The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026125	Acinetobacter baumannii strain ABNIH28 chromosome, complete genome	3787376	53144	63289	3787376	integrase	Acinetobacter_phage(57.14%)	17	50960:50974	64940:64954
50960:50974	attL	AATTTTATTTAATTC	NA	NA	NA	NA
WP_000947475.1|53144_54302_+|integrase	site-specific integrase	integrase	A0A2H4J339	uncultured_Caudovirales_phage	63.0	4.9e-134
WP_001076477.1|54298_55183_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000549863.1|55173_55629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000527288.1|55743_56736_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_168732385.1|56742_56913_-	hypothetical protein	NA	A0A2H4JBW6	uncultured_Caudovirales_phage	69.2	2.4e-13
WP_001292077.1|56913_57129_-	hypothetical protein	NA	I2GUB6	Acinetobacter_phage	92.9	8.5e-32
WP_046660032.1|57125_57482_-	hypothetical protein	NA	J7HXR6	Acinetobacter_phage	55.4	3.6e-27
WP_000978815.1|57478_57772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046660034.1|57910_58939_-	ead/Ea22-like family protein	NA	A0A2I7QY11	Vibrio_phage	29.0	3.8e-13
WP_023060560.1|58951_59632_-	DNA polymerase III subunit epsilon	NA	NA	NA	NA	NA
WP_001260065.1|59802_60174_-	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	40.6	1.4e-10
WP_001072368.1|60170_60500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000350171.1|60558_60819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103270742.1|60904_61708_-	DUF2303 family protein	NA	NA	NA	NA	NA
WP_000105905.1|61748_62081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000440996.1|62292_62580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000660939.1|62590_63289_-	LexA family transcriptional regulator	NA	A0A0P0IYD9	Acinetobacter_phage	35.8	7.8e-26
64940:64954	attR	AATTTTATTTAATTC	NA	NA	NA	NA
>prophage 2
NZ_CP026125	Acinetobacter baumannii strain ABNIH28 chromosome, complete genome	3787376	89879	150067	3787376	transposase,terminase,tail,integrase	Escherichia_phage(21.05%)	52	118659:118677	143710:143728
WP_103270747.1|89879_91871_+|terminase	terminase	terminase	A0A077SK57	Escherichia_phage	54.9	3.6e-07
WP_103270748.1|91943_93545_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_001243269.1|93559_93838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001272161.1|93839_94970_+	hypothetical protein	NA	A0A222YXT1	Escherichia_phage	35.2	1.3e-22
WP_000934750.1|94959_95508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000120881.1|95504_95807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000217480.1|95961_97740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000718477.1|97803_98430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151778.1|98434_98722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001022847.1|98840_100136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067778.1|100157_100925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001098598.1|100986_101265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005120136.1|101350_102247_-	hypothetical protein	NA	A5VW58	Enterobacteria_phage	42.0	7.4e-45
WP_000229653.1|102453_102705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001015563.1|103250_103526_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_000119670.1|103488_103755_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	51.2	5.2e-15
WP_001187723.1|103881_104526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001240941.1|104525_104975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001167468.1|104974_105868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103270749.1|105877_115456_+	DUF1983 domain-containing protein	NA	A0A126DKX0	Acinetobacter_phage	31.3	1.0e-128
WP_000190166.1|115456_115855_+	hypothetical protein	NA	G4WT78	Acinetobacter_phage	69.7	7.8e-47
WP_046660180.1|115854_116625_+	hypothetical protein	NA	G4WT79	Acinetobacter_phage	79.5	3.2e-81
WP_103270750.1|116652_116847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000098520.1|117006_118542_+	hypothetical protein	NA	A0A222YXQ7	Escherichia_phage	26.2	1.2e-31
WP_000863713.1|118541_119195_+	hypothetical protein	NA	NA	NA	NA	NA
118659:118677	attL	GTTGATCGAGCTGTTTCAC	NA	NA	NA	NA
WP_103270751.1|119268_121221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103270752.1|121220_122732_+	hypothetical protein	NA	A0A222YY44	Escherichia_phage	42.8	6.8e-83
WP_103270753.1|122807_126638_+	DEAD/DEAH box helicase family protein	NA	A0A1Y0T2N3	Pseudomonas_phage	43.0	1.4e-198
WP_004743497.1|126763_127213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004743499.1|127287_128100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004743501.1|128099_128795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000894311.1|128787_129006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001279704.1|129127_129415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000766533.1|129411_130182_+	TIGR02594 family protein	NA	A0A0B5L5G5	Acinetobacter_phage	98.4	1.7e-151
WP_000602528.1|130307_130667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072150.1|131050_131749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001215499.1|131902_133201_-	DNA polymerase V subunit UmuC	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	62.4	2.3e-156
WP_000022554.1|133197_133698_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	57.8	6.3e-46
WP_000332614.1|133839_134475_-	SOS response-associated peptidase family protein	NA	A0A218MNF5	uncultured_virus	57.4	3.0e-69
WP_001050367.1|134623_135289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002047807.1|135666_137019_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAT5	uncultured_Caudovirales_phage	39.0	5.7e-73
WP_004738162.1|137194_138418_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.3	3.2e-43
WP_002047760.1|138552_139917_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_002047799.1|139918_140113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086384349.1|140231_141128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086384348.1|141235_141748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017897367.1|141829_144709_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
143710:143728	attR	GTTGATCGAGCTGTTTCAC	NA	NA	NA	NA
WP_050680866.1|145559_145913_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_017897789.1|146025_146421_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_050680865.1|146853_147636_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	32.4	5.5e-20
WP_017897680.1|147635_149204_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	56.4	4.4e-162
WP_002122556.1|149320_150067_+|transposase	IS5-like element ISAba31 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.9	4.3e-14
>prophage 3
NZ_CP026125	Acinetobacter baumannii strain ABNIH28 chromosome, complete genome	3787376	288164	359971	3787376	transposase	Enterobacteria_phage(23.08%)	60	NA	NA
WP_076611894.1|288164_288987_-|transposase	IS5-like element ISAba27 family transposase	transposase	NA	NA	NA	NA
WP_103270756.1|289249_290182_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	42.0	1.7e-60
WP_031997976.1|292061_293270_-|transposase	IS256-like element ISAba26 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	6.9e-46
WP_016654309.1|296811_297591_+	OmpA family protein	NA	NA	NA	NA	NA
