The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026199	Escherichia coli strain ECONIH6 chromosome, complete genome	4869246	662021	742530	4869246	integrase,capsid,holin,tail,portal,terminase,tRNA,head,transposase	Escherichia_phage(42.55%)	90	694680:694694	742632:742646
WP_000343760.1|662021_663242_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_039023127.1|663617_664529_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|664735_665197_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_039023126.1|665273_665933_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|666004_666298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695215.1|666539_666941_+	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
WP_001056840.1|667043_667412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301105.1|667931_668627_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|668650_669463_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|669466_669733_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_001131446.1|670482_670602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001325005.1|670562_670748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122462.1|670848_671022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000726974.1|671023_671368_+	glycine zipper family protein	NA	NA	NA	NA	NA
WP_001065861.1|674810_675029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001246498.1|675160_676684_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_001065752.1|677015_677264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000888772.1|677376_677643_-	biofilm/acid-resistance regulator AriR	NA	NA	NA	NA	NA
WP_000858002.1|677671_677944_-	two-component-system connector protein YmgA	NA	NA	NA	NA	NA
WP_000554140.1|677986_678223_-	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
WP_001299269.1|678536_679748_+	blue light-responsive regulator BluF	NA	NA	NA	NA	NA
WP_000332303.1|679952_680684_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|680904_681309_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032082692.1|681361_681472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039023277.1|681956_683153_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001295666.1|683462_683786_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_000444488.1|683888_685139_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	3.2e-22
WP_001248681.1|685310_685964_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|685973_686435_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001297484.1|686488_687595_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|687630_688272_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423742.1|688275_689646_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001265471.1|689814_690486_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|690485_691946_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000456506.1|692021_693143_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359434.1|693191_694418_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|694667_695804_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
694680:694694	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799406.1|695787_696651_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000241001.1|697205_697874_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_042047081.1|698111_698642_-	chaperone of endosialidase	NA	A0A2D1UII2	Escherichia_phage	85.2	2.5e-69
WP_032143699.1|699375_699747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189123.1|700055_701564_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_001233546.1|705517_706117_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	1.6e-107
WP_000515345.1|706184_709664_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_000090843.1|709724_710333_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	1.9e-100
WP_001333568.1|710269_711013_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	4.5e-149
WP_001152457.1|711018_711717_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	3.4e-130
WP_001330090.1|711716_712073_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_000224003.1|712050_715278_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
WP_077253127.1|715324_715585_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	95.3	2.3e-39
WP_001324129.1|715626_716013_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_000097535.1|716012_716717_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	92.7	1.4e-112
WP_001206700.1|716777_717122_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	5.1e-55
WP_000968644.1|717118_717568_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001147814.1|717564_717903_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719064.1|717911_718229_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	5.3e-22
WP_000766109.1|718305_719523_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000923134.1|720128_721355_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
WP_001140892.1|721502_723260_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_001333563.1|723259_723742_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001135104.1|723889_724240_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	8.0e-64
WP_000738421.1|724765_725059_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_075202333.1|725149_725332_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000992097.1|725548_726082_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
