phage	98.7	1.3e-71
WP_019892351.1|1183175_1183430_+	hypothetical protein	NA	A0A0P0IQP0	Lactobacillus_phage	98.8	5.9e-40
WP_101511982.1|1183426_1183792_+	endodeoxyribonuclease	NA	A0A0P0HRU0	Lactobacillus_phage	99.2	5.3e-66
WP_101511983.1|1183805_1184657_+	DNA (cytosine-5-)-methyltransferase	NA	A8YQM6	Lactobacillus_phage	72.5	3.8e-107
WP_101511984.1|1184649_1185366_+	N-6 DNA methylase	NA	A8YQM7	Lactobacillus_phage	95.7	1.2e-125
WP_101511985.1|1185352_1186276_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	43.4	6.4e-68
WP_101511986.1|1186286_1186865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101511987.1|1186888_1186999_+	acetyltransferase	NA	A0A2D1GP93	Lactobacillus_phage	94.4	5.5e-11
WP_101511988.1|1186995_1187511_+	DUF1642 domain-containing protein	NA	Q8LTB6	Lactobacillus_phage	59.4	4.8e-49
1187477:1187490	attR	GCGAAAAAGAAGAG	NA	NA	NA	NA
WP_101511989.1|1187841_1188123_+	hypothetical protein	NA	A0A0A1EL18	Lactobacillus_phage	49.4	1.5e-15
WP_164886370.1|1188249_1188447_+	hypothetical protein	NA	A0A1B0Y850	Lactobacillus_phage	98.5	6.1e-29
WP_071253136.1|1188621_1189050_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_016375957.1|1189404_1190028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101511991.1|1190488_1191637_+	hypothetical protein	NA	A0A0P0I3G0	Lactobacillus_phage	97.4	7.6e-220
WP_101511992.1|1192022_1192712_+	helix-turn-helix domain-containing protein	NA	A0A1S5SAA7	Streptococcus_phage	48.9	8.2e-44
WP_052915997.1|1192695_1193949_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0P0I3B0	Lactobacillus_phage	99.0	1.1e-248
WP_101512333.1|1193953_1195381_+|portal	phage portal protein	portal	A0A0P0IJV3	Lactobacillus_phage	93.3	2.2e-253
WP_101511993.1|1195346_1196345_+|capsid	minor capsid protein	capsid	A0A0P0ID43	Lactobacillus_phage	95.7	2.4e-177
WP_101511994.1|1196354_1196681_+	hypothetical protein	NA	A0A0P0IJR5	Lactobacillus_phage	88.9	2.3e-49
WP_101511995.1|1196677_1197121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101511996.1|1197137_1197512_+	hypothetical protein	NA	A0A2D2W301	Escherichia_phage	55.3	1.1e-21
WP_101511997.1|1197629_1198268_+	DUF4355 domain-containing protein	NA	A0A0P0ID10	Lactobacillus_phage	93.4	2.4e-82
WP_063557949.1|1198280_1198595_+	hypothetical protein	NA	A0A0N7IR89	Lactobacillus_phage	93.3	1.8e-46
WP_101511998.1|1198608_1199628_+|capsid	major capsid protein	capsid	A0A0P0IZJ7	Lactobacillus_phage	98.8	4.7e-189
WP_101511999.1|1199855_1200230_+|head,tail	phage head-tail connector protein	head,tail	A0A0P0IV23	Lactobacillus_phage	87.9	9.5e-55
WP_101512000.1|1200234_1200537_+	hypothetical protein	NA	A0A0P0HRN0	Lactobacillus_phage	90.0	1.3e-46
WP_003584996.1|1200533_1200899_+	HK97 gp10 family phage protein	NA	A0A0P0IUZ3	Lactobacillus_phage	95.0	1.3e-56
WP_072671901.1|1200899_1201304_+	DUF3168 domain-containing protein	NA	A0A0P0I3C8	Lactobacillus_phage	97.8	1.7e-70
WP_101512001.1|1201315_1201918_+|tail	phage tail protein	tail	A0A0P0ID88	Lactobacillus_phage	88.6	1.2e-96
WP_101512002.1|1202003_1202336_+|tail	tail assembly chaperone	tail	A0A0P0IQQ6	Lactobacillus_phage	93.6	1.8e-49
WP_101512334.1|1202440_1202794_+	hypothetical protein	NA	A0A0P0I7N9	Lactobacillus_phage	95.7	4.0e-55
WP_101512003.1|1202786_1205876_+	tape measure protein	NA	A0A0P0IJD2	Lactobacillus_phage	96.9	8.4e-298
WP_101512004.1|1205878_1207888_+|tail	phage tail family protein	tail	B4XYQ4	Lactobacillus_phage	50.5	1.3e-166
WP_101512005.1|1207887_1210401_+|tail	phage tail protein	tail	B4XYQ5	Lactobacillus_phage	41.9	1.3e-155
WP_101512006.1|1210412_1210685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032779081.1|1210681_1210813_+	XkdX family protein	NA	A0A0P0HRS7	Lactobacillus_phage	60.5	4.0e-08
WP_003581984.1|1210868_1211144_+	hypothetical protein	NA	A0A0P0IZF9	Lactobacillus_phage	100.0	7.5e-49
WP_071252206.1|1211158_1211572_+|holin	phage holin	holin	A0A0N7IR91	Lactobacillus_phage	99.3	8.9e-46
WP_164886369.1|1211582_1212758_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0P0HRN9	Lactobacillus_phage	92.1	2.3e-211
>prophage 4
NZ_CP026097	Lacticaseibacillus paracasei strain HDS-01 chromosome, complete genome	3038767	1896576	1992976	3038767	protease,holin,integrase,tail,head,portal,terminase,transposase,tRNA,capsid	Lactobacillus_phage(78.33%)	94	1928024:1928048	1998564:1998588
WP_101512054.1|1896576_1897821_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	8.8e-12