WP_086238066.1|297701_298268_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_031985039.1|298527_298869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001166305.1|298976_299090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000669365.1|299168_299486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000003719.1|299898_300183_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_002057436.1|300179_300740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002057431.1|300804_301437_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_005139846.1|301504_302827_+	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
WP_001187366.1|302858_304067_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_002057424.1|304063_305296_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_000129799.1|305505_305757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000058923.1|305811_306213_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000896576.1|306278_306920_+	cation transporter	NA	NA	NA	NA	NA
WP_000950251.1|306977_307580_-	amino acid transporter	NA	NA	NA	NA	NA
WP_002057442.1|307686_308577_+	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_002057439.1|308579_308966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001275992.1|309060_309897_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	39.9	5.3e-45
WP_000959396.1|310090_310492_+	YraN family protein	NA	NA	NA	NA	NA
WP_002057438.1|310572_311280_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_001048904.1|311283_312147_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002057427.1|312169_312913_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_001289227.1|312912_314556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001984886.1|314689_316069_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.6	7.9e-38
WP_000277832.1|316301_319517_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7NU10	Lactobacillus_phage	37.7	2.8e-25
WP_086238067.1|319655_321368_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002059666.1|321397_322450_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_000008524.1|322449_323460_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002059659.1|323437_325027_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	2.5e-19
WP_002122556.1|325135_325882_+|transposase	IS5-like element ISAba31 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.9	4.3e-14
WP_002059665.1|326072_327317_+	NADH:flavin oxidoreductase/NADH oxidase family protein	NA	NA	NA	NA	NA
WP_002059667.1|327375_329490_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001982681.1|329767_330430_-	ribonuclease T	NA	L0N5X9	Acaryochloris_phage	35.4	2.0e-07
WP_001084867.1|330414_331449_-	dihydroorotase	NA	NA	NA	NA	NA
WP_000013375.1|331598_332861_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.6	2.9e-18
WP_001986427.1|332920_334279_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	81.0	2.0e-54
WP_002059658.1|334544_336575_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_086222338.1|336913_337966_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_001153947.1|338025_339114_-	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_001043692.1|339217_340150_-|transposase	IS5-like element ISAba13 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
WP_000732870.1|341003_341882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079269062.1|344043_344691_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_031985153.1|344822_345293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002059267.1|345592_346264_+	CsgG/HfaB family protein	NA	NA	NA	NA	NA
WP_002059262.1|346281_346650_+	DUF4810 domain-containing protein	NA	NA	NA	NA	NA
WP_000592254.1|346646_347324_+	DUF799 domain-containing protein	NA	NA	NA	NA	NA
WP_000416092.1|347467_347827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074163676.1|348208_349567_-	amino acid permease	NA	NA	NA	NA	NA
WP_002059257.1|349712_351158_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_002059261.1|351177_352509_-	APC family permease	NA	NA	NA	NA	NA
WP_000191922.1|352704_353412_-	cache protein	NA	NA	NA	NA	NA
WP_001277431.1|353477_354197_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002059260.1|354256_355027_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_002059266.1|355055_356486_-	gamma-aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002001056.1|356804_357227_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_017725625.1|357362_358598_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.2e-23
WP_001043692.1|359038_359971_+|transposase	IS5-like element ISAba13 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
>prophage 4
NZ_CP026125	Acinetobacter baumannii strain ABNIH28 chromosome, complete genome	3787376	366807	454572	3787376	transposase,integrase,tRNA,tail,lysis,terminase,capsid	Acinetobacter_phage(59.38%)	100	371920:371940	421626:421646
WP_088360641.1|366807_368186_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.8e-74
WP_002059726.1|368268_368826_-	cytochrome b	NA	NA	NA	NA	NA
WP_000735756.1|369066_369456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000495834.1|369521_370088_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	42.4	2.4e-25
WP_000906487.1|370157_370412_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	8.8e-12
WP_001185176.1|370658_371939_-	aspartate kinase	NA	NA	NA	NA	NA
371920:371940	attL	TTTTGAACGATTAATGCCATA	NA	NA	NA	NA
WP_000362184.1|372148_372364_-	hypothetical protein	NA	A0A0R6PG25	Moraxella_phage	55.9	3.7e-11
WP_000015928.1|372365_372623_-	hypothetical protein	NA	A0A0P0J0B1	Acinetobacter_phage	90.5	2.2e-42
WP_103270757.1|372626_372911_-	hypothetical protein	NA	A0A0P0HSI5	Acinetobacter_phage	95.7	7.5e-44
WP_000453808.1|372907_373117_-	hypothetical protein	NA	A0A0P0IVS1	Acinetobacter_phage	98.6	6.3e-32
WP_000654849.1|373119_373365_-	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	98.8	3.3e-40
WP_103270758.1|373366_374368_-	hypothetical protein	NA	A0A0P0IKV7	Acinetobacter_phage	92.2	6.5e-175
WP_103270759.1|374364_375486_-	ATP-binding protein	NA	A0A0N7IRE0	Acinetobacter_phage	99.7	5.7e-212
WP_049069022.1|375497_375821_-	hypothetical protein	NA	A0A0P0IVW1	Acinetobacter_phage	77.6	2.1e-42
WP_000656410.1|375813_376104_-	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	99.0	1.6e-49
WP_001101440.1|376103_376544_-	hypothetical protein	NA	A0A0D4DBH9	Acinetobacter_phage	100.0	2.3e-76
WP_000187985.1|376771_377563_-	helix-turn-helix domain-containing protein	NA	A0A0R6PH50	Moraxella_phage	52.1	1.4e-10
WP_000210973.1|377565_377814_+	helix-turn-helix domain-containing protein	NA	A0A0R6PH31	Moraxella_phage	58.6	8.0e-18
WP_001289843.1|377868_378369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103270936.1|378418_378691_+	hypothetical protein	NA	A0A0P0IVP2	Acinetobacter_phage	95.5	1.7e-37
WP_001084133.1|378687_378984_+	hypothetical protein	NA	A0A0D4DCL5	Acinetobacter_phage	98.0	4.0e-48
WP_103270760.1|378980_379343_+	hypothetical protein	NA	A0A0D4DBI9	Acinetobacter_phage	98.3	9.2e-55
WP_103270761.1|379335_380265_+	YdaU family protein	NA	A0A0P0I481	Acinetobacter_phage	99.4	3.7e-172
WP_000544506.1|380257_381007_+	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	98.4	1.2e-136
WP_001031745.1|381003_381129_+	putative phage replication protein	NA	A0A0P0IR92	Acinetobacter_phage	89.5	4.8e-11
WP_000778991.1|381125_381533_+	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	48.8	2.3e-25
WP_029749821.1|381628_381847_+	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	90.7	1.7e-19
WP_057691425.1|381843_382248_+	DUF1064 domain-containing protein	NA	A0A0R6PIZ9	Moraxella_phage	50.0	2.6e-21
WP_000992314.1|382250_382664_+	antitermination protein	NA	NA	NA	NA	NA
WP_002011142.1|382961_383498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085940844.1|383608_384774_-|transposase	IS3-like element ISAba22 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	99.6	1.6e-164