WP_000193264.1|726145_726496_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000372595.1|726500_726716_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000874243.1|727023_727212_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001333560.1|727472_727808_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
WP_001333559.1|727878_728091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106104550.1|728579_728666_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000762879.1|729060_729882_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
WP_000139999.1|729878_730259_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
WP_001221526.1|730259_731318_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
WP_032155008.1|731319_731598_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001013636.1|731765_731978_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_001224662.1|733012_733195_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000403785.1|733288_733645_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001151150.1|733702_734125_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_001262390.1|734165_735236_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_000693850.1|735307_735733_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|735716_735959_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001420344.1|736350_736689_+	peptidase S24	NA	H9C160	Pectobacterium_phage	32.0	2.5e-06
WP_001092153.1|737120_737321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|737413_737632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001517906.1|737596_737800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|738200_738389_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070255.1|738385_738577_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102136.1|738670_741112_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
WP_000003742.1|741173_741443_+	excisionase	NA	NA	NA	NA	NA
WP_000074971.1|741411_742530_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	1.6e-84
742632:742646	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 2
NZ_CP026199	Escherichia coli strain ECONIH6 chromosome, complete genome	4869246	1673359	1734019	4869246	integrase,protease,lysis,tail,portal,terminase,transposase	Enterobacteria_phage(42.31%)	69	1674729:1674777	1719483:1719531
WP_000772656.1|1673359_1674568_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.7e-130
1674729:1674777	attL	AAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_039023233.1|1675206_1676049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039023231.1|1676549_1676747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000371964.1|1677442_1678024_-	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_039023230.1|1678001_1678883_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_072240810.1|1679560_1679689_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.6	1.7e-11
WP_086708942.1|1679743_1683502_-	peptidase S74	NA	A0A2D1UII2	Escherichia_phage	93.4	0.0e+00
WP_001230375.1|1683566_1684166_-	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	5.7e-110
WP_039023163.1|1684235_1687733_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.0	0.0e+00
WP_032158484.1|1687793_1688441_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.3	6.2e-110
WP_032151194.1|1688338_1689082_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	2.3e-148
WP_001152385.1|1689087_1689786_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_039023164.1|1689795_1690125_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	1.7e-60
WP_039023165.1|1690124_1693190_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.2	0.0e+00
WP_001161009.1|1693161_1693491_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|1693499_1693886_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_021560209.1|1693946_1694690_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	99.2	2.3e-132
WP_001079419.1|1694700_1695102_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_023140704.1|1695098_1695677_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
WP_001283153.1|1695688_1695964_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_023140705.1|1695956_1696280_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	99.1	8.5e-52
WP_023277783.1|1696366_1698394_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.4	0.0e+00
WP_052249886.1|1698377_1699847_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	3.1e-282
WP_001072975.1|1699846_1700059_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_025670557.1|1700055_1702158_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.1	0.0e+00
WP_000349509.1|1702157_1702649_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_021512737.1|1703324_1703477_-	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	98.0	4.7e-21
WP_001341210.1|1703464_1703932_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
WP_001135250.1|1703928_1704426_-	lysozyme	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_000839596.1|1704425_1704641_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799656.1|1704708_1705761_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000917724.1|1705911_1706115_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_001446998.1|1706383_1707325_+	hypothetical protein	NA	A5LH79	Enterobacteria_phage	44.2	5.0e-68
WP_001208502.1|1707346_1707796_+	hypothetical protein	NA	A5LH78	Enterobacteria_phage	43.8	8.0e-24
WP_085949407.1|1707831_1708200_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	87.5	9.4e-55
WP_039023166.1|1708214_1709204_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	7.5e-192