WP_003575996.1|1897953_1899120_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_003575994.1|1899103_1900384_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_101512055.1|1900395_1901577_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_003566056.1|1901921_1902221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003584872.1|1902221_1903052_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_003584873.1|1903199_1903763_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_003584874.1|1903875_1904694_+	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_003566065.1|1904753_1905893_-	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_003584875.1|1907214_1907679_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003566070.1|1907671_1908124_-	SprT family protein	NA	NA	NA	NA	NA
WP_003584876.1|1908265_1909018_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.4	1.9e-09
WP_003584877.1|1909010_1909910_-	permease component of an ABC superfamily transporter	NA	NA	NA	NA	NA
WP_003584878.1|1909906_1910902_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003566078.1|1911387_1911825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003584879.1|1911961_1914622_-	cation-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	29.8	1.4e-75
WP_003584880.1|1914930_1916088_-	serine hydrolase	NA	NA	NA	NA	NA
WP_003566083.1|1916353_1917181_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.6	2.7e-70
WP_003579778.1|1917183_1918377_-	serine hydrolase	NA	A0A2R4AS58	Mycobacterium_phage	27.0	1.2e-10
WP_003566087.1|1918380_1919844_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	42.7	2.6e-100
WP_003566099.1|1920288_1920990_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003579780.1|1921014_1922160_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_003579793.1|1923075_1925052_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_003579795.1|1925380_1926208_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_003579797.1|1926269_1927736_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	35.9	1.2e-71
1928024:1928048	attL	GGTCCTTATGTGTAGGTTTCTGGGC	NA	NA	NA	NA
WP_003579799.1|1928211_1930530_-	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	40.1	2.8e-35
WP_003566829.1|1930955_1931330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003566828.1|1931469_1931892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003579803.1|1933978_1935115_+	alpha-L-fucosidase	NA	NA	NA	NA	NA
WP_003566825.1|1935223_1935541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003579806.1|1935711_1937379_-	phosphoenolpyruvate carboxykinase (ATP)	NA	NA	NA	NA	NA
WP_003566823.1|1937593_1937761_-	FeoB-associated Cys-rich membrane protein	NA	NA	NA	NA	NA
WP_003579808.1|1937796_1939908_-	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_003579810.1|1939894_1940386_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_003579812.1|1940584_1941337_-	acyltransferase	NA	NA	NA	NA	NA
WP_101512056.1|1941819_1943109_-	LysM peptidoglycan-binding domain-containing protein	NA	B4XYQ9	Lactobacillus_phage	88.2	4.4e-216
WP_071252206.1|1943119_1943533_-|holin	phage holin	holin	A0A0N7IR91	Lactobacillus_phage	99.3	8.9e-46
WP_003581984.1|1943547_1943823_-	hypothetical protein	NA	A0A0P0IZF9	Lactobacillus_phage	100.0	7.5e-49
WP_032779081.1|1943878_1944010_-	XkdX family protein	NA	A0A0P0HRS7	Lactobacillus_phage	60.5	4.0e-08
WP_101512006.1|1944006_1944279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101512057.1|1947733_1949668_-|tail	phage tail family protein	tail	B4XYQ4	Lactobacillus_phage	46.7	4.8e-150
WP_101512058.1|1949668_1954531_-|tail	phage tail tape measure protein	tail	U5U708	Lactobacillus_phage	94.7	0.0e+00
WP_101512059.1|1954653_1955067_-	hypothetical protein	NA	A0A2D1GPL7	Lactobacillus_phage	100.0	6.4e-52
WP_101512060.1|1955165_1955783_-|tail	phage tail protein	tail	U5U3Z7	Lactobacillus_phage	97.6	7.0e-111
WP_101512061.1|1955816_1956203_-|tail	phage tail protein	tail	U5U3W4	Lactobacillus_phage	96.9	1.1e-69
WP_101512062.1|1956202_1956589_-	HK97 gp10 family phage protein	NA	B4XYP9	Lactobacillus_phage	96.9	2.5e-66
WP_101512063.1|1956588_1956918_-|head,tail	head-tail adaptor protein	head,tail	A0A2D1GPN9	Lactobacillus_phage	99.1	2.1e-58
WP_101512064.1|1956907_1957267_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5U4K5	Lactobacillus_phage	97.5	2.5e-60
WP_101512065.1|1957277_1957517_-	Ig-like domain-containing protein	NA	A0A2D1GPN4	Lactobacillus_phage	94.9	6.1e-31
WP_101512066.1|1957534_1958737_-|capsid	phage major capsid protein	capsid	U5U3Z5	Lactobacillus_phage	97.5	3.2e-213
WP_101512067.1|1958777_1959407_-|head,protease	HK97 family phage prohead protease	head,protease	Q8LTC1	Lactobacillus_phage	95.7	4.2e-111