WP_000372130.1|384976_385618_+	hypothetical protein	NA	J7I4N9	Acinetobacter_phage	97.7	1.3e-123
WP_000212566.1|385676_386147_+	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	100.0	3.0e-82
WP_103270762.1|386136_387564_+|terminase	phage terminase large subunit	terminase	A0A0D4DCE6	Acinetobacter_phage	90.5	3.6e-259
WP_103270763.1|387560_389006_+	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	89.8	2.2e-256
WP_057691261.1|389012_390116_+|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	99.5	1.3e-205
WP_004743774.1|390124_390553_+	hypothetical protein	NA	J7I4P3	Acinetobacter_phage	99.3	3.4e-72
WP_000004361.1|390651_390894_+	hypothetical protein	NA	A0A0P0IY55	Acinetobacter_phage	100.0	2.1e-39
WP_001139861.1|391111_391303_+	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	100.0	1.7e-28
WP_103270764.1|391416_392184_+	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	89.8	2.1e-117
WP_000214194.1|392211_393165_+	Ig domain-containing protein	NA	A0A0D4DBM4	Acinetobacter_phage	94.0	1.2e-167
WP_023188266.1|393229_393895_+	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	72.4	5.2e-80
WP_049065468.1|393899_394289_+	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	96.9	6.2e-65
WP_081408048.1|394245_394659_+	glutamate 5-kinase	NA	J7I467	Acinetobacter_phage	73.0	1.5e-53
WP_103270765.1|394667_395042_+	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	88.6	1.2e-57
WP_049065464.1|395236_395605_+	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	81.1	3.3e-52
WP_049065463.1|395606_396005_+	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	65.9	1.1e-48
WP_103270767.1|396122_397058_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	38.8	9.1e-54
WP_086223776.1|397107_397641_+	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	61.9	4.0e-46
WP_023188274.1|397969_398152_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	95.0	1.8e-27
WP_023188275.1|398216_398621_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	89.6	1.3e-62
WP_031959349.1|398703_399051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031959380.1|399491_399680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103270769.1|399843_403917_+	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	47.9	2.5e-249
WP_103270770.1|403919_404183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171266193.1|404263_404407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103270771.1|404403_404745_+|tail	phage tail protein	tail	A0A0R6PHH7	Moraxella_phage	39.4	2.6e-11
WP_103270772.1|404798_405971_+	hypothetical protein	NA	G3ENB2	Psychrobacter_phage	41.7	3.4e-50
WP_103270773.1|405957_406764_+|tail	phage minor tail protein L	tail	A0A0R6PGU8	Moraxella_phage	62.7	1.2e-91
WP_103270774.1|406770_407520_+	C40 family peptidase	NA	A0A0R6PIM4	Moraxella_phage	55.3	4.8e-82
WP_103270775.1|407525_407864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103270776.1|407933_408599_+|tail	tail assembly protein	tail	A0A0R6PIW1	Moraxella_phage	48.6	1.3e-43
WP_103270777.1|408655_413101_+|tail	phage tail protein	tail	A0A0R6PIC9	Moraxella_phage	65.5	0.0e+00
WP_049065885.1|413113_413473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103270778.1|413453_414305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103270779.1|414393_414687_+|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_103270780.1|414667_414892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103270781.1|414949_415495_+	N-acetylmuramidase	NA	A0A0N7IRE7	Acinetobacter_phage	93.4	1.9e-96
WP_103270782.1|416240_416462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103270783.1|416544_417843_-	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	60.5	1.4e-153
WP_103270784.1|417846_418341_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	60.3	6.9e-45
WP_103270785.1|418455_419100_-	SOS response-associated peptidase family protein	NA	A0A218MNF5	uncultured_virus	49.3	1.6e-57
WP_103270786.1|419140_420139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103270787.1|420212_421424_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A0R6PDI8	Moraxella_phage	51.0	8.6e-105
WP_000199457.1|421710_424347_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.6	1.8e-75
421626:421646	attR	TTTTGAACGATTAATGCCATA	NA	NA	NA	NA
WP_001188823.1|424616_425642_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000155680.1|425917_427084_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000517792.1|427148_428468_+	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	36.0	4.8e-69
WP_000776215.1|428589_428907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001034598.1|429023_429803_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_002059731.1|429860_430910_-	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_000203217.1|431070_431778_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001195082.1|432216_432639_+	OsmC family protein	NA	NA	NA	NA	NA
WP_002059735.1|432733_433159_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001237336.1|433155_433962_-	peptidoglycan DD-metalloendopeptidase family protein	NA	G9BW84	Planktothrix_phage	35.9	9.0e-18
WP_001210050.1|434262_436842_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	32.4	1.3e-123
WP_000941316.1|436899_437388_-	CinA family protein	NA	A0A218MNG4	uncultured_virus	43.3	4.0e-29
WP_001060738.1|437656_438073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086238301.1|438098_440324_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000655897.1|440542_440887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002059721.1|441010_442027_+	aspartate carbamoyltransferase catalytic subunit	NA	NA	NA	NA	NA
WP_086267205.1|442030_443275_+	aspartate carbamoyltransferase	NA	NA	NA	NA	NA
WP_000026486.1|443488_444904_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002059729.1|444990_445770_+	DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_000912925.1|445780_446407_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_002059736.1|446622_447198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043692.1|447204_448137_-|transposase	IS5-like element ISAba13 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
WP_002059733.1|450110_450851_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_002059722.1|450972_453411_+	ExeM/NucH family extracellular endonuclease	NA	NA	NA	NA	NA
WP_078207669.1|453639_454572_+|transposase	IS5-like element IS17 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.2	9.3e-59
>prophage 5
NZ_CP026125	Acinetobacter baumannii strain ABNIH28 chromosome, complete genome	3787376	501536	510520	3787376	transposase	Staphylococcus_phage(16.67%)	8	NA	NA
WP_001183458.1|501536_502283_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	3.1e-20
WP_002122556.1|502364_503111_+|transposase	IS5-like element ISAba31 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.9	4.3e-14
WP_162897177.1|503678_504902_+	TolC family protein	NA	NA	NA	NA	NA
WP_000988402.1|504898_507040_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	24.7	2.7e-29
WP_031985054.1|507036_508227_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000885988.1|508318_508918_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	36.6	5.0e-21
WP_000132362.1|508910_509522_+	chloramphenicol acetyltransferase CAT	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	54.0	3.6e-11
WP_001082436.1|509677_510520_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	33.9	2.6e-36
>prophage 6