WP_024227971.1|1709211_1710021_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	98.1	1.4e-148
WP_000767113.1|1710040_1710430_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210170.1|1710426_1710753_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_001377816.1|1710749_1711403_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	8.1e-126
WP_001393497.1|1711402_1711897_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_103216202.1|1711893_1712865_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	89.5	4.4e-136
WP_001250272.1|1712854_1713034_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_032198019.1|1713209_1713761_-	hypothetical protein	NA	U5P4K1	Shigella_phage	98.9	3.8e-100
WP_032198020.1|1713753_1714014_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	98.8	7.1e-41
WP_001020632.1|1714111_1714804_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	6.4e-121
WP_000135680.1|1715506_1715869_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081287.1|1715934_1716759_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008200.1|1716886_1717423_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_001242749.1|1717413_1717776_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206737.1|1717775_1718081_+	hypothetical protein	NA	U5P0J0	Shigella_phage	98.0	5.8e-50
WP_000433939.1|1718080_1718431_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
WP_039023168.1|1718307_1719471_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.2	1.7e-227
WP_000893278.1|1719675_1720929_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
1719483:1719531	attR	AAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|1720940_1722044_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_039023169.1|1722331_1723387_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
WP_000174677.1|1723425_1723827_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189532.1|1723884_1725129_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|1725220_1725679_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001292994.1|1725939_1727397_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001326471.1|1727453_1727990_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001295202.1|1727922_1728189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059892.1|1728494_1728947_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263489.1|1728956_1729355_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554758.1|1729357_1729651_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226164.1|1729702_1730758_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001333407.1|1730828_1731599_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_103216203.1|1731558_1733298_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000006255.1|1733521_1734019_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP026199	Escherichia coli strain ECONIH6 chromosome, complete genome	4869246	1742277	1815120	4869246	tRNA,protease,plate,transposase	uncultured_Caudovirales_phage(20.0%)	59	NA	NA
WP_000420818.1|1742277_1743414_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001101839.1|1743844_1744237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039023185.1|1744214_1748447_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_032329316.1|1748522_1750664_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_001142958.1|1750873_1751392_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037397.1|1752086_1752587_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|1752621_1752846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056989.1|1752896_1754372_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611744.1|1754378_1754792_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393852.1|1754795_1756646_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|1756609_1757692_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113709.1|1757716_1758997_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|1758993_1759518_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246443.1|1759520_1760852_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343289.1|1760856_1761618_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614325.1|1761626_1764392_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000088852.1|1764388_1765132_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240525.1|1765136_1766549_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122545204.1|1766657_1770092_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087741.1|1770102_1771455_+	membrane protein	NA	NA	NA	NA	NA
WP_001284199.1|1771478_1771961_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908066.1|1772004_1772919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236653.1|1772928_1773408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086141.1|1773544_1774330_-	lipoprotein	NA	NA	NA	NA	NA
WP_001340895.1|1774866_1775598_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_000917883.1|1775662_1776130_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001326702.1|1776126_1776849_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052715.1|1776882_1777638_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|1777709_1779068_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000016007.1|1779115_1779739_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001230983.1|1779742_1780543_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648572.1|1780783_1781698_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997010.1|1781694_1782498_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_001140187.1|1788257_1788833_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000594006.1|1789020_1790052_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