WP_101512068.1|1959360_1960614_-|portal	phage portal protein	portal	Q8LTC2	Lactobacillus_phage	99.0	7.5e-237
WP_003661399.1|1960619_1960811_-	hypothetical protein	NA	A0A2D1GPE7	Lactobacillus_phage	100.0	3.0e-28
WP_101512069.1|1960822_1962535_-|terminase	terminase large subunit	terminase	Q8LTC3	Lactobacillus_phage	98.4	0.0e+00
WP_003661401.1|1962556_1963012_-|terminase	P27 family phage terminase small subunit	terminase	U5U3Z1	Lactobacillus_phage	99.3	4.7e-80
WP_101512070.1|1963210_1964005_-	HNH endonuclease	NA	U5U440	Lactobacillus_phage	99.2	2.2e-149
WP_101512071.1|1963994_1964576_-	hypothetical protein	NA	Q96200	Lactobacillus_phage	87.6	2.3e-92
WP_101512072.1|1964588_1964912_-	hypothetical protein	NA	Q8LT99	Lactobacillus_phage	86.0	3.8e-44
WP_101512073.1|1964914_1965244_-	ribonucleoside-diphosphate reductase	NA	A0A0N7IRA2	Lactobacillus_phage	84.0	9.9e-48
WP_101512074.1|1965230_1966448_-	hypothetical protein	NA	A0A2D1GPQ9	Lactobacillus_phage	96.8	1.0e-235
WP_101512075.1|1966818_1967250_-	DUF1492 domain-containing protein	NA	A0A2D1GPD7	Lactobacillus_phage	72.1	2.1e-53
WP_101512076.1|1967318_1967537_-	helix-turn-helix transcriptional regulator	NA	U5U738	Lactobacillus_phage	83.3	7.5e-28
WP_101512077.1|1967607_1967790_-	hypothetical protein	NA	U5U7A2	Lactobacillus_phage	60.7	9.4e-08
WP_101512078.1|1967773_1968010_-	hypothetical protein	NA	U5U734	Lactobacillus_phage	83.3	1.6e-31
WP_101512079.1|1967996_1968437_-	hypothetical protein	NA	U5U4M8	Lactobacillus_phage	63.9	9.2e-41
WP_101512080.1|1968627_1969008_-	hypothetical protein	NA	C1KFE5	Lactobacillus_virus	64.1	1.4e-37
WP_189260170.1|1969316_1969493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101512082.1|1969482_1970034_-	hypothetical protein	NA	C1KFT3	Lactobacillus_virus	50.5	7.7e-37
WP_101512083.1|1969996_1970140_-	acetyltransferase	NA	A0A2D1GP93	Lactobacillus_phage	100.0	1.4e-11
WP_101512084.1|1970152_1970761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103153497.1|1970771_1971695_-|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	42.8	7.1e-67
WP_101512085.1|1971681_1972392_-	N-6 DNA methylase	NA	A8YQM7	Lactobacillus_phage	94.7	2.9e-121
WP_101512086.1|1972388_1972631_-	hypothetical protein	NA	A8YQM8	Lactobacillus_phage	50.0	1.7e-12
WP_101512088.1|1972890_1973274_-	DUF1064 domain-containing protein	NA	A0A0P0IJU5	Lactobacillus_phage	96.1	1.2e-65
WP_101512089.1|1973276_1973726_-	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	91.9	2.4e-68
WP_003579409.1|1973738_1974083_-	hypothetical protein	NA	U5U420	Lactobacillus_phage	100.0	1.3e-61
WP_101512090.1|1974084_1975347_-	DNA helicase	NA	U5U3Y9	Lactobacillus_phage	98.1	1.2e-234
WP_101512091.1|1975343_1976174_-	helix-turn-helix domain-containing protein	NA	U5U793	Lactobacillus_phage	77.7	4.8e-115
WP_101512092.1|1976190_1976628_-	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	95.2	4.1e-73
WP_101512338.1|1976642_1977311_-	hypothetical protein	NA	U5U4M2	Lactobacillus_phage	96.4	2.4e-125
WP_101512093.1|1977313_1978069_-	ERF family protein	NA	U5U416	Lactobacillus_phage	95.6	3.7e-130
WP_101512094.1|1978079_1978571_-	siphovirus Gp157 family protein	NA	Q9T0Y7	Lactobacillus_phage	66.3	2.7e-49
WP_101512095.1|1978588_1978792_-	hypothetical protein	NA	U5U788	Lactobacillus_phage	86.6	7.0e-28
WP_101512097.1|1979029_1979353_-	DUF771 domain-containing protein	NA	A0A0P0IJJ0	Lactobacillus_phage	82.4	6.2e-10
WP_101512098.1|1979403_1979661_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_101512099.1|1979661_1980429_-	phage antirepressor KilAC domain-containing protein	NA	Q6SEF4	Lactobacillus_prophage	62.3	1.3e-82
WP_015992507.1|1980425_1980671_-	helix-turn-helix transcriptional regulator	NA	B4XYR7	Lactobacillus_phage	100.0	8.2e-39
WP_103153498.1|1980832_1981507_+	helix-turn-helix domain-containing protein	NA	O64370	Lactobacillus_phage	96.9	9.0e-120
WP_101512101.1|1981566_1982244_+	transcriptional regulator	NA	A0A2D1GPN7	Lactobacillus_phage	98.2	9.1e-88
WP_101512102.1|1982418_1983588_+|integrase	site-specific integrase	integrase	A0A2D1GPE8	Lactobacillus_phage	97.9	1.5e-218
WP_003579813.1|1984038_1984677_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_003579815.1|1984715_1985228_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_003566817.1|1985380_1985905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003579820.1|1991692_1992976_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.6	3.6e-85
1998564:1998588	attR	GCCCAGAAACCTACACATAAGGACC	NA	NA	NA	NA
>prophage 5
