The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	0	14860	5403218		uncultured_virus(33.33%)	12	NA	NA
WP_002894771.1|787_1336_+	replication initiation negative regulator SeqA	NA	NA	NA	NA	NA
WP_040236636.1|1368_3009_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_004893387.1|3063_3501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002894776.1|3482_4160_-	two-component system response regulator KdpE	NA	NA	NA	NA	NA
WP_004176863.1|4156_6844_-	two-component system sensor histidine kinase KdbD	NA	NA	NA	NA	NA
WP_040236637.1|6844_7420_-	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_040236638.1|7430_9479_-	potassium-transporting ATPase subunit KdpB	NA	A0A218MNH6	uncultured_virus	27.5	3.9e-25
WP_004152226.1|9499_11179_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_020323459.1|11178_11268_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_002894847.1|11577_11784_+	DUF2517 family protein	NA	NA	NA	NA	NA
WP_040236639.1|11967_13410_+	deoxyribodipyrimidine photo-lyase	NA	F2Y1V1	Organic_Lake_phycodnavirus	33.1	2.3e-56
WP_103215379.1|13381_14860_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.3	2.9e-46
>prophage 2
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	20669	21461	5403218		Kaumoebavirus(100.0%)	1	NA	NA
WP_040236641.1|20669_21461_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.2	3.6e-11
>prophage 3
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	46012	49523	5403218		Vibriophage(33.33%)	4	NA	NA
WP_004151689.1|46012_46732_+	nicotinamide riboside transporter PnuC	NA	I6W764	Vibriophage	34.6	2.0e-24
WP_004147641.1|46728_47673_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.4	3.4e-24
WP_002895084.1|47790_48156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002895086.1|48470_49523_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.0	1.2e-81
>prophage 4
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	53884	60407	5403218		Tupanvirus(33.33%)	7	NA	NA
WP_004183448.1|53884_54901_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.1	1.2e-78
WP_040236643.1|55110_56583_-	molybdate ABC transporter ATP-binding protein ModF	NA	W5SAS9	Pithovirus	28.5	2.0e-10
WP_002895154.1|56650_57439_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002895156.1|57591_57741_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_004176834.1|57883_58657_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002895159.1|58656_59346_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004176832.1|59348_60407_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	34.8	5.3e-18
>prophage 5
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	65253	65988	5403218		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004176830.1|65253_65988_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.3	1.4e-49
>prophage 6
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	69098	76953	5403218		Leptospira_phage(33.33%)	4	NA	NA
WP_004223724.1|69098_72164_-	efflux RND transporter permease subunit	NA	S5VL66	Leptospira_phage	20.6	5.1e-21
WP_004147662.1|72164_73250_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004183465.1|73782_74214_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	41.4	1.3e-23
WP_023284866.1|74265_76953_+	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	26.3	2.9e-68
>prophage 7
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	86373	91457	5403218		Catovirus(50.0%)	4	NA	NA
WP_012737677.1|86373_87900_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.0	3.7e-81
WP_004142109.1|87998_89381_+	amino acid permease	NA	NA	NA	NA	NA
WP_002895575.1|89620_90097_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_040236948.1|90167_91457_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.8	2.9e-18
>prophage 8
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	95260	95983	5403218		Planktothrix_phage(100.0%)	1	NA	NA
WP_004152853.1|95260_95983_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	24.0	5.3e-09
>prophage 9
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	103854	104760	5403218		Streptococcus_phage(100.0%)	1	NA	NA
WP_040235902.1|103854_104760_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	29.8	7.5e-29
>prophage 10
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	115164	116904	5403218		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_103215381.1|115164_116904_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.5	4.3e-17
>prophage 11
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	120818	131261	5403218	transposase	Escherichia_phage(16.67%)	10	NA	NA
WP_000019449.1|120818_121799_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
WP_002895750.1|122545_123295_+	glucose 1-dehydrogenase	NA	NA	NA	NA	NA
WP_002895753.1|123308_124154_+	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	30.3	3.1e-08
WP_002895757.1|124153_125146_+	transketolase family protein	NA	NA	NA	NA	NA
WP_023283465.1|125360_126716_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.1	2.8e-48
WP_004147693.1|126903_129060_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	1.5e-43
WP_004179105.1|129089_130058_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_004176772.1|130167_130428_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_002895824.1|130713_130980_-	DksA/TraR family C4-type zinc finger protein	NA	A0A1S6UBD1	Serratia_phage	52.3	1.6e-16
WP_004176771.1|131000_131261_-	DUF1471 domain-containing protein	NA	A0A1B2IB27	Erwinia_phage	47.9	9.7e-06
>prophage 12
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	135335	140486	5403218		Planktothrix_phage(33.33%)	6	NA	NA
WP_004142040.1|135335_136058_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	3.3e-35
WP_103215383.1|136054_136714_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_002895839.1|136839_137586_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_002895841.1|137993_138497_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222Z0F3	Streptomyces_phage	47.6	9.3e-05
WP_032411096.1|138734_139622_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_002895845.1|139973_140486_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.7e-14
>prophage 13
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	144488	145865	5403218		Pandoravirus(100.0%)	1	NA	NA
WP_004176762.1|144488_145865_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	23.8	7.2e-23
>prophage 14
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	148874	150467	5403218		Tupanvirus(100.0%)	1	NA	NA
WP_002895876.1|148874_150467_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	5.0e-60
>prophage 15
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	158447	160880	5403218		Bacteriophage(100.0%)	1	NA	NA
WP_023284885.1|158447_160880_-	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A2K8HAT8	Bacteriophage	47.4	8.0e-09
>prophage 16
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	165123	166983	5403218		Planktothrix_phage(100.0%)	1	NA	NA
WP_004151710.1|165123_166983_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.2	6.3e-14
>prophage 17
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	178846	180846	5403218		Stx2-converting_phage(50.0%)	2	NA	NA
WP_004893232.1|178846_180049_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.3	2.5e-96
WP_004151717.1|180087_180846_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	27.6	2.4e-12
>prophage 18
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	188318	199906	5403218		Bacillus_phage(33.33%)	13	NA	NA
WP_002896352.1|188318_188582_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_008805812.1|188784_189072_+	YbjC family protein	NA	NA	NA	NA	NA
WP_004179133.1|189055_189778_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_002896363.1|189892_190795_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896365.1|190883_191363_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896368.1|191711_192824_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896370.1|192987_194121_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896371.1|194131_195085_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896372.1|195081_195927_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896376.1|195984_196473_+	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896378.1|196514_197642_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896380.1|197720_198437_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896382.1|198433_199906_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
>prophage 19
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	203050	207401	5403218		Planktothrix_phage(50.0%)	4	NA	NA
WP_002896392.1|203050_203779_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896394.1|204005_204521_-	lipoprotein	NA	NA	NA	NA	NA
WP_004176708.1|205399_206539_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_004209681.1|206570_207401_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
>prophage 20
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	220217	244054	5403218	tRNA,protease	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
WP_002896440.1|220217_221333_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|221329_223270_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|223346_223568_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|223893_224211_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|224241_226521_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|226640_226859_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|227212_227914_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004209699.1|227958_229680_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	22.6	1.2e-14
WP_004141843.1|229680_231447_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004141839.1|231561_232557_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
WP_000228469.1|233062_233557_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_022631247.1|233692_237946_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_002898132.1|238068_238680_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004224013.1|238688_240032_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	5.6e-81
WP_002898139.1|240122_241415_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_004147794.1|241615_244054_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.2	2.8e-219
>prophage 21
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	247131	250346	5403218		Tetraselmis_virus(100.0%)	2	NA	NA
WP_002898145.1|247131_247872_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	1.4e-20
WP_002898148.1|248063_250346_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	8.4e-162
>prophage 22
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	254397	255486	5403218		Streptococcus_phage(100.0%)	1	NA	NA
WP_040236865.1|254397_255486_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.5	5.0e-80
>prophage 23
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	259659	264202	5403218		Bacillus_phage(100.0%)	3	NA	NA
WP_002898165.1|259659_259947_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.2e-10
WP_040236863.1|260152_262417_+	ComEC family protein	NA	NA	NA	NA	NA
WP_004201387.1|262453_264202_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	4.6e-59
>prophage 24
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	283235	284636	5403218	tRNA	Bandra_megavirus(100.0%)	1	NA	NA
WP_002898206.1|283235_284636_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.8	1.0e-80
>prophage 25
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	290698	295821	5403218		Agrobacterium_phage(33.33%)	3	NA	NA
WP_002898217.1|290698_291901_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.5	5.1e-41
WP_040236861.1|292227_294843_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.4	1.7e-20
WP_004150838.1|295047_295821_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	2.9e-29
>prophage 26
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	304587	306495	5403218		Tupanvirus(100.0%)	1	NA	NA
WP_004147848.1|304587_306495_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	1.2e-49
>prophage 27
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	319189	321244	5403218		Bacillus_phage(100.0%)	1	NA	NA
WP_040236859.1|319189_321244_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	26.0	1.8e-14
>prophage 28
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	333230	335378	5403218		Bacillus_phage(100.0%)	1	NA	NA
WP_040236544.1|333230_335378_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	25.1	1.7e-26
>prophage 29
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	344722	345382	5403218	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002898458.1|344722_345382_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
>prophage 30
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	369665	373184	5403218		Enterobacteria_phage(100.0%)	4	NA	NA
WP_002898708.1|369665_369839_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
WP_004199515.1|370001_370940_+	DMT family transporter	NA	NA	NA	NA	NA
WP_004211313.1|371345_372668_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	87.8	8.2e-202
WP_002898812.1|372689_373184_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	75.0	6.9e-37
>prophage 31
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	389748	390807	5403218		Cronobacter_phage(100.0%)	1	NA	NA
WP_004147894.1|389748_390807_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	77.6	8.6e-93
>prophage 32
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	398800	399328	5403218		Infectious_spleen_and_kidney_necrosis_virus(100.0%)	1	NA	NA
WP_004176593.1|398800_399328_+	O-acetyl-ADP-ribose deacetylase	NA	A0A140G0J9	Infectious_spleen_and_kidney_necrosis_virus	45.3	1.3e-28
>prophage 33
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	407679	408600	5403218		Morganella_phage(100.0%)	1	NA	NA
WP_004140735.1|407679_408600_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	42.2	3.3e-56
>prophage 34
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	411841	412093	5403218		Salmonella_phage(100.0%)	1	NA	NA
WP_004140729.1|411841_412093_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	50.0	3.0e-12
>prophage 35
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	431256	432438	5403218		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_002899294.1|431256_431991_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.0e-15
WP_000103754.1|432201_432438_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 36
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	435717	436359	5403218		Pseudomonas_phage(100.0%)	1	NA	NA
WP_002900674.1|435717_436359_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	37.0	3.8e-27
>prophage 37
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	456083	459834	5403218		Planktothrix_phage(50.0%)	4	NA	NA
WP_002900798.1|456083_456785_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.4	7.8e-34
WP_048982446.1|456784_458029_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_004140619.1|458077_458989_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_004176563.1|459003_459834_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.0	5.3e-21
>prophage 38
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	467094	471937	5403218		Synechococcus_phage(50.0%)	3	NA	NA
WP_004147958.1|467094_468045_+	transaldolase	NA	A0A0E3G6C9	Synechococcus_phage	38.3	3.5e-13
WP_102949321.1|468064_470071_+	transketolase	NA	NA	NA	NA	NA
WP_048981946.1|470308_471937_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.8	1.9e-27
>prophage 39
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	476370	477507	5403218		Bacillus_virus(100.0%)	1	NA	NA
WP_004147966.1|476370_477507_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	36.0	2.6e-31
>prophage 40
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	484072	485443	5403218		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_004176557.1|484072_485443_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	1.2e-107
>prophage 41
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	488671	489922	5403218		Phage_21(100.0%)	1	NA	NA
WP_004150800.1|488671_489922_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
>prophage 42
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	504514	506299	5403218		Bacillus_phage(100.0%)	1	NA	NA
WP_032445909.1|504514_506299_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	9.9e-17
>prophage 43
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	509588	513172	5403218		Morganella_phage(50.0%)	7	NA	NA
WP_008807690.1|509588_510503_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.0	3.2e-72
WP_048983200.1|510592_511231_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004190891.1|511360_511624_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004140488.1|511682_511808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213093.1|511925_512000_-	protein YoaJ	NA	NA	NA	NA	NA
WP_004150782.1|511999_512101_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004176549.1|512158_513172_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
>prophage 44
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	520101	536729	5403218	transposase	Klebsiella_phage(11.11%)	15	NA	NA
WP_002901096.1|520101_520344_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	72.2	4.1e-27
WP_004194275.1|520960_522445_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_002901192.1|522523_522943_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	5.5e-35
WP_004183665.1|522945_524211_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	79.4	2.9e-196
WP_048983379.1|524223_525123_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048983378.1|525289_526039_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	29.1	1.9e-14
WP_049105742.1|526035_527253_-	MFS transporter	NA	NA	NA	NA	NA
WP_004179386.1|527428_528310_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140435.1|528567_528879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002901230.1|529000_529483_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	39.1	1.6e-17
WP_004190861.1|529641_530205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152363.1|530250_531534_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.7e-10
WP_001118616.1|532008_532932_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_002901236.1|535036_535783_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_048982801.1|535874_536729_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	26.0	2.8e-17
>prophage 45
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	540413	542479	5403218		Artogeia_rapae_granulovirus(50.0%)	2	NA	NA
WP_002901255.1|540413_541667_-	glycoside hydrolase family 18 protein	NA	D2J4H7	Artogeia_rapae_granulovirus	25.6	2.6e-24
WP_004140413.1|541837_542479_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	37.1	1.9e-18
>prophage 46
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	548860	550807	5403218		Streptococcus_phage(100.0%)	1	NA	NA
WP_004148065.1|548860_550807_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.3	8.2e-41
>prophage 47
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	556109	556742	5403218		Bacillus_phage(100.0%)	1	NA	NA
WP_004148072.1|556109_556742_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.3	7.8e-09
>prophage 48
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	562799	564020	5403218		Klosneuvirus(100.0%)	1	NA	NA
WP_060415569.1|562799_564020_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.2	8.0e-26
>prophage 49
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	570703	571531	5403218		Bacillus_virus(100.0%)	1	NA	NA
WP_004151921.1|570703_571531_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.5	2.7e-70
>prophage 50
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	577795	583529	5403218		Tupanvirus(50.0%)	5	NA	NA
WP_048983353.1|577795_580054_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.4	1.0e-143
WP_004140343.1|580166_580499_+	cell division activator CedA	NA	NA	NA	NA	NA
WP_004151918.1|580558_581950_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_002901611.1|582085_582676_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_004176511.1|582767_583529_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.6	1.8e-15
>prophage 51
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	590823	591501	5403218		Cyanophage(100.0%)	1	NA	NA
WP_048981991.1|590823_591501_-	PKHD-type hydroxylase YbiX	NA	A0A127KM56	Cyanophage	33.8	2.5e-21
>prophage 52
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	598799	601757	5403218		Acinetobacter_phage(100.0%)	2	NA	NA
WP_040151497.1|598799_600158_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.4	3.3e-36
WP_004148109.1|600161_601757_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	36.5	2.8e-47
>prophage 53
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	613222	618588	5403218	protease	Chrysochromulina_ericina_virus(50.0%)	5	NA	NA
WP_004196459.1|613222_613984_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.2	1.2e-08
WP_004148112.1|613978_614194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032419875.1|614238_615285_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_002901761.1|615332_615584_-	YciN family protein	NA	NA	NA	NA	NA
WP_002901763.1|615990_618588_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.6	2.9e-89
>prophage 54
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	623427	624030	5403218		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002901778.1|623427_624030_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
>prophage 55
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	629619	631554	5403218		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_048982779.1|629619_631554_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	7.0e-08
>prophage 56
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	636184	651714	5403218	transposase,integrase	Enterobacteria_phage(50.0%)	15	632048:632062	648748:648762
632048:632062	attL	GCCAGCAGCGGCGCC	NA	NA	NA	NA
WP_004140269.1|636184_636994_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004140266.1|636995_637988_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004151901.1|637987_638878_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_102949323.1|639054_640242_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	2.2e-121
WP_014832196.1|640463_640703_-	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	75.6	5.5e-24
WP_049015027.1|640740_641826_-	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	63.1	1.1e-122
WP_103215389.1|641835_644997_-	exodeoxyribonuclease	NA	K7P6V4	Enterobacteria_phage	64.5	0.0e+00
WP_060415572.1|645791_646280_-	hypothetical protein	NA	A0A2H4J2Z0	uncultured_Caudovirales_phage	35.9	1.5e-23
WP_072269252.1|646279_646867_-	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
WP_142390695.1|646893_647292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049015030.1|647528_647912_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	63.5	3.4e-39
WP_072269253.1|648011_648239_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	63.5	8.4e-22
WP_049015032.1|648241_648793_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	46.4	3.4e-32
648748:648762	attR	GGCGCCGCTGCTGGC	NA	NA	NA	NA
WP_049015035.1|649790_650477_+	phage replication protein P	NA	G8C7U6	Escherichia_phage	63.4	4.4e-82
WP_023296974.1|650553_651714_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.4	3.5e-39
>prophage 57
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	656138	665522	5403218	transposase	Enterobacteria_phage(28.57%)	8	NA	NA
WP_032425493.1|656138_657062_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	95.4	2.0e-170
WP_060415576.1|659101_659650_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	97.2	3.8e-92
WP_072001560.1|659727_660150_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	8.0e-26
WP_004194275.1|661044_662529_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004179627.1|662608_663028_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	58.3	8.5e-36
WP_064174231.1|663029_664295_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.2	5.3e-206
WP_060415578.1|664473_664722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060415579.1|664853_665522_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	3.1e-80
>prophage 58
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	695539	700979	5403218		Staphylococcus_phage(33.33%)	6	NA	NA
WP_048982796.1|695539_696409_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	7.4e-50
WP_032415977.1|696576_696885_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_004179527.1|696955_697144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004176438.1|697445_698360_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023279949.1|698468_699230_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	6.3e-21
WP_048982797.1|699446_700979_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	28.7	1.5e-21
>prophage 59
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	708965	714132	5403218		Cronobacter_phage(50.0%)	2	NA	NA
WP_103215391.1|708965_711620_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	1.7e-97
WP_048982655.1|711612_714132_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.6	2.0e-18
>prophage 60
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	719136	720117	5403218	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_000019449.1|719136_720117_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
>prophage 61
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	743467	744481	5403218		Planktothrix_phage(100.0%)	1	NA	NA
WP_004152912.1|743467_744481_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.1	1.7e-29
>prophage 62
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	747802	754918	5403218	tRNA	Escherichia_phage(40.0%)	7	NA	NA
WP_023341413.1|747802_748546_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.5	6.0e-16
WP_004148192.1|748825_749809_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_004151591.1|750333_751707_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	8.6e-53
WP_002902422.1|751752_752688_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.0	3.5e-138
WP_002902424.1|752921_753347_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	51.4	7.1e-30
WP_002902432.1|753437_753650_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_004176397.1|753793_754918_-	porin OmpK37	NA	Q1MVN1	Enterobacteria_phage	59.8	3.8e-115
>prophage 63
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	760036	761026	5403218		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_002902515.1|760036_761026_-	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.9	2.5e-70
>prophage 64
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	787219	791844	5403218		Klosneuvirus(50.0%)	2	NA	NA
WP_040248807.1|787219_791122_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.2	3.8e-53
WP_019704213.1|791169_791844_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	52.5	6.0e-31
>prophage 65
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	800529	801735	5403218		Klosneuvirus(100.0%)	1	NA	NA
WP_004176366.1|800529_801735_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.0	6.9e-22
>prophage 66
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	814484	818012	5403218		Enterobacteria_phage(50.0%)	6	NA	NA
WP_004224558.1|814484_814877_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	38.5	3.0e-19
WP_002903233.1|815127_815361_-	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_004179663.1|815357_816566_-	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_002903236.1|816669_817023_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_004190341.1|817220_817739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151566.1|817808_818012_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	73.1	2.6e-22
>prophage 67
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	823114	823729	5403218		Clostridium_phage(100.0%)	1	NA	NA
WP_032442199.1|823114_823729_-	recombinase family protein	NA	A0A0A8WJD4	Clostridium_phage	28.1	2.5e-07
>prophage 68
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	827165	828935	5403218		Burkholderia_virus(100.0%)	1	NA	NA
WP_032442195.1|827165_828935_-	recombinase family protein	NA	Q6V7T7	Burkholderia_virus	28.3	6.4e-32
>prophage 69
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	838799	842114	5403218		Bacillus_phage(50.0%)	2	NA	NA
WP_004151564.1|838799_840101_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.0	2.9e-18
WP_103215756.1|840671_842114_-	protein kinase	NA	M1PH48	Moumouvirus	29.7	3.7e-06
>prophage 70
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	853380	853896	5403218		Streptococcus_phage(100.0%)	1	NA	NA
WP_004224598.1|853380_853896_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.5	4.6e-23
>prophage 71
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	873242	876020	5403218		Lactobacillus_phage(100.0%)	1	NA	NA
WP_004152245.1|873242_876020_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.1	6.2e-66
>prophage 72
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	885463	886423	5403218		Salmonella_phage(100.0%)	1	NA	NA
WP_004148291.1|885463_886423_-	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	2.7e-53
>prophage 73
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	903547	905674	5403218		Escherichia_phage(100.0%)	3	NA	NA
WP_004179727.1|903547_904156_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.3	6.4e-24
WP_002903710.1|904197_905055_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	35.9	9.0e-24
WP_004152235.1|905056_905674_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.1	2.6e-73
>prophage 74
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	910470	920420	5403218		uncultured_virus(20.0%)	10	NA	NA
WP_002903722.1|910470_910797_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.9	1.1e-22
WP_048982198.1|910910_912194_+	MFS transporter	NA	NA	NA	NA	NA
WP_023328605.1|912447_913911_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.3	1.3e-43
WP_002903728.1|914175_914607_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	40.7	2.7e-21
WP_002903730.1|914657_915344_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002903733.1|915435_916185_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_048982201.1|916315_918361_+	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	20.5	3.9e-17
WP_085806868.1|918438_918831_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_103215757.1|918852_919695_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032419006.1|919745_920420_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.6	2.2e-81
>prophage 75
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	929564	946786	5403218	transposase	Escherichia_phage(70.0%)	15	NA	NA
WP_004892174.1|929564_930185_-	aldolase	NA	A0A077SK32	Escherichia_phage	99.5	1.8e-114
WP_049106602.1|930177_931443_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.0	2.1e-231
WP_002903955.1|931454_932357_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|932617_933379_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_001620095.1|933399_934260_-	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_004176262.1|934557_934818_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620097.1|934904_935993_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_000427623.1|937253_938258_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_060415592.1|938670_941778_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004183956.1|941974_943039_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	44.5	2.0e-65