NZ_CP026125	Acinetobacter baumannii strain ABNIH28 chromosome, complete genome	3787376	1697629	1711803	3787376	transposase,integrase	Acinetobacter_phage(72.73%)	13	1696563:1696578	1720885:1720900
1696563:1696578	attL	ACTCGTAATCTTTACC	NA	NA	NA	NA
WP_085942227.1|1697629_1698795_-|transposase	IS3-like element ISAba22 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	100.0	7.1e-165
WP_000872622.1|1699075_1700617_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	100.0	3.9e-288
WP_000999161.1|1700613_1702416_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	97.7	0.0e+00
WP_023188291.1|1702904_1704101_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0D4DBR3	Acinetobacter_phage	97.7	5.5e-221
WP_023188290.1|1704237_1704732_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	58.3	1.2e-44
WP_103270811.1|1704735_1706034_+	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	61.9	1.7e-159
WP_103270938.1|1706133_1706733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103270812.1|1706969_1707512_-	N-acetylmuramidase	NA	A0A0N7IRE7	Acinetobacter_phage	95.5	2.5e-96
WP_001100986.1|1707573_1707753_-	hypothetical protein	NA	A0A0D4DCA7	Acinetobacter_phage	100.0	9.2e-24
WP_001021568.1|1707778_1708321_-	hypothetical protein	NA	A0A0D4DBW7	Acinetobacter_phage	100.0	5.7e-101
WP_103270813.1|1708432_1708822_-	hypothetical protein	NA	J7I481	Acinetobacter_phage	98.4	7.3e-66
WP_103270814.1|1708885_1711375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103270815.1|1711374_1711803_-	C40 family peptidase	NA	A0A0B5A615	Paracoccus_phage	34.6	4.5e-08
1720885:1720900	attR	ACTCGTAATCTTTACC	NA	NA	NA	NA
>prophage 7
NZ_CP026125	Acinetobacter baumannii strain ABNIH28 chromosome, complete genome	3787376	1724006	1760858	3787376	terminase,capsid	Acinetobacter_phage(73.53%)	47	NA	NA
WP_000039808.1|1724006_1724981_-	DUF2184 domain-containing protein	NA	M4SQD1	Psychrobacter_phage	37.5	2.0e-51
WP_000240727.1|1724986_1725457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005068141.1|1725470_1726667_-	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	33.9	2.5e-24
WP_000823405.1|1726720_1727020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153309870.1|1727135_1727366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000207479.1|1727354_1728167_-|capsid	minor capsid protein	capsid	M4T3R2	Psychrobacter_phage	41.8	1.3e-51
WP_103270823.1|1728111_1729446_-	DUF1073 domain-containing protein	NA	M4SN90	Psychrobacter_phage	38.9	2.2e-85
WP_103270824.1|1729454_1730981_-|terminase	phage terminase large subunit	terminase	I3PGT7	Xanthomonas_phage	42.0	1.6e-92
WP_103270825.1|1730958_1731435_-	DUF2280 domain-containing protein	NA	A0A0P0HSK4	Acinetobacter_phage	47.7	8.5e-32
WP_033855583.1|1731480_1732113_-	hypothetical protein	NA	A0A1B1P9K3	Acinetobacter_phage	55.5	7.5e-60
WP_033855584.1|1732109_1732301_-	hypothetical protein	NA	J7I0V8	Acinetobacter_phage	87.3	4.0e-25
WP_000898317.1|1732357_1732603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002120865.1|1732861_1733014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033855586.1|1733279_1734032_-	hypothetical protein	NA	A0A0P0J081	Acinetobacter_phage	92.8	1.1e-129
WP_103270826.1|1734045_1734444_-	DUF559 domain-containing protein	NA	A0A0P0IKL1	Acinetobacter_phage	92.4	6.3e-65
WP_004834289.1|1734443_1734767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000030899.1|1734756_1734963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004834288.1|1734955_1735234_-	DUF3850 domain-containing protein	NA	A0A059T7N3	Listeria_phage	46.5	2.2e-11
WP_103270827.1|1735226_1735598_-	hypothetical protein	NA	A0A0P0IKW4	Acinetobacter_phage	60.6	5.0e-32
WP_002069861.1|1735614_1735758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000017854.1|1735754_1736162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078177514.1|1736158_1736908_-	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	97.6	9.9e-136
WP_064713902.1|1736900_1737851_-	YdaU family protein	NA	A0A0P0I481	Acinetobacter_phage	63.9	1.5e-99
WP_078177518.1|1737847_1739401_-	DNA cytosine methyltransferase	NA	Q5QF27	Pseudomonas_virus	41.3	3.2e-136
WP_044696544.1|1739397_1739718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057048486.1|1739767_1740268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019767546.1|1740328_1740592_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_032018627.1|1740725_1741475_+	helix-turn-helix transcriptional regulator	NA	H1ZZB6	Pseudomonas_virus	31.4	6.4e-10
WP_103270828.1|1741679_1742129_+	hypothetical protein	NA	A0A0N7IRE9	Acinetobacter_phage	95.9	1.9e-73
WP_000064469.1|1742121_1742445_+	hypothetical protein	NA	A0A0P0IVW1	Acinetobacter_phage	79.4	1.5e-43
WP_001207477.1|1742455_1743577_+	ATP-binding protein	NA	A0A0D4DBX7	Acinetobacter_phage	100.0	2.6e-212
WP_002126580.1|1743573_1744533_+	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	91.2	5.1e-161
WP_000654850.1|1744534_1744786_+	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	98.7	3.2e-38
WP_004834275.1|1744786_1745176_+	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	53.0	5.7e-10
WP_000783308.1|1745172_1745475_+	hypothetical protein	NA	A0A2I7QNA8	Vibrio_phage	35.7	7.8e-07
WP_103270829.1|1745471_1745666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000529848.1|1745666_1745936_+	hypothetical protein	NA	A0A0P0J067	Acinetobacter_phage	100.0	8.7e-42
WP_171057037.1|1746059_1746635_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	A0A0P0IKJ1	Acinetobacter_phage	98.4	3.9e-108
WP_086384350.1|1746731_1749503_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	97.9	0.0e+00
WP_000281138.1|1749510_1752243_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	98.2	0.0e+00
WP_001982145.1|1752599_1753649_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
WP_000608309.1|1753658_1754465_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	98.9	1.9e-145
WP_000066126.1|1754474_1755170_+	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	100.0	5.8e-122
WP_001164231.1|1755180_1756164_-	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	96.0	1.1e-182
WP_017897159.1|1756170_1758546_-	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	98.6	0.0e+00
WP_000893699.1|1758547_1760047_-	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	95.4	2.2e-275
WP_001187844.1|1760309_1760858_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	100.0	1.7e-97
>prophage 8
NZ_CP026125	Acinetobacter baumannii strain ABNIH28 chromosome, complete genome	3787376	2020648	2078095	3787376	tRNA,transposase,protease	Enterobacteria_phage(16.67%)	46	NA	NA
WP_002059245.1|2020648_2021044_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_103270854.1|2021117_2021489_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001040033.1|2021641_2022574_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.6	1.7e-60
WP_103270855.1|2022728_2023403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103270856.1|2023645_2027644_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	33.3	6.6e-69
WP_103270857.1|2028250_2028781_+	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_000841361.1|2029039_2029534_-	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_001984613.1|2029906_2031019_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001110719.1|2031110_2031494_-	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000271251.1|2031700_2032606_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	64.2	1.4e-91
WP_002010827.1|2033196_2033973_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	53.6	2.4e-36
WP_103270858.1|2034230_2035136_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001135457.1|2035185_2035761_-	DUF4112 domain-containing protein	NA	NA	NA	NA	NA