NZ_CP026097	Lacticaseibacillus paracasei strain HDS-01 chromosome, complete genome	3038767	2432119	2497402	3038767	protease,tRNA,bacteriocin	Bacillus_phage(27.27%)	59	NA	NA
WP_076653085.1|2432119_2433613_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016384793.1|2433760_2434741_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_101512214.1|2434856_2435528_-	ribose-5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_016384791.1|2435711_2436542_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063558272.1|2436687_2437527_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003577828.1|2437539_2438556_-	membrane protein	NA	NA	NA	NA	NA
WP_003567242.1|2438562_2438937_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_101512215.1|2439101_2440373_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_063558274.1|2440690_2441467_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016385157.1|2441484_2442372_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.5	6.9e-35
WP_101512216.1|2442674_2443790_-	PIN domain nuclease	NA	NA	NA	NA	NA
WP_101512217.1|2445191_2445734_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	48.6	1.4e-38
WP_003567258.1|2445954_2446245_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003567260.1|2446349_2446727_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_103153506.1|2446971_2448291_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	34.2	7.8e-59
WP_003571383.1|2448612_2449959_+	C1 family peptidase	NA	A0A2H4UTL8	Bodo_saltans_virus	29.8	6.9e-47
WP_003588720.1|2450186_2451287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164886379.1|2451283_2452480_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003576231.1|2452542_2453421_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.4	1.2e-12
WP_003567271.1|2453582_2455637_+	potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	33.3	9.5e-64
WP_101512220.1|2455793_2458424_-	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	40.2	8.4e-89
WP_003576237.1|2458585_2459209_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_101512221.1|2459708_2460380_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_013246020.1|2460477_2460717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101512222.1|2460891_2462013_+	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_003567280.1|2462026_2462311_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_003567284.1|2463803_2464010_-	CsbD family protein	NA	NA	NA	NA	NA
WP_003567286.1|2464142_2464400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567288.1|2464470_2464677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013246021.1|2464901_2465153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567292.1|2465480_2466713_+	MFS transporter	NA	NA	NA	NA	NA
WP_003576247.1|2466791_2468048_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	56.8	7.3e-99
WP_003588744.1|2468136_2468970_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	9.6e-47
WP_103153507.1|2469286_2469481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101512224.1|2469734_2470271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101512225.1|2470458_2471682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101512226.1|2473104_2474664_-	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_016385140.1|2474660_2475983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016385138.1|2479266_2479824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567314.1|2479918_2481115_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003659566.1|2481323_2482379_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_101512227.1|2482629_2483259_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	37.5	1.6e-06
WP_003596042.1|2483394_2483724_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003576280.1|2483720_2484509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101512228.1|2484561_2485350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567328.1|2485394_2485673_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003580845.1|2485696_2485981_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_101512229.1|2486173_2486470_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003567335.1|2486570_2487926_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003580849.1|2488231_2488543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567340.1|2488615_2488966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101512230.1|2489139_2490519_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_101512231.1|2490529_2492722_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	26.7	8.1e-37