WP_004176252.1|943293_943734_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004205985.1|943786_944002_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_004176251.1|943970_945068_-	transcriptional regulator FtrA	NA	NA	NA	NA	NA
WP_002904247.1|945135_945534_+	rhodanese	NA	NA	NA	NA	NA
WP_002904248.1|945682_946786_+	cobalamin-independent methionine synthase II family protein	NA	A0A218MNE0	uncultured_virus	48.9	3.1e-101
>prophage 76
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	950937	952443	5403218		Brazilian_cedratvirus(50.0%)	2	NA	NA
WP_002904321.1|950937_951735_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	26.9	2.4e-10
WP_004176246.1|951744_952443_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	2.1e-15
>prophage 77
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	955689	956064	5403218		Streptococcus_phage(100.0%)	1	NA	NA
WP_002904397.1|955689_956064_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	2.3e-08
>prophage 78
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	961141	962092	5403218		Catovirus(100.0%)	1	NA	NA
WP_048982748.1|961141_962092_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	34.7	4.8e-34
>prophage 79
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	966615	967377	5403218		Escherichia_phage(100.0%)	1	NA	NA
WP_002904489.1|966615_967377_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	36.2	2.7e-32
>prophage 80
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	972825	974193	5403218		Bacillus_phage(100.0%)	1	NA	NA
WP_102949331.1|972825_974193_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.7	2.9e-16
>prophage 81
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	986579	987371	5403218		Bacillus_virus(100.0%)	1	NA	NA
WP_072269264.1|986579_987371_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	30.5	2.5e-20
>prophage 82
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	997864	999244	5403218		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004176204.1|997864_999244_+	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	5.3e-18
>prophage 83
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1033198	1034731	5403218	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_009310015.1|1033198_1034731_-|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	4.1e-51
>prophage 84
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1043157	1045195	5403218	transposase	Erysipelothrix_phage(50.0%)	2	NA	NA
WP_103215402.1|1043157_1043676_-	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	37.6	7.6e-26
WP_001118645.1|1044271_1045195_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	1.0e-166
>prophage 85
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1058521	1059259	5403218		Planktothrix_phage(100.0%)	1	NA	NA
WP_004179947.1|1058521_1059259_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.9	3.0e-36
>prophage 86
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1083016	1084273	5403218		Bacillus_phage(100.0%)	1	NA	NA
WP_021314003.1|1083016_1084273_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.5	4.0e-20
>prophage 87
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1090267	1094385	5403218		Bacillus_virus(50.0%)	4	NA	NA
WP_004180001.1|1090267_1090996_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	9.6e-19
WP_004180004.1|1090992_1091733_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004212078.1|1091757_1092693_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002905540.1|1092999_1094385_+	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.0	7.4e-28
>prophage 88
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1098299	1100380	5403218		Bacillus_phage(100.0%)	2	NA	NA
WP_038435342.1|1098299_1099643_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	24.3	1.4e-10
WP_004180014.1|1099639_1100380_-	response regulator	NA	W8CYM9	Bacillus_phage	37.6	1.5e-30
>prophage 89
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1115777	1116458	5403218		Bacillus_virus(100.0%)	1	NA	NA
WP_048982737.1|1115777_1116458_-	MgtC family protein	NA	G3MA03	Bacillus_virus	41.9	2.1e-15
>prophage 90
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1127371	1127776	5403218		Stx_converting_phage(100.0%)	1	NA	NA
WP_002906035.1|1127371_1127776_-	YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	41.6	2.0e-10
>prophage 91
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1132583	1134921	5403218		Mycobacterium_phage(50.0%)	3	NA	NA
WP_004143717.1|1132583_1132799_-	hypothetical protein	NA	H9NCK9	Mycobacterium_phage	48.0	9.4e-07
WP_004143718.1|1133164_1133350_-	general stress protein	NA	NA	NA	NA	NA
WP_020953426.1|1134048_1134921_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	58.6	1.3e-83
>prophage 92
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1140774	1145510	5403218		Tupanvirus(66.67%)	4	NA	NA
WP_049105482.1|1140774_1142490_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	23.8	6.2e-32
WP_032446095.1|1142526_1143480_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002906218.1|1143647_1144247_-	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.1	5.0e-21
WP_002906221.1|1144499_1145510_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.8	4.9e-29
>prophage 93
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1149098	1150715	5403218		Planktothrix_phage(100.0%)	1	NA	NA
WP_023283770.1|1149098_1150715_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.6	3.3e-19
>prophage 94
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1161986	1162760	5403218		Bacillus_phage(100.0%)	1	NA	NA
WP_048983119.1|1161986_1162760_-	1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase	NA	W8CYX9	Bacillus_phage	48.5	3.8e-05
>prophage 95
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1169239	1170739	5403218		Mycobacterium_phage(100.0%)	1	NA	NA
WP_004175980.1|1169239_1170739_-	efflux MFS transporter KmrA	NA	A0A0M3UL24	Mycobacterium_phage	29.3	7.8e-31
>prophage 96
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1176846	1178391	5403218		Escherichia_phage(100.0%)	1	NA	NA
WP_060415606.1|1176846_1178391_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	38.1	1.4e-19
>prophage 97
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1184026	1184728	5403218		Bacillus_virus(100.0%)	1	NA	NA
WP_032104980.1|1184026_1184728_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	2.8e-31
>prophage 98
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1194166	1194946	5403218		Bacillus_virus(100.0%)	1	NA	NA
WP_002906697.1|1194166_1194946_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.0	1.6e-19
>prophage 99
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1200884	1201436	5403218		Leuconostoc_phage(100.0%)	1	NA	NA
WP_103215413.1|1200884_1201436_-	adenylate kinase	NA	A0A097BYE2	Leuconostoc_phage	33.7	8.1e-10
>prophage 100
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1206015	1208106	5403218		Salmonella_phage(100.0%)	1	NA	NA
WP_004220069.1|1206015_1208106_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	67.6	1.6e-138
>prophage 101
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1224230	1225244	5403218		Mycoplasma_phage(100.0%)	1	NA	NA
WP_004184243.1|1224230_1225244_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	56.4	2.1e-24
>prophage 102
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1232114	1234076	5403218		Phage_TP(100.0%)	1	NA	NA
WP_002907469.1|1232114_1234076_-	U32 family peptidase	NA	Q6DW11	Phage_TP	28.0	5.1e-22
>prophage 103
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1244506	1247147	5403218		Moumouvirus(100.0%)	2	NA	NA
WP_060415616.1|1244506_1245595_+	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	25.2	4.1e-05
WP_060415617.1|1245641_1247147_-	carboxylesterase/lipase family protein	NA	M1PNU1	Moumouvirus	38.0	9.5e-29
>prophage 104
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1253972	1256023	5403218		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_103215414.1|1253972_1255091_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	30.0	1.1e-32
WP_002907563.1|1255115_1255391_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_002907640.1|1255495_1256023_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	46.8	5.9e-18
>prophage 105
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1261573	1262944	5403218		Pandoravirus(100.0%)	1	NA	NA
WP_004180160.1|1261573_1262944_+	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	35.1	2.1e-67
>prophage 106
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1274199	1275474	5403218	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_004175868.1|1274199_1275474_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.0	1.4e-86
>prophage 107
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1278809	1280171	5403218		Bacillus_phage(100.0%)	1	NA	NA
WP_004180166.1|1278809_1280171_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.7	5.2e-18
>prophage 108
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1283977	1285465	5403218		Salmonella_phage(50.0%)	2	NA	NA
WP_004184268.1|1283977_1284499_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	58.0	2.3e-51
WP_103215416.1|1284568_1285465_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	28.7	1.4e-06
>prophage 109
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1289652	1290525	5403218		Bacillus_phage(100.0%)	1	NA	NA
WP_004151204.1|1289652_1290525_+	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	39.5	1.7e-17
>prophage 110
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1293796	1305968	5403218	transposase	Enterobacteria_phage(16.67%)	12	NA	NA
WP_002907778.1|1293796_1294822_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	30.9	1.2e-30
WP_009307704.1|1294748_1295753_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060415624.1|1295865_1297047_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_002907788.1|1297339_1298488_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	1.2e-84
WP_002907792.1|1298524_1299160_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.3	1.3e-22
WP_004148609.1|1299389_1300763_+	MdtK family multidrug efflux MATE transporter	NA	NA	NA	NA	NA
WP_004175849.1|1300938_1301277_+	acid resistance repetitive basic protein Asr	NA	NA	NA	NA	NA
WP_004175848.1|1301417_1301996_-	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	35.5	5.9e-19
WP_077256825.1|1302675_1302903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071888317.1|1302899_1303163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009310076.1|1303730_1304711_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.2e-184
WP_004180176.1|1305083_1305968_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.3	4.3e-21
>prophage 111
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1311384	1312155	5403218		Escherichia_phage(100.0%)	1	NA	NA
WP_004184291.1|1311384_1312155_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.4	2.4e-12
>prophage 112
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1317339	1319288	5403218		Bacillus_virus(50.0%)	2	NA	NA
WP_060415630.1|1317339_1318320_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.8	1.5e-11
WP_060415631.1|1318316_1319288_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	28.6	1.1e-17
>prophage 113
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1332992	1337510	5403218		Bacillus_virus(50.0%)	4	NA	NA
WP_032418872.1|1332992_1333823_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.9e-26
WP_004145364.1|1333824_1334640_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_102949332.1|1334669_1336088_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_023278927.1|1336142_1337510_-	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	62.8	6.6e-29
>prophage 114
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1364748	1365372	5403218		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004151165.1|1364748_1365372_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	23.4	1.8e-05
>prophage 115
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1371388	1372459	5403218		Planktothrix_phage(100.0%)	1	NA	NA
WP_002908292.1|1371388_1372459_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.5	1.4e-29
>prophage 116
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1391991	1392813	5403218		Planktothrix_phage(100.0%)	1	NA	NA
WP_060415651.1|1391991_1392813_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	8.6e-16
>prophage 117
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1395974	1396748	5403218		Bacillus_virus(100.0%)	1	NA	NA
WP_004175711.1|1395974_1396748_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.2	1.5e-30
>prophage 118
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1407398	1409362	5403218		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
WP_060415657.1|1407398_1408415_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.7	4.3e-41
WP_017879921.1|1408411_1409362_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.3	2.8e-34
>prophage 119
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1416799	1417549	5403218		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_004151841.1|1416799_1417549_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.1	5.8e-11
>prophage 120
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1427469	1430682	5403218		environmental_halophage(50.0%)	3	NA	NA
WP_060415662.1|1427469_1428690_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	42.0	1.3e-92
WP_060415663.1|1428686_1429961_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_002908876.1|1429935_1430682_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	29.8	8.4e-10
>prophage 121
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1445173	1445935	5403218		Indivirus(100.0%)	1	NA	NA
WP_004212506.1|1445173_1445935_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.2	2.3e-15
>prophage 122
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1455914	1463883	5403218		Hokovirus(25.0%)	7	NA	NA
WP_004891189.1|1455914_1458293_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.1	1.4e-172
WP_002909061.1|1458632_1459466_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_004180369.1|1459620_1460667_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	A0A0B5IW14	Pandoravirus	46.6	1.4e-82
WP_002909070.1|1460774_1461002_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_060415669.1|1461031_1462474_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	37.5	2.3e-56
WP_002909082.1|1462587_1463052_-	lipoprotein	NA	NA	NA	NA	NA
WP_004175611.1|1463133_1463883_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.9	3.8e-10
>prophage 123
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1470950	1478119	5403218	tRNA	Geobacillus_virus(25.0%)	8	NA	NA
WP_002909098.1|1470950_1471250_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_060415671.1|1471254_1473642_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002909105.1|1473657_1474641_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	4.9e-34
WP_001386830.1|1474779_1474824_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|1474947_1475304_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|1475354_1475552_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004189469.1|1475644_1476187_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.5	6.3e-15
WP_103215423.1|1476190_1478119_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	1.8e-128
>prophage 124
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1487776	1490674	5403218		Lactobacillus_phage(33.33%)	3	NA	NA
WP_002910080.1|1487776_1488604_-	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	40.0	3.9e-08
WP_002910083.1|1488659_1489664_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	29.6	2.6e-14
WP_004151853.1|1489660_1490674_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	3.8e-13
>prophage 125
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1498933	1505200	5403218		Citrobacter_phage(25.0%)	7	NA	NA
WP_002910100.1|1498933_1499551_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.2e-54
WP_002910103.1|1500112_1500520_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_002910105.1|1500638_1501541_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.6	1.8e-59
WP_002910107.1|1501738_1502752_-	two-component system response regulator RssB	NA	Q6XM27	Feldmannia_irregularis_virus	29.4	1.1e-07
WP_002910108.1|1502841_1503744_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_002910109.1|1503856_1504315_+	YchJ family protein	NA	NA	NA	NA	NA
WP_004151854.1|1504357_1505200_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	43.1	8.3e-14
>prophage 126
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1509201	1510737	5403218		Escherichia_phage(100.0%)	1	NA	NA
WP_103215426.1|1509201_1510737_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	2.8e-20
>prophage 127
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1527230	1528019	5403218		Bacillus_virus(100.0%)	1	NA	NA
WP_004145418.1|1527230_1528019_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.4	2.6e-30
>prophage 128
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1533529	1570738	5403218	plate,tRNA,transposase	uncultured_Caudovirales_phage(33.33%)	32	NA	NA
WP_002910389.1|1533529_1533760_-	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	48.0	5.4e-08
WP_002910392.1|1534023_1535124_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_002910393.1|1535210_1536065_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.2	2.3e-48
WP_002910395.1|1536104_1536917_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004145428.1|1536920_1537313_-	SirB family protein	NA	NA	NA	NA	NA
WP_101970312.1|1537312_1538161_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002910403.1|1538160_1539243_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.9e-07
WP_002910404.1|1539285_1540542_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_002910405.1|1540812_1541424_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_032411361.1|1541420_1542272_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_002910407.1|1542455_1543403_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
WP_019704159.1|1543527_1545207_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	1.0e-23
WP_004175547.1|1545207_1546254_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910437.1|1546476_1546752_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_004180389.1|1547024_1547609_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002910443.1|1547726_1548818_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_103215429.1|1548899_1549229_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_002910453.1|1549312_1550227_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_103215430.1|1550358_1551774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215431.1|1551793_1552237_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004189400.1|1552239_1552782_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_021314027.1|1552756_1553803_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_103215432.1|1553802_1555566_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_103215433.1|1555699_1558666_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_004899005.1|1559130_1560342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004899008.1|1560346_1560604_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_032409210.1|1560629_1561037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009310076.1|1562227_1563208_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.2e-184
WP_103215434.1|1563640_1565047_-	M23 family metallopeptidase	NA	A0A2H4JIA8	uncultured_Caudovirales_phage	31.6	1.5e-47
WP_001101446.1|1565135_1566161_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_103215435.1|1566500_1567424_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	95.4	9.0e-171
WP_103215436.1|1568110_1570738_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.8	5.9e-18
>prophage 129
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1576464	1577163	5403218		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_004200316.1|1576464_1577163_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
>prophage 130
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1582379	1631794	5403218	integrase,holin	Salmonella_phage(28.07%)	71	1571964:1571980	1644031:1644047
1571964:1571980	attL	TCCGGCGGCTGACCCCG	NA	NA	NA	NA
WP_103215441.1|1582379_1582847_-	hypothetical protein	NA	U5P083	Shigella_phage	34.4	2.1e-11
WP_103215442.1|1582859_1583486_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	47.8	2.7e-22
WP_064168810.1|1583485_1584259_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.1	1.8e-76
WP_103215443.1|1584255_1585452_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.4	1.5e-157
WP_103215444.1|1585451_1585805_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	1.8e-50
WP_103215445.1|1585806_1586460_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	62.9	1.7e-59
WP_129075352.1|1586682_1587039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064162789.1|1587085_1587430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215446.1|1587426_1588455_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	53.5	3.9e-98
WP_065520196.1|1588457_1588760_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	8.8e-27
WP_103215447.1|1588760_1589360_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	58.1	9.9e-54
WP_103215448.1|1589359_1591363_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.4	5.7e-247
WP_016244729.1|1591352_1591505_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	84.0	1.4e-17
WP_103215449.1|1591546_1591966_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	64.4	2.2e-39
WP_103215450.1|1591969_1592410_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	78.8	3.6e-61
WP_103215451.1|1592420_1593572_-	DUF3383 family protein	NA	A0A0M4RD26	Salmonella_phage	81.5	6.1e-177
WP_077253977.1|1593573_1594125_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	44.9	2.0e-40
WP_009652660.1|1594117_1594522_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	71.5	1.1e-43
WP_021312707.1|1594521_1595028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215452.1|1595024_1595444_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	61.5	8.8e-41
WP_062920907.1|1595412_1595694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215453.1|1595733_1596675_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	75.2	1.8e-134
WP_103215454.1|1596686_1597181_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.1	9.3e-50
WP_103215455.1|1597184_1598387_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	52.8	9.1e-107
WP_103215456.1|1598438_1598987_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	55.7	6.3e-47
WP_086893091.1|1599042_1600494_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	69.2	6.5e-192
WP_064146503.1|1600497_1602111_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	83.8	6.6e-278
WP_103215457.1|1602113_1602587_-	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	70.0	4.3e-52
WP_103215458.1|1602617_1603253_-	hypothetical protein	NA	I6S676	Salmonella_phage	82.1	4.2e-103
WP_045354782.1|1603775_1604225_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	71.8	1.2e-59
WP_025987688.1|1604211_1604517_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	97.9	8.6e-46
WP_048265257.1|1604497_1604752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103215459.1|1604777_1605599_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	67.5	1.1e-98
WP_103215460.1|1605714_1606071_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	64.1	1.8e-39
WP_047748520.1|1606067_1606352_-	hypothetical protein	NA	G8C7V5	Escherichia_phage	96.8	7.2e-47
WP_103215461.1|1606344_1607016_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	73.1	1.7e-99
WP_024264476.1|1607012_1607180_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	7.8e-09
WP_103215462.1|1607185_1607782_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	54.3	1.2e-56
WP_103215463.1|1607946_1608198_-	hypothetical protein	NA	A0A2P1MXF0	Escherichia_phage	42.7	5.3e-09
WP_032455392.1|1608190_1608400_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_142390690.1|1608996_1609257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215465.1|1610318_1610798_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	35.9	5.4e-10
WP_048267547.1|1610794_1611097_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_103215466.1|1611093_1611966_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	69.0	3.2e-93
WP_059065814.1|1611950_1612805_-	replication protein	NA	K7PGT1	Enterobacteria_phage	54.8	3.7e-62
WP_040154952.1|1612891_1613212_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	69.8	5.0e-36
WP_004194000.1|1613251_1613479_-	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	61.2	1.9e-18
WP_103215467.1|1613547_1614270_+	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	62.4	3.9e-73
WP_142390689.1|1614389_1614860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103215469.1|1615633_1615849_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	2.0e-09
WP_072044099.1|1615948_1616155_+	cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	2.4e-31
WP_060415518.1|1616213_1616732_+	hypothetical protein	NA	A0A1W6DY33	Salmonella_phage	44.7	3.7e-33
WP_060415519.1|1616735_1617704_+	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	77.7	1.7e-39
WP_008807813.1|1617711_1617996_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	3.8e-40
WP_048983155.1|1618011_1618857_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	9.0e-69
WP_048983156.1|1618853_1619534_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	92.9	1.8e-123
WP_032442370.1|1619530_1619959_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	1.3e-63
WP_048983157.1|1619955_1620612_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.0	3.5e-113
WP_032442371.1|1620827_1621052_+	hypothetical protein	NA	G8C7U9	Escherichia_phage	73.2	1.6e-20
WP_103215470.1|1621048_1621240_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	62.7	2.1e-13
WP_016244760.1|1621614_1621860_+	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	93.4	3.8e-36
WP_064168663.1|1621902_1623165_+|integrase	site-specific integrase	integrase	A0A286S1S8	Klebsiella_phage	94.5	3.3e-232
WP_103215471.1|1623149_1623431_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_103215472.1|1623405_1624212_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004175494.1|1624226_1625522_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
WP_002910715.1|1625825_1626752_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910717.1|1626850_1627327_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004180410.1|1627376_1629020_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910720.1|1629303_1630197_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_103215473.1|1630202_1630922_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.1e-11
WP_004148803.1|1630918_1631794_-	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	25.5	1.5e-10
1644031:1644047	attR	CGGGGTCAGCCGCCGGA	NA	NA	NA	NA
>prophage 131
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1635656	1637951	5403218		Tetraselmis_virus(100.0%)	1	NA	NA
WP_021466440.1|1635656_1637951_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	3.9e-159
>prophage 132
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1654059	1654671	5403218		Geobacillus_virus(100.0%)	1	NA	NA
WP_002910846.1|1654059_1654671_-	membrane-bound lytic murein transglycosylase EmtA	NA	A0A0H3V0Q1	Geobacillus_virus	40.7	3.0e-05
>prophage 133
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1670296	1677665	5403218	tRNA	Staphylococcus_phage(33.33%)	7	NA	NA
WP_002910904.1|1670296_1671982_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.7e-34
WP_016946456.1|1672187_1672769_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_103215482.1|1672807_1673503_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_004175456.1|1673648_1675559_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.0	1.1e-90
WP_002910910.1|1675690_1676035_+	RidA family protein	NA	NA	NA	NA	NA
WP_004145519.1|1676035_1676221_-	YoaH family protein	NA	NA	NA	NA	NA
WP_023313377.1|1676309_1677665_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	40.4	1.8e-42
>prophage 134
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1681573	1683133	5403218		Moraxella_phage(100.0%)	1	NA	NA
WP_004145524.1|1681573_1683133_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.0	1.1e-40
>prophage 135
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1690573	1693366	5403218	transposase	Morganella_phage(50.0%)	4	NA	NA
WP_001062678.1|1690573_1690783_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_071526670.1|1690865_1690940_-	DUF2627 domain-containing protein	NA	NA	NA	NA	NA
WP_002911374.1|1691530_1691821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000608644.1|1692103_1693366_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
>prophage 136
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1697681	1699730	5403218		Moraxella_phage(100.0%)	1	NA	NA
WP_004145536.1|1697681_1699730_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.3	3.0e-86
>prophage 137
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1707237	1707891	5403218		Escherichia_phage(100.0%)	1	NA	NA
WP_004180432.1|1707237_1707891_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	8.0e-57
>prophage 138
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1711614	1712583	5403218		Pectobacterium_phage(50.0%)	2	NA	NA
WP_002911406.1|1711614_1711845_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	57.4	5.9e-15
WP_002911407.1|1711923_1712583_+	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	31.7	2.2e-14
>prophage 139
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1720008	1721484	5403218		Cyanophage(100.0%)	1	NA	NA
WP_002911427.1|1720008_1721484_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	3.2e-77
>prophage 140
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1725409	1741956	5403218	tRNA	Tupanvirus(37.5%)	18	NA	NA
WP_002911444.1|1725409_1726729_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	38.2	5.3e-15
WP_004180437.1|1726744_1727689_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_002911449.1|1727767_1728520_+	zinc ABC transporter ATP-binding protein ZnuC	NA	A0A2K9L3Z8	Tupanvirus	30.7	3.0e-15
WP_004899157.1|1728519_1729305_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_014343250.1|1729368_1730379_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.3	1.4e-07
WP_002911454.1|1730387_1730999_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_002911456.1|1731078_1731600_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	3.4e-10
WP_002911459.1|1731634_1732375_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002911477.1|1732402_1732846_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_103215488.1|1732847_1734635_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.2	1.3e-11