WP_001294600.1|1790044_1790698_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874226.1|1790737_1791553_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|1791670_1792075_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|1792071_1792779_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260712.1|1792890_1794609_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001336393.1|1794662_1795487_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239163.1|1795686_1796397_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635537.1|1796410_1796833_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185290.1|1796829_1797375_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|1797540_1797741_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|1797727_1797988_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176549.1|1798036_1799335_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901099.1|1799399_1799789_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|1799845_1801987_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|1802085_1803045_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|1803057_1806540_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|1806576_1807173_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000139654.1|1807169_1808318_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|1808317_1809106_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|1809109_1809565_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139279.1|1809669_1810695_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|1810698_1811184_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|1811305_1813738_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|1813767_1815120_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 4
NZ_CP026199	Escherichia coli strain ECONIH6 chromosome, complete genome	4869246	2488097	2586002	4869246	integrase,protease,capsid,lysis,holin,tail,portal,plate,terminase,tRNA,head,transposase	Escherichia_phage(47.06%)	99	2497797:2497832	2594887:2594922
WP_000187022.1|2488097_2489198_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000806411.1|2489237_2489597_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_001309117.1|2489596_2490247_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_001120810.1|2490577_2491978_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_001025939.1|2491960_2492878_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_001230087.1|2493144_2494518_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_001352356.1|2494578_2495355_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_000935370.1|2495362_2496367_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_001298964.1|2496520_2497672_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
2497797:2497832	attL	CCGTAGGCCGGATAAGGCGCTCGCGCCGCATCCGGC	NA	NA	NA	NA
WP_001005586.1|2498269_2500921_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_000556306.1|2501102_2502836_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000274643.1|2503050_2503902_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000323841.1|2503888_2504230_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000204105.1|2504231_2505110_-	[formate-C-acetyltransferase]-activating enzyme	NA	NA	NA	NA	NA
WP_000184811.1|2505075_2507373_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|2507423_2507744_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004446.1|2507758_2508838_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_039023143.1|2509146_2511648_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	7.9e-12
WP_000424840.1|2511659_2512322_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_000374004.1|2512332_2513436_+	bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_000647894.1|2513710_2514328_+	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_001271242.1|2514354_2515260_-	cystine transporter YijE	NA	NA	NA	NA	NA
WP_001295695.1|2515352_2517533_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_000007529.1|2517861_2518752_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_000110772.1|2519100_2521533_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_001295694.1|2521535_2522696_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000852812.1|2522972_2523290_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_000797353.1|2523473_2524082_+	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000710769.1|2524142_2524355_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001333520.1|2524557_2526756_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_000644904.1|2526911_2527937_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_000068828.1|2528028_2528988_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000208242.1|2529080_2529611_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293341.1|2529620_2530952_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|2531018_2531945_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|2532037_2532523_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|2532607_2532853_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|2533277_2534123_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|2534145_2535654_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|2535788_2536799_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796332.1|2536895_2537642_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323