The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026269	Klebsiella oxytoca strain KONIH4 chromosome, complete genome	6252643	121691	130327	6252643		Enterobacteria_phage(83.33%)	11	NA	NA
WP_077255288.1|121691_122285_-	hypothetical protein	NA	Q9JMN3	Wolbachia_phage	45.7	3.7e-37
WP_042946131.1|122409_122697_-	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_023321787.1|122823_123015_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_042946130.1|123031_123760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042946129.1|124499_126833_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	81.3	0.0e+00
WP_004185276.1|126847_127168_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004098168.1|127164_127392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071889462.1|127388_127940_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	74.1	1.0e-36
WP_042946128.1|128763_129501_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.2	1.5e-72
WP_004136116.1|129497_129743_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_042946127.1|129760_130327_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	3.3e-59
>prophage 2
NZ_CP026269	Klebsiella oxytoca strain KONIH4 chromosome, complete genome	6252643	1373854	1471989	6252643	head,tRNA,integrase,portal,capsid,terminase,plate,lysis,holin,tail,transposase	Escherichia_phage(30.91%)	106	1372062:1372078	1472278:1472294
1372062:1372078	attL	ACGCCGCAGGCTGGCGG	NA	NA	NA	NA
WP_000019441.1|1373854_1374835_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
1372062:1372078	attL	ACGCCGCAGGCTGGCGG	NA	NA	NA	NA
WP_103433512.1|1374880_1375087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032931761.1|1375676_1376783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016157240.1|1377239_1379219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032931759.1|1379215_1379722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042945865.1|1379718_1380927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042945864.1|1381398_1382343_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	43.4	8.0e-58
WP_016157235.1|1382665_1382902_+	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_016157234.1|1382904_1383219_+	CcdB family protein	NA	NA	NA	NA	NA
WP_016157233.1|1383215_1383968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042945862.1|1383976_1385713_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_016157231.1|1386489_1386795_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	37.8	4.6e-07
WP_016947617.1|1387221_1388202_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_016157229.1|1388392_1388791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016157228.1|1388787_1389813_-	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
WP_016157227.1|1389802_1391056_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_016157226.1|1391075_1391978_-	P-type conjugative transfer protein VirB9	NA	NA	NA	NA	NA
WP_016157225.1|1391977_1392661_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_016157223.1|1392883_1393948_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_016157222.1|1393958_1394186_-	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_016157221.1|1394197_1394902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016157220.1|1394922_1397667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032931998.1|1397677_1397971_-	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_016157218.1|1397970_1398681_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_016157217.1|1398751_1398985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016157216.1|1399379_1399589_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016157215.1|1399578_1400163_-	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_016157214.1|1400286_1400472_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	52.0	9.6e-08
WP_016157214.1|1400658_1400844_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	52.0	9.6e-08
WP_016157213.1|1400984_1401911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016157212.1|1402261_1405333_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_077255296.1|1405329_1406310_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_158650800.1|1406567_1407503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016947617.1|1407528_1408509_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_077255282.1|1408733_1410182_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_016157208.1|1410178_1410838_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_032931751.1|1411239_1412487_-|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	38.1	1.1e-67
WP_113706809.1|1412765_1413836_-	SAVED domain-containing protein	NA	NA	NA	NA	NA
WP_016157205.1|1413835_1414300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016157204.1|1414289_1416008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087855188.1|1417120_1418270_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.5	5.4e-48