WP_004145564.1|1734902_1735469_+	hydrolase	NA	NA	NA	NA	NA
WP_002911483.1|1735465_1736284_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
WP_103215489.1|1736336_1736732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184666.1|1736771_1737515_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
WP_004148862.1|1737511_1738516_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_004145568.1|1738597_1739341_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_002911491.1|1739417_1739987_-	VOC family protein	NA	NA	NA	NA	NA
WP_004151452.1|1740222_1741956_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	1.4e-87
>prophage 141
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1761993	1797781	5403218	lysis,tail,terminase,integrase	uncultured_Caudovirales_phage(32.35%)	48	1761679:1761738	1797908:1797969
1761679:1761738	attL	TCCCAATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAA	NA	NA	NA	NA
WP_103215493.1|1761993_1762353_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	43.1	3.2e-15
WP_103215494.1|1762349_1762886_-	lysozyme	NA	K7PM52	Enterobacteria_phage	73.4	2.4e-75
WP_015365951.1|1762869_1763094_-|lysis	phage lysis protein S	lysis	A0A0P0ZFW5	Escherichia_phage	70.1	2.0e-20
WP_158650601.1|1763183_1763513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215496.1|1763478_1765725_-	hypothetical protein	NA	A0A0F6TJC8	Escherichia_coli_O157_typing_phage	38.7	4.3e-33
WP_103215497.1|1765742_1767353_-|terminase	phage terminase large subunit	terminase	A0A2H4JCA3	uncultured_Caudovirales_phage	70.8	1.2e-226
WP_076752321.1|1767349_1767691_-	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	48.2	2.0e-19
WP_142390679.1|1767825_1768263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103215499.1|1768259_1771136_-	hypothetical protein	NA	G9L6D4	Escherichia_phage	68.7	0.0e+00
WP_103215500.1|1771135_1773847_-	transglycosylase SLT domain-containing protein	NA	G9L6D3	Escherichia_phage	59.3	3.1e-296
WP_040200578.1|1773852_1774341_-	hypothetical protein	NA	A0A2H4J679	uncultured_Caudovirales_phage	49.0	3.5e-09
WP_082236719.1|1774343_1774796_-	GNAT family N-acetyltransferase	NA	A0A2H4J9Z5	uncultured_Caudovirales_phage	43.0	5.8e-22
WP_103215501.1|1774795_1776787_-	hypothetical protein	NA	A0A2H4J6H2	uncultured_Caudovirales_phage	48.3	2.1e-185
WP_103215502.1|1776786_1777350_-	hypothetical protein	NA	A0A2H4JID6	uncultured_Caudovirales_phage	49.2	7.6e-48
WP_103215503.1|1777409_1778315_-	hypothetical protein	NA	A0A2H4JC66	uncultured_Caudovirales_phage	39.6	9.7e-45
WP_103215504.1|1778530_1778887_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	70.7	1.1e-41
WP_103215505.1|1778922_1779423_-	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	61.7	4.5e-52
WP_158650602.1|1779438_1779603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215506.1|1779636_1780485_-	hypothetical protein	NA	A0A2H4JEQ5	uncultured_Caudovirales_phage	42.5	1.2e-44
WP_103215507.1|1780471_1780705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215508.1|1780704_1782327_-|tail	phage tail protein	tail	A0A2H4J3N6	uncultured_Caudovirales_phage	59.8	1.1e-174
WP_032409891.1|1782330_1782552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215509.1|1782562_1783003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215510.1|1783031_1783328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157665539.1|1783331_1783496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086893375.1|1783483_1783861_-	hypothetical protein	NA	A0A1I9KFA7	Aeromonas_phage	47.4	1.7e-19
WP_158236244.1|1783778_1784255_-	HNH endonuclease	NA	Q2NPG0	Xanthomonas_virus	42.2	2.6e-17
WP_071458084.1|1784265_1784862_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	70.2	4.0e-79
WP_032409886.1|1784930_1785122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215511.1|1785304_1785643_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.2	1.9e-46
WP_103215512.1|1785655_1786273_-	hypothetical protein	NA	A0A2H4JEM6	uncultured_Caudovirales_phage	24.9	2.3e-05
WP_015365928.1|1786269_1786500_-	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	37.3	3.8e-06
WP_103215513.1|1786502_1787093_-	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	86.2	1.3e-95
WP_103215514.1|1787238_1787472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215515.1|1787475_1788144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215760.1|1788182_1789577_-	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	46.7	1.9e-103
WP_103215516.1|1789585_1790578_-	replication protein RepO	NA	A0A067ZIA1	Vibrio_phage	46.1	6.9e-28
WP_015365921.1|1790580_1790739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015365920.1|1790822_1791269_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	51.4	1.7e-26
WP_000364674.1|1791331_1791565_-	helix-turn-helix transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	44.4	2.9e-09
WP_047723458.1|1791673_1792129_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	55.0	4.1e-36
WP_103215517.1|1792762_1793086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103215518.1|1793093_1793339_+	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	55.0	2.8e-15
WP_103215519.1|1793368_1795579_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.1	3.5e-96
WP_103215520.1|1795578_1796139_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	58.4	2.6e-48
WP_103215521.1|1796140_1796326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103215522.1|1796535_1796781_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	35.2	1.6e-05
WP_103215523.1|1796764_1797781_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	64.5	5.7e-126
1797908:1797969	attR	TCCCAATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAAT	NA	NA	NA	NA
>prophage 142
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1803238	1803991	5403218		Bacillus_virus(100.0%)	1	NA	NA
WP_004151455.1|1803238_1803991_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	2.2e-26
>prophage 143
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1814367	1819035	5403218		Burkholderia_phage(50.0%)	5	NA	NA
WP_015874955.1|1814367_1814862_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.7	5.7e-31
WP_009484430.1|1814842_1816276_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.0	4.0e-101
WP_002911594.1|1816319_1817027_-	phosphohydrolase	NA	S4W232	Pandoravirus	27.7	2.8e-07
WP_004151461.1|1817069_1817351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002911596.1|1817889_1819035_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-117
>prophage 144
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1836269	1837538	5403218	integrase	Stenotrophomonas_phage(100.0%)	1	1826568:1826581	1841103:1841116
1826568:1826581	attL	TGCCGGTCAGCACC	NA	NA	NA	NA
WP_004899245.1|1836269_1837538_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.7	9.7e-75
WP_004899245.1|1836269_1837538_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.7	9.7e-75
1841103:1841116	attR	GGTGCTGACCGGCA	NA	NA	NA	NA
>prophage 145
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1845479	1850222	5403218	transposase	Leptospira_phage(50.0%)	5	NA	NA
WP_085956072.1|1845479_1846600_-|transposase	IS3-like element ISKpn34 family transposase	transposase	S5WIU1	Leptospira_phage	43.3	1.5e-50
WP_029497606.1|1846795_1847038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023286683.1|1847107_1848211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023286684.1|1848207_1849179_-	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_103215525.1|1849385_1850222_-	alpha/beta hydrolase	NA	A0A2D1GKK1	Mycobacterium_phage	28.8	4.8e-14
>prophage 146
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1865743	1870838	5403218		Stx2-converting_phage(50.0%)	3	NA	NA
WP_004148990.1|1865743_1866913_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	80.7	7.6e-183
WP_103215529.1|1867087_1868512_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_083565370.1|1868735_1870838_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.9	2.8e-63
>prophage 147
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1875344	1876244	5403218		Cellulophaga_phage(100.0%)	1	NA	NA
WP_002912152.1|1875344_1876244_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	92.1	1.4e-11
>prophage 148
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1882491	1900398	5403218	transposase	Catovirus(11.11%)	14	NA	NA
WP_032439381.1|1882491_1883808_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	37.5	7.1e-12
WP_032418681.1|1883930_1885064_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_032439382.1|1885076_1885970_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_032439383.1|1885966_1887121_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	40.9	9.4e-77
WP_103215530.1|1887136_1889032_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_002912371.1|1889047_1889788_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	24.9	1.7e-07
WP_023316137.1|1889787_1890555_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_103215531.1|1891598_1892603_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	8.0e-32
WP_023343085.1|1892830_1893754_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.7	1.2e-172
WP_032439385.1|1894065_1894188_+	small membrane protein	NA	NA	NA	NA	NA
WP_032439386.1|1894610_1895777_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_004899416.1|1895940_1897311_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.9	1.1e-31
WP_032412638.1|1897333_1898749_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.8	8.9e-53
WP_032439387.1|1898991_1900398_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	1.6e-38
>prophage 149
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1911672	1912665	5403218		Sulfolobales_Mexican_rudivirus(100.0%)	1	NA	NA
WP_103215532.1|1911672_1912665_-	glycosyltransferase family 4 protein	NA	K4PAI8	Sulfolobales_Mexican_rudivirus	35.3	4.8e-05
>prophage 150
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1920862	1928696	5403218	transposase	Bacillus_phage(20.0%)	6	NA	NA
WP_001741945.1|1920862_1921753_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.0	5.6e-45
WP_103215534.1|1922186_1923110_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.7	4.7e-172
WP_032439401.1|1923584_1925168_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.5	5.0e-36
WP_004180531.1|1925504_1927352_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_004151145.1|1927382_1927964_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	5.1e-31
WP_002912442.1|1928054_1928696_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.3	2.0e-36
>prophage 151
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1945816	1952723	5403218	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004149058.1|1945816_1947295_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
WP_004175198.1|1947291_1948014_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004144192.1|1948332_1949694_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_002912636.1|1949939_1950833_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004180550.1|1951075_1951849_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004180551.1|1951859_1952723_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 152
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1979742	1986798	5403218	tRNA	Enterobacteria_phage(50.0%)	7	NA	NA
WP_002912753.1|1979742_1981776_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	8.9e-54
WP_002912756.1|1981892_1982363_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	74.4	6.6e-61
WP_004144215.1|1982410_1983130_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_002912760.1|1983123_1984812_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	84.1	5.5e-259
WP_002912762.1|1985041_1985155_+	protein YohO	NA	NA	NA	NA	NA
WP_004151128.1|1985129_1985867_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004149083.1|1985850_1986798_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	6.9e-25
>prophage 153
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	1993332	1993887	5403218		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002912829.1|1993332_1993887_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.8	1.3e-20
>prophage 154
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2009910	2011431	5403218		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002912876.1|2009910_2011431_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.0	3.1e-11
>prophage 155
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2015195	2019102	5403218		Cellulophaga_phage(50.0%)	3	NA	NA
WP_004184878.1|2015195_2015864_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	55.8	3.4e-55
WP_004151123.1|2016224_2017058_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_004890725.1|2017128_2019102_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.5	4.8e-12
>prophage 156
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2023502	2024357	5403218		Catovirus(100.0%)	1	NA	NA
WP_002912937.1|2023502_2024357_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	33.2	1.5e-23
>prophage 157
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2032189	2036501	5403218		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_049192311.1|2032189_2033656_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.2	5.4e-45
WP_032103472.1|2033776_2034754_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_004180648.1|2034797_2035505_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002912967.1|2035931_2036501_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.0	3.1e-12
>prophage 158
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2042256	2048343	5403218		Planktothrix_phage(33.33%)	5	NA	NA
WP_004151118.1|2042256_2043846_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.8	4.5e-21
WP_002912974.1|2043849_2044194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023280364.1|2044525_2045722_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	24.2	2.6e-21
WP_002912977.1|2045718_2046438_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_004144263.1|2046585_2048343_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	6.4e-101
>prophage 159
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2052579	2066415	5403218	integrase	Vibrio_phage(28.57%)	14	2055919:2055935	2075404:2075420
WP_004144267.1|2052579_2053587_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	49.8	2.4e-84
WP_004195346.1|2053773_2054001_+	YejL family protein	NA	NA	NA	NA	NA
WP_002912990.1|2054019_2055780_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
2055919:2055935	attL	CTCTCGTGCCGACCAAA	NA	NA	NA	NA
WP_064163518.1|2056127_2057387_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	45.2	2.6e-96
WP_064163519.1|2057513_2058581_+	hypothetical protein	NA	A0A1W6JPD1	Morganella_phage	32.3	6.8e-05
WP_064163520.1|2058711_2058909_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_103214974.1|2059234_2060278_+	topoisomerase	NA	A0A1B0VML8	Pseudomonas_phage	50.8	2.4e-39
WP_103214975.1|2060261_2062109_+	DUF927 domain-containing protein	NA	NA	NA	NA	NA
WP_077267588.1|2062807_2063077_+	host cell division inhibitor Icd-like protein	NA	A0A1W6JPK3	Morganella_phage	43.5	3.1e-07
WP_064163524.1|2063069_2063390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071527897.1|2063587_2063842_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032455384.1|2064135_2064486_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_064163525.1|2064498_2065503_+	hypothetical protein	NA	A0A1P8DIG7	Virus_Rctr197k	37.7	2.8e-08
WP_142294709.1|2065545_2066415_+	hypothetical protein	NA	H2DE57	Erwinia_phage	49.5	5.3e-72
2075404:2075420	attR	CTCTCGTGCCGACCAAA	NA	NA	NA	NA
>prophage 160
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2074234	2074948	5403218		Shewanella_sp._phage(100.0%)	1	NA	NA
WP_064163533.1|2074234_2074948_-	DUF1353 domain-containing protein	NA	A0A088C4U2	Shewanella_sp._phage	40.5	5.7e-08
>prophage 161
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2079438	2080599	5403218		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_072159425.1|2079438_2080599_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	48.2	6.6e-78
>prophage 162
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2084517	2088810	5403218	transposase	Acanthamoeba_polyphaga_mimivirus(50.0%)	3	NA	NA
WP_064794904.1|2084517_2085582_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y3R2	Acanthamoeba_polyphaga_mimivirus	49.5	3.5e-17
WP_004201678.1|2085655_2086708_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_032425493.1|2087886_2088810_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	95.4	2.0e-170
>prophage 163
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2093121	2105252	5403218		Pseudomonas_phage(33.33%)	7	NA	NA
WP_009307389.1|2093121_2095962_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	25.9	8.3e-42
WP_103215547.1|2096093_2098727_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.8	2.3e-94
WP_002913014.1|2098873_2099602_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_009307388.1|2099946_2102232_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.6	2.5e-283
WP_004140835.1|2102333_2103464_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.7	1.0e-176
WP_002913017.1|2103463_2103718_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	65.3	8.2e-26
WP_004149154.1|2104181_2105252_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	52.6	2.1e-09
>prophage 164
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2113097	2114303	5403218		Oenococcus_phage(100.0%)	1	NA	NA
WP_004175029.1|2113097_2114303_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.0	7.9e-26
>prophage 165
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2117418	2118372	5403218	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_004175025.1|2117418_2118372_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.7	1.5e-67
>prophage 166
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2146401	2147001	5403218		Salmonella_phage(100.0%)	1	NA	NA
WP_002913188.1|2146401_2147001_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	39.8	2.4e-07
>prophage 167
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2159403	2160177	5403218		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_002913206.1|2159403_2160177_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.1	1.9e-09
>prophage 168
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2164468	2165986	5403218		Mollivirus(100.0%)	1	NA	NA
WP_002913213.1|2164468_2165986_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	43.6	1.0e-86
>prophage 169
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2170536	2268671	5403218	terminase,tail,capsid,portal,integrase,holin,head,tRNA,protease	Enterobacteria_phage(14.29%)	101	2193269:2193297	2234958:2234986
WP_002913226.1|2170536_2171349_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_060415762.1|2171348_2172362_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002913228.1|2172425_2173562_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	1.6e-20
WP_004174966.1|2173672_2174650_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_060415763.1|2174736_2175912_-	MFS transporter	NA	NA	NA	NA	NA
WP_002913291.1|2176121_2177342_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_060416120.1|2177500_2179489_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_002913338.1|2179550_2179832_-	YfcL family protein	NA	NA	NA	NA	NA
WP_004174962.1|2179863_2180412_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_002913340.1|2180411_2181221_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_004174960.1|2181220_2182045_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_002913342.1|2182047_2183133_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
WP_002913346.1|2183174_2184107_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002913348.1|2184274_2184826_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_016946874.1|2184847_2185333_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_004174952.1|2185542_2187687_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_002913358.1|2187686_2188997_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_002913359.1|2189156_2189441_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_103215551.1|2189809_2191138_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_002913362.1|2191199_2191961_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_060415764.1|2192250_2193180_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	81.4	3.0e-134
2193269:2193297	attL	TGTCCCCTTAGTTAAATGGATATAACGAG	NA	NA	NA	NA
WP_103215552.1|2193403_2194003_-	DUF4760 domain-containing protein	NA	Q8HA56	Vibrio_phage	32.6	9.4e-20
WP_103215554.1|2195693_2196452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103215555.1|2196785_2197181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215556.1|2197260_2198160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040150180.1|2198170_2198749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215557.1|2200775_2203853_-	kinase	NA	A0A286S259	Klebsiella_phage	62.0	0.0e+00
WP_023313066.1|2203849_2204230_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	84.1	6.9e-61
WP_004864228.1|2204242_2204719_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
WP_101991321.1|2204705_2205179_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.6e-54
WP_103215558.1|2205200_2208587_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.7	1.2e-302
WP_016530182.1|2208647_2208881_-	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_004177139.1|2208954_2209260_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
WP_021313622.1|2209262_2209667_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	57.7	8.5e-33
WP_023302600.1|2209697_2210402_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.5	1.6e-79
WP_101991315.1|2210458_2210806_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	62.8	3.6e-32
WP_101991316.1|2210802_2211252_-	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	2.3e-63
WP_103215559.1|2211248_2211587_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	68.8	5.1e-39
WP_103215560.1|2211595_2211913_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.9	2.1e-23
WP_004104235.1|2211990_2213229_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	69.2	6.8e-158
WP_000999827.1|2213238_2213838_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
WP_075253003.1|2213830_2215057_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	84.8	7.1e-208
WP_103215561.1|2215204_2216956_-|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	72.2	5.2e-252
WP_023316719.1|2216959_2217457_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	72.0	1.9e-63
WP_023313054.1|2217614_2217965_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	80.2	2.7e-51
WP_023313053.1|2218104_2218644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074195605.1|2218894_2219098_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	78.1	9.8e-22
WP_064190522.1|2219048_2219324_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	82.8	1.3e-05
WP_050849670.1|2219326_2219956_-	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	77.8	3.1e-90
WP_000243811.1|2219955_2220237_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	48.4	4.8e-19
WP_001294159.1|2220223_2220610_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	90.6	1.6e-57
WP_001018764.1|2220775_2221015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215562.1|2221165_2221744_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	3.8e-50
WP_046654861.1|2221740_2222382_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	68.4	3.7e-83
WP_050484678.1|2222378_2223023_-	NinG family protein	NA	A0A1W6JNX3	Morganella_phage	54.3	1.9e-39
WP_038806620.1|2222992_2223964_-	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	61.6	3.9e-108
WP_103215563.1|2223960_2225490_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	66.9	8.6e-203
WP_040176286.1|2225482_2225758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025711394.1|2225919_2226198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040203468.1|2226233_2226704_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	75.0	4.2e-60
WP_040176134.1|2226729_2226927_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	68.3	1.4e-17
WP_040176132.1|2227030_2227678_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	63.0	3.5e-73
WP_134920548.1|2228077_2228272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032426830.1|2228245_2228425_-	hypothetical protein	NA	S5FM78	Shigella_phage	61.0	2.5e-13
WP_004104278.1|2228849_2229209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048267936.1|2229252_2230065_+	DUF2303 family protein	NA	NA	NA	NA	NA
WP_103215564.1|2230146_2231007_+	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	53.4	3.6e-73
WP_074424597.1|2231196_2231325_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_077265469.1|2231321_2231546_+	hypothetical protein	NA	S4TVX5	Salmonella_phage	52.3	1.4e-13
WP_060415777.1|2231538_2231793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060415778.1|2232622_2233561_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_103215565.1|2233593_2234763_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	85.0	3.1e-200
WP_004174945.1|2235281_2235764_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
2234958:2234986	attR	TGTCCCCTTAGTTAAATGGATATAACGAG	NA	NA	NA	NA
WP_060415780.1|2236131_2237013_+	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
WP_060415781.1|2237022_2237931_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	4.6e-10
WP_060415782.1|2238063_2238522_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	33.1	4.2e-12
WP_014907146.1|2238518_2239715_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_099119320.1|2240053_2240125_+	membrane protein YpdK	NA	NA	NA	NA	NA
WP_015875075.1|2240195_2241410_-	alanine transaminase	NA	NA	NA	NA	NA
WP_004149230.1|2241792_2243490_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	6.7e-47
WP_002913374.1|2243501_2244239_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
WP_002913377.1|2244292_2245258_-	glucokinase	NA	NA	NA	NA	NA
WP_004154521.1|2245521_2246757_+	ion channel protein	NA	NA	NA	NA	NA
WP_004159719.1|2246753_2248415_-	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
WP_040222174.1|2248595_2249588_+	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_002913419.1|2249718_2250078_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_002913421.1|2250135_2251377_-	Mn(2+) uptake NRAMP transporter MntH	NA	NA	NA	NA	NA
WP_002913423.1|2251723_2252926_+	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_103215566.1|2252932_2255146_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_002913434.1|2255767_2256121_+	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_103215567.1|2256124_2256517_+	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004145598.1|2256568_2257987_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002913438.1|2258729_2259656_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.3	4.1e-06
WP_002913439.1|2259744_2260743_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_002913440.1|2260739_2260958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215568.1|2260959_2262975_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.5	1.7e-145
WP_103215761.1|2263044_2264118_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_004174922.1|2264351_2265113_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_002913498.1|2265289_2266261_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.3	3.3e-75
WP_002913505.1|2266641_2266899_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_002913506.1|2266943_2268671_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.6	3.3e-17
>prophage 170
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2272279	2274404	5403218		Lactococcus_phage(50.0%)	2	NA	NA
WP_004890515.1|2272279_2273191_-	cysteine synthase CysM	NA	A0A1W6JHY1	Lactococcus_phage	40.7	9.8e-53
WP_002913623.1|2273309_2274404_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	7.2e-26
>prophage 171
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2277757	2281334	5403218		Pandoravirus(50.0%)	5	NA	NA
WP_020803947.1|2277757_2278657_-	Dyp-type peroxidase	NA	S4VVJ7	Pandoravirus	32.6	3.8e-25
WP_002913630.1|2278751_2279327_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_002913635.1|2279388_2279838_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_002913637.1|2279824_2280250_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_002913639.1|2280461_2281334_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	31.9	2.2e-17
>prophage 172
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2313236	2414715	5403218	transposase,terminase,tail,capsid,integrase,holin,tRNA,protease	Salmonella_phage(29.23%)	108	2397324:2397352	2414935:2414963
WP_032434834.1|2313236_2315240_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
WP_040218517.1|2315249_2316125_-	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
WP_002913801.1|2316244_2316958_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	1.1e-38
WP_103215572.1|2317174_2318209_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_002913803.1|2318225_2319104_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_004145648.1|2319191_2319824_+	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
WP_002913805.1|2319827_2320298_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_002913806.1|2320359_2321421_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002913807.1|2321643_2323107_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
WP_002913810.1|2323116_2323476_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_060415791.1|2323603_2324527_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	4.6e-74
WP_020947395.1|2324523_2325225_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_002913824.1|2325323_2326610_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
WP_002913827.1|2326705_2327332_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_004174870.1|2327549_2328983_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_004213188.1|2328992_2329886_-	ROK family protein	NA	NA	NA	NA	NA
WP_002913836.1|2330149_2331187_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
WP_004145656.1|2331183_2331825_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	9.0e-29
WP_002913838.1|2332005_2334066_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_002913839.1|2334069_2335602_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_002913843.1|2338235_2338427_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	79.3	3.3e-19
WP_002913846.1|2338523_2339411_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060415793.1|2339508_2340741_+	MFS transporter	NA	NA	NA	NA	NA
WP_029884024.1|2341034_2342213_+	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_060415794.1|2342196_2344065_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	1.2e-07
WP_060596325.1|2344284_2344767_-	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	83.8	5.0e-64
WP_060596324.1|2344763_2345393_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	77.9	9.6e-92
WP_004146393.1|2345382_2345688_-|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	2.7e-39