WP_003571414.1|2493187_2493325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045603255.1|2493514_2494813_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_003567351.1|2494817_2495624_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_042753684.1|2495985_2496183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101512232.1|2496729_2496969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032675994.1|2497228_2497402_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 6
NZ_CP026097	Lacticaseibacillus paracasei strain HDS-01 chromosome, complete genome	3038767	2622966	2695763	3038767	protease,transposase,tRNA,integrase	Streptococcus_phage(40.91%)	60	2611171:2611186	2699321:2699336
2611171:2611186	attL	GTATTCACCGCGGCGT	NA	NA	NA	NA
WP_101512260.1|2622966_2625114_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	A0A0P0CCN8	Ostreococcus_mediterraneus_virus	50.6	3.2e-110
WP_003567626.1|2625175_2625721_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	32.8	1.1e-11
WP_016380390.1|2625717_2627028_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	25.9	1.5e-06
WP_003567630.1|2627105_2627591_-	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_003567632.1|2627946_2628348_-	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_003567635.1|2628447_2628711_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_101512261.1|2628714_2630292_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_003581070.1|2630412_2633937_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_003567642.1|2634009_2634567_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_003567646.1|2635236_2636217_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_003571470.1|2636627_2637998_+	peptidoglycan binding domain-containing protein	NA	NA	NA	NA	NA
WP_003567650.1|2638499_2639165_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_003567652.1|2639440_2640145_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_003567654.1|2640273_2641707_-	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_003581075.1|2641842_2646300_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_003567657.1|2646573_2647095_-	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	32.3	4.6e-07
WP_003567661.1|2647278_2647662_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A2K9V2U7	Faecalibacterium_phage	36.1	1.2e-09
WP_003567665.1|2647681_2647930_-	antitoxin	NA	NA	NA	NA	NA
WP_003581082.1|2647997_2649134_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	31.8	1.0e-35
WP_003567669.1|2649120_2649495_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_003567670.1|2649663_2651172_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	39.3	4.1e-72
WP_003581096.1|2651471_2652860_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_003581098.1|2652920_2653685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162137637.1|2653750_2653948_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_003571475.1|2654064_2654712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101512262.1|2654708_2655386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567685.1|2655485_2655914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_189260174.1|2656622_2660432_+	Cys-Gln thioester bond-forming surface protein	NA	NA	NA	NA	NA
WP_101512344.1|2660433_2660676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101512264.1|2660718_2661042_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	42.3	6.8e-17
WP_003606403.1|2661060_2661432_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	50.4	6.4e-27
WP_101512265.1|2661506_2661770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103153513.1|2661783_2662035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101512266.1|2662054_2662342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101512267.1|2662338_2663727_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	60.8	7.7e-150
WP_101512268.1|2663716_2663992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101512269.1|2663996_2664257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101512270.1|2664253_2666797_-	recombinase RecF	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	23.5	2.5e-05
WP_010491198.1|2667174_2668365_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	43.7	7.9e-95
WP_010491196.1|2668354_2668681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003606383.1|2669644_2669866_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.6	1.7e-27
WP_101512271.1|2669869_2670367_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	44.6	6.5e-35