1417661:1417677	attR	CCGCCAGCCTGCGGCGT	NA	NA	NA	NA
WP_016157202.1|1418823_1419426_-	hypothetical protein	NA	NA	NA	NA	NA
1417661:1417677	attR	CCGCCAGCCTGCGGCGT	NA	NA	NA	NA
WP_071889451.1|1419422_1419860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016157201.1|1420680_1421241_+	3'-5' exonuclease	NA	A0A2K9L1H6	Tupanvirus	28.0	1.0e-07
WP_103433602.1|1421249_1421750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077255295.1|1421815_1422856_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_103433603.1|1423519_1424701_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_103433604.1|1424807_1426187_-	SAVED domain-containing protein	NA	NA	NA	NA	NA
WP_103433514.1|1426678_1427789_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	29.7	5.4e-05
WP_016157194.1|1428314_1429556_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	46.3	2.9e-100
WP_004104655.1|1430243_1430726_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	1.8e-29
WP_029946935.1|1430836_1431313_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_014226445.1|1431302_1431593_+	RnfH family protein	NA	NA	NA	NA	NA
WP_004123807.1|1431659_1432001_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_014839242.1|1432148_1433810_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_004123797.1|1433896_1434775_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_004853330.1|1434900_1435491_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_014839241.1|1435555_1436845_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_004853326.1|1436863_1437655_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004123779.1|1437819_1439187_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_004123777.1|1439423_1439672_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_014226441.1|1439690_1440239_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_004104636.1|1440284_1441052_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004104634.1|1441091_1441439_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_019704610.1|1441589_1441808_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	84.7	1.0e-32
WP_042945854.1|1441884_1443042_-	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	80.9	2.9e-174
WP_019724795.1|1443041_1443521_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	77.7	1.4e-66
WP_042945852.1|1443532_1445971_-|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	83.1	8.4e-293
WP_015959005.1|1445963_1446101_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	91.1	2.2e-17
WP_004195711.1|1446115_1446391_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	77.3	2.4e-31
WP_014343412.1|1446450_1446966_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	3.2e-69
WP_042945849.1|1446979_1448161_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	86.1	3.9e-195
WP_042945847.1|1448270_1449431_-|tail	phage tail protein	tail	Q858V4	Yersinia_virus	49.3	6.0e-47
WP_042945845.1|1449484_1449739_-	hypothetical protein	NA	L0ARW5	Klebsiella_phage	50.6	1.0e-15
WP_049870923.1|1449741_1451847_-	hypothetical protein	NA	R9TMK5	Aeromonas_phage	40.2	5.9e-109
WP_042945842.1|1451852_1452449_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	51.3	3.9e-50
WP_042945841.1|1452441_1453350_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	72.2	8.9e-115
WP_042945839.1|1453354_1453702_-|plate	baseplate assembly protein	plate	Q7Y4D7	Escherichia_virus	76.5	5.4e-44
WP_042945838.1|1453698_1454334_-|plate	phage baseplate assembly protein V	plate	M1SV78	Escherichia_phage	84.4	4.5e-97
WP_042945836.1|1454402_1454852_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.7	1.4e-49
WP_042945835.1|1454844_1455312_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	73.5	1.0e-61
WP_019704240.1|1455407_1455839_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	65.5	2.4e-41
WP_042945833.1|1455835_1456333_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	87.3	7.9e-81
WP_009309693.1|1456319_1456610_-|holin	holin	holin	O80308	Escherichia_phage	84.7	9.1e-37
WP_042945832.1|1456614_1456818_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	79.1	2.8e-24
WP_042945830.1|1456817_1457324_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	84.6	2.9e-62
WP_042945828.1|1457419_1458178_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	64.9	2.1e-77
WP_042945826.1|1458181_1459342_-|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	63.0	2.8e-129
WP_042945825.1|1459373_1460237_-|capsid	GPO family capsid scaffolding protein	capsid	Q01088	Escherichia_phage	74.9	1.3e-118
WP_042945823.1|1460401_1462171_+|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	80.8	5.5e-286
WP_042945821.1|1462170_1463205_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	81.5	2.0e-163