WP_004146394.1|2345674_2346079_-	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_103215573.1|2346175_2346391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215574.1|2346391_2348806_-	hypothetical protein	NA	A0A1J0MGQ6	Serratia_phage	40.6	8.7e-117
WP_004194725.1|2348997_2350218_-|transposase	ISL3-like element ISCfr12 family transposase	transposase	NA	NA	NA	NA
WP_085320215.1|2350317_2350578_+	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	64.0	9.3e-25
WP_103215575.1|2350892_2351582_+	anti-repressor protein	NA	G9L6E2	Escherichia_phage	65.2	1.2e-79
WP_009307977.1|2351776_2352409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080842387.1|2352696_2352933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215576.1|2353158_2353599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103215577.1|2353599_2353896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196907.1|2353961_2355500_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	7.4e-295
WP_004196919.1|2355548_2355896_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	3.3e-62
WP_003031976.1|2355892_2356297_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	98.5	4.3e-69
WP_103215578.1|2359450_2362195_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	39.9	8.8e-97
WP_024622833.1|2362207_2362705_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	41.7	5.2e-24
WP_103215579.1|2362697_2363168_-	hypothetical protein	NA	Q858G2	Salmonella_phage	53.3	2.3e-42
WP_103215580.1|2363169_2365653_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	57.1	1.4e-274
WP_004197381.1|2365652_2366264_-	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	9.2e-47
WP_103215581.1|2366312_2366591_-	hypothetical protein	NA	Q858G6	Salmonella_phage	59.6	2.3e-21
WP_103215582.1|2366583_2366976_-	hypothetical protein	NA	T1SA71	Salmonella_phage	89.1	1.3e-54
WP_087652941.1|2366985_2367993_-|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	92.5	4.7e-181
WP_040120462.1|2368005_2368404_-	peptidase	NA	T1SAP9	Salmonella_phage	59.5	1.6e-36
WP_048328162.1|2368706_2369012_-	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	6.4e-17
WP_065928327.1|2369008_2370688_-|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	59.1	2.3e-193
WP_004152472.1|2370691_2370895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087826983.1|2371637_2371994_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	69.9	4.1e-39
WP_103215583.1|2372153_2373629_-|terminase	terminase	terminase	Q858H3	Salmonella_phage	92.2	5.4e-279
WP_023301598.1|2373625_2374210_-|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	6.4e-90
WP_017896964.1|2374267_2374597_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	56.1	3.0e-28
WP_004194725.1|2374698_2375919_+|transposase	ISL3-like element ISCfr12 family transposase	transposase	NA	NA	NA	NA
WP_103215584.1|2375998_2376337_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	85.5	2.1e-48
WP_048980343.1|2376329_2376518_-	hypothetical protein	NA	R9TNE4	Aeromonas_phage	76.7	2.5e-19
WP_040154944.1|2376517_2376778_-	hypothetical protein	NA	A0A077SLR0	Escherichia_phage	70.9	9.0e-28
WP_103215762.1|2376770_2377313_-	DUF551 domain-containing protein	NA	R9TQX3	Aeromonas_phage	57.1	5.3e-46
WP_103215585.1|2377429_2377741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048981801.1|2377737_2378094_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	34.1	3.7e-08
WP_103215586.1|2378286_2378634_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	81.7	4.2e-49
WP_103215587.1|2378752_2379538_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.0	1.4e-132
WP_103215588.1|2379534_2380302_-	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	91.0	2.6e-139
WP_023301592.1|2380301_2380511_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	79.7	1.0e-26
WP_023285447.1|2380657_2380891_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	1.2e-23
WP_004144290.1|2381045_2381627_+	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
WP_103215763.1|2382029_2383061_+	hypothetical protein	NA	A0A059VK18	Pseudomonas_phage	51.6	4.2e-36
WP_103215589.1|2383068_2383368_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	52.5	5.7e-18
WP_059065285.1|2383364_2384264_+	endonuclease	NA	Q858E0	Salmonella_phage	91.0	1.9e-157
WP_103215590.1|2384273_2385296_+	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.6	1.8e-180
WP_004144294.1|2385346_2385595_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
WP_103215591.1|2385704_2385998_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	70.1	1.2e-31
WP_094818680.1|2385990_2386149_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	82.4	6.7e-18
WP_103215592.1|2386145_2386817_+	hypothetical protein	NA	R9VWB9	Serratia_phage	71.3	1.6e-92
WP_101977160.1|2386813_2387005_+	DUF1382 family protein	NA	G9L698	Escherichia_phage	66.1	3.5e-13
WP_103215593.1|2387590_2387953_+	hypothetical protein	NA	A0A173GC52	Salmonella_phage	35.7	1.3e-08
WP_103215594.1|2387967_2389218_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.5	1.8e-206
WP_004151979.1|2389410_2390988_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004151980.1|2391055_2392522_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_060415795.1|2392680_2394072_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	33.0	3.7e-35
WP_004144303.1|2394055_2394274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004174854.1|2394323_2395403_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_032432163.1|2395586_2396066_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_060415796.1|2396287_2396980_-	hypothetical protein	NA	NA	NA	NA	NA
2397324:2397352	attL	CTGATAGCTTATTTGCTTTTCTTGATGTG	NA	NA	NA	NA
WP_103215595.1|2397546_2397921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032750877.1|2398322_2398622_-	hypothetical protein	NA	A0A2H4JEE3	uncultured_Caudovirales_phage	40.3	7.4e-10
WP_077267674.1|2399050_2401366_+	transglycosylase SLT domain-containing protein	NA	A0A193GYI3	Enterobacter_phage	35.0	2.7e-107
WP_103215596.1|2401362_2403171_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	70.8	2.8e-237
WP_103215597.1|2403174_2405652_+	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	83.8	0.0e+00
WP_032750882.1|2405655_2405961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075212195.1|2406426_2406522_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_103215599.1|2406561_2406855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215600.1|2407217_2409350_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	41.7	4.4e-128
WP_103215601.1|2409360_2410002_-	hypothetical protein	NA	A0A1B5FPB4	Escherichia_phage	43.8	3.9e-24
WP_064168531.1|2409998_2410343_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_049190144.1|2410347_2410536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064371237.1|2410522_2410735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215602.1|2410727_2410961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215764.1|2410953_2411172_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_103215603.1|2411389_2411587_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	41.4	9.5e-06
WP_103215604.1|2411686_2412265_-	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	58.2	3.3e-54
WP_075912587.1|2412306_2412519_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_103215605.1|2412805_2413456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215765.1|2413452_2414715_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	58.4	4.1e-142
2414935:2414963	attR	CTGATAGCTTATTTGCTTTTCTTGATGTG	NA	NA	NA	NA
>prophage 173
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2423814	2424246	5403218		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_004144312.1|2423814_2424246_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	38.6	1.7e-18
>prophage 174
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2434758	2441079	5403218		Mycoplasma_phage(20.0%)	8	NA	NA
WP_002913953.1|2434758_2436045_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	9.9e-35
WP_002913954.1|2436115_2436316_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_002913956.1|2436317_2436653_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_004149343.1|2436654_2438505_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.5	1.4e-103
WP_004174835.1|2438520_2439036_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_002913979.1|2439110_2439434_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.6e-21
WP_002913991.1|2439451_2439838_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
WP_002913992.1|2439864_2441079_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.8	3.2e-35
>prophage 175
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2456326	2478395	5403218	tRNA	Bacillus_phage(25.0%)	19	NA	NA
WP_002914027.1|2456326_2457580_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	1.9e-99
WP_004185137.1|2457905_2459096_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_002914032.1|2459170_2459509_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_103215607.1|2459574_2460912_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	34.2	3.0e-10
WP_102949328.1|2460898_2461606_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_103215608.1|2461614_2463036_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.8	1.1e-13
WP_103215609.1|2463626_2467514_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	5.0e-130
WP_004144346.1|2467689_2469306_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_004890375.1|2469302_2469845_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.8	2.6e-05
WP_002914050.1|2469874_2470510_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_004144349.1|2470723_2471572_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004888420.1|2471628_2471889_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	54.7	1.3e-18
WP_004144351.1|2471901_2472282_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_004180923.1|2472281_2473013_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_060415805.1|2473024_2473762_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_002914063.1|2473773_2474679_-	GTPase Era	NA	NA	NA	NA	NA
WP_002914065.1|2474675_2475356_-	ribonuclease III	NA	A0A0P0YM82	Yellowstone_lake_phycodnavirus	29.7	1.6e-20
WP_002914067.1|2475605_2476580_-	signal peptidase I	NA	NA	NA	NA	NA
WP_002914069.1|2476595_2478395_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.4	5.5e-23
>prophage 176
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2483295	2586954	5403218	transposase,terminase,tail,portal,integrase,holin,tRNA,protease	Enterobacteria_phage(29.31%)	106	2520141:2520156	2577806:2577821
WP_060415807.1|2483295_2484033_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_002914082.1|2484164_2485496_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
WP_002914084.1|2485541_2485925_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914088.1|2486237_2486927_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_048987822.1|2486984_2488070_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914091.1|2488273_2488699_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_004174808.1|2488768_2489467_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_060415808.1|2489501_2492153_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_103215610.1|2492273_2493629_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_004899914.1|2493670_2493994_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_004144368.1|2493997_2495296_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	4.1e-44
WP_004890358.1|2501300_2503874_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_021469932.1|2504003_2504735_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002914110.1|2504731_2505712_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004145664.1|2505843_2506581_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914111.1|2506851_2507187_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100250063.1|2507293_2507341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014907100.1|2507441_2508602_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_004174805.1|2508598_2509471_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_032433445.1|2509533_2510655_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002914114.1|2510664_2511735_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_004174804.1|2512077_2512587_+	YfiR family protein	NA	NA	NA	NA	NA
WP_002914116.1|2512579_2513803_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_004145671.1|2513816_2514299_+	OmpA family protein	NA	NA	NA	NA	NA
WP_048978186.1|2514307_2515678_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_002914119.1|2515734_2516193_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|2516312_2516660_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002914147.1|2516699_2517467_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004150977.1|2517498_2518047_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914149.1|2518065_2518314_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002914152.1|2518573_2519938_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914153.1|2520101_2520893_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
2520141:2520156	attL	GTCAGCCTCGCGCTGA	NA	NA	NA	NA
WP_004149392.1|2520912_2522199_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914155.1|2522318_2522909_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_023284132.1|2523033_2523912_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_023284133.1|2523998_2525660_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914160.1|2525807_2526149_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004145682.1|2526215_2526506_-	RnfH family protein	NA	NA	NA	NA	NA
WP_015875096.1|2526495_2526972_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914164.1|2527082_2527565_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_103215611.1|2528234_2528618_-	DNA polymerase V	NA	Q6UAV9	Klebsiella_phage	89.0	2.6e-63
WP_015370245.1|2528697_2528937_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	87.3	7.2e-32
WP_103215612.1|2529183_2529753_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	87.3	1.6e-85
WP_103215613.1|2529960_2531559_+	hypothetical protein	NA	A0A1J0MGQ6	Serratia_phage	42.9	1.8e-126
WP_103215614.1|2531558_2531786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048981995.1|2531817_2532093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215615.1|2534203_2537266_-	kinase	NA	A0A286S259	Klebsiella_phage	80.6	0.0e+00
WP_049592238.1|2537262_2537643_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	92.9	7.6e-68
WP_103215616.1|2537652_2538135_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	83.8	1.1e-71
WP_103215617.1|2538131_2538596_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	56.7	2.6e-49
WP_103215618.1|2538595_2541292_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	58.0	2.1e-196
WP_094963353.1|2541272_2541590_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	49.5	3.5e-18
WP_064375426.1|2541610_2542006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072351786.1|2542050_2542533_-|tail	phage tail protein	tail	O64327	Escherichia_phage	66.9	8.2e-59
WP_064375427.1|2542540_2542939_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	62.5	3.6e-44
WP_103215619.1|2542935_2543487_-|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	63.8	1.1e-51
WP_064375429.1|2543476_2543770_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_103215620.1|2543762_2544089_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	72.9	3.9e-36
WP_103215621.1|2544176_2546192_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	86.4	0.0e+00
WP_103215622.1|2546136_2547636_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	82.8	6.2e-246
WP_103215623.1|2547632_2547848_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	75.7	5.5e-23
WP_103215624.1|2547844_2549953_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	84.1	0.0e+00
WP_064375435.1|2549952_2550444_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	84.0	8.4e-67
WP_103215625.1|2550767_2550953_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	57.4	9.2e-11
WP_108918987.1|2551020_2551281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064398221.1|2551505_2551748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215627.1|2551880_2552156_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	67.8	4.9e-24
WP_103215628.1|2552152_2552497_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	64.9	3.0e-31
WP_103215629.1|2552493_2553036_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	75.8	4.9e-76
WP_103215630.1|2553038_2553392_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	75.7	1.2e-43
WP_103215631.1|2553533_2554586_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	76.7	4.4e-166
WP_103215632.1|2554735_2554930_-	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	81.5	1.9e-22
WP_103215633.1|2555123_2555822_-	antitermination protein	NA	Q6UAU4	Klebsiella_phage	29.2	1.2e-10
WP_103215634.1|2555843_2556905_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	55.1	1.7e-109
WP_103215635.1|2556901_2558872_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	57.7	8.2e-214
WP_103215636.1|2558864_2559764_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	73.2	1.7e-126
WP_004122994.1|2559763_2560021_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	75.0	3.3e-22
WP_103215637.1|2560017_2560896_-	GntR family transcriptional regulator	NA	K7PLZ7	Enterobacterial_phage	56.7	7.0e-32
WP_103215638.1|2560892_2561072_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_103215639.1|2561073_2561793_-	phage regulatory protein/antirepressor Ant	NA	A0A2I7RHG4	Vibrio_phage	51.8	2.8e-47
WP_103215640.1|2561773_2561971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215641.1|2561967_2562525_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	54.1	1.9e-43
WP_103215642.1|2562553_2562763_-	cell division protein	NA	NA	NA	NA	NA
WP_103215643.1|2562863_2563490_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	47.3	1.0e-45
WP_004123001.1|2564760_2565132_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	93.5	2.8e-59
WP_103215645.1|2565188_2566016_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	84.4	4.8e-131
WP_048258083.1|2566157_2566685_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	69.7	9.3e-64
WP_048258072.1|2566684_2566885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103215646.1|2566877_2567663_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	2.8e-64
WP_103215647.1|2568177_2568582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103215648.1|2568578_2569298_+	hypothetical protein	NA	A0A1B0VCG7	Salmonella_phage	40.5	1.2e-26
WP_103215649.1|2569297_2569813_+	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	77.0	3.4e-71
WP_103215650.1|2570894_2572085_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.9	1.4e-147
WP_048269408.1|2572361_2573567_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.8	3.7e-108
WP_127897275.1|2573569_2575204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103215651.1|2575196_2576567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048269410.1|2576952_2577519_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	3.7e-58
WP_032699000.1|2577536_2577782_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	4.2e-19
WP_048269412.1|2577778_2578516_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.2	7.1e-70
2577806:2577821	attR	GTCAGCCTCGCGCTGA	NA	NA	NA	NA
WP_077258327.1|2579320_2579878_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	67.6	1.6e-29
WP_004136110.1|2579874_2580102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048269416.1|2580098_2580419_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_060415811.1|2580430_2582764_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
WP_041146806.1|2583067_2584279_+	hypothetical protein	NA	U5N3F3	Enterobacteria_phage	28.4	1.4e-33
WP_001118616.1|2584665_2585589_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_001101446.1|2585928_2586954_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 177
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2601499	2602402	5403218		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002914281.1|2601499_2602402_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.2	2.6e-37
>prophage 178
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2607583	2612882	5403218		Lactobacillus_phage(25.0%)	5	NA	NA
WP_002914320.1|2607583_2607829_+	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	41.1	5.5e-11
WP_002914321.1|2607825_2608236_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_060415821.1|2608208_2610350_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	46.4	2.5e-184
WP_002914327.1|2610360_2611323_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	72.2	1.5e-131
WP_060415822.1|2611679_2612882_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.8	1.2e-26
>prophage 179
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2627599	2635804	5403218	tRNA	Vibrio_phage(20.0%)	8	NA	NA
WP_000906486.1|2627599_2627785_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_060415824.1|2628148_2630776_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	4.9e-81
WP_004213244.1|2631026_2631527_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_002914769.1|2631594_2632653_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	2.3e-114
WP_004213242.1|2632743_2633241_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	50.3	3.1e-29
WP_060415825.1|2633380_2634259_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004149458.1|2634266_2635130_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_004181011.1|2635126_2635804_-	ATP-binding cassette domain-containing protein	NA	A0A2H4UU96	Bodo_saltans_virus	29.3	3.0e-06
>prophage 180
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2641742	2642708	5403218		Tetraselmis_virus(100.0%)	1	NA	NA
WP_004174691.1|2641742_2642708_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.6	1.6e-37
>prophage 181
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2669649	2671050	5403218		Pandoravirus(100.0%)	1	NA	NA
WP_002914970.1|2669649_2671050_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	28.3	5.2e-45
>prophage 182
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2681415	2682237	5403218		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_004211599.1|2681415_2682237_+	manganese/iron ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.4	2.1e-14
>prophage 183
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2693980	2697475	5403218		Staphylococcus_phage(50.0%)	2	NA	NA
WP_060415839.1|2693980_2694760_+	heme ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.5	3.0e-10
WP_004151059.1|2694913_2697475_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.9	1.3e-30
>prophage 184
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2700942	2707361	5403218		uncultured_Mediterranean_phage(40.0%)	7	NA	NA
WP_025367922.1|2700942_2701830_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.3	8.7e-06
WP_060415846.1|2701938_2703141_+	MFS transporter	NA	NA	NA	NA	NA
WP_009485531.1|2703137_2703515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002915106.1|2703567_2704560_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	4.6e-32
WP_004149542.1|2704717_2705854_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	3.8e-06
WP_002915108.1|2705979_2706606_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	6.3e-35
WP_060415847.1|2706599_2707361_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.4	1.7e-58
>prophage 185
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2710431	2712464	5403218		Tupanvirus(50.0%)	2	NA	NA
WP_002915158.1|2710431_2711037_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	37.6	6.1e-27
WP_060415848.1|2711036_2712464_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.1	1.1e-34
>prophage 186
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2721230	2726567	5403218		Vibrio_phage(33.33%)	4	NA	NA
WP_002915210.1|2721230_2721902_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	32.1	2.5e-13
WP_004210593.1|2722376_2723486_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_002915213.1|2723549_2724848_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	57.5	7.5e-131
WP_004142808.1|2724929_2726567_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.7	2.3e-153
>prophage 187
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2730109	2735575	5403218		Erysipelothrix_phage(33.33%)	3	NA	NA
WP_002915220.1|2730109_2731414_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	1.7e-34
WP_103215654.1|2731527_2734278_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	28.9	6.4e-47
WP_002915222.1|2734435_2735575_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.9	3.4e-47
>prophage 188
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2742989	2743835	5403218		Vibrio_phage(100.0%)	1	NA	NA
WP_038807062.1|2742989_2743835_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.4	1.5e-42
>prophage 189
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2754090	2755113	5403218		Bacillus_phage(100.0%)	1	NA	NA
WP_004174621.1|2754090_2755113_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	33.0	1.0e-13
>prophage 190
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2761517	2762273	5403218		Bacillus_phage(100.0%)	1	NA	NA
WP_060415855.1|2761517_2762273_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.6	2.9e-10
>prophage 191
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2773818	2776319	5403218	tRNA	environmental_halophage(50.0%)	3	NA	NA
WP_040166220.1|2773818_2775024_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	6.8e-70
WP_004142894.1|2775023_2775455_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_002915577.1|2775497_2776319_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	31.7	1.6e-14
>prophage 192
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2783430	2785911	5403218		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_103215655.1|2783430_2785911_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.4	6.2e-17
>prophage 193
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2788991	2789252	5403218		Burkholderia_virus(100.0%)	1	NA	NA
WP_020325073.1|2788991_2789252_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	31.8	1.6e-05
>prophage 194
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2800994	2801819	5403218		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_002915614.1|2800994_2801819_-	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	23.3	4.3e-07
>prophage 195
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2834471	2846151	5403218		Deep-sea_thermophilic_phage(25.0%)	6	NA	NA
WP_004900318.1|2834471_2835725_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.9	1.5e-14
WP_004149616.1|2835952_2837284_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_002915873.1|2837513_2837834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023313602.1|2837891_2839736_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	24.8	5.3e-21
WP_064174150.1|2839732_2843269_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.1	1.7e-07
WP_060415872.1|2843265_2846151_-	pitrilysin	NA	A0A1V0SH69	Hokovirus	21.8	1.1e-44
>prophage 196
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2851662	2863580	5403218		Geobacillus_virus(25.0%)	10	NA	NA
WP_023284221.1|2851662_2852457_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	72.7	2.4e-119
WP_002915934.1|2852463_2853339_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_002915935.1|2853584_2855831_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	23.3	5.6e-09
WP_002915936.1|2855843_2856374_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_004143967.1|2857056_2857752_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_002915973.1|2857815_2858529_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	46.8	4.5e-45
WP_002915974.1|2858652_2858871_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_060415873.1|2859091_2860132_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_023284222.1|2860234_2861428_-	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
WP_002915977.1|2861420_2863580_-	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	A0A2H4PQU7	Staphylococcus_phage	25.1	6.4e-18
>prophage 197
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2869557	2870568	5403218		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004143975.1|2869557_2870568_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.7	2.1e-27
>prophage 198
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2876281	2877409	5403218		Bacillus_phage(100.0%)	1	NA	NA
WP_004149643.1|2876281_2877409_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.5	4.7e-12
>prophage 199
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2883172	2886643	5403218		Enterobacteria_phage(33.33%)	3	NA	NA
WP_004149647.1|2883172_2884168_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.2	2.8e-13
WP_002916001.1|2884164_2885586_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	27.3	1.1e-23
WP_002916003.1|2885881_2886643_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	1.0e-18
>prophage 200
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2902819	2938475	5403218	transposase,integrase	Escherichia_phage(33.33%)	37	2899790:2899808	2943577:2943595
2899790:2899808	attL	GCTGGTCTGGGTATCGGTA	NA	NA	NA	NA
WP_000019449.1|2902819_2903800_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
WP_002916131.1|2904478_2904688_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_004151952.1|2904783_2905680_-	EamA family transporter	NA	NA	NA	NA	NA
WP_002916184.1|2905761_2906268_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_103215658.1|2906264_2907221_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_002916186.1|2908039_2908288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015875142.1|2908438_2909044_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.4	4.6e-51
WP_004174509.1|2909509_2910118_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	50.7	2.6e-49
WP_002916190.1|2910596_2911145_+	fimbrial protein	NA	NA	NA	NA	NA
WP_004174507.1|2911215_2911752_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_103215659.1|2911780_2912506_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_103215660.1|2912587_2915200_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_019705553.1|2915210_2915738_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002916195.1|2915750_2916251_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_032435667.1|2916268_2917174_+	fimbrial protein	NA	NA	NA	NA	NA
WP_023328364.1|2917170_2918583_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_002916201.1|2918625_2918898_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_002916202.1|2918909_2919140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002916204.1|2919345_2919618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103215661.1|2919624_2920650_+	multidrug transporter subunit MdtN	NA	NA	NA	NA	NA
WP_103215662.1|2920662_2922600_+	multidrug efflux transporter permease subunit MdtO	NA	NA	NA	NA	NA