WP_103270859.1|2035833_2038929_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_000488520.1|2039192_2040335_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_002122556.1|2041179_2041926_-|transposase	IS5-like element ISAba31 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.9	4.3e-14
WP_000379022.1|2042306_2042681_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_001274623.1|2042855_2044490_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	60.9	8.1e-175
WP_000065579.1|2044548_2044839_-	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	51.1	2.3e-16
WP_000924308.1|2045024_2045783_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_001247651.1|2045763_2046702_-	NAD(+)/NADH kinase	NA	NA	NA	NA	NA
WP_000214355.1|2047093_2048926_+	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_000868068.1|2048967_2050485_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000063783.1|2050639_2052148_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_017898102.1|2052825_2053335_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001043188.1|2055438_2055861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278002.1|2055880_2056549_-	methyltransferase	NA	NA	NA	NA	NA
WP_001229849.1|2056789_2057638_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.4	6.1e-25
WP_002123675.1|2058062_2059826_-	alkaline phosphatase D family protein	NA	NA	NA	NA	NA
WP_002017041.1|2060529_2060820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161325550.1|2060978_2061821_-	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_001286662.1|2061961_2063857_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	M4QMW8	Micromonas_pusilla_virus	46.4	1.4e-106
WP_000235573.1|2063991_2064642_-	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	A0A140HEP8	Marsac_virus	25.1	4.1e-05
WP_000729551.1|2064841_2065165_+	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_000179359.1|2065179_2065716_+	DOMON-like domain-containing protein	NA	NA	NA	NA	NA
WP_001282885.1|2065774_2066362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000106446.1|2066675_2067815_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	NA	NA	NA	NA
WP_001126293.1|2067829_2071060_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_001190203.1|2071147_2071624_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_000116197.1|2071704_2072292_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001258301.1|2072432_2072825_+	RidA family protein	NA	NA	NA	NA	NA
WP_000818514.1|2072937_2073570_+	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	35.5	3.5e-17
WP_000966786.1|2073691_2074129_+	universal stress protein	NA	NA	NA	NA	NA
WP_000377323.1|2074184_2074514_-	MGMT family protein	NA	NA	NA	NA	NA
WP_000722324.1|2074595_2075312_+|protease	metalloprotease	protease	NA	NA	NA	NA
WP_001043692.1|2077162_2078095_+|transposase	IS5-like element ISAba13 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
>prophage 9
NZ_CP026125	Acinetobacter baumannii strain ABNIH28 chromosome, complete genome	3787376	2272949	2334263	3787376	tRNA,transposase	Enterobacteria_phage(25.0%)	53	NA	NA
WP_103270875.1|2272949_2273700_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	44.9	3.5e-24
WP_002046710.1|2274095_2275166_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017725450.1|2275156_2276443_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_001071168.1|2276439_2277336_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_017725449.1|2277332_2278136_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_103270876.1|2278565_2279498_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	42.3	7.6e-61
WP_000364279.1|2280099_2281095_-	DUF2804 domain-containing protein	NA	NA	NA	NA	NA
WP_017725381.1|2281132_2281645_-	DUF1543 domain-containing protein	NA	NA	NA	NA	NA
WP_000372734.1|2281654_2282884_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000083555.1|2282867_2283527_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_086249945.1|2283883_2285734_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_004745935.1|2285831_2286410_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_017725384.1|2286482_2287196_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_000701693.1|2287224_2287755_-	META domain-containing protein	NA	NA	NA	NA	NA
WP_000199593.1|2287963_2289136_+	acyl-CoA desaturase	NA	F2NZ38	Diadromus_pulchellus_ascovirus	32.3	2.5e-32
WP_001160208.1|2289249_2290692_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	31.9	2.6e-44
WP_000680577.1|2290755_2291442_-	response regulator	NA	W8CYM9	Bacillus_phage	33.8	2.5e-29
WP_103270939.1|2291461_2293120_-	sensor histidine kinase efflux regulator BaeS	NA	NA	NA	NA	NA
WP_002056344.1|2293214_2294147_+|transposase	IS5-like element ISAba13 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.6	1.3e-55
WP_005134747.1|2294299_2294680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001136744.1|2294969_2296772_+	acyl-CoA dehydrogenase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001123422.1|2296939_2298721_+	acyl-CoA dehydrogenase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001113294.1|2298840_2299323_+	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_017725386.1|2299360_2299744_-	RcnB family protein	NA	NA	NA	NA	NA
WP_017725387.1|2299908_2300355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017725388.1|2300669_2302133_-	phospholipase D	NA	NA	NA	NA	NA
WP_049594531.1|2302208_2304290_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001116941.1|2304425_2305190_+	DUF4184 family protein	NA	NA	NA	NA	NA
WP_017725390.1|2305360_2307139_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	21.7	1.4e-18
WP_001251491.1|2307280_2307499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001170031.1|2307498_2308437_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_000498151.1|2308474_2309494_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	33.9	7.9e-11
WP_001195721.1|2309521_2310073_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	52.4	1.7e-47
WP_000054001.1|2310062_2310953_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.6	1.0e-110
WP_000698332.1|2310949_2311843_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_000670932.1|2311845_2312913_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	52.1	6.2e-99
WP_000193718.1|2313048_2314092_-	mitochondrial fission ELM1 family protein	NA	NA	NA	NA	NA
WP_000705219.1|2314104_2315088_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000499405.1|2315090_2315900_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000548418.1|2315913_2316801_-	mitochondrial fission ELM1 family protein	NA	NA	NA	NA	NA
WP_001046506.1|2316868_2317795_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_000990825.1|2317819_2320570_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_000194108.1|2320638_2321907_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_001177143.1|2322709_2323747_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_001121100.1|2323900_2324929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016653537.1|2325013_2325583_+	LemA family protein	NA	NA	NA	NA	NA
WP_002057951.1|2325826_2326960_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.2	1.3e-94
WP_000051669.1|2327058_2327388_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_001270222.1|2327439_2329341_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_001984787.1|2329349_2330315_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	33.1	1.7e-31
WP_103270877.1|2330405_2331735_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	50.8	7.5e-70