WP_019704250.1|1463644_1463875_-	DinI-like family protein	NA	A0A218M4I0	Erwinia_phage	77.6	2.7e-28
WP_032419998.1|1463878_1464064_-	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	77.0	6.0e-18
WP_071889450.1|1464185_1466408_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	93.4	0.0e+00
WP_042945817.1|1466398_1466680_-	DUF3850 domain-containing protein	NA	A0A0P0I3U9	Klebsiella_phage	50.0	1.3e-11
WP_014343385.1|1466676_1466949_-	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	73.3	1.1e-31
WP_042945815.1|1466945_1467527_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	77.7	2.6e-83
WP_023317535.1|1467523_1467751_-	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	77.8	8.1e-25
WP_023317536.1|1467750_1467975_-	DUF2732 domain-containing protein	NA	A0A218M4I9	Erwinia_phage	71.9	4.4e-15
WP_049870922.1|1468040_1468328_-	hypothetical protein	NA	F1BUS4	Erwinia_phage	57.0	2.3e-24
WP_048335349.1|1468408_1468609_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	71.0	5.5e-17
WP_042945812.1|1468616_1469126_-	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	94.1	6.0e-84
WP_042945810.1|1469158_1469533_-	regulatory phage cox family protein	NA	A0A0M4R4X7	Salmonella_phage	75.0	1.1e-45
WP_042945809.1|1469654_1470500_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	65.2	1.4e-101
WP_042945807.1|1470507_1470912_+	hypothetical protein	NA	B9A7A8	Serratia_phage	40.2	1.3e-20
WP_040165600.1|1470939_1471989_+|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	92.8	3.1e-196
1472278:1472294	attR	CTGATTGTGGTGGCGCC	NA	NA	NA	NA
>prophage 3
NZ_CP026269	Klebsiella oxytoca strain KONIH4 chromosome, complete genome	6252643	1500865	1613992	6252643	protease,tRNA,integrase,portal,terminase,holin,tail,transposase	Enterobacterial_phage(16.13%)	113	1501124:1501142	1582924:1582942
WP_004123719.1|1500865_1501939_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
1501124:1501142	attL	GCGCCGGGCGATGAGGCGC	NA	NA	NA	NA
WP_038424783.1|1501989_1503318_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_014230405.1|1503433_1504123_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	51.2	4.6e-55
WP_004104596.1|1504433_1504817_+	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	69.9	3.1e-32
WP_042945804.1|1504861_1506193_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	1.1e-44
WP_014839225.1|1506325_1507066_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_042945802.1|1507050_1508670_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_004104583.1|1509094_1509670_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_004853279.1|1509702_1510353_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_004853278.1|1510352_1511309_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_014230402.1|1511305_1511785_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_004853275.1|1511970_1513770_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.3	6.5e-24
WP_014230401.1|1513785_1514760_+	signal peptidase I	NA	NA	NA	NA	NA
WP_004104573.1|1514986_1515667_+	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.5	2.8e-20
WP_004104571.1|1515663_1516569_+	GTPase Era	NA	NA	NA	NA	NA
WP_004853269.1|1516767_1517505_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_014230400.1|1517516_1518248_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_014230399.1|1518247_1518628_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_064388754.1|1518674_1518935_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	1.9e-17
WP_103433515.1|1519149_1520547_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_103433516.1|1520745_1521318_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	64.5	6.7e-68
WP_103433517.1|1521368_1521605_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	55.4	1.0e-14
WP_103433518.1|1521597_1522008_-	hypothetical protein	NA	C6ZR26	Salmonella_phage	56.9	3.4e-05
WP_103433605.1|1522004_1522223_-	hypothetical protein	NA	Q8HAA6	Salmonella_phage	63.8	1.6e-09
WP_103433519.1|1522688_1522877_-	diguanylate phosphodiesterase	NA	A0A192Y8X2	Salmonella_phage	88.7	6.3e-23
WP_103433520.1|1522876_1523251_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	93.3	5.6e-63
WP_103433521.1|1523251_1524007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103433522.1|1523999_1524308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102003680.1|1524304_1524433_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_064353124.1|1524626_1525487_-	hypothetical protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	57.9	6.8e-72
WP_103433523.1|1525567_1526380_-	DUF2303 family protein	NA	NA	NA	NA	NA
WP_004104278.1|1526421_1526781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103433524.1|1527119_1527479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103433525.1|1527905_1528559_-	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	59.4	2.2e-70