WP_103215663.1|2922596_2924045_+	MdtP family multidrug efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_002916274.1|2924107_2924407_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_002916277.1|2924591_2926145_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.1	9.5e-157
WP_004181224.1|2926617_2927040_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	65.7	4.5e-45
WP_087848481.1|2927049_2928342_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.7	2.5e-163
WP_002916281.1|2928393_2928723_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	54.0	2.9e-23
WP_002916282.1|2928941_2929235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002916283.1|2929265_2929838_+	DUF1349 domain-containing protein	NA	NA	NA	NA	NA
WP_004174494.1|2929841_2930117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004174493.1|2930288_2931188_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004151785.1|2931326_2931635_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_004181226.1|2931643_2932201_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_103215664.1|2932221_2933241_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	31.8	3.8e-05
WP_001101446.1|2934094_2935120_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_032425493.1|2935459_2936383_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	95.4	2.0e-170
WP_000227969.1|2937398_2938475_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
2943577:2943595	attR	TACCGATACCCAGACCAGC	NA	NA	NA	NA
>prophage 201
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2941674	2949576	5403218	tRNA	Clostridium_phage(20.0%)	7	NA	NA
WP_004157874.1|2941674_2942388_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	35.8	1.7e-12
WP_004181232.1|2942704_2943259_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_060415879.1|2943493_2945011_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.2	8.6e-86
WP_095858446.1|2945020_2946119_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	3.1e-05
WP_060415880.1|2946204_2947938_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.2	4.9e-61
WP_002916301.1|2947943_2948657_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_004144729.1|2948679_2949576_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	7.9e-31
>prophage 202
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2954220	2955654	5403218		Pandoravirus(100.0%)	1	NA	NA
WP_004185559.1|2954220_2955654_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	2.7e-33
>prophage 203
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2963052	2965926	5403218		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_002916478.1|2963052_2965926_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.6	5.7e-264
>prophage 204
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2973868	2975101	5403218		Catovirus(100.0%)	1	NA	NA
WP_019704920.1|2973868_2975101_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	6.9e-102
>prophage 205
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2991089	2992244	5403218		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004149807.1|2991089_2992244_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.4	1.4e-128
>prophage 206
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	2999121	3000102	5403218	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_000019449.1|2999121_3000102_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
>prophage 207
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3008316	3009399	5403218		Geobacillus_virus(100.0%)	1	NA	NA
WP_002916629.1|3008316_3009399_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	9.9e-12
>prophage 208
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3015068	3016439	5403218		Lactococcus_phage(100.0%)	1	NA	NA
WP_038435813.1|3015068_3016439_+	pyridoxal-phosphate dependent enzyme	NA	A0A1W6JIM2	Lactococcus_phage	37.3	6.6e-45
>prophage 209
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3036146	3046049	5403218		Staphylococcus_phage(25.0%)	8	NA	NA
WP_060415893.1|3036146_3036974_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	42.9	3.4e-60
WP_004144550.1|3037009_3037537_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004174383.1|3037594_3039778_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	1.0e-103
WP_004144547.1|3039901_3041314_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_002916826.1|3041397_3042135_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_004181324.1|3042326_3044585_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	36.1	1.4e-84
WP_060415894.1|3044706_3045576_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002916833.1|3045653_3046049_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	42.5	9.8e-18
>prophage 210
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3049360	3051256	5403218		Bacillus_virus(100.0%)	1	NA	NA
WP_002916844.1|3049360_3051256_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.7	5.9e-92
>prophage 211
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3055598	3062479	5403218		Erwinia_phage(25.0%)	8	NA	NA
WP_002916849.1|3055598_3056270_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	48.3	9.7e-42
WP_023280574.1|3056275_3057436_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.9	1.1e-88
WP_004181331.1|3057480_3058272_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_002916852.1|3058458_3059229_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_004174356.1|3059290_3059944_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	8.3e-46
WP_002916856.1|3060321_3060594_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_002916857.1|3060629_3060827_-	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
WP_002916858.1|3061045_3062479_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.8	2.0e-39
>prophage 212
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3067590	3068832	5403218		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_002916864.1|3067590_3068832_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	50.1	5.2e-89
>prophage 213
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3078125	3083509	5403218	tRNA	Moraxella_phage(33.33%)	4	NA	NA
WP_048288856.1|3078125_3079139_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.2e-109
WP_001144069.1|3079376_3079592_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_004149864.1|3079703_3081449_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_004174339.1|3081667_3083509_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
>prophage 214
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3091671	3092475	5403218		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_002917658.1|3091671_3092475_-	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	31.5	1.2e-14
>prophage 215
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3110553	3111933	5403218		Klosneuvirus(100.0%)	1	NA	NA
WP_004174227.1|3110553_3111933_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	2.5e-31
>prophage 216
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3116204	3117692	5403218		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004181393.1|3116204_3117692_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.3	1.0e-19
>prophage 217
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3127255	3128227	5403218		Escherichia_phage(100.0%)	1	NA	NA
WP_004144845.1|3127255_3128227_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	32.4	1.5e-35
>prophage 218
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3145365	3146511	5403218		Streptococcus_phage(100.0%)	1	NA	NA
WP_023284319.1|3145365_3146511_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	39.2	5.7e-50
>prophage 219
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3151785	3159661	5403218		Streptococcus_phage(25.0%)	10	NA	NA
WP_004144878.1|3151785_3152649_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.5	2.1e-49
WP_060415917.1|3152712_3154821_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_002918206.1|3154778_3155165_+	YraN family protein	NA	NA	NA	NA	NA
WP_002918211.1|3155190_3155781_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	5.4e-12
WP_002918214.1|3155790_3156366_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_004174199.1|3156487_3157528_-	permease	NA	NA	NA	NA	NA
WP_004181410.1|3157603_3158251_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_002918221.1|3158379_3158916_+	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	9.3e-11
WP_002918223.1|3158877_3159321_-	YhbP family protein	NA	NA	NA	NA	NA
WP_004152864.1|3159376_3159661_+	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	52.6	2.3e-13
>prophage 220
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3165354	3167286	5403218		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_004150943.1|3165354_3167286_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.0	2.1e-52
>prophage 221
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3172700	3179319	5403218		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_002918250.1|3172700_3175391_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.4	5.1e-25
WP_002918252.1|3175415_3176903_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_002918364.1|3176930_3177383_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_004144895.1|3177975_3179319_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 222
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3183583	3186460	5403218	protease	Pandoravirus(50.0%)	2	NA	NA
WP_002918371.1|3183583_3184432_-	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	30.7	6.0e-20
WP_002918372.1|3184525_3186460_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.5	4.1e-117
>prophage 223
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3193058	3194500	5403218		Indivirus(50.0%)	2	NA	NA
WP_004144907.1|3193058_3194030_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.0	1.0e-07
WP_002918381.1|3194227_3194500_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	63.5	3.1e-15
>prophage 224
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3198549	3211480	5403218		Bacillus_virus(16.67%)	15	NA	NA
WP_060416126.1|3198549_3199362_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	1.2e-17
WP_002918397.1|3199571_3200549_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_002918399.1|3200563_3201550_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.8	3.0e-39
WP_002918405.1|3201564_3202131_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	81.3	5.3e-57
WP_002918413.1|3202127_3202703_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002918415.1|3202671_3203217_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_002918417.1|3203223_3203949_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	9.3e-22
WP_002918420.1|3203996_3205430_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_002918423.1|3205452_3205740_+	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_004144926.1|3205810_3206299_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002918428.1|3206344_3207199_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_002918431.1|3207195_3207468_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_004144927.1|3207531_3208257_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_004181418.1|3208253_3208907_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_002918444.1|3209140_3211480_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.6	9.3e-39
>prophage 225
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3215424	3216357	5403218		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002918455.1|3215424_3216357_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	33.8	3.4e-16
>prophage 226
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3223802	3224297	5403218	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_002918465.1|3223802_3224297_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
>prophage 227
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3228242	3229610	5403218	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_004174125.1|3228242_3229610_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
>prophage 228
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3247318	3248362	5403218		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002918653.1|3247318_3248362_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 229
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3275898	3277370	5403218	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_004174081.1|3275898_3276408_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	1.5e-18
WP_004150007.1|3276422_3277370_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
>prophage 230
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3297273	3300642	5403218		Tupanvirus(50.0%)	2	NA	NA
WP_004174069.1|3297273_3298458_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	5.2e-14
WP_002920103.1|3298527_3300642_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.6	1.8e-57
>prophage 231
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3308487	3318131	5403218		Tupanvirus(25.0%)	9	NA	NA
WP_060415928.1|3308487_3310392_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.9	6.5e-75
WP_004181442.1|3310595_3311618_+	hydrolase	NA	NA	NA	NA	NA
WP_002920151.1|3311614_3311833_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	37.3	4.0e-05
WP_002920153.1|3311869_3312739_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_002920158.1|3312793_3313198_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242758.1|3313504_3314137_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_004181443.1|3314188_3316267_+	membrane protein	NA	H9YQA8	environmental_Halophage	84.8	4.1e-62
WP_004174049.1|3316256_3317477_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_004181445.1|3317567_3318131_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	58.4	1.4e-57
>prophage 232
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3329532	3330360	5403218		Vibrio_phage(100.0%)	1	NA	NA
WP_002920260.1|3329532_3330360_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	50.0	6.1e-70
>prophage 233
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3345183	3348955	5403218		Bacillus_phage(66.67%)	3	NA	NA
WP_060415930.1|3345183_3346806_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	51.3	7.6e-141
WP_103215671.1|3346883_3348239_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	24.7	1.2e-11
WP_001157751.1|3348235_3348955_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 234
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3361781	3364172	5403218		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_004151407.1|3361781_3364172_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	1.1e-13
>prophage 235
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3367516	3368275	5403218		Escherichia_phage(100.0%)	1	NA	NA
WP_002920548.1|3367516_3368275_-	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.6	2.3e-23
>prophage 236
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3371336	3373784	5403218		Dickeya_phage(100.0%)	1	NA	NA
WP_002920561.1|3371336_3373784_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	83.3	2.7e-33
>prophage 237
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3391528	3393336	5403218		Enterococcus_phage(50.0%)	2	NA	NA
WP_060415935.1|3391528_3392269_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	4.1e-09
WP_004150074.1|3392265_3393336_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.7	2.6e-20
>prophage 238
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3396761	3398994	5403218		Streptococcus_phage(33.33%)	4	NA	NA
WP_002920800.1|3396761_3397130_-	type II toxin-antitoxin system death-on-curing family toxin	NA	E4ZFM2	Streptococcus_phage	30.1	3.5e-09
WP_004174006.1|3397126_3397348_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_004145133.1|3397511_3398225_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	30.6	2.2e-15
WP_002920803.1|3398226_3398994_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.4	5.8e-14
>prophage 239
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3410918	3416719	5403218		Klosneuvirus(25.0%)	5	NA	NA
WP_002920814.1|3410918_3412184_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	1.0e-23
WP_004889407.1|3412302_3413826_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.2	1.4e-14
WP_002920815.1|3413878_3414733_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.7	7.0e-45
WP_004173994.1|3415002_3416058_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_002920817.1|3416050_3416719_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	5.0e-14
>prophage 240
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3419803	3424163	5403218		Dickeya_phage(50.0%)	4	NA	NA
WP_004173987.1|3419803_3420430_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	60.2	2.1e-30
WP_004145145.1|3420508_3422719_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	36.1	1.1e-113
WP_002920858.1|3423045_3423291_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	86.1	4.7e-10
WP_002920860.1|3423497_3424163_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	55.8	2.1e-57
>prophage 241
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3430462	3434569	5403218		Tupanvirus(66.67%)	3	NA	NA
WP_060415942.1|3430462_3432448_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.7	5.7e-21
WP_002921035.1|3432444_3433428_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase ArnC	NA	A8CG95	Salmonella_phage	33.3	9.6e-38
WP_002921037.1|3433429_3434569_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	27.3	9.4e-29
>prophage 242
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3440671	3441463	5403218		Bacillus_virus(100.0%)	1	NA	NA
WP_032445328.1|3440671_3441463_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	28.2	2.3e-13
>prophage 243
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3451834	3453877	5403218		Indivirus(100.0%)	1	NA	NA
WP_004151426.1|3451834_3453877_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.8	3.8e-44
>prophage 244
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3497616	3503590	5403218		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_004173941.1|3497616_3499728_-	UDP-forming cellulose synthase catalytic subunit	NA	M1I277	Paramecium_bursaria_Chlorella_virus	34.2	4.6e-37
WP_004173940.1|3499747_3500551_-	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
WP_004186070.1|3500541_3501081_-	cellulose biosynthesis protein BcsO	NA	NA	NA	NA	NA
WP_002921784.1|3501596_3502610_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.4	7.4e-17
WP_002921785.1|3502606_3503590_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	2.3e-15
>prophage 245
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3514648	3517388	5403218		Streptococcus_phage(50.0%)	2	NA	NA
WP_004181509.1|3514648_3515089_+	N-acetyltransferase	NA	A0A1X9I6I8	Streptococcus_phage	33.6	1.3e-15
WP_060415951.1|3515057_3517388_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.3	4.4e-65
>prophage 246
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3522547	3523519	5403218		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_060415952.1|3522547_3523519_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	26.5	6.4e-18
>prophage 247
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3526922	3530427	5403218	transposase	Morganella_phage(33.33%)	4	NA	NA
WP_000014594.1|3526922_3527135_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
WP_040189542.1|3527233_3528853_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	24.9	8.1e-26
WP_002922102.1|3529154_3529307_-	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_004173931.1|3529380_3530427_+|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
>prophage 248
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3534330	3535326	5403218		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_004145225.1|3534330_3535326_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.3	2.1e-08
>prophage 249
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3540795	3542337	5403218		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002922346.1|3540795_3542337_+	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	2.5e-16
>prophage 250
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3550311	3552153	5403218		Tupanvirus(100.0%)	1	NA	NA
WP_060415956.1|3550311_3552153_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	24.7	1.2e-12
>prophage 251
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3566804	3575953	5403218		Rhizobium_phage(20.0%)	9	NA	NA
WP_002922429.1|3566804_3567056_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	52.1	9.9e-16
WP_002922436.1|3567159_3567591_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_004152046.1|3567836_3569381_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_002922458.1|3569390_3570662_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	30.3	3.5e-08
WP_002922459.1|3570665_3571613_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_016946699.1|3571618_3572407_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002922461.1|3572575_3573601_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	3.6e-19
WP_002922462.1|3573613_3574807_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	28.5	1.7e-36
WP_002922463.1|3575020_3575953_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.4	2.2e-36
>prophage 252
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3580385	3581369	5403218		Catovirus(100.0%)	1	NA	NA
WP_016529888.1|3580385_3581369_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	39.0	1.9e-09
>prophage 253
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3588889	3593631	5403218		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_002922501.1|3588889_3589369_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.3	2.8e-27
WP_060415962.1|3589556_3590366_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.1	2.9e-24
WP_002922510.1|3590501_3590669_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|3590689_3590926_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002922589.1|3591142_3591808_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_004188117.1|3591980_3593195_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.7	1.1e-43
WP_002922593.1|3593175_3593631_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	4.7e-48
>prophage 254
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3599695	3601629	5403218	transposase	Enterobacteria_phage(50.0%)	2	NA	NA
WP_032425493.1|3599695_3600619_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	95.4	2.0e-170
WP_004181533.1|3600711_3601629_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.5	2.1e-23
>prophage 255
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3605930	3614813	5403218	integrase	Morganella_phage(50.0%)	12	3596637:3596652	3618571:3618586
3596637:3596652	attL	GCCAGCGCCACGCAGG	NA	NA	NA	NA
WP_064158095.1|3605930_3607190_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	79.4	2.6e-197
WP_064158071.1|3607304_3608228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016244010.1|3608339_3608558_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_064158072.1|3608557_3608995_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	52.9	6.6e-31
WP_064158073.1|3609008_3609818_+	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	41.3	2.6e-25
WP_048293902.1|3609810_3609984_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_077266691.1|3610064_3610667_+	host cell division inhibitor Icd-like protein	NA	A0A1C9IHV9	Salmonella_phage	54.3	4.5e-14
WP_064158074.1|3610659_3610839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049014547.1|3610835_3611150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064158075.1|3611146_3611410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064158076.1|3611406_3612033_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	35.2	2.2e-24
WP_064158077.1|3612047_3614813_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	56.7	9.5e-293
3618571:3618586	attR	GCCAGCGCCACGCAGG	NA	NA	NA	NA
>prophage 256
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3620150	3628441	5403218		Acanthamoeba_polyphaga_mimivirus(25.0%)	7	NA	NA
WP_060415965.1|3620150_3621209_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	47.5	1.4e-18
WP_032418268.1|3621264_3622515_-	chloride channel protein	NA	NA	NA	NA	NA
WP_002922654.1|3622790_3623408_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_060415966.1|3623413_3625090_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	24.0	3.0e-23
WP_002922664.1|3625348_3625972_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.0	1.7e-19
WP_000135058.1|3626026_3626302_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_004150214.1|3626320_3628441_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 257
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3639422	3640274	5403218		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_002922941.1|3639422_3640274_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.2	2.2e-14
>prophage 258
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3643408	3644800	5403218		environmental_Halophage(100.0%)	1	NA	NA
WP_002922950.1|3643408_3644800_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	95.2	1.4e-66
>prophage 259
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3658059	3659109	5403218		Tupanvirus(100.0%)	1	NA	NA
WP_004901462.1|3658059_3659109_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	43.9	3.4e-73
>prophage 260
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3676244	3677408	5403218		Salmonella_phage(100.0%)	1	NA	NA
WP_060415979.1|3676244_3677408_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.9	4.5e-26
>prophage 261
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3695661	3696774	5403218		Bacillus_virus(100.0%)	1	NA	NA
WP_060415983.1|3695661_3696774_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.5	1.5e-26
>prophage 262
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3708952	3716301	5403218		Micromonas_sp._RCC1109_virus(33.33%)	7	NA	NA
WP_004173858.1|3708952_3710641_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	31.0	2.9e-58
WP_002923286.1|3710745_3710841_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_004152765.1|3711202_3712687_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_002923292.1|3713412_3713502_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_016946139.1|3713592_3714039_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_060415987.1|3714107_3714941_+	EamA family transporter	NA	NA	NA	NA	NA
WP_004181587.1|3715116_3716301_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	25.2	1.1e-11
>prophage 263
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3727311	3729231	5403218		Morganella_phage(33.33%)	3	NA	NA
WP_049185577.1|3727311_3728136_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	5.3e-90
WP_004145074.1|3728272_3728701_-	heat shock chaperone IbpB	NA	A0A2H4N7P1	Lake_Baikal_phage	41.1	2.6e-16
WP_004151523.1|3728817_3729231_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 264
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3732672	3733821	5403218		Oenococcus_phage(100.0%)	1	NA	NA
WP_004150286.1|3732672_3733821_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.7	4.7e-52
>prophage 265
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3739588	3747179	5403218		Bacillus_virus(33.33%)	7	NA	NA
WP_004173845.1|3739588_3742003_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.3	8.2e-115
WP_004150293.1|3742031_3743105_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_004145090.1|3743312_3744413_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.2	1.8e-53
WP_004151534.1|3744417_3745821_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000831330.1|3746442_3746583_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_004151535.1|3746598_3746958_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_004151536.1|3746921_3747179_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	55.2	9.2e-17
>prophage 266
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3754599	3755937	5403218		Moraxella_phage(100.0%)	1	NA	NA
WP_004145100.1|3754599_3755937_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.6	1.1e-63
>prophage 267
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3761713	3769273	5403218		Bacillus_phage(25.0%)	6	NA	NA
WP_004145006.1|3761713_3762487_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.2	2.0e-14
WP_004151547.1|3762534_3763425_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_004145004.1|3763424_3764384_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_004150308.1|3764512_3765553_-	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	38.1	3.4e-49
WP_004150309.1|3765889_3767719_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	41.4	1.9e-124
WP_004151550.1|3767902_3769273_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.6	2.8e-35
>prophage 268
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3785781	3791660	5403218		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_002882520.1|3785781_3787650_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	8.4e-67
WP_002882527.1|3787835_3788255_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_049000604.1|3788265_3789771_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	22.5	1.4e-19
WP_002882531.1|3789776_3790742_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_002882536.1|3790769_3791660_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	3.3e-05
>prophage 269
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3806120	3808913	5403218		uncultured_virus(100.0%)	1	NA	NA
WP_004187174.1|3806120_3808913_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.5	6.4e-71
>prophage 270
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3812801	3815269	5403218		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_002882749.1|3812801_3814211_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.3	4.8e-06
WP_004146229.1|3814219_3815269_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	1.0e-08
>prophage 271
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3822091	3823009	5403218		Pandoravirus(100.0%)	1	NA	NA
WP_060415997.1|3822091_3823009_-	alpha/beta hydrolase	NA	S4W4Z4	Pandoravirus	29.6	5.1e-17
>prophage 272
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3845980	3847492	5403218		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004150373.1|3845980_3847492_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.0	7.6e-18
>prophage 273
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3855791	3863238	5403218	transposase	Escherichia_phage(40.0%)	7	NA	NA
WP_002882894.1|3855791_3856412_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.9	3.5e-62
WP_016947361.1|3856484_3857159_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_002882898.1|3857226_3858600_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	24.0	1.4e-10
WP_002882901.1|3858596_3859295_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
WP_002882903.1|3859444_3859948_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_000019449.1|3861275_3862256_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
WP_032430319.1|3863019_3863238_+	DNA-binding transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	93.1	8.3e-35
>prophage 274
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3867172	3868507	5403218		Erwinia_phage(100.0%)	1	NA	NA