547.1|2537646_2538075_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655989.1|2538101_2538401_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155257.1|2538612_2539053_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802214.1|2539153_2539753_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216327.1|2539860_2540628_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001326656.1|2540682_2541438_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045683.1|2541544_2542534_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591795.1|2542853_2543816_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|2543996_2544899_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_001145759.1|2545106_2545619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947770.1|2545892_2547262_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_000468308.1|2547334_2547553_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882940.1|2547634_2548798_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.8e-206
WP_000978889.1|2548797_2549277_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000069960.1|2549291_2551739_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.2	0.0e+00
WP_000785970.1|2551731_2551851_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031307.1|2551883_2552159_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251408.1|2552215_2552734_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286718.1|2552746_2553937_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	3.7e-225
WP_062914736.1|2553996_2554599_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	95.3	3.5e-99
WP_001333339.1|2554606_2556142_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
WP_000612626.1|2556190_2556538_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|2556534_2556939_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001333405.1|2557080_2557596_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	56.8	5.0e-46
WP_024176421.1|2557610_2558213_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	75.5	2.5e-81
WP_001032315.1|2558184_2558601_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	46.0	3.4e-21
WP_001285346.1|2559895_2560507_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	1.4e-116
WP_001121501.1|2560499_2561408_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	3.7e-161
WP_000127167.1|2561412_2561760_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	3.8e-58
WP_001093698.1|2561756_2562392_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.5e-111
WP_001001770.1|2562458_2562911_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	97.3	4.5e-75
WP_000917160.1|2562903_2563371_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	3.3e-81
WP_001440152.1|2563333_2563507_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000040631.1|2563478_2563904_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	94.3	1.3e-63
WP_000736582.1|2563891_2564317_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	92.9	3.7e-55
WP_001144097.1|2564331_2564829_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.5e-92
WP_000123123.1|2564828_2565110_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846414.1|2565113_2565317_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	2.6e-30
WP_000988633.1|2565316_2565826_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_024176422.1|2565925_2566669_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	96.4	4.6e-125
WP_001248567.1|2566672_2567746_-|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	98.9	2.2e-200
WP_001085956.1|2567804_2568659_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.6	1.7e-136
WP_000156872.1|2568832_2570605_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_000038166.1|2570604_2571639_+|portal	phage portal protein	portal	U5N087	Enterobacteria_phage	99.1	1.6e-200
WP_000012516.1|2572010_2574494_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_001016257.1|2575811_2576558_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_002431311.1|2576572_2578114_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
WP_000027659.1|2579588_2579864_-	DUF5405 family protein	NA	A0A0F7LCM4	Escherichia_phage	100.0	2.3e-45
WP_001113270.1|2579860_2580085_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_001277952.1|2580084_2580387_-	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	2.5e-45
WP_000557703.1|2580386_2580611_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217670.1|2580674_2581175_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001308179.1|2581344_2581617_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|2581753_2582047_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985246.1|2582116_2583097_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_001223800.1|2583283_2583784_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_001033722.1|2583933_2584632_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|2584628_2586002_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
2594887:2594922	attR	GCCGGATGCGGCGCGAGCGCCTTATCCGGCCTACGG	NA	NA	NA	NA
>prophage 5
NZ_CP026199	Escherichia coli strain ECONIH6 chromosome, complete genome	4869246	3924771	3937954	4869246		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|3924771_3925533_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|3925526_3926153_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|3926292_3927432_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|3927494_3928487_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|3928580_3929945_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136934.1|3930033_3930810_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|3930814_3931453_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|3931449_3932712_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847984.1|3932708_3933617_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	5.1e-118