WP_074184689.1|1528654_1528852_+	hypothetical protein	NA	A0A1W6JP24	Morganella_phage	49.2	6.2e-13
WP_048985418.1|1528877_1529348_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	76.3	5.0e-61
WP_103433526.1|1529825_1530101_+	hypothetical protein	NA	A0A1P8VVT6	Streptococcus_phage	43.6	5.1e-05
WP_103433527.1|1530093_1531623_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	67.1	4.6e-204
WP_103433528.1|1531619_1532591_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	61.1	1.7e-108
WP_103433606.1|1532560_1533205_+	NinG family protein	NA	A0A1W6JNX3	Morganella_phage	55.7	2.3e-40
WP_103433529.1|1533201_1533846_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	66.4	7.8e-81
WP_103433530.1|1533835_1534240_+	antitermination protein	NA	S5M7R9	Escherichia_phage	51.6	4.7e-31
WP_103433531.1|1534419_1534611_+	TrmB family transcriptional regulator	NA	Q8SBE3	Shigella_phage	85.7	2.9e-23
WP_103433532.1|1534761_1535814_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	80.4	7.1e-172
WP_103433533.1|1535961_1536357_+	hypothetical protein	NA	G8C7V8	Escherichia_phage	72.3	3.2e-45
WP_103433534.1|1536343_1536625_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	73.1	1.7e-32
WP_103433535.1|1536624_1537254_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	75.8	7.6e-89
WP_103433536.1|1537256_1537532_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	96.4	1.6e-06
WP_103433538.1|1537753_1538053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103433539.1|1538123_1538363_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	89.2	3.7e-28
WP_103433540.1|1538680_1539172_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	84.7	2.9e-67
WP_103433541.1|1539171_1541280_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	82.4	0.0e+00
WP_103433542.1|1541276_1541492_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	78.6	3.4e-25
WP_103433543.1|1541488_1542988_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.0	1.8e-245
WP_103433544.1|1542932_1544945_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	83.8	0.0e+00
WP_103433607.1|1545026_1545353_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	70.1	5.1e-36
WP_103433545.1|1545345_1545639_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_103433546.1|1545628_1546180_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	68.7	3.7e-55
WP_103433547.1|1546176_1546575_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	58.6	3.2e-40
WP_103433548.1|1546582_1547065_+|tail	phage tail protein	tail	O64327	Escherichia_phage	66.9	4.1e-58
WP_103433549.1|1547107_1547506_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_103433550.1|1547526_1547844_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	53.4	8.4e-20
WP_103433551.1|1547824_1550521_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	58.2	4.6e-199
WP_103433552.1|1550520_1550994_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	57.8	1.8e-50
WP_103433553.1|1550980_1551463_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	63.9	2.6e-52
WP_103433554.1|1551470_1551851_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	50.0	3.2e-34
WP_103433608.1|1552351_1554901_+	kinase	NA	A0A286S259	Klebsiella_phage	67.2	0.0e+00
WP_103433555.1|1554977_1557110_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A286S1P0	Klebsiella_phage	36.9	2.6e-11
WP_103433556.1|1557266_1558667_+	hypothetical protein	NA	W6E8G0	Rhizobium_phage	30.3	4.3e-15
WP_142395351.1|1558767_1560135_-	hypothetical protein	NA	W6E8G0	Rhizobium_phage	33.5	1.3e-21
WP_103433558.1|1560297_1562286_-	right-handed parallel beta-helix repeat-containing protein	NA	A0A2H4YH15	Raoultella_phage	45.7	1.4e-06
WP_103433609.1|1562378_1562942_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	93.9	8.1e-90
WP_103433559.1|1562960_1563200_-	DinI family protein	NA	K7P6H1	Enterobacteria_phage	84.4	1.2e-29
WP_103433560.1|1563273_1563600_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.9	8.9e-25
WP_014230398.1|1563921_1564770_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004853258.1|1564979_1565615_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_071846082.1|1565634_1566180_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.8	4.5e-05
WP_014839219.1|1566176_1567793_-	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_032720558.1|1567967_1571855_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.0	1.0e-130
WP_103433610.1|1572417_1573854_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.0	5.9e-12
WP_038424778.1|1573867_1574572_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_042945800.1|1574558_1575896_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	33.1	3.0e-10
WP_002914032.1|1575961_1576300_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_032693157.1|1576358_1577549_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_009654385.1|1577874_1579128_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	3.3e-99