WP_002882917.1|3867172_3868507_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	29.5	2.1e-43
>prophage 275
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3885899	3886562	5403218		Cyanophage(100.0%)	1	NA	NA
WP_060416004.1|3885899_3886562_-	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	34.0	6.0e-28
>prophage 276
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3901192	3903031	5403218		Acinetobacter_phage(100.0%)	1	NA	NA
WP_060416008.1|3901192_3903031_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	29.2	1.7e-08
>prophage 277
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3913094	3914741	5403218		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002883142.1|3913094_3914741_+	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	3.1e-65
>prophage 278
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3922844	3924866	5403218		Bacillus_phage(100.0%)	1	NA	NA
WP_004181641.1|3922844_3924866_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.0	1.4e-112
>prophage 279
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3929357	3931294	5403218		Cafeteria_roenbergensis_virus(50.0%)	2	NA	NA
WP_002883222.1|3929357_3930623_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.3	1.8e-41
WP_002883224.1|3930964_3931294_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	39.6	2.5e-14
>prophage 280
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3935344	3941486	5403218		Catovirus(20.0%)	6	NA	NA
WP_002883297.1|3935344_3936475_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	33.2	9.7e-26
WP_004186361.1|3936471_3937734_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HPJ2	Paramecium_bursaria_Chlorella_virus	25.9	3.8e-23
WP_002883303.1|3937730_3938798_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	2.4e-98
WP_023284450.1|3938816_3939698_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	67.4	4.6e-108
WP_004146507.1|3939675_3940350_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_002883310.1|3940355_3941486_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	3.3e-18
>prophage 281
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3957768	3961613	5403218		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_002883396.1|3957768_3958671_+	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	29.4	5.9e-18
WP_004146477.1|3958670_3959387_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_002883398.1|3959450_3961613_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.3	6.0e-117
>prophage 282
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3965449	3968911	5403218	transposase	Catovirus(50.0%)	3	NA	NA
WP_060416013.1|3965449_3967276_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.6	1.3e-83
WP_004177928.1|3967337_3967958_+	threonine export protein RhtC	NA	NA	NA	NA	NA
WP_020804042.1|3968002_3968911_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	8.2e-68
>prophage 283
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3980912	3984256	5403218		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_004177924.1|3980912_3982553_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	2.2e-39
WP_002883425.1|3982682_3982934_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_004181653.1|3982937_3983474_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_002883427.1|3983476_3984256_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	31.7	7.4e-25
>prophage 284
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	3992973	3993588	5403218		Streptococcus_phage(100.0%)	1	NA	NA
WP_060416015.1|3992973_3993588_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	32.5	2.8e-19
>prophage 285
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4003451	4006572	5403218		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_002883524.1|4003451_4004402_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	2.7e-29
WP_004174069.1|4005387_4006572_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	5.2e-14
>prophage 286
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4010799	4023243	5403218		Chrysochromulina_ericina_virus(33.33%)	6	NA	NA
WP_004901914.1|4010799_4014828_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	28.6	2.3e-21
WP_002884146.1|4014904_4019128_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.5	9.1e-69
WP_002884148.1|4019528_4020869_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_002884149.1|4020911_4021229_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002884150.1|4021232_4021538_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_004178221.1|4021710_4023243_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.1	2.2e-12
>prophage 287
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4031668	4033432	5403218		Klosneuvirus(50.0%)	3	NA	NA
WP_060416020.1|4031668_4032340_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.9	3.4e-18
WP_002884331.1|4032382_4032973_+	YjaG family protein	NA	NA	NA	NA	NA
WP_002884342.1|4033159_4033432_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	56.7	9.4e-20
>prophage 288
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4038853	4040443	5403218		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_002884359.1|4038853_4040443_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.0	5.3e-70
>prophage 289
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4054154	4057838	5403218		Dickeya_phage(100.0%)	1	NA	NA
WP_004151753.1|4054154_4057838_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	4.9e-26
>prophage 290
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4076552	4077662	5403218		Mycoplasma_phage(100.0%)	1	NA	NA
WP_002884743.1|4076552_4077662_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	3.6e-17
>prophage 291
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4084728	4085337	5403218		Lactococcus_phage(100.0%)	1	NA	NA
WP_002884822.1|4084728_4085337_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	40.7	4.6e-14
>prophage 292
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4091331	4093858	5403218		Escherichia_phage(50.0%)	2	NA	NA
WP_002884942.1|4091331_4092747_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.8	5.7e-201
WP_004178273.1|4092778_4093858_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.2	2.4e-26
>prophage 293
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4097039	4102346	5403218		uncultured_Mediterranean_phage(33.33%)	3	NA	NA
WP_020324826.1|4097039_4099865_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
WP_004151744.1|4100116_4100641_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	95.4	5.1e-54
WP_021314574.1|4100765_4102346_-	lytic transglycosylase F	NA	K7RVN3	Vibrio_phage	31.7	6.3e-07
>prophage 294
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4105895	4106927	5403218		Bacillus_virus(100.0%)	1	NA	NA
WP_004177837.1|4105895_4106927_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	2.3e-26
>prophage 295
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4114456	4115806	5403218		Moraxella_phage(100.0%)	1	NA	NA
WP_002885079.1|4114456_4115806_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.1	1.5e-158
>prophage 296
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4119723	4120647	5403218	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
WP_001118645.1|4119723_4120647_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	1.0e-166
>prophage 297
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4127111	4129070	5403218		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004178297.1|4127111_4129070_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.3	2.3e-91
>prophage 298
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4134918	4137066	5403218		Escherichia_phage(100.0%)	1	NA	NA
WP_012737173.1|4134918_4137066_-	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	24.3	2.0e-32
>prophage 299
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4143007	4144528	5403218		Staphylococcus_phage(100.0%)	1	NA	NA
WP_087760985.1|4143007_4144528_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.5	2.2e-17
>prophage 300
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4149849	4151396	5403218		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_002885196.1|4149849_4150530_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.0	6.7e-06
WP_004178305.1|4150637_4151396_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	26.7	6.7e-15
>prophage 301
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4156756	4158259	5403218		Burkholderia_virus(100.0%)	1	NA	NA
WP_002885227.1|4156756_4158259_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.7	1.1e-56
>prophage 302
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4162623	4273603	5403218	tail,integrase,plate,transposase,tRNA,protease	Vibrio_phage(52.0%)	112	4166920:4166937	4212400:4212417
WP_004177778.1|4162623_4163580_+	recombinase	NA	A0A222YXF2	Escherichia_phage	78.0	1.6e-143
WP_004186571.1|4163589_4163961_+	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	51.2	2.3e-21
WP_020803817.1|4165501_4166584_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
4166920:4166937	attL	CGCTTGCGCGGGCCTACG	NA	NA	NA	NA
WP_060416037.1|4167532_4167838_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_004210044.1|4167837_4168755_-	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	42.2	2.8e-07
WP_040243881.1|4168900_4169584_-	TerC family protein	NA	W8EBD0	Pseudomonas_phage	42.2	3.9e-30
WP_002885391.1|4169809_4170595_+	DsbA family protein	NA	NA	NA	NA	NA
WP_004177775.1|4170640_4171090_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_002885393.1|4171089_4172418_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_038433392.1|4172410_4174426_-	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_103215686.1|4176300_4176933_-	helix-turn-helix transcriptional regulator	NA	A0A2I7S9A5	Vibrio_phage	30.1	3.6e-06
WP_103215687.1|4177114_4177342_+	transcriptional regulator	NA	M1PVU4	Vibrio_phage	53.5	2.6e-15
WP_032751449.1|4177344_4179423_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	48.4	3.7e-172
WP_032751448.1|4179458_4180406_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	65.0	2.4e-110
WP_032751446.1|4180411_4180747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032751445.1|4180724_4180964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004114541.1|4180966_4181254_+	HTH domain-containing protein	NA	C9DGL7	Escherichia_phage	48.3	3.5e-17
WP_032751444.1|4181269_4181887_+	DUF3164 family protein	NA	A0A2I7S9B0	Vibrio_phage	59.4	5.8e-65
WP_032751970.1|4181967_4182462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032751443.1|4182454_4182754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032751442.1|4182750_4182975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032751440.1|4183044_4183599_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	47.8	1.3e-39
WP_032751439.1|4183595_4183991_+	Middle operon regulator	NA	A0A0C4UR27	Shigella_phage	62.5	7.7e-39
WP_032751438.1|4183994_4184507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103215688.1|4184601_4185180_+	N-acetylmuramidase	NA	A0A2I7S9B9	Vibrio_phage	47.6	4.6e-40
WP_049123502.1|4185182_4185401_+	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	70.8	1.3e-24
WP_103215689.1|4185393_4185801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103215690.1|4185788_4186394_+	hypothetical protein	NA	M4MB79	Vibrio_phage	40.3	6.3e-24
WP_032751432.1|4186390_4186621_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016807466.1|4186601_4186904_+	DUF2730 domain-containing protein	NA	M1Q558	Vibrio_phage	42.6	4.3e-13
WP_016807465.1|4186913_4187201_+	hypothetical protein	NA	A0A2I7S9D8	Vibrio_phage	64.5	8.4e-27
WP_064182396.1|4187203_4187479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103215691.1|4187468_4188047_+	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	57.9	4.4e-51
WP_103215692.1|4188043_4189633_+	hypothetical protein	NA	M4MHG0	Vibrio_phage	68.5	2.7e-199
WP_103215693.1|4189632_4191204_+	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	56.2	6.0e-159
WP_023301732.1|4191196_4192039_+	hypothetical protein	NA	M1PVV7	Vibrio_phage	56.9	1.7e-88
WP_098140142.1|4192227_4193244_+	peptidase	NA	M1Q578	Vibrio_phage	49.7	8.6e-74
WP_023301730.1|4193246_4194149_+	hypothetical protein	NA	M4MB71	Vibrio_phage	60.9	3.0e-102
WP_103215694.1|4194371_4194851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032751414.1|4194850_4195291_+	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	47.3	4.1e-33
WP_019704459.1|4195290_4195833_+	phage morphogeneis protein	NA	A0A2I7S9D7	Vibrio_phage	64.2	1.7e-60
WP_087848258.1|4195829_4196441_+	hypothetical protein	NA	M1PJ94	Vibrio_phage	39.3	5.0e-37
WP_103215695.1|4196443_4196653_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_103215696.1|4196654_4198136_+|tail	phage tail protein	tail	M1Q565	Vibrio_phage	59.8	2.4e-165
WP_004114591.1|4198145_4198499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064184309.1|4198502_4198886_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	46.2	5.1e-11
WP_103215697.1|4198984_4200856_+|tail	phage tail protein	tail	M4MHE6	Vibrio_phage	51.9	1.4e-122
WP_103215698.1|4200852_4202112_+	multidrug DMT transporter	NA	M4M9N2	Vibrio_phage	42.2	1.7e-87
WP_103215699.1|4202104_4203184_+|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	50.0	3.0e-93
WP_103215700.1|4203174_4203714_+|plate	phage baseplate assembly protein V	plate	A0A2I7S9F6	Vibrio_phage	47.8	5.1e-33
WP_019704449.1|4203710_4204163_+	hypothetical protein	NA	A0A2I7S9F0	Vibrio_phage	43.4	6.6e-26
WP_103215701.1|4204149_4205226_+|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	52.8	1.4e-103
WP_103215702.1|4205210_4205795_+	YmfQ family protein	NA	M4M9M8	Vibrio_phage	48.2	2.2e-45
WP_103215703.1|4205797_4206550_+|tail	tail fiber protein	tail	A9DEM1	Yersinia_phage	46.5	2.5e-30
WP_103215704.1|4206549_4207425_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	43.1	2.2e-25
WP_103215705.1|4209285_4209594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002885396.1|4211157_4211724_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004153693.1|4212035_4212326_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_153928261.1|4212600_4212756_+	hypothetical protein	NA	NA	NA	NA	NA
4212400:4212417	attR	CGTAGGCCCGCGCAAGCG	NA	NA	NA	NA
WP_023288144.1|4213110_4215198_-	DUF1176 domain-containing protein	NA	NA	NA	NA	NA
WP_004218175.1|4215265_4215841_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_023288145.1|4215876_4217673_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_002885422.1|4217648_4217972_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_060416040.1|4218096_4219398_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_002885424.1|4219513_4220950_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_004152422.1|4221272_4221764_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_040223649.1|4221815_4223066_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_004152420.1|4223298_4223592_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	42.3	3.5e-12
WP_002885441.1|4223629_4225276_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.1	9.0e-190
WP_004152419.1|4225536_4225890_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000019449.1|4226758_4227739_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
WP_014908088.1|4228910_4230197_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_012737199.1|4230301_4230670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215767.1|4230972_4231995_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000019449.1|4232020_4233001_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
WP_060416042.1|4233229_4235773_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_004872804.1|4235808_4236495_-	molecular chaperone	NA	NA	NA	NA	NA
WP_004872803.1|4236553_4237117_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_004179076.1|4237291_4238272_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.5e-184
WP_017880312.1|4238797_4239442_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_060416043.1|4239563_4240592_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_002885506.1|4240633_4241200_+	elongation factor P	NA	NA	NA	NA	NA
WP_002885511.1|4241273_4241405_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_002885518.1|4241564_4241711_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_002885521.1|4241854_4242172_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_004222047.1|4242168_4242702_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	50.0	5.0e-41
WP_002885526.1|4242815_4243175_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_048289692.1|4243185_4243581_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_048289693.1|4243591_4244326_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_004177727.1|4244318_4246109_-	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	27.2	3.8e-16
WP_103215706.1|4246384_4247362_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.7	2.1e-29
WP_004178330.1|4247545_4249048_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_004146716.1|4249085_4252415_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_002885536.1|4252438_4253401_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_004178332.1|4253561_4254623_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_002885538.1|4254717_4255263_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	42.1	1.2e-29
WP_012737208.1|4255306_4256038_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_060416044.1|4256970_4258110_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_060416045.1|4258108_4259635_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_002885589.1|4259627_4260089_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_004178335.1|4260105_4261458_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	3.1e-18
WP_060416046.1|4261468_4263328_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	40.8	2.2e-59
WP_002885652.1|4263320_4264271_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_002885659.1|4264363_4264672_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_004146725.1|4264747_4266028_+	GTPase HflX	NA	NA	NA	NA	NA
WP_004146726.1|4266093_4267356_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_060416047.1|4267358_4268363_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_004894787.1|4268445_4268736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002885664.1|4268959_4269157_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_002885665.1|4269259_4270558_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	1.7e-66
WP_002885667.1|4270708_4271134_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_004192475.1|4271170_4273603_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.7	1.9e-66
>prophage 303
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4293200	4294025	5403218		Bordetella_phage(100.0%)	1	NA	NA
WP_040088035.1|4293200_4294025_-	AraC family transcriptional regulator	NA	A0A291LAM3	Bordetella_phage	42.0	1.9e-07
>prophage 304
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4308282	4314795	5403218		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_002886766.1|4308282_4308813_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	2.7e-55
WP_002886769.1|4309216_4310173_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004177669.1|4310296_4311799_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.2	7.6e-10
WP_060416053.1|4311809_4312769_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_103215708.1|4312755_4313754_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_002886827.1|4313796_4314795_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	1.3e-69
>prophage 305
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4330924	4334145	5403218		uncultured_Caudovirales_phage(33.33%)	3	NA	NA
WP_004894697.1|4330924_4331209_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	58.5	3.5e-25
WP_048968808.1|4331212_4331677_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	59.5	5.0e-53
WP_103215710.1|4332006_4334145_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.0	9.1e-267
>prophage 306
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4341902	4347960	5403218		Enterobacteria_phage(33.33%)	5	NA	NA
WP_004192384.1|4341902_4342850_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	23.6	8.7e-12
WP_060416061.1|4343229_4345938_+	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	26.5	5.3e-46
WP_002886926.1|4346010_4346397_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_002886927.1|4346549_4347011_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_002886928.1|4347024_4347960_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.9	1.3e-52
>prophage 307
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4352119	4361169	5403218	tRNA	Klosneuvirus(33.33%)	6	NA	NA
WP_009486532.1|4352119_4354975_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.5	6.0e-141
WP_002886953.1|4354974_4355418_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_002886954.1|4355537_4357049_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	9.2e-48
WP_002886955.1|4357438_4358536_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_002886956.1|4358535_4359618_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_060416064.1|4359666_4361169_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	1.8e-83
>prophage 308
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4375513	4380336	5403218		Bacillus_virus(50.0%)	5	NA	NA
WP_060416069.1|4375513_4376584_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	4.0e-29
WP_023284524.1|4376589_4377414_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_038435127.1|4377424_4378312_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_023284525.1|4378301_4379174_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_004192328.1|4379316_4380336_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	31.7	1.9e-44
>prophage 309
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4383486	4384758	5403218	integrase	Enterobacteria_phage(100.0%)	1	4382755:4382768	4392373:4392386
4382755:4382768	attL	GATGAAATTAATGT	NA	NA	NA	NA
WP_004192316.1|4383486_4384758_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	39.1	6.3e-82
WP_004192316.1|4383486_4384758_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	39.1	6.3e-82
4392373:4392386	attR	ACATTAATTTCATC	NA	NA	NA	NA
>prophage 310
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4388599	4390240	5403218		Acidithiobacillus_phage(100.0%)	1	NA	NA
WP_103215712.1|4388599_4390240_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	28.7	2.1e-21
>prophage 311
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4394904	4397741	5403218		Staphylococcus_phage(100.0%)	2	NA	NA
WP_077268007.1|4394904_4396134_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	26.1	7.1e-22
WP_040247096.1|4396133_4397741_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	55.4	4.0e-158
>prophage 312
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4409456	4409927	5403218		Pseudomonas_phage(100.0%)	1	NA	NA
WP_040246527.1|4409456_4409927_+	antirestriction protein	NA	A0A1S5R3R9	Pseudomonas_phage	34.6	3.6e-11
>prophage 313
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4414357	4415468	5403218	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_103215769.1|4414357_4415468_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	30.4	3.4e-07
>prophage 314
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4441933	4446891	5403218		Enterobacteria_phage(33.33%)	4	NA	NA
WP_002887258.1|4441933_4442662_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	47.4	1.4e-46
WP_002887259.1|4442778_4443312_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	59.6	8.2e-52
WP_004177568.1|4443321_4443669_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_060416077.1|4443741_4446891_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.6	3.7e-59
>prophage 315
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4450129	4452236	5403218		Bacillus_phage(50.0%)	2	NA	NA
WP_004214143.1|4450129_4450813_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	36.0	7.9e-31
WP_060416079.1|4450802_4452236_+	Cu(+)/Ag(+) sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	27.2	2.7e-12
>prophage 316
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4461993	4464738	5403218		Staphylococcus_phage(100.0%)	1	NA	NA
WP_060416082.1|4461993_4464738_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	6.0e-21
>prophage 317
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4468653	4470138	5403218		Bacillus_virus(100.0%)	1	NA	NA
WP_004177552.1|4468653_4470138_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	1.1e-13
>prophage 318
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4485724	4486651	5403218	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_002887421.1|4485724_4486651_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	3.9e-73
>prophage 319
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4493144	4494125	5403218	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_009310076.1|4493144_4494125_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.2e-184
>prophage 320
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4519112	4525913	5403218	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_009310076.1|4519112_4520093_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.2e-184
WP_049194306.1|4520206_4520623_+	PTS sugar transporter	NA	NA	NA	NA	NA
WP_002887607.1|4520637_4521108_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002887608.1|4521124_4521904_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_012737365.1|4521893_4522733_+	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_023284623.1|4522745_4523807_+	SIS domain-containing protein	NA	M1I2B0	Paramecium_bursaria_Chlorella_virus	23.1	1.5e-07
WP_085955639.1|4523803_4524835_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_023284625.1|4524974_4525913_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	3.4e-69
>prophage 321
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4529073	4530353	5403218		Shigella_phage(50.0%)	2	NA	NA
WP_002887623.1|4529073_4529811_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.7	1.2e-64
WP_002887624.1|4529813_4530353_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.4e-27
>prophage 322
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4543576	4546297	5403218		Streptococcus_phage(50.0%)	3	NA	NA
WP_002887711.1|4543576_4545166_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.9	5.3e-30
WP_004146042.1|4545385_4546006_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_002887716.1|4546135_4546297_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	67.9	1.2e-11
>prophage 323
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4551032	4552355	5403218		Geobacillus_virus(100.0%)	1	NA	NA
WP_002887787.1|4551032_4552355_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	40.9	2.0e-78
>prophage 324
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4558686	4563846	5403218		Enterococcus_phage(33.33%)	3	NA	NA
WP_002887802.1|4558686_4559919_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.3	1.3e-87
WP_002887805.1|4560012_4561680_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.8	2.9e-42
WP_004182874.1|4561908_4563846_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.5	2.7e-12
>prophage 325
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4581002	4581956	5403218		Cyanophage(100.0%)	1	NA	NA
WP_002887897.1|4581002_4581956_+	transaldolase	NA	A0A127KNC6	Cyanophage	32.1	1.3e-10
>prophage 326
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4586351	4596305	5403218	tRNA	Chrysochromulina_ericina_virus(25.0%)	7	NA	NA
WP_004146997.1|4586351_4588268_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	6.4e-147
WP_002887955.1|4588355_4589489_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.5	1.2e-28
WP_060416131.1|4589667_4590843_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.4	3.8e-89
WP_103215718.1|4590897_4591794_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_002887965.1|4591913_4592177_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_002887969.1|4592506_4593445_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_004212580.1|4593488_4596305_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 327
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4602871	4604020	5403218		Halovirus(100.0%)	1	NA	NA
WP_004177433.1|4602871_4604020_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.1	9.1e-48
>prophage 328
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4610503	4612422	5403218		Bacillus_phage(50.0%)	2	NA	NA
WP_002888320.1|4610503_4610983_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.2e-28
WP_004177431.1|4611573_4612422_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0A0YWI7	Pseudomonas_phage	48.4	3.4e-07
>prophage 329
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4624880	4630332	5403218		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_004177426.1|4624880_4627787_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.9	4.9e-21
WP_040235934.1|4627974_4630332_-	DNA polymerase II	NA	X5FTI3	Fish_lymphocystis_disease_virus	23.7	2.3e-13
>prophage 330
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4636628	4637330	5403218		Bacillus_virus(100.0%)	1	NA	NA
WP_004145970.1|4636628_4637330_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	36.2	8.1e-23
>prophage 331
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4646029	4646785	5403218		Streptococcus_phage(100.0%)	1	NA	NA
WP_004177420.1|4646029_4646785_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.5	4.2e-25
>prophage 332
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4656462	4659715	5403218	transposase	Escherichia_phage(50.0%)	3	NA	NA
WP_000019449.1|4656462_4657443_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
WP_153931917.1|4657434_4657596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002888534.1|4657990_4659715_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	25.8	3.3e-33
>prophage 333
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4685908	4686952	5403218		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_004191995.1|4685908_4686952_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.9	4.1e-103
>prophage 334
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4691219	4691783	5403218		Sphingobium_phage(100.0%)	1	NA	NA
WP_002888692.1|4691219_4691783_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	30.4	4.1e-09
>prophage 335
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4703123	4704548	5403218		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_002888731.1|4703123_4704548_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	2.1e-41
>prophage 336
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4716122	4722781	5403218		Mamastrovirus(33.33%)	5	NA	NA
WP_040236126.1|4716122_4717733_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	51.1	7.6e-16
WP_103215721.1|4717816_4720207_-	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_002888819.1|4720411_4720948_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.8	3.9e-17
WP_002888821.1|4721007_4721670_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_002888823.1|4721854_4722781_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.4	1.8e-22