WP_001300386.1|3933812_3934580_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|3934630_3935287_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_039023140.1|3935392_3937954_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 6
NZ_CP026199	Escherichia coli strain ECONIH6 chromosome, complete genome	4869246	4288252	4331618	4869246	coat,integrase,lysis,holin,tail,portal,terminase,transposase	Enterobacteria_phage(52.73%)	59	4285784:4285800	4334872:4334888
4285784:4285800	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000194515.1|4288252_4289686_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
WP_001274887.1|4289901_4290816_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_001197023.1|4290887_4292135_+	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001163428.1|4292664_4292865_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001281203.1|4292988_4293333_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	98.2	2.2e-58
WP_000545732.1|4293360_4293528_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	4.9e-27
WP_001336413.1|4293746_4293899_-	hypothetical protein	NA	Q71T70	Escherichia_phage	73.7	5.1e-07
WP_103216217.1|4293876_4294119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103216218.1|4295222_4295975_-	ead/Ea22-like family protein	NA	K7P6J7	Enterobacteria_phage	79.6	2.6e-99
WP_103216219.1|4295971_4296514_-	hypothetical protein	NA	K7P7V4	Enterobacteria_phage	72.2	4.2e-59
WP_032148160.1|4296510_4296675_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	1.9e-23
WP_001111298.1|4296685_4296979_-	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	99.0	1.9e-50
WP_103216220.1|4297481_4297955_-	single-stranded DNA-binding protein	NA	G8EYH4	Enterobacteria_phage	96.8	2.5e-60
WP_103216221.1|4297955_4298663_-	recombinase	NA	K7PKU3	Enterobacteria_phage	99.6	6.5e-137
WP_033876910.1|4299178_4299412_-	hypothetical protein	NA	A0A2P1JUD4	Erwinia_phage	61.0	2.1e-07
WP_001264184.1|4299484_4299727_-	hypothetical protein	NA	U5PUY0	Salmonella_phage	57.1	7.1e-19
WP_103216222.1|4299737_4300037_-	hypothetical protein	NA	A5VW99	Enterobacteria_phage	97.0	1.7e-30
WP_000856967.1|4300438_4301089_-	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	100.0	1.1e-122
WP_000276886.1|4301169_4301355_+	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_000251072.1|4301463_4301757_+	hypothetical protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
WP_001244621.1|4301779_4302052_+	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_103216241.1|4302114_4303002_+	replication protein	NA	A5VW95	Enterobacteria_phage	99.0	1.1e-144
WP_001543888.1|4302998_4304375_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.8	9.7e-254
WP_000736913.1|4304448_4304889_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_103216223.1|4304885_4305413_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	98.9	6.2e-100
WP_001254237.1|4305409_4305592_+	NinE family protein	NA	C6ZR57	Salmonella_phage	98.3	3.7e-28
WP_000566871.1|4305588_4305759_+	protein ninF	NA	K7PM86	Enterobacteria_phage	100.0	5.5e-26
WP_001003989.1|4305751_4306474_+	DNA-binding protein	NA	K7P6K2	Enterobacteria_phage	99.6	5.4e-131
WP_000002248.1|4306473_4306764_+	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	97.9	4.2e-50
WP_001008200.1|4306760_4307123_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	100.0	9.2e-63
WP_000994516.1|4307119_4307308_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001235459.1|4307304_4307928_+	antitermination protein	NA	K7P6X1	Enterobacteria_phage	100.0	3.0e-114
WP_000783734.1|4308361_4308685_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229392.1|4308668_4309145_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_097749753.1|4309141_4309579_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	95.9	3.6e-69
WP_097749754.1|4309566_4309719_+	hypothetical protein	NA	Q716B2	Shigella_phage	94.0	1.2e-19
WP_000999674.1|4309958_4310339_+	hypothetical protein	NA	Q716B1	Shigella_phage	99.2	1.4e-66
WP_000807788.1|4310442_4310685_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000729922.1|4310720_4311209_+	DNA-packaging protein gp3	NA	A0A0M3ULC0	Salmonella_phage	100.0	5.0e-88
WP_024238508.1|4311186_4312686_+|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	99.8	2.4e-306
WP_062810285.1|4312686_4314852_+|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	98.8	0.0e+00
WP_103216224.1|4314865_4315777_+	scaffolding protein	NA	A0A2D1GLN7	Escherichia_phage	99.3	1.1e-160
WP_103216225.1|4315776_4317075_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	95.6	3.4e-232
WP_103216226.1|4317119_4317512_+	hypothetical protein	NA	A0A2D1GLK1	Escherichia_phage	98.0	4.5e-23
WP_021514122.1|4317489_4317990_+	hypothetical protein	NA	G8EYJ2	Enterobacteria_phage	100.0	1.7e-91
WP_103216227.1|4317990_4319409_+	hypothetical protein	NA	A0A088CQ70	Enterobacteria_phage	98.7	4.3e-273
WP_103216228.1|4319408_4320110_+|tail	phage tail protein	tail	G5DA78	Enterobacteria_phage	97.4	4.3e-117
WP_103216229.1|4320109_4320565_+	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	99.3	5.2e-87
WP_000964872.1|4320567_4321260_+	DNA transfer protein	NA	A5VW66	Enterobacteria_phage	97.8	5.8e-114
WP_000257026.1|4321270_4322686_+	DNA transfer protein	NA	I6RSG0	Salmonella_phage	80.9	4.4e-201