WP_025106587.1|1579183_1579606_-	DoxX family protein	NA	NA	NA	NA	NA
WP_014230381.1|1579679_1580876_-	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_038424776.1|1580988_1584264_+	DUF5107 domain-containing protein	NA	NA	NA	NA	NA
1582924:1582942	attR	GCGCCGGGCGATGAGGCGC	NA	NA	NA	NA
WP_038424775.1|1584334_1585771_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_038424773.1|1585770_1586607_+	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_004853228.1|1586684_1587818_+	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_032693153.1|1587814_1589092_-	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_014839209.1|1589216_1589855_+	DUF1007 family protein	NA	NA	NA	NA	NA
WP_038424772.1|1589845_1590826_+	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_004853221.1|1590880_1591684_-	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_014230373.1|1591804_1592545_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_004853217.1|1592782_1593274_+	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_004134936.1|1593450_1594665_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.6e-34
WP_002913991.1|1594691_1595078_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
WP_004104506.1|1595097_1595421_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.6e-21
WP_004104505.1|1595494_1596010_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_014230372.1|1596025_1597876_+	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.8	1.9e-103
WP_004104503.1|1597877_1598213_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_004104502.1|1598214_1598415_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_014230371.1|1598522_1599809_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	38.6	3.4e-35
WP_014230370.1|1599920_1600697_+	enhanced serine sensitivity protein SseB	NA	NA	NA	NA	NA
WP_014230369.1|1600736_1601582_-	3-mercaptopyruvate sulfurtransferase	NA	NA	NA	NA	NA
WP_038424770.1|1601706_1602891_-	amidohydrolase	NA	NA	NA	NA	NA
WP_014230367.1|1602926_1604138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042945798.1|1604538_1609485_+	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_042945797.1|1609485_1611810_+	peptidoglycan glycosyltransferase PbpC	NA	NA	NA	NA	NA
WP_004114414.1|1611980_1612412_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	38.6	1.7e-18
WP_004123586.1|1612825_1613992_+|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP026269	Klebsiella oxytoca strain KONIH4 chromosome, complete genome	6252643	1815240	1885778	6252643	holin,transposase,protease,integrase	Escherichia_phage(13.33%)	56	1810704:1810721	1843368:1843385
1810704:1810721	attL	CTGCTGGGCGGCGCGGTG	NA	NA	NA	NA
WP_014839116.1|1815240_1815792_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.6	2.1e-50
WP_014230249.1|1816217_1816754_+	fimbrial protein	NA	NA	NA	NA	NA
WP_032694826.1|1816816_1817479_+	molecular chaperone	NA	NA	NA	NA	NA
WP_042945745.1|1817509_1820059_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_014230246.1|1820078_1821119_+	fimbrial protein	NA	NA	NA	NA	NA
WP_014839112.1|1821131_1821641_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_014839111.1|1821674_1822205_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_014839110.1|1822251_1823172_-	ribonuclease Z	NA	NA	NA	NA	NA
WP_004852808.1|1823356_1823818_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_042945742.1|1823915_1825211_+	isochorismate synthase MenF	NA	NA	NA	NA	NA
WP_042945740.1|1825288_1826959_+	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_042945738.1|1826955_1827714_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_004123101.1|1827728_1828586_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_025106688.1|1828585_1829551_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_042945736.1|1829547_1830939_+	o-succinylbenzoate--CoA ligase	NA	NA	NA	NA	NA
WP_042945734.1|1830915_1831539_-	DUF2238 domain-containing protein	NA	NA	NA	NA	NA
WP_014230236.1|1831644_1833165_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_014230235.1|1833176_1833608_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_014230234.1|1833623_1834604_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_014230233.1|1834738_1835413_+	transcriptional regulator TctD	NA	NA	NA	NA	NA
WP_014230232.1|1835399_1836815_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_014230231.1|1836806_1837232_-	nucleoside triphosphatase NudI	NA	NA	NA	NA	NA
WP_014230229.1|1838351_1839800_-	catalase	NA	A0A2K9L0T1	Tupanvirus	46.7	6.9e-101
WP_004123076.1|1840069_1840612_+	membrane protein	NA	NA	NA	NA	NA
WP_014230228.1|1840708_1841905_+	nicotinamide mononucleotide deamidase-related protein YfaY	NA	NA	NA	NA	NA