>prophage 337
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4728183	4734954	5403218	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_071526609.1|4728183_4729578_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	36.9	1.6e-25
WP_004145903.1|4729640_4730522_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_002888845.1|4730581_4731037_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_002888848.1|4731199_4731916_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_004145901.1|4731915_4732452_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_040236129.1|4732524_4734954_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.3	1.5e-39
>prophage 338
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4759911	4760709	5403218		Planktothrix_phage(100.0%)	1	NA	NA
WP_002889212.1|4759911_4760709_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	9.2e-15
>prophage 339
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4766675	4767020	5403218		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_002889275.1|4766675_4767020_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	1.2e-27
>prophage 340
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4770975	4772409	5403218	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_002889286.1|4770975_4772409_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	3.9e-24
>prophage 341
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4783986	4784745	5403218		Flavobacterium_phage(100.0%)	1	NA	NA
WP_002889316.1|4783986_4784745_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	6.1e-24
>prophage 342
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4793576	4797676	5403218		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_002889376.1|4793576_4794176_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.6	1.6e-27
WP_004177353.1|4794193_4797676_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.5	3.1e-208
>prophage 343
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4810659	4811691	5403218		Planktothrix_phage(100.0%)	1	NA	NA
WP_002889450.1|4810659_4811691_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.3	9.4e-36
>prophage 344
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4818270	4819074	5403218		Indivirus(100.0%)	1	NA	NA
WP_012737430.1|4818270_4819074_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	9.2e-39
>prophage 345
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4823139	4827349	5403218		Lactobacillus_phage(33.33%)	5	NA	NA
WP_002889632.1|4823139_4824507_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	29.1	4.0e-10
WP_004145833.1|4824578_4825334_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_103215723.1|4825366_4826089_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002889686.1|4826085_4826553_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	56.6	8.0e-51
WP_004152034.1|4826617_4827349_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	36.9	7.1e-38
>prophage 346
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4832857	4833439	5403218		Caulobacter_phage(100.0%)	1	NA	NA
WP_004145825.1|4832857_4833439_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	29.8	2.2e-13
>prophage 347
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4850612	4851896	5403218		Klosneuvirus(100.0%)	1	NA	NA
WP_020802539.1|4850612_4851896_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.6	2.2e-34
>prophage 348
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4859429	4860425	5403218		Catovirus(100.0%)	1	NA	NA
WP_060416104.1|4859429_4860425_-	2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	29.9	4.1e-28
>prophage 349
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4865075	4866473	5403218		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_040236710.1|4865075_4866473_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.5	2.2e-43
>prophage 350
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4879681	4885466	5403218		Streptococcus_phage(50.0%)	4	NA	NA
WP_032729407.1|4879681_4881052_-	FRG domain-containing protein	NA	Q9AZ51	Lactococcus_phage	33.8	5.1e-05
WP_023283266.1|4881756_4883010_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.4	2.6e-96
WP_004144574.1|4883020_4884124_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
WP_004144576.1|4884413_4885466_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	57.9	1.4e-111
>prophage 351
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4891743	4892586	5403218		Planktothrix_phage(100.0%)	1	NA	NA
WP_032430776.1|4891743_4892586_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.2	4.7e-17
>prophage 352
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4901660	4905382	5403218		Planktothrix_phage(66.67%)	5	NA	NA
WP_004151355.1|4901660_4902479_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	3.1e-34
WP_002890106.1|4902480_4903290_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002890108.1|4903624_4903795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103215724.1|4903911_4904607_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	25.7	3.2e-11
WP_004893977.1|4904599_4905382_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.8	8.8e-10
>prophage 353
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4916368	4917136	5403218		Planktothrix_phage(100.0%)	1	NA	NA
WP_040236692.1|4916368_4917136_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	38.6	4.3e-25
>prophage 354
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4938227	4946747	5403218		Bacillus_phage(60.0%)	6	NA	NA
WP_002890285.1|4938227_4939139_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	5.5e-104
WP_040236689.1|4939230_4940145_+	fructokinase	NA	NA	NA	NA	NA
WP_040236688.1|4940218_4943356_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	24.9	1.0e-08
WP_040187984.1|4943352_4944558_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	35.5	1.8e-06
WP_002890343.1|4944740_4945430_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	37.6	3.7e-36
WP_002890344.1|4945451_4946747_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.0	2.2e-26
>prophage 355
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4959589	4960570	5403218	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_000019449.1|4959589_4960570_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
>prophage 356
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4964180	4968519	5403218	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
WP_002890395.1|4964180_4965308_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	1.6e-89
WP_002890398.1|4965330_4965663_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	4.9e-10
WP_002890400.1|4965689_4967537_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_002890403.1|4967547_4968519_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	39.1	3.6e-45
>prophage 357
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4972118	4976778	5403218		Indivirus(33.33%)	6	NA	NA
WP_004144650.1|4972118_4973222_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.2	1.1e-50
WP_001021161.1|4973309_4973780_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_002891356.1|4973799_4974219_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_004178737.1|4974290_4975262_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_004177266.1|4975254_4975758_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_040236468.1|4975803_4976778_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	21.2	7.1e-09
>prophage 358
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	4989581	4991261	5403218		Lactobacillus_phage(100.0%)	1	NA	NA
WP_016946554.1|4989581_4991261_-	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	25.4	1.2e-16
>prophage 359
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5005567	5010736	5403218	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_002891804.1|5005567_5006191_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	3.8e-64
WP_002891807.1|5006441_5007716_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	7.3e-131
WP_004151336.1|5007899_5010254_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	2.7e-224
WP_002444653.1|5010463_5010736_+	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	61.8	8.5e-21
>prophage 360
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5013966	5014668	5403218		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002891863.1|5013966_5014668_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.4	1.1e-88
>prophage 361
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5019095	5022639	5403218		Bacillus_phage(100.0%)	2	NA	NA
WP_103215728.1|5019095_5020868_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.6	3.7e-48
WP_002891880.1|5020860_5022639_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.5	6.0e-38
>prophage 362
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5028708	5034363	5403218		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_072041644.1|5028708_5029662_+	hypothetical protein	NA	A0A1B1ITH5	uncultured_Mediterranean_phage	28.3	4.8e-26
WP_103215729.1|5029913_5031041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040236485.1|5031061_5032270_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0ZCT8	Stx2-converting_phage	45.6	1.2e-21
WP_040236487.1|5032259_5032538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040236489.1|5032890_5033472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003847550.1|5033799_5034363_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.2	2.2e-23
>prophage 363
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5044307	5045417	5403218		Planktothrix_phage(100.0%)	1	NA	NA
WP_009307951.1|5044307_5045417_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.5	1.1e-26
>prophage 364
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5054591	5063982	5403218		Enterobacteria_phage(33.33%)	10	NA	NA
WP_002892007.1|5054591_5055662_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	42.8	6.1e-70
WP_002892011.1|5055777_5056041_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_002892018.1|5056040_5056181_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_002892021.1|5056177_5056876_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_040236504.1|5056976_5058428_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.1	4.6e-12
WP_002892026.1|5058402_5058873_-	membrane protein	NA	NA	NA	NA	NA
WP_002892030.1|5059005_5059572_-	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_002892050.1|5059730_5059949_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_002892066.1|5059975_5060350_-	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
WP_002892069.1|5060835_5063982_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.7	1.1e-47
>prophage 365
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5071791	5077320	5403218		Klosneuvirus(33.33%)	5	NA	NA
WP_004177230.1|5071791_5072343_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.5	3.9e-28
WP_040236507.1|5072435_5074343_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	37.4	3.0e-43
WP_002892173.1|5074396_5074729_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_023283309.1|5074728_5075334_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_040236508.1|5075445_5077320_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	3.7e-115
>prophage 366
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5087440	5158980	5403218	transposase,terminase,tail,head,integrase,holin,tRNA,protease	Cronobacter_phage(19.67%)	91	5103365:5103424	5157368:5158416
WP_004178775.1|5087440_5089942_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.0	3.6e-113
WP_002892208.1|5090048_5090459_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004142979.1|5090455_5090914_-	NfeD family protein	NA	NA	NA	NA	NA
WP_002892258.1|5090910_5091828_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_004177224.1|5091968_5092646_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.0	1.3e-22
WP_004177223.1|5092632_5093415_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_002892263.1|5093522_5094377_-	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_004183221.1|5094435_5095206_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002892267.1|5095234_5095861_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_004146399.1|5095828_5096515_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	1.6e-31
WP_023283312.1|5096511_5098926_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004142997.1|5099107_5100253_+	porin	NA	NA	NA	NA	NA
WP_023283313.1|5100360_5101437_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_004143002.1|5101548_5102616_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_004151322.1|5102612_5103122_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
5103365:5103424	attL	GGCTTTGTTGAATAAATCGAACTTTTGCTGAGTTGAAGGATCAGATCACGTATCCTCCCG	NA	NA	NA	NA
WP_032425493.1|5103441_5104365_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	95.4	2.0e-170
WP_001101446.1|5104683_5105709_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_004151320.1|5106104_5106827_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_103215733.1|5106830_5107325_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_004143010.1|5107500_5108886_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004143016.1|5108931_5109144_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|5109145_5110012_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_103215734.1|5110443_5111607_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	86.8	2.5e-202
WP_071531921.1|5111483_5111819_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_103215735.1|5111820_5112039_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	50.7	3.8e-11
WP_032442372.1|5112035_5112227_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	62.7	6.0e-13
WP_032442371.1|5112223_5112448_-	hypothetical protein	NA	G8C7U9	Escherichia_phage	73.2	1.6e-20
WP_048983157.1|5112663_5113320_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.0	3.5e-113
WP_032442370.1|5113316_5113745_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	1.3e-63
WP_048983156.1|5113741_5114422_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	92.9	1.8e-123
WP_048983155.1|5114418_5115264_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	9.0e-69
WP_008807813.1|5115279_5115564_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	3.8e-40
WP_060415519.1|5115571_5116540_-	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	77.7	1.7e-39
WP_060415518.1|5116543_5117062_-	hypothetical protein	NA	A0A1W6DY33	Salmonella_phage	44.7	3.7e-33
WP_072044099.1|5117120_5117327_-	cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	2.4e-31
WP_019704102.1|5117950_5118583_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	39.5	4.6e-33
WP_023284762.1|5118682_5118898_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	60.9	4.2e-15
WP_009307994.1|5118947_5119268_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	67.9	4.2e-35
WP_100040039.1|5119417_5120374_+	phage replication protein	NA	H6WRX7	Salmonella_phage	64.0	4.3e-59
WP_023283974.1|5120373_5120964_+	hypothetical protein	NA	I3PUZ9	Vibrio_phage	40.5	9.2e-36
WP_004151295.1|5120963_5121257_+	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_103215736.1|5121253_5121760_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	34.5	2.4e-08
WP_023301659.1|5121756_5122017_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	76.8	7.4e-30
WP_103215737.1|5122123_5122624_+	ead/Ea22-like family protein	NA	NA	NA	NA	NA
WP_023301661.1|5122620_5122800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103215771.1|5123060_5123699_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	68.6	3.8e-51
WP_064161320.1|5123691_5123997_+	hypothetical protein	NA	Q7Y3Y0	Yersinia_phage	43.4	5.1e-14
WP_103215462.1|5124154_5124751_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	54.3	1.2e-56
WP_004146340.1|5124959_5125250_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	89.6	1.8e-45
WP_047718179.1|5125246_5125609_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	82.4	9.5e-52
WP_023301665.1|5125605_5125746_+	YlcG family protein	NA	NA	NA	NA	NA
WP_023301666.1|5125742_5126432_+	hypothetical protein	NA	I6PDF8	Cronobacter_phage	57.1	5.5e-64
WP_031280382.1|5127171_5127471_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	99.0	2.9e-46
WP_023301667.1|5127467_5128007_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	99.4	6.7e-102
WP_023301668.1|5128003_5128348_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	79.8	4.4e-38
WP_017880211.1|5128344_5128620_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_032443192.1|5129575_5129812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023301669.1|5129859_5130069_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_023301670.1|5130096_5130612_+|terminase	terminase small subunit	terminase	I6PDJ6	Cronobacter_phage	74.7	7.4e-66
WP_023301671.1|5130611_5132084_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.3	3.4e-249
WP_103215738.1|5132096_5133518_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	5.6e-148
WP_103215739.1|5133492_5134497_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	68.8	1.2e-112
WP_103215740.1|5134538_5135015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049016932.1|5135087_5136467_+	hypothetical protein	NA	F1C5D9	Cronobacter_phage	52.7	3.0e-130
WP_023339710.1|5136466_5136901_+	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	47.8	2.2e-26
WP_023339711.1|5136912_5137944_+	hypothetical protein	NA	A0A0M3LQZ1	Mannheimia_phage	52.6	6.2e-96
WP_032428666.1|5137983_5138271_+	hypothetical protein	NA	A0A0M3LR32	Mannheimia_phage	75.6	1.4e-13
WP_040206659.1|5138273_5138654_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	4.1e-29
WP_004223294.1|5138653_5138824_+	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	50.0	3.4e-12
WP_103215741.1|5138827_5139211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103215742.1|5139207_5139570_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	47.5	3.7e-19
WP_004151265.1|5139572_5139998_+	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004178853.1|5139994_5140387_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	51.9	3.3e-34
WP_064147639.1|5140455_5141208_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	41.8	1.3e-42
WP_032442344.1|5141260_5141938_+	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.5	1.8e-72
WP_064147640.1|5142113_5142869_+	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	52.2	9.5e-62
WP_103215743.1|5142871_5143126_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	69.7	3.9e-20
WP_023328739.1|5143546_5143867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086556004.1|5143918_5144236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151254.1|5144660_5145164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103215744.1|5145256_5148697_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	44.3	5.2e-147
WP_016531189.1|5148796_5149216_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	47.8	1.8e-30
WP_103215745.1|5149215_5149686_+	hypothetical protein	NA	F1C5F1	Cronobacter_phage	37.0	1.3e-24
WP_004223348.1|5149682_5150078_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	53.6	1.4e-35
WP_103215746.1|5150064_5152536_+|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	45.2	9.7e-204
WP_103215747.1|5152622_5154878_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	45.3	1.9e-97
WP_103215773.1|5155024_5155645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194725.1|5155832_5157053_+|transposase	ISL3-like element ISCfr12 family transposase	transposase	NA	NA	NA	NA
WP_103215748.1|5157113_5157398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032425493.1|5157444_5158368_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	95.4	2.0e-170
WP_047718144.1|5158686_5158980_-	hypothetical protein	NA	Q687E4	Enterobacteria_phage	62.2	4.1e-05
5157368:5158416	attR	GGCTTTGTTGAATAAATCGAACTTTTGCTGAGTTGAAGGATCAGATCACGTATCCTCCCGACAACACAGACCATTCCGTGGCAAAGCAAAAGTTCAGAATCACCAACTGGTCCACCTACAACAAAGCTCTCATCAACCGTGGCTCCCTCACTTTCTGGCTGGATGATGAGGCGATTCAGGCCTGGTATGAGTCGGCAACGCCTTCATCACGAGGAAGGCCCCAGCGCTATTCTGATCTCGCCATCACCACCGTTCTGGTGATTAAACGCGTATTCCGGCTGACCCTGCGGGCTGCGCAGGGTTTTATTGATTCCATTTTTGCCCTGATGAACGTTCCGTTGCGCTGCCCGGATTACACCAGTGTCAGTAAGCGGGCAAAGTCGGTTAATGTCAGTTTCAAAACGTCCACCCGGGGTGAAATCGCACACCTGGTGATTGATTCCACCGGGCTGAAGGTCTTTGGTGAAGGCGAATGGAAAGTCAGAAAGCACGGCAAAGAGCGCCGTCGTATCTGGCGAAAGTTGCATCTTGCTGTTGACAGCAACACACATGAAGTTGTCTGTGCAGACCTGTCGCTGAATAACGTCACGGACTCAGAAGCCTTCCCGGGTCTTATCCGGCAGACTCACAGAAAAATCAGGGCAGCATCGGCAGACGGCGCTTACGACACCCGGCTCTGTCACGATGAACTGCGGCGTAAGAAAATCAGCGCGCTTATCCCTCCCCGAAAAGGTGCGGGTTACTGGCCCGGTGAATATGCAGACCGTAACCGTGCAGTGGCTAATCAGCGAATGACCGGGAGTAATGCGCGGTGGAAATGGACAACAGATTACAACCGTCGCTCGATAGCGGAAACGGCGATGTACCGGGTAAAACAGCTGTTCGGGGGTTCACTGACGCTGCGTGACTACGATGGTCAGGTTGCGGAGGCTATGGCCCTGGTACGAGCGCTGAACAAAATGACGAAAGCAGGTATGCCTGAAAGCGTGCGTATTGCCTGAAAACACAACCCGCTACGGGGGAGACTTACCCGAAATCTGATTTATTCA	NA	NA	NA	NA
>prophage 367
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5164163	5165084	5403218		Morganella_phage(100.0%)	1	NA	NA
WP_002892400.1|5164163_5165084_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	40.1	5.4e-51
>prophage 368
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5171307	5174632	5403218	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_004151795.1|5171307_5172783_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.0	6.9e-48
WP_002892491.1|5173114_5174632_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	9.5e-85
>prophage 369
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5183152	5188954	5403218		Staphylococcus_phage(50.0%)	5	NA	NA
WP_040236761.1|5183152_5184637_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.7e-14
WP_040236759.1|5184647_5185679_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004178871.1|5185862_5186504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040236771.1|5186519_5187524_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_040236757.1|5187553_5188954_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	24.7	8.6e-16
>prophage 370
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5195579	5196377	5403218		Bacillus_virus(100.0%)	1	NA	NA
WP_017898796.1|5195579_5196377_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.7	3.5e-14
>prophage 371
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5215122	5216987	5403218		Tupanvirus(33.33%)	3	NA	NA
WP_004211620.1|5215122_5216238_+	class II histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	32.7	1.5e-39
WP_004178884.1|5216321_5216624_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	44.0	2.2e-17
WP_004196125.1|5216627_5216987_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	90.7	1.2e-57
>prophage 372
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5243839	5246554	5403218		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_103215751.1|5243839_5246554_+	cation-transporting P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.0	1.0e-65
>prophage 373
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5255507	5264180	5403218		Planktothrix_phage(75.0%)	9	NA	NA
WP_040236588.1|5255507_5256971_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	6.2e-17
WP_040236589.1|5257212_5258064_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002893187.1|5258111_5258753_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002893189.1|5258767_5259433_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004142516.1|5259425_5260187_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	1.3e-29
WP_009485410.1|5260240_5261005_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004183313.1|5261185_5262523_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_004178936.1|5262652_5263357_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	2.3e-25
WP_004178937.1|5263343_5264180_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.4	9.1e-13
>prophage 374
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5268737	5274651	5403218	holin	Catovirus(50.0%)	4	NA	NA
WP_004142489.1|5268737_5270402_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	6.1e-61
WP_004178943.1|5270415_5271888_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004151671.1|5271901_5272489_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_004142478.1|5272617_5274651_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.7	5.8e-21
>prophage 375
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5281354	5282899	5403218		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002893593.1|5281354_5282899_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	4.6e-18
>prophage 376
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5294293	5299034	5403218		Tupanvirus(50.0%)	2	NA	NA
WP_040236596.1|5294293_5298175_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	27.8	1.5e-54
WP_002893737.1|5298239_5299034_-	iron-enterobactin ABC transporter ATP-binding protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	25.7	1.5e-09
>prophage 377
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5311491	5315912	5403218		Burkholderia_phage(50.0%)	5	NA	NA
WP_012737625.1|5311491_5311896_-	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	33.3	1.0e-06
WP_002893907.1|5311870_5312173_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_021464368.1|5312356_5313100_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_040236601.1|5313157_5314246_-	oxidoreductase	NA	NA	NA	NA	NA
WP_040236603.1|5314409_5315912_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	8.4e-17
>prophage 378
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5332988	5346703	5403218		Cedratvirus(20.0%)	12	NA	NA
WP_004191366.1|5332988_5334017_+	2-hydroxyacid dehydrogenase	NA	A0A2R8FCS0	Cedratvirus	34.0	7.2e-28
WP_004147553.1|5334059_5335001_-	sugar kinase	NA	NA	NA	NA	NA
WP_040236615.1|5335012_5336017_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_040236616.1|5336013_5337003_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_040236618.1|5336999_5338550_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.8	1.5e-16
WP_002894353.1|5338546_5339527_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_040236620.1|5339935_5342245_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	33.6	1.0e-82
WP_004183390.1|5342352_5342895_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_032437044.1|5342891_5343581_-	acireductone synthase	NA	NA	NA	NA	NA
WP_004191350.1|5343707_5344868_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_004151651.1|5344868_5345495_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	48.2	1.1e-52
WP_016946809.1|5345479_5346703_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	34.1	2.4e-62
>prophage 379
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5349838	5351909	5403218		Bacillus_virus(50.0%)	2	NA	NA
WP_002894398.1|5349838_5351404_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.6	6.4e-44
WP_002894401.1|5351480_5351909_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.0	7.4e-19
>prophage 380
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5355999	5356660	5403218		Morganella_phage(50.0%)	2	NA	NA
WP_002439184.1|5355999_5356209_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	79.7	1.2e-22
WP_004223642.1|5356276_5356660_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	8.9e-24
>prophage 381
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5361538	5364025	5403218		Stx2-converting_phage(50.0%)	2	NA	NA
WP_002894539.1|5361538_5362738_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.0	6.5e-105
WP_004147579.1|5362876_5364025_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	51.6	1.1e-08
>prophage 382
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5371069	5377050	5403218	tRNA,transposase	Staphylococcus_phage(33.33%)	4	NA	NA
WP_004147581.1|5371069_5373652_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	1.0e-184
WP_002894699.1|5373878_5374361_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_000019449.1|5375066_5376047_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
WP_002894706.1|5376324_5377050_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	1.2e-29
>prophage 383
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5383054	5384101	5403218		Pseudomonas_phage(100.0%)	1	NA	NA
WP_004176871.1|5383054_5384101_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	3.2e-47
>prophage 384
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5388141	5389806	5403218		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002894734.1|5388141_5389806_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.7	7.2e-86
>prophage 385
NZ_CP026178	Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome	5403218	5394559	5398361	5403218	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_004147599.1|5394559_5396515_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	6.4e-09
WP_004893401.1|5396693_5398361_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	93.5	0.0e+00
>prophage 1
NZ_CP026179	Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence	237571	5741	39930	237571	transposase	uncultured_Caudovirales_phage(37.5%)	33	NA	NA
WP_000427614.1|5741_6746_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001549888.1|7409_7838_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.3e-52
WP_001549887.1|7887_9171_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.6	2.9e-175
WP_001549886.1|9266_9620_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.1	5.9e-22
WP_001549885.1|10103_11582_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	1.6e-198
WP_004118529.1|11600_12428_+	universal stress protein	NA	NA	NA	NA	NA
WP_001549953.1|12499_13696_-	MFS transporter	NA	NA	NA	NA	NA
WP_004118534.1|14224_14599_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	56.0	4.5e-28
WP_011977829.1|14873_16022_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	65.9	1.7e-123
WP_001067855.1|16674_17379_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001217881.1|17610_18168_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_014454105.1|18401_18956_+	aminoglycoside N-acetyltransferase AAC(6')-Ib'	NA	NA	NA	NA	NA
WP_001206315.1|19025_19814_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000722315.1|19873_20698_+	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
WP_000027057.1|21397_22258_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001166628.1|23730_24186_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294660.1|24257_24608_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732276.1|24623_24899_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522993.1|24926_25334_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000281123.1|25372_27055_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	1.9e-38