WP_103216230.1|4322685_4324524_+	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	74.4	1.5e-246
WP_063610642.1|4324548_4324917_-	hypothetical protein	NA	I6S5X4	Salmonella_phage	99.2	1.7e-64
WP_000136767.1|4325094_4326063_+	hypothetical protein	NA	A9YX09	Burkholderia_phage	48.6	8.5e-71
WP_103216231.1|4326078_4326330_-	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	91.6	1.1e-35
WP_103216232.1|4326476_4328384_+	hypothetical protein	NA	A0A2P1CCP7	Klebsiella_phage	75.2	2.4e-242
WP_000343760.1|4328595_4329816_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_103216233.1|4329871_4330111_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	57.0	2.3e-17
WP_103216234.1|4330110_4330428_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.5	2.8e-23
WP_103216235.1|4330460_4331618_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.5	3.7e-222
4334872:4334888	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 7
NZ_CP026199	Escherichia coli strain ECONIH6 chromosome, complete genome	4869246	4674384	4685299	4869246		Enterobacteria_phage(22.22%)	10	NA	NA
WP_125922846.1|4674384_4675662_+	hypothetical protein	NA	A0A1V0E6Q2	Klebsiella_phage	24.5	1.1e-12
WP_099147824.1|4675697_4677026_+	flippase	NA	NA	NA	NA	NA
WP_099147860.1|4677105_4677498_+	serine acetyltransferase	NA	A0A191KBJ5	Streptococcus_virus	41.1	6.8e-11
WP_000043542.1|4677669_4679076_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_049139659.1|4679300_4680365_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	4.4e-105
WP_016161468.1|4680391_4681261_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	9.8e-111
WP_004206787.1|4681292_4682183_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.2	3.7e-28
WP_004206788.1|4682197_4682752_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.8	1.0e-52
WP_000704907.1|4682932_4684099_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_087523507.1|4684291_4685299_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
>prophage 1
NZ_CP026200	Escherichia coli strain ECONIH6 plasmid pECO-6dfa, complete sequence	97800	0	72564	97800	transposase,protease,integrase	Escherichia_phage(42.86%)	59	67563:67622	73583:74351
WP_001067855.1|2239_2944_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004201280.1|3190_3664_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001067855.1|4877_5582_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000844627.1|6518_6761_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000164043.1|6792_7443_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|7548_8748_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|8779_9664_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|9801_10194_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000969996.1|12790_13072_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_021546940.1|13068_13338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012600012.1|14727_14907_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	60.3	6.8e-11
WP_032156934.1|15130_15448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021546939.1|15555_16443_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_001021938.1|16452_17052_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_000645940.1|17048_17633_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_000687847.1|17651_21329_+	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_021546938.1|21345_23109_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_021546937.1|23124_26754_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_004011547.1|26753_29411_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_048659818.1|29472_31518_+|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_021546935.1|32193_33198_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|35075_35780_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_094653748.1|35791_36016_-	hypothetical protein	NA	Q71TM1	Escherichia_phage	96.7	1.0e-24
WP_000725192.1|36280_37246_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	100.0	3.3e-168
WP_000817632.1|37242_38448_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	100.0	2.0e-226
WP_021546926.1|38847_39708_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	99.7	1.4e-157
WP_000948429.1|40361_41561_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_048230572.1|41570_41759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085018615.1|41773_41986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103216243.1|42437_43403_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	43.0	3.3e-59
WP_013438824.1|43574_43751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001776120.1|43882_44314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048659789.1|44345_44873_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	39.5	2.8e-20
WP_000909125.1|44865_45612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033546593.1|45626_47534_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_001079960.1|48242_48635_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_023281073.1|48631_50833_-	type IA DNA topoisomerase	NA	NA	NA	NA	NA
WP_000212005.1|50829_51138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000610141.1|51113_51449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000683352.1|51475_51793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000979494.1|51883_52285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000342114.1|52271_53321_-	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