WP_010491186.1|2670428_2670821_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	73.6	6.5e-46
WP_101512273.1|2673255_2675349_+	conjugal transfer protein	NA	A0A1S5SF30	Streptococcus_phage	52.1	2.3e-145
WP_005691161.1|2675345_2676341_+	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	60.0	1.6e-109
WP_101512274.1|2676350_2676884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005691157.1|2676880_2677804_+	conjugal transfer protein	NA	A0A2K5B2A4	Erysipelothrix_phage	39.7	6.3e-07
WP_101512275.1|2679264_2680051_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_101512276.1|2680476_2681385_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_101512277.1|2682995_2683679_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.3	1.1e-59
WP_101512278.1|2683933_2685934_-	glycosyl hydrolase 53 family protein	NA	NA	NA	NA	NA
WP_101512279.1|2686212_2686545_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_101512280.1|2686564_2688007_-	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	30.0	8.5e-51
WP_101512282.1|2690070_2691060_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002816607.1|2691385_2692069_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	2.1e-60
WP_101512283.1|2692163_2692847_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	52.4	6.8e-59
WP_005691070.1|2693174_2693573_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_019899265.1|2693593_2693851_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010490992.1|2694200_2694473_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_101512284.1|2694524_2695763_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2699321:2699336	attR	GTATTCACCGCGGCGT	NA	NA	NA	NA
>prophage 7
NZ_CP026097	Lacticaseibacillus paracasei strain HDS-01 chromosome, complete genome	3038767	2970259	2997776	3038767	integrase,tail,head,portal,terminase,transposase,capsid	Lactobacillus_phage(27.27%)	28	2985104:2985123	2998848:2998867
WP_003577841.1|2970259_2971504_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	8.8e-12
WP_003586051.1|2971803_2972631_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003586053.1|2972917_2973427_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_003574021.1|2974931_2975852_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003586056.1|2976631_2978449_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003586058.1|2978774_2979173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016368092.1|2979363_2980662_+	amino acid permease	NA	NA	NA	NA	NA
WP_101512307.1|2981731_2983162_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_003586065.1|2983218_2983698_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_016366759.1|2983871_2984726_-	PRD domain-containing protein	NA	NA	NA	NA	NA
2985104:2985123	attL	TATTCTGGGTGGTCAGGGGA	NA	NA	NA	NA
WP_101512308.1|2985220_2986378_-|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	33.2	1.3e-46
WP_101512309.1|2986472_2987126_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_101512310.1|2987255_2987534_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014570224.1|2987623_2987845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101512311.1|2987955_2988147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101512312.1|2988191_2988467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003604804.1|2988463_2988652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101512313.1|2988635_2989463_+	bifunctional DNA primase/polymerase	NA	A0A221SAP5	Ralstonia_phage	31.3	4.0e-13
WP_101512314.1|2989455_2990880_+	virulence protein	NA	A0A1W6JQD6	Staphylococcus_phage	37.6	8.6e-64
WP_016370389.1|2991143_2991485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_189260175.1|2991567_2991942_+	HNH endonuclease	NA	D2JLE2	Staphylococcus_phage	40.7	2.2e-11
WP_013245611.1|2992066_2992537_+|terminase	phage terminase small subunit P27 family	terminase	M1PKP2	Streptococcus_phage	29.3	1.6e-06
WP_101512315.1|2992533_2994237_+|terminase	terminase	terminase	E9LUI0	Lactobacillus_phage	39.7	2.5e-118
WP_101512316.1|2994202_2994382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101512317.1|2994386_2995571_+|portal	phage portal protein	portal	A0A2H4JB06	uncultured_Caudovirales_phage	35.2	2.8e-60
WP_101512318.1|2995557_2997099_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	25.6	1.5e-40
WP_003577144.1|2997160_2997451_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_101512319.1|2997434_2997776_+|head	phage head closure protein	head	A0A249XUQ2	Enterococcus_phage	38.4	4.7e-08
2998848:2998867	attR	TATTCTGGGTGGTCAGGGGA	NA	NA	NA	NA