WP_001277463.1|27072_27438_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|27434_27671_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001446012.1|27654_27774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993245.1|27736_27949_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001162012.1|28078_28636_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_001138073.1|28638_31611_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_000480968.1|32293_33130_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|33129_33933_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|33993_34809_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000954592.1|35138_35315_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_000427619.1|35496_36501_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|38044_38749_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|39225_39930_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP026179	Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence	237571	57662	120656	237571	transposase,integrase,protease	Escherichia_phage(25.0%)	52	57165:57179	104876:104890
57165:57179	attL	GCAACCGAAAAACTG	NA	NA	NA	NA
WP_001452808.1|57662_58454_+|protease	zinc metalloprotease	protease	NA	NA	NA	NA
WP_000057569.1|58468_58810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749982.1|59369_60089_+	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.9	8.6e-20
WP_001749988.1|62045_62615_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
WP_000845048.1|63007_64021_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|64176_64650_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001144737.1|64870_65137_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|65279_66044_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|66304_67519_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_071076600.1|67552_68968_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	6.9e-106
WP_001553819.1|69003_71901_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_000509966.1|71995_72601_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_004152397.1|72914_74234_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004199234.1|74483_75365_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_001067855.1|75889_76594_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_012954666.1|77271_77916_+	quinolone resistance pentapeptide repeat protein QnrB19	NA	NA	NA	NA	NA
WP_088169311.1|77924_78242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000608644.1|78405_79668_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_002210513.1|81453_82215_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|82235_83096_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_001067855.1|83232_83937_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004118540.1|84225_84783_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	47.2	8.4e-39
WP_022631502.1|89038_89239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001118616.1|89539_90463_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_004099052.1|90880_93073_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_004099051.1|93202_94486_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_009653212.1|94574_96008_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_023157975.1|96026_98474_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	69.2	6.1e-25
WP_004197675.1|98587_100231_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	25.0	1.5e-22
WP_004197678.1|100355_100922_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004197671.1|101256_101535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009653207.1|101774_103172_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004143398.1|103360_103756_-	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_077253535.1|103804_105151_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
104876:104890	attR	CAGTTTTTCGGTTGC	NA	NA	NA	NA
WP_001567369.1|105376_106009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|106037_107441_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_009310015.1|107552_109085_+|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	4.1e-51
WP_003026803.1|109243_109726_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003026799.1|109713_109980_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004206660.1|110424_110655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206661.1|110668_110872_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004206662.1|110932_111424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032415728.1|111557_112769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193994.1|112765_113014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206664.1|113371_113722_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.1e-23
WP_004206665.1|113773_114136_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_016151356.1|114153_115905_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004206668.1|115952_117242_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.8	3.3e-171
WP_004206670.1|117254_117680_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.1	6.6e-52
WP_004206671.1|117712_118141_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_103215775.1|118262_119261_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000227969.1|119579_120656_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP026182	Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-0c4e, complete sequence	61178	6287	15916	61178	integrase	Escherichia_phage(42.86%)	9	1163:1176	11923:11936
1163:1176	attL	TTCTTCAGGCGTTA	NA	NA	NA	NA
WP_023280891.1|6287_7070_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_000764642.1|7127_7385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|8152_9019_+	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_000339857.1|9375_9645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000368714.1|10059_11265_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_012600007.1|11261_12239_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
11923:11936	attR	TAACGCCTGAAGAA	NA	NA	NA	NA
WP_004118291.1|12320_13592_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
WP_000776034.1|13591_14023_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_021312688.1|14431_15916_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	9.1e-32
>prophage 1
NZ_CP026186	Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence	373179	2428	47109	373179	protease,integrase,transposase	Dinoroseobacter_phage(25.0%)	34	29921:29936	48470:48485
WP_004118178.1|2428_2977_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_032427182.1|2954_3452_-	heat resistance protein PsiE-GI	NA	NA	NA	NA	NA
WP_023326110.1|3454_5164_-	heat resistance system K+/H+ antiporter KefB-GI	NA	NA	NA	NA	NA
WP_000786814.1|5167_5608_-	heat resistance system thioredoxin Trx-GI	NA	A0A023NHA9	Dinoroseobacter_phage	34.7	5.8e-11
WP_032427178.1|5597_6743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032427177.1|6822_7434_-	heat resistance membrane protein HdeD-GI	NA	NA	NA	NA	NA
WP_049245904.1|7523_8411_-	heat resistance protein YfdX2	NA	NA	NA	NA	NA
WP_015065597.1|8513_9428_-	heat resistance protein YfdX1	NA	NA	NA	NA	NA
WP_015065596.1|9450_9909_-	small heat shock protein sHSP20-GI	NA	NA	NA	NA	NA
WP_023205099.1|9996_10137_-|protease	ATP-dependent metalloprotease FtsH	protease	NA	NA	NA	NA
WP_032174385.1|10854_12285_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_021567632.1|12301_15163_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.3	1.2e-128
WP_032174387.1|15260_15833_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_024238610.1|16248_16512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032174388.1|17068_18691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032731984.1|20187_21798_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_032174395.1|21790_23851_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032731983.1|23864_24692_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_153677588.1|25835_25976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049129980.1|26750_27089_+	copper homeostasis periplasmic binding protein CopC	NA	NA	NA	NA	NA
WP_023313931.1|27185_27446_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_032435791.1|27502_29566_-	TonB-dependent copper receptor	NA	NA	NA	NA	NA
WP_015065566.1|29648_30068_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
29921:29936	attL	CCATGTCGTGGTGCAT	NA	NA	NA	NA
WP_000156884.1|30434_31457_+|transposase	IS110-like element IS5708 family transposase	transposase	NA	NA	NA	NA
WP_000427614.1|31791_32796_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_004118062.1|33142_33421_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004181742.1|33514_33727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040210113.1|34701_35016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032437744.1|35258_35711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032413243.1|36212_37148_-|protease	omptin family outer membrane protease Kop	protease	NA	NA	NA	NA
WP_085955508.1|40029_41150_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.4	3.9e-51
WP_004026560.1|41276_42176_-	RepB family plasmid replication initiator protein	NA	A0A1B0VDL5	Salmonella_phage	49.0	6.9e-67
WP_016946352.1|43643_43898_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_014386529.1|45972_47109_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
48470:48485	attR	CCATGTCGTGGTGCAT	NA	NA	NA	NA
>prophage 2
NZ_CP026186	Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence	373179	104499	137774	373179	transposase	Enterobacteria_phage(55.56%)	28	NA	NA
WP_023280932.1|104499_105423_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	5.1e-166
WP_029497558.1|105541_106093_+	DUF3833 domain-containing protein	NA	NA	NA	NA	NA
WP_040210203.1|106089_107049_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_040215689.1|107179_108562_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_025714638.1|108793_108976_-	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
WP_023280930.1|109032_110286_-	lactose permease	NA	NA	NA	NA	NA
WP_050888045.1|110337_113412_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
WP_004152286.1|113533_114616_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
WP_004152284.1|115076_116087_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000156884.1|116496_117519_+|transposase	IS110-like element IS5708 family transposase	transposase	NA	NA	NA	NA
WP_020804811.1|117853_118858_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_071527925.1|119155_119398_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004118251.1|119728_120022_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
WP_004152282.1|120120_120888_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004152281.1|120888_121845_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_004118243.1|121841_122840_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004118241.1|122836_123739_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_004152280.1|123783_126108_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_004118237.1|126193_127147_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_004118235.1|127143_127665_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_103215782.1|128222_129044_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	94.7	3.6e-147
WP_023280914.1|129090_130014_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	2.3e-166
WP_001101446.1|130331_131357_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_040088343.1|131685_133218_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	3.1e-51
WP_040210104.1|133417_133828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032676095.1|134115_134688_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	47.2	7.8e-40
WP_072041693.1|134696_135515_+	abortive infection family protein	NA	NA	NA	NA	NA
WP_023280912.1|136697_137774_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP026186	Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence	373179	167613	174805	373179		Burkholderia_phage(33.33%)	10	NA	NA
WP_048995640.1|167613_168192_+	HNH endonuclease	NA	W0LI46	Edwardsiella_phage	57.6	1.2e-40
WP_004181824.1|168182_168497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048995652.1|168621_169032_+	hypothetical protein	NA	Q71TH9	Escherichia_phage	60.0	1.0e-41
WP_004196726.1|169216_169576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040222914.1|169806_170250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026466.1|170503_170764_+	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	41.0	5.9e-11
WP_053515148.1|170796_171231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026464.1|171227_171971_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	49.6	1.8e-60
WP_038992077.1|172097_173513_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	4.1e-106
WP_038992075.1|173602_174805_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.1	1.1e-35
>prophage 4
NZ_CP026186	Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence	373179	197571	205177	373179		Salmonella_phage(33.33%)	14	NA	NA
WP_004026417.1|197571_197892_+	hypothetical protein	NA	J9Q750	Salmonella_phage	50.9	2.2e-28
WP_004026416.1|197972_198287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197205.1|198407_198659_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	76.7	1.9e-22
WP_004026415.1|198824_199043_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	66.7	4.4e-20
WP_040209848.1|199135_199633_+	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	67.1	2.0e-23
WP_004197241.1|199629_199818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049131881.1|199810_200032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197209.1|200296_200524_+	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	1.5e-10
WP_049131879.1|200520_201165_+	hypothetical protein	NA	A0A0U4JEF1	Pseudomonas_phage	39.8	2.4e-05
WP_049131877.1|201581_201968_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	85.1	3.7e-17
WP_153236429.1|202546_202882_+	hypothetical protein	NA	J9Q804	Salmonella_phage	51.4	3.3e-14
WP_032451279.1|204118_204313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197220.1|204614_204821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197207.1|204904_205177_+	hypothetical protein	NA	I7B2L9	Escherichia_phage	48.9	1.5e-12
>prophage 5
NZ_CP026186	Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence	373179	235084	294729	373179	transposase	Bacillus_phage(28.57%)	56	NA	NA
WP_061891937.1|235084_236266_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_040088343.1|236406_237939_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	3.1e-51
WP_004196353.1|238013_239354_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_032072095.1|239609_240032_-	nickel resistance OB fold protein NcrY	NA	NA	NA	NA	NA
WP_004196366.1|240193_241324_-	Ni(II)/Co(II) efflux transporter permease subunit NcrC	NA	NA	NA	NA	NA
WP_004196355.1|241336_241606_-	nickel-sensing transcriptional repressor NcrB	NA	NA	NA	NA	NA
WP_004196314.1|241711_243010_-	MFS transporter	NA	NA	NA	NA	NA
WP_004196325.1|243243_244002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196315.1|244055_244976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032425553.1|245038_245410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008460269.1|245810_246734_+	chromate resistance protein	NA	NA	NA	NA	NA
WP_008460270.1|246687_248067_+	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	64.6	1.6e-27
WP_004196322.1|248097_248787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008460272.1|248800_249538_-	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_009651956.1|249581_249947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196370.1|250197_250437_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	9.1e-19
WP_000323025.1|250436_250724_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_004181898.1|250795_250954_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_004196351.1|252731_253109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181903.1|253798_254866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196344.1|255021_255369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196327.1|255447_255681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196337.1|256223_256580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196333.1|256633_257407_-	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	48.0	5.1e-10
WP_004196347.1|257409_258546_-	S49 family peptidase	NA	G0YPK2	Erwinia_phage	29.0	5.7e-10
WP_004181910.1|258554_259229_-	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_004196339.1|259241_260339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196374.1|260341_262468_-	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_004196321.1|262457_265406_-	helicase	NA	NA	NA	NA	NA
WP_004196318.1|265419_266208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026319.1|266207_266672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071528223.1|267611_268025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196372.1|268217_268742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196331.1|268758_269301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103215802.1|269666_270704_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_004181920.1|270747_272103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196345.1|272104_276073_+	traG-like region family protein	NA	NA	NA	NA	NA
WP_004181922.1|276123_276429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196338.1|277317_277674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196369.1|277825_281167_+	viral (Super1) RNA helicase	NA	NA	NA	NA	NA
WP_004026303.1|281434_282049_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_004181926.1|282182_282911_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_004181928.1|282927_283239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181929.1|283252_283594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196319.1|283653_284610_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_025368585.1|284839_285796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181933.1|285913_286429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181934.1|286431_287034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181937.1|287307_287964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196329.1|287993_288434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181938.1|288423_288933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196316.1|288941_289256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|289462_290866_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|290894_291527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040088343.1|291703_293236_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	3.1e-51
WP_004113090.1|293325_294729_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP026181	Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-6a23, complete sequence	94405	0	11791	94405	transposase	Morganella_phage(14.29%)	15	NA	NA
WP_032743916.1|791_1217_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	54.7	4.9e-31
WP_004194725.1|1313_2534_+|transposase	ISL3-like element ISCfr12 family transposase	transposase	NA	NA	NA	NA
WP_020804878.1|2748_2979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032744253.1|3415_4117_+	methylase	NA	A0A2K9VH43	Faecalibacterium_phage	34.3	2.6e-21
WP_020804418.1|4116_4338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020804419.1|4383_4794_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_020804421.1|4840_5605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032744250.1|6037_6466_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.9	2.2e-10
WP_020803879.1|6510_7017_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	31.9	6.9e-08
WP_020803881.1|7057_7249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032425679.1|7449_7713_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	53.8	3.4e-14
WP_103214951.1|7737_8058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103214949.1|8866_9424_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.0	1.1e-49
WP_020314938.1|9473_9722_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_103214948.1|9790_11791_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	28.4	3.3e-21
>prophage 2
NZ_CP026181	Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-6a23, complete sequence	94405	16422	18365	94405		Klebsiella_phage(50.0%)	4	NA	NA
WP_020804855.1|16422_16761_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	54.1	1.6e-21
WP_020804856.1|16816_17164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032744242.1|17254_17485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032744240.1|17531_18365_+	N-6 DNA methylase	NA	A0A2K9V411	Faecalibacterium_phage	34.8	3.7e-22
>prophage 3
NZ_CP026181	Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-6a23, complete sequence	94405	43179	93288	94405	transposase,tail	Salmonella_phage(18.75%)	47	NA	NA
WP_000227969.1|43179_44256_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_088883382.1|47211_47883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053390238.1|48434_48821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048235023.1|48939_51252_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_064342599.1|52997_53189_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_023301640.1|53322_53496_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_103215785.1|53492_53810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032443143.1|53793_54129_+	hypothetical protein	NA	M4MCT3	Vibrio_phage	38.3	9.6e-06
WP_023301642.1|54442_55171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023301643.1|55170_55584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023301644.1|55695_56514_+	hypothetical protein	NA	A0A219VH76	Ochrobactrum_phage	49.4	1.3e-35
WP_023301645.1|56506_57406_+	hypothetical protein	NA	A0A0A1IWZ9	Pseudomonas_phage	38.6	1.3e-62
WP_023301646.1|57454_59251_+|tail	phage tail tape measure protein	tail	M4MHE6	Vibrio_phage	29.8	6.0e-62
WP_158650604.1|59594_63332_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_013023834.1|63412_64138_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	28.3	1.2e-05
WP_004152380.1|64209_64803_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_101455611.1|64969_65566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064184850.1|65615_66260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064184849.1|66315_66966_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_071049152.1|66962_67271_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	31.7	1.9e-08
WP_071049169.1|67374_67917_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	34.6	9.4e-19
WP_077270869.1|68343_68421_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_071049154.1|68413_69433_+	replication initiation protein	NA	NA	NA	NA	NA
WP_071049156.1|70675_71239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103215786.1|71222_71834_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_023307208.1|72401_75299_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	5.5e-182
WP_103214952.1|75393_75999_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	7.2e-20
WP_023317852.1|76216_76852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020326536.1|76987_77983_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	27.9	4.1e-20
WP_020804881.1|78711_79410_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_001138073.1|80345_83318_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|83320_83878_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_000993245.1|84007_84220_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001446012.1|84182_84302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087807.1|84285_84522_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277463.1|84518_84884_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000281123.1|84901_86584_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	1.9e-38
WP_000522993.1|86622_87030_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732276.1|87057_87333_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294660.1|87348_87699_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_001166628.1|87770_88226_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_020314648.1|88425_88704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020804876.1|89021_89633_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_020314639.1|89629_90583_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	57.1	9.5e-75
WP_022644719.1|90703_90970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020314642.1|90989_91610_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.0	1.0e-08
WP_020804882.1|92646_93288_+	ParA family protein	NA	A4JWV7	Burkholderia_virus	25.5	1.1e-05
>prophage 1
NZ_CP026180	Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9729, complete sequence	97198	0	90065	97198	integrase,transposase	Enterobacteria_phage(16.67%)	72	10451:10465	34998:35012
WP_001568040.1|848_1079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015345000.1|1141_1813_-	mediator of plasmid stability	NA	NA	NA	NA	NA
WP_001568038.1|1815_2787_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_004194318.1|3035_4520_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.1	1.1e-29
WP_009309980.1|4925_5351_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	50.4	2.9e-31
WP_004206782.1|5350_6622_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	8.6e-156
WP_004206783.1|6700_6952_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_009309981.1|7005_7311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009309982.1|8464_9436_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.3	9.2e-150
WP_000523812.1|9435_10602_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	3.0e-224
10451:10465	attL	ACGCCAACTAAATCT	NA	NA	NA	NA
WP_000200070.1|11352_12363_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	54.3	3.0e-87
WP_001515717.1|13060_13801_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004194725.1|13867_15088_-|transposase	ISL3-like element ISCfr12 family transposase	transposase	NA	NA	NA	NA
WP_000227969.1|16080_17157_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001189111.1|17698_19207_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_004187025.1|20921_21170_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_020804663.1|22258_22924_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001101446.1|23150_24176_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_103215782.1|24536_25358_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	94.7	3.6e-147
WP_023280914.1|25404_26328_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	2.3e-166
WP_001189111.1|27600_29109_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_023280912.1|29650_30727_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_012561110.1|31314_32151_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_012561111.1|32215_32614_-	VOC family protein	NA	NA	NA	NA	NA
WP_017384070.1|32657_33767_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.3	4.9e-30
WP_017384071.1|33801_34077_-	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_001749988.1|35498_36068_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
34998:35012	attR	ACGCCAACTAAATCT	NA	NA	NA	NA
WP_005012528.1|36307_37522_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_000019449.1|38852_39833_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
WP_012561158.1|39979_40621_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_013279382.1|40676_40988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016338363.1|41023_41338_-	KikA	NA	NA	NA	NA	NA
WP_000509966.1|41681_42287_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_023307208.1|42381_45279_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	5.5e-182
WP_080884488.1|45616_46354_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_158650603.1|46350_46545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016338361.1|46627_47551_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.7	6.2e-172
WP_001567660.1|47958_48981_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_004181739.1|50326_50743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032442631.1|50883_51807_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.1	2.4e-171
WP_032442632.1|51954_52782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077254647.1|52783_54265_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_032249431.1|55671_56529_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_020804505.1|56521_56599_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004099069.1|56814_57093_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_013213996.1|57413_57965_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.1	6.2e-18
WP_020805034.1|59197_61240_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000443938.1|61232_62684_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_009310009.1|63543_64299_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_001101446.1|65123_66149_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_077254646.1|66443_67412_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.8	3.1e-182
WP_004196314.1|67746_69045_+	MFS transporter	NA	NA	NA	NA	NA
WP_004196355.1|69150_69420_+	nickel-sensing transcriptional repressor NcrB	NA	NA	NA	NA	NA
WP_004196366.1|69432_70563_+	Ni(II)/Co(II) efflux transporter permease subunit NcrC	NA	NA	NA	NA	NA
WP_139108066.1|70724_71147_+	NirD/YgiW/YdeI family stress tolerance protein	NA	NA	NA	NA	NA
WP_004196353.1|71402_72743_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_009310015.1|72831_74364_+|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	4.1e-51
WP_032442619.1|74493_75567_+|transposase	IS481-like element ISKpn28 family transposase	transposase	NA	NA	NA	NA
WP_000019449.1|75645_76626_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
WP_077253291.1|77097_79221_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_009310020.1|79585_80626_-	ATP-binding protein	NA	M4QMW8	Micromonas_pusilla_virus	35.2	9.5e-20
WP_020803817.1|81105_82188_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_080479035.1|82392_83085_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.0	1.0e-41
WP_009310022.1|83039_83549_-|transposase	IS3 family transposase	transposase	A0A2I6AZV8	Macacine_betaherpesvirus	58.7	6.9e-48
WP_023280872.1|83749_84124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568059.1|84179_84506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568058.1|84502_85231_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_020804497.1|85227_85659_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_009310025.1|85703_87761_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.4	2.6e-21
WP_009310026.1|87830_88079_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_020804498.1|88127_88670_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	4.6e-50
WP_009310029.1|89501_90065_-	methyltransferase	NA	A0A2I7RHK4	Vibrio_phage	34.3	4.4e-19
>prophage 2
NZ_CP026180	Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9729, complete sequence	97198	93103	94286	97198		Pectobacterium_phage(50.0%)	3	NA	NA
WP_011977779.1|93103_93358_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	48.8	4.0e-12
WP_103215784.1|93545_93737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023332911.1|93779_94286_-	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	32.2	5.3e-08