WP_087486619.1|2331783_2333002_+|transposase	IS3-like element ISAba19 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.8e-78
WP_100223103.1|2333124_2334263_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	59.0	7.9e-84
>prophage 10
NZ_CP026125	Acinetobacter baumannii strain ABNIH28 chromosome, complete genome	3787376	2852569	2886888	3787376	tRNA,transposase,protease	uncultured_virus(25.0%)	29	NA	NA
WP_005137264.1|2852569_2853532_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	34.1	2.9e-07
WP_005137263.1|2853528_2854833_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_001097630.1|2854875_2855019_-	methionine/alanine import family NSS transporter small subunit	NA	NA	NA	NA	NA
WP_004833442.1|2855031_2856510_-	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_001256688.1|2857105_2857831_+	TIGR04219 family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_000587887.1|2857888_2858488_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_014538288.1|2864356_2864842_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	37.7	3.3e-15
WP_002124507.1|2865057_2866128_-	alpha/beta hydrolase	NA	A0A2K9L3Q5	Tupanvirus	27.3	9.8e-12
WP_001274778.1|2866338_2866665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000733015.1|2866838_2867069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122230.1|2867805_2868111_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	52.5	3.4e-18
WP_106631126.1|2868149_2868653_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_002124530.1|2868919_2869216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001262789.1|2870380_2870935_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002124501.1|2871088_2873017_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	48.3	2.2e-147
WP_002124526.1|2873348_2874266_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_004836538.1|2874452_2875358_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_001985173.1|2875459_2875846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088753077.1|2875894_2877103_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_004836541.1|2877870_2878992_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000994663.1|2879001_2879514_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.9	1.0e-19
WP_085943970.1|2879697_2880060_-	DMT family protein	NA	NA	NA	NA	NA
WP_000550095.1|2880301_2881675_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_001265996.1|2881744_2882995_-	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_000051336.1|2883130_2883727_+	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
WP_005137745.1|2884044_2885001_+	TerC family protein	NA	A0A1D7XFL1	Escherichia_phage	32.5	2.2e-31
WP_005137747.1|2885196_2885562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106631126.1|2886040_2886544_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_000122230.1|2886582_2886888_-|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	52.5	3.4e-18
>prophage 11
NZ_CP026125	Acinetobacter baumannii strain ABNIH28 chromosome, complete genome	3787376	3133447	3162907	3787376	transposase,integrase	uncultured_Caudovirales_phage(22.22%)	25	3136478:3136493	3167379:3167394
WP_000122230.1|3133447_3133753_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	52.5	3.4e-18
WP_106631126.1|3133791_3134295_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_000994592.1|3134313_3135705_-	multidrug transporter subunit MdtD	NA	NA	NA	NA	NA
WP_001986939.1|3135902_3136508_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.8	2.5e-12
3136478:3136493	attL	CAGATGTTATTGGTGA	NA	NA	NA	NA
WP_000575778.1|3136852_3138445_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.1	8.8e-41
WP_000194006.1|3138516_3138984_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000927792.1|3139029_3139674_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_000366687.1|3139756_3141076_+	MFS transporter	NA	NA	NA	NA	NA
WP_000202262.1|3141229_3143449_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	33.9	3.2e-81
WP_000411996.1|3143746_3145426_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	1.7e-34
WP_017897392.1|3145465_3145849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001985514.1|3145943_3146354_+	MAPEG family protein	NA	A0A2H4J146	uncultured_Caudovirales_phage	43.8	2.4e-14
WP_000122443.1|3146481_3147009_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.2	9.6e-61
WP_000910009.1|3147115_3148432_-	outer membrane porin, OprD family	NA	NA	NA	NA	NA
WP_001985635.1|3149341_3150169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000772980.1|3150211_3151090_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_000845026.1|3151105_3151882_-	aldolase	NA	NA	NA	NA	NA
WP_031984972.1|3151993_3153406_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_079254824.1|3153442_3154069_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_017897426.1|3154207_3154906_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_017897425.1|3154898_3156788_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_085942227.1|3157224_3158390_-|transposase	IS3-like element ISAba22 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	100.0	7.1e-165
WP_031985165.1|3158929_3160021_+	TniQ family protein	NA	NA	NA	NA	NA
WP_031985164.1|3160035_3161478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087486619.1|3161687_3162907_-|transposase	IS3-like element ISAba19 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.8e-78
3167379:3167394	attR	CAGATGTTATTGGTGA	NA	NA	NA	NA
>prophage 1
NZ_CP026128	Acinetobacter baumannii strain ABNIH28 plasmid pABA-1fe1, complete sequence	110754	0	80790	110754	transposase,tail,terminase,portal	Salmonella_phage(31.58%)	75	NA	NA
WP_000959558.1|8922_9501_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	35.6	2.5e-25
WP_000567460.1|9494_10244_-	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	40.5	7.8e-48
WP_103270948.1|10240_10936_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	47.3	2.8e-60
WP_000394499.1|10935_11262_-|tail	phage tail protein	tail	D6PGG4	uncultured_phage	31.1	9.0e-09
WP_103270949.1|11334_16923_-|tail	tail length tape measure protein	tail	NA	NA	NA	NA
WP_000119495.1|16925_17222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000771531.1|17278_17632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000002670.1|17726_18272_-	hypothetical protein	NA	A0A2H4P707	Pseudomonas_phage	52.2	6.3e-39
WP_042053029.1|18356_18854_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_001068664.1|18853_19240_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	32.8	1.6e-12
WP_005113849.1|19236_19587_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	35.1	4.3e-09
WP_171068479.1|19573_20269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001110364.1|20270_21041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000769019.1|21047_21542_-	hypothetical protein	NA	L7TKJ9	Rhizobium_phage	28.7	6.8e-08
WP_001130341.1|21680_22583_-	hypothetical protein	NA	A0A2H4P701	Pseudomonas_phage	58.3	6.9e-91
WP_001131896.1|22718_23597_-	hypothetical protein	NA	A0A2H4P6Z8	Pseudomonas_phage	29.4	7.3e-13
WP_000206081.1|23640_25311_-|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	51.9	8.1e-146
WP_000764108.1|25356_26601_-|terminase	terminase	terminase	A0A2H4P6Z9	Pseudomonas_phage	62.4	1.3e-151
WP_000134192.1|26610_27216_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	34.3	4.0e-18
WP_000084570.1|27368_27770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005113862.1|27881_28376_-	hypothetical protein	NA	A0A0D4DBK8	Acinetobacter_phage	33.0	7.0e-05