WP_000980841.1|53324_54521_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_001045307.1|54517_55411_-	P-type conjugative transfer protein VirB9	NA	NA	NA	NA	NA
WP_001293055.1|55403_56090_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_000014166.1|56299_57307_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_000769859.1|57324_57609_-	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_024132261.1|57620_58331_-	Minor pilin of type IV secretion complex (VirB5)	NA	NA	NA	NA	NA
WP_048659795.1|58355_61106_-	ATPase	NA	NA	NA	NA	NA
WP_000175462.1|61115_61415_-	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_000958205.1|61425_62088_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_001112907.1|62090_62306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000062770.1|62298_62607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000891983.1|62920_63835_+	response regulator	NA	NA	NA	NA	NA
WP_039267228.1|63838_64822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000238872.1|64814_65303_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_087760816.1|65299_67018_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	27.8	1.6e-27
67563:67622	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
WP_001067852.1|68931_69636_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
WP_000600827.1|71586_72564_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	34.9	1.1e-06
73583:74351	attR	GCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACCATCGTTGTGTACTTTATGGAGGATCGTTTGGTTGGCGATCAAAAAATCTATAATTTCTTGAATTCTTTCGCTACGAGCATTGGCTCTTAACAAAGTCAAAACGCTTACCATATGTTGCTGGCAGTATTTGTTGTCTAAATTCACTCGCACTTCATTAGAGTGCATTGCTATAACTGTATTGATAATGTTTTGATCGCCAAGCATGCCAAAAAACTGATCATACAAAGGTCGTCCCGCCGGAGAAACACCAGTATTATATGGTATTCCTTTACCAACACGACAAATCAAAACTGTTTTTATAAGCTTATGAACCCTCTCTAAAGGTATGTCATTTTCAGTCTTTAAATACGAAAGAATCTTCCGCATATGAGGGGGTTCATTATAAAAGTTATCCCAAGCATACCTAGCCTCTAAGAGATCGTCGGCATGGCCGTCCAGTGATATAATTCTAGAGTCTAATGATTGATAACGATTACCATCACAAAACGTAAAAAACTCAATACCTAAAGCATGTTTCTCGTTGTGAAGATTGTTCTTGTATCCGTCTAGCGTCACGCCGAGCTTGTATTTTACGTTATCACTGCTTTTATTCCAGATATGCGGAGCAAAAAGAGCGATATTTTTTCTGACAACATTTCCTGTTGAATCAGCTGTATATATGCCGAAAATACTATTGAGTAGATTGTCAGTATTCTGAAGCGACAGATCA	NA	NA	NA	NA
>prophage 1
NZ_CP026201	Escherichia coli strain ECONIH6 plasmid pNDM-d2e9, complete sequence	100989	29879	58217	100989	integrase,transposase	Escherichia_phage(35.71%)	30	38099:38158	58222:59023
WP_050576375.1|29879_32912_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.2	0.0e+00
WP_001067855.1|32902_33607_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013362816.1|33929_35462_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_013362817.1|35990_36440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100249774.1|36954_37065_-	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	88.6	1.9e-08
WP_013362818.1|37069_37807_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	6.3e-135
WP_013362819.1|37932_38028_-	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
38099:38158	attL	TGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
WP_001067855.1|38162_38867_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_089602696.1|38988_39903_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|39899_41138_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|41137_41722_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|42214_42979_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001235713.1|43257_43815_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|43997_44858_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_012372818.1|45027_45783_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_014342204.1|45863_46412_-	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_099147893.1|46432_46825_+	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	58.1	8.5e-22
WP_001067855.1|47018_47723_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_023408309.1|48281_49094_+	subclass B1 metallo-beta-lactamase NDM-5	NA	NA	NA	NA	NA
WP_004201167.1|49097_49463_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201168.1|49467_50106_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201169.1|50116_51148_-	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_000050481.1|51460_53002_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|53406_54246_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|54239_54587_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|54750_55542_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|55547_55838_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|55949_56447_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_060591625.1|56591_57479_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	42.2	9.2e-56
WP_001067855.1|57512_58217_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
58222:59023	attR	AGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCACTTCGACGACTACCTGCTGCCGGCCGAGAAGTTCGCCGCACTCAAGCGCGAGCAGGCCCTGCCCCTGGCGATCAACCCGAACAGCGACCAGTACCTGGAAGAGCGTTTGCAGCTGCTGGACGAGCAGTTGGCCACCGTCACCCGCCTGGCCAAGGACAACGAGCTGCCCGATGCCATCCTCACCGAGTCAGGGCTGAAAATCACCCCGCTGGATGCGGCGGTGCCGGATCGGGCGCAGGCGCTGATCGACCAAACCAGCCAGTTACTGCCGCGCATCAAGATCACCGAACTGCTGATGGACGTGGACGACTGGACGGGCTTCAGCCGCCACTTCACCCACTTGAAGGACGGGGCCGAGGCCAAAGACAGGACGTTGCTGCTGTCCGCAATCCTCGGTGATGCGATCAACCTCGGGCTGACCAAGATGGCCGAGTCGAGCCCCGGCCTGACCTACGCCAAGCTGTCCTGGCTGCAAGCCTGGCACATCCGCGACGAAACCTATTCGGCGGCCTTGGCCGAGCTGGTCAACCACCAGTATCGCCACGCCTTTGCCGCCCACTGGGGCGACGGCACGACCTCATCCTCCGATGGCCAGCGCTTCCGCGCGGGTGGCCGGGGCGAGAGCACCGGGCACGTCAACCCGAAGTACGGTAGCGAGCCGGGACGGCTGTTCTATACCCATATCTCCGACCAGTACGCGCCGTTCAGCACCCGCGTGGTGAATGTCGGCGTCCGCGATTCC	NA	NA	NA	NA