WP_001175928.1|28344_28668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000416809.1|28658_29612_-	hypothetical protein	NA	A0A2H4P6X5	Pseudomonas_phage	42.1	4.6e-61
WP_000184979.1|29650_30073_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_000312034.1|30069_30726_-	ATP-binding cassette domain-containing protein	NA	L7TNS9	Rhizobium_phage	54.8	5.9e-60
WP_001292430.1|30725_31376_-	ParB N-terminal domain-containing protein	NA	L7TMF9	Rhizobium_phage	41.9	3.8e-35
WP_103270950.1|31372_31975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103270951.1|32003_32642_-	ParB N-terminal domain-containing protein	NA	L7TL04	Rhizobium_phage	46.1	1.0e-48
WP_103270952.1|32720_34430_+	DEAD/DEAH box helicase	NA	L7TNS5	Rhizobium_phage	46.2	9.8e-131
WP_000741665.1|34555_34849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000146944.1|34912_35191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086249593.1|35225_35795_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_103270953.1|36188_36989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960558.1|37428_37854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005113872.1|38492_38858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072618697.1|40178_40514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000906141.1|40577_40796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023897590.1|41305_41554_+	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	44.8	1.3e-07
WP_005113876.1|41591_42107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002009082.1|42093_42267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103270954.1|42631_42883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158650814.1|43020_43191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103270956.1|43646_45215_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	56.5	1.1e-163
WP_103270957.1|45214_46462_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_001177806.1|46471_47383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103270958.1|47411_50291_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_029423630.1|51523_52384_-	hypothetical protein	NA	A0A2H4P788	Pseudomonas_phage	28.1	8.7e-11
WP_000135194.1|52517_53030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042757975.1|53029_53314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000582283.1|53306_53729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000698342.1|53782_54559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005113777.1|54845_55325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029423633.1|55299_55620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613548.1|55855_56395_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	48.9	8.9e-38
WP_029574691.1|56964_58941_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	40.1	3.8e-126
WP_078207669.1|59381_60314_-|transposase	IS5-like element IS17 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	42.6	6.9e-62
WP_000047654.1|60376_60604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001019929.1|60603_60888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167539.1|60891_61803_-	hypothetical protein	NA	A0A0K2FHE7	Achromobacter_phage	44.8	3.5e-66
WP_023897602.1|61815_62805_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A2H4P762	Pseudomonas_phage	38.4	2.5e-54
WP_029423593.1|62902_65275_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	50.7	3.1e-207
WP_000030999.1|65296_65677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029423595.1|65750_66353_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	42.2	2.4e-31
WP_000192217.1|66484_67321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005113798.1|67412_69353_-	AAA family ATPase	NA	L7TNH6	Rhizobium_phage	42.5	4.1e-117
WP_005113801.1|69352_70468_-	metallophosphoesterase	NA	A0A2H4P756	Pseudomonas_phage	38.1	8.6e-59
WP_000095727.1|71191_71653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000680035.1|71649_72009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005113804.1|72096_74295_-	hypothetical protein	NA	J9Q736	Salmonella_phage	50.7	3.6e-53
WP_000429228.1|74297_75335_-	hypothetical protein	NA	J9Q7S6	Salmonella_phage	36.9	2.3e-50
WP_001099771.1|75397_76258_-	hypothetical protein	NA	A0A2H4P7I7	Pseudomonas_phage	31.5	1.9e-29
WP_000034357.1|76400_77489_-	hypothetical protein	NA	A0A2H4P749	Pseudomonas_phage	35.3	5.0e-11
WP_000695254.1|77578_78844_-	hypothetical protein	NA	A0A2H4P750	Pseudomonas_phage	38.1	5.9e-72
WP_000432852.1|78840_79416_-	HNH endonuclease	NA	A0A0K0N6H6	Gordonia_phage	51.3	1.6e-24
WP_114205116.1|79464_80790_-	hypothetical protein	NA	J9Q7Z2	Salmonella_phage	51.5	5.0e-114
>prophage 2
NZ_CP026128	Acinetobacter baumannii strain ABNIH28 plasmid pABA-1fe1, complete sequence	110754	84574	105698	110754	integrase,transposase	Rhizobium_phage(25.0%)	23	76368:76384	99700:99716
76368:76384	attL	ATTATAGTAAGCGCTTA	NA	NA	NA	NA
WP_000063931.1|84574_85819_-	AAA family ATPase	NA	L7TKP0	Rhizobium_phage	41.5	1.6e-85
WP_001005718.1|85963_87886_-	hypothetical protein	NA	A0A2H4P735	Pseudomonas_phage	43.0	1.5e-74
WP_000047261.1|88126_88321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000833466.1|88742_89162_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000124734.1|89501_90086_+|integrase	site-specific integrase	integrase	A0A0A8WF93	Clostridium_phage	29.3	8.9e-07
WP_029574900.1|90082_90499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002125263.1|90701_91379_+	AAA family ATPase	NA	E5FFJ3	Burkholderia_phage	26.4	2.8e-12
WP_000016663.1|91375_91804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029574901.1|91791_92412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497827.1|92484_93057_-	guanylate kinase	NA	A0A218KC48	Bacillus_phage	28.5	9.3e-09
WP_000343018.1|93533_94742_+|transposase	IS256-like element ISAba26 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	3.1e-46
WP_058061515.1|94901_96317_-	DNA ligase	NA	A0A2H4P729	Pseudomonas_phage	40.0	4.2e-87
WP_103270960.1|96329_96839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103270961.1|96835_97444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082443.1|97437_97929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004832940.1|97928_98483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283392.1|98546_99641_-	DNA primase	NA	A0A2H4P738	Pseudomonas_phage	43.7	1.1e-87
WP_000102026.1|99728_101132_-	DNA helicase	NA	L7TS87	Rhizobium_phage	39.0	1.5e-84
99700:99716	attR	TAAGCGCTTACTATAAT	NA	NA	NA	NA
WP_103270962.1|101168_101600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103270963.1|101687_102419_-	hypothetical protein	NA	L7TM14	Rhizobium_phage	26.6	2.9e-15
WP_000818856.1|102535_103657_-	replication initiation protein	NA	NA	NA	NA	NA
WP_103270964.1|104667_105306_-	lysozyme	NA	A0A075DXC6	Acinetobacter_phage	63.1	2.2e-67
WP_000138815.1|105305_105698_-	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	55.5	1.1e-32
>prophage 1
NZ_CP026129	Acinetobacter baumannii strain ABNIH28 plasmid pABA-2f10, complete sequence	130044	13020	70783	130044	transposase,integrase	Acinetobacter_phage(23.53%)	50	12972:13031	74994:76501
12972:13031	attL	TGTTATTCCTAAGTAGAAATGTCCTACCTTAAAACCAAATAGAAATGTCCTATACCGACA	NA	NA	NA	NA
WP_001280604.1|13020_14346_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001089571.1|14519_15032_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_000447197.1|15710_16229_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000269901.1|16787_17144_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001140619.1|17136_17439_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_103270968.1|17431_17617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103270969.1|17653_18873_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	53.2	4.8e-79
WP_000286812.1|19060_19288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002072923.1|20519_20909_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000088946.1|21096_21417_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_000033474.1|21693_21882_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	69.6	4.1e-14
WP_001258992.1|21868_22156_+	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	48.4	7.4e-15
WP_000236586.1|22234_22489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004882762.1|22439_22664_-	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	46.6	2.9e-06
WP_000568530.1|22684_23116_-	hypothetical protein	NA	A0A0P0IDW1	Acinetobacter_phage	90.6	2.1e-66
WP_000378524.1|25791_26259_-	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	70.3	5.3e-55
WP_004882767.1|26320_26776_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	96.0	5.5e-81
WP_000152662.1|27437_27674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000245257.1|27866_28049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004882768.1|28115_28568_-	hypothetical protein	NA	A0A2H4JDI9	uncultured_Caudovirales_phage	66.4	3.7e-53
WP_001169440.1|28751_31952_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_004882769.1|31956_34293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004882771.1|34279_34729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004882773.1|35346_35820_+	Fic family protein	NA	NA	NA	NA	NA
WP_079281550.1|35874_36075_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004882775.1|37923_38472_-	lipocalin family protein	NA	A0A2K9L662	Tupanvirus	38.9	2.2e-23
WP_004882777.1|38641_39415_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_004882778.1|39799_41323_+	cryptochrome/photolyase family protein	NA	A0A1V0S9A0	Catovirus	27.8	6.0e-47
WP_079281548.1|41326_41470_+	DUF2256 domain-containing protein	NA	NA	NA	NA	NA
WP_004882779.1|41475_41730_-	TIGR03643 family protein	NA	NA	NA	NA	NA
WP_004882780.1|41910_43404_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_025465674.1|45726_46899_-	replication initiation protein	NA	NA	NA	NA	NA
WP_004882790.1|47753_48527_+	AAA family ATPase	NA	Q8JL10	Natrialba_phage	33.3	4.4e-14
WP_004882792.1|48540_49452_+	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	42.9	2.0e-13
WP_004882794.1|49557_49836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004882796.1|50189_50948_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	42.9	2.5e-46
WP_004882800.1|50988_51285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004882807.1|53564_54635_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004882808.1|54652_55144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004882810.1|55443_56634_+	MFS transporter	NA	NA	NA	NA	NA
WP_001067783.1|57090_57795_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	84.5	2.3e-118
WP_006582499.1|58272_58791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006581696.1|58916_59633_+	molecular chaperone	NA	NA	NA	NA	NA
WP_006581695.1|59636_61934_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_006582498.1|61946_62354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004741406.1|63860_64565_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.3	4.2e-120
WP_004642278.1|65782_65944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004882738.1|65996_68846_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.1	1.2e-128
WP_099143681.1|69393_69702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004882735.1|69850_70783_-|transposase	IS5-like element ISAba13 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	42.5	7.6e-61
74994:76501	attR	TGTTATTCCTAAGTAGAAATGTCCTACCTTAAAACCAAATAGAAATGTCCTATACCGACATTTCCAAGTCAAGCACAGGATTCAGATTTCGTTCTTTGATTACTGTTTTCTGTGCACGTCTGCTTGGCATCTTTTGAGAACGATTGCGTTTATTTTGTTGTTCTAGTTCTTCATGCTGCTGTTGAATATGGGCTAATACAGAACCCAAACGTTTATTTTCAACAATCTCTCGCTGGTTGAGCTGACTTAATTTATCGAAGATGCTGTAATTGATTTTTCTTCCCTGATATTCAATCGCGACTGTACTATTCGGGTATTCCAGAAACTCAAGATACTTGCCAATCAATCTTTGGTTTTCTTCCGTTTTTTCCAAGAGATATACGCACTTATCATAAGTGATCGTCAGGCTATTCGTGACTCTGCGGGGTTCACGCCAGGTAAAAAAATCATCTAATTCTTCGGCTGTTTCAGTGACAGTCCGGTGTAGATCCTTGGGATTAAAGGCCATCTTGGCAAACTTCTGATTGAACTGCTCAATGAAGCAGGGTAGCCAGGCATTGGCTTCGGCAATCGAACTGATGCCTTCCAGACGCATTTCTTTGATCAGACGGTCCTGAAGCGTTCTATTGGCTCGTTCTACACGGCCTTTGGCCTGTGGTGAATTAGCGAAGATAATATCGATATTCAGGGTGCTGAGTACGCGCCCAAACTGGGTAATCTTGGTGTCTTTCTTACTGCTTTGATTCACCCTGAAGACTGAATGTTTATCGCTGTAGAAGGCTAAAGGCTTACCATGCTGCTCAACATACAAACGTGTTGAAATCATATAGTCAAAGGTTGATTCTGACTTACAGAAGCGTAAATGCTGTAATTTGCCTGTGGCATCATCGATAAATACCAGCAGACAGCATTTAGGGGCTCGACCTTCAAACCAGTCATGGTGTGAGCCATCGATTTGGATCAGTTCACCATAACAGTCCCGGTTATAACGAGGCTGATACGGGCGTTTCAGACGCTTGGCACGAGGAGTCCATAAATCGGCTGCAATCATCCAGGAACGCAGTGTTTCCACTGAAATATCAAAGCCATGAACGGTGGTGAGCTTTTCATGCGCTAAAGTGGGTCCGAAACCATGCAGTTGATCAGAAACAATATTGAGGCACTTGAGTCTGAGCTCTTCAGGAAGCCTGGAATTGCTGATTTGACCACGACCGGCATGGGCTAATGCAGCTGGGCCTTGAGCTTTGTATTTTTGCAATAAACGCCTGATCTGACGCTCTGAAATATGAAGTAGCTGAGCAGCTTGGGACTGGGTTATGCGTTGATCACAGATTTCCTGCAAGACCGACAATCGTTTAAGTTCTTTATCCGACATAGACACCAACATATCAAACCGTCCGCTAAGGAAATTGCAAAAGTGCATATTCTAAAAGCGGACATTTTTACTTTGGAGAAACCGGACATTTCTATTTTGGGCTTACAGGGCTTACAAACGATATTTCGTATAA	NA	NA	NA	NA
>prophage 1
NZ_CP026127	Acinetobacter baumannii strain ABNIH28 plasmid pNDM-0285, complete sequence	39359	0	3425	39359		Geobacillus_virus(100.0%)	3	NA	NA
WP_015060710.1|933_2451_+	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004999346.1|2469_2670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017480462.1|2714_3425_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	50.8	6.9e-30
>prophage 2
NZ_CP026127	Acinetobacter baumannii strain ABNIH28 plasmid pNDM-0285, complete sequence	39359	7813	14880	39359	transposase	Moraxella_phage(25.0%)	8	NA	NA
WP_015060706.1|7813_8296_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	38.0	3.6e-22
WP_015060705.1|8292_10005_-	zeta toxin family protein	NA	NA	NA	NA	NA
WP_015056389.1|10188_10413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004993315.1|10564_11212_+	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	31.4	2.6e-15
WP_004201167.1|11641_12007_-	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201164.1|12010_12823_-	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004994718.1|12923_13949_-|transposase	IS30-like element ISAba125 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.1	1.2e-51
WP_014386410.1|14100_14880_-	APH(3')-VI family aminoglycoside O-phosphotransferase	NA	E4ZFP6	Streptococcus_phage	34.7	6.9e-31
>prophage 3
NZ_CP026127	Acinetobacter baumannii strain ABNIH28 plasmid pNDM-0285, complete sequence	39359	18446	24576	39359		Tetraselmis_virus(50.0%)	6	NA	NA
WP_017480453.1|18446_21359_-	AAA family ATPase	NA	A0A2P0VMS9	Tetraselmis_virus	23.9	4.4e-06
WP_015060720.1|21890_22427_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_017480467.1|22650_22881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015060719.1|22867_23290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015060718.1|23450_23687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015060717.1|23748_24576_-	DUF3560 domain-containing protein	NA	H7BV66	unidentified_phage	32.8	2.5e-15
>prophage 4
NZ_CP026127	Acinetobacter baumannii strain ABNIH28 plasmid pNDM-0285, complete sequence	39359	29801	30491	39359		Mycobacterium_phage(100.0%)	1	NA	NA
WP_005000446.1|29801_30491_-	AAA family ATPase	NA	W0LIU2	Mycobacterium_phage	32.8	8.0e-15