WP_004852774.1|1842109_1842892_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042945732.1|1842905_1844111_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.0	6.7e-25
1843368:1843385	attR	CTGCTGGGCGGCGCGGTG	NA	NA	NA	NA
WP_004852770.1|1844163_1845453_+	MFS transporter	NA	NA	NA	NA	NA
WP_014839099.1|1845467_1846271_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_042945730.1|1846293_1847472_-	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_042945728.1|1847468_1848728_-	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_042945726.1|1848717_1850340_-	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_042946241.1|1850611_1851958_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_042945725.1|1851967_1853035_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	42.9	3.9e-08
WP_042945723.1|1853039_1853996_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038424725.1|1854040_1855585_-|holin	glucose-methanol-choline oxidoreductase	holin	A0A1V0SI18	Klosneuvirus	28.2	6.8e-38
WP_004104002.1|1855776_1856031_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	64.0	8.2e-26
WP_042945722.1|1856030_1857161_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	4.8e-174
WP_014839096.1|1857264_1859550_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.9	3.5e-285
WP_014230217.1|1859894_1860623_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_014839094.1|1860808_1863442_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.7	6.2e-92
WP_014230216.1|1863572_1866419_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.3	3.4e-43
WP_004103995.1|1866463_1867114_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_014230215.1|1867130_1869791_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_014230214.1|1870562_1871681_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.5	1.9e-119
WP_014230213.1|1871783_1872836_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_014230212.1|1872908_1873973_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	L7Y5F8	Megavirus	47.2	1.4e-18
WP_014230211.1|1873972_1874623_+	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
WP_014230210.1|1874699_1876343_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.6	1.2e-08
WP_014230209.1|1876511_1877948_+	magnesium transporter	NA	NA	NA	NA	NA
WP_042945720.1|1877910_1879158_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	44.6	7.3e-67
WP_014230207.1|1879437_1881072_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_014230206.1|1881116_1881608_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_009653963.1|1881810_1882917_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_001101446.1|1883489_1884515_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_042946240.1|1884854_1885778_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.9e-176
>prophage 5
NZ_CP026269	Klebsiella oxytoca strain KONIH4 chromosome, complete genome	6252643	2004237	2012631	6252643	tRNA	Planktothrix_phage(33.33%)	8	NA	NA
WP_014230106.1|2004237_2005101_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	3.9e-11
WP_014230105.1|2005111_2005885_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	7.8e-27
WP_032693715.1|2006301_2007102_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014230103.1|2007088_2007559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009654032.1|2007559_2008453_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.9	8.8e-14
WP_014230102.1|2008697_2010059_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	91.8	4.7e-200
WP_014230101.1|2010376_2011099_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	2.4e-30
WP_042945701.1|2011095_2012631_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	27.6	2.8e-28
>prophage 6
NZ_CP026269	Klebsiella oxytoca strain KONIH4 chromosome, complete genome	6252643	2226256	2247144	6252643	tail,head,integrase	Pectobacterium_phage(35.0%)	31	2224386:2224400	2246784:2246798
2224386:2224400	attL	TGCGGGCGCTGGCGA	NA	NA	NA	NA
WP_015365913.1|2226256_2227273_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	64.2	3.7e-125
WP_042945582.1|2227256_2227502_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	40.0	8.2e-07
WP_015365915.1|2227711_2227897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042945580.1|2227898_2228465_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	63.0	3.6e-53
WP_042945578.1|2228464_2230618_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.0	9.0e-97
WP_029602739.1|2230662_2230896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077255279.1|2231618_2232083_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	51.7	2.1e-35
WP_000364674.1|2232182_2232416_+	helix-turn-helix transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	44.4	2.9e-09
WP_015365920.1|2232478_2232925_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	51.4	1.7e-26
WP_015365921.1|2233008_2233167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049870931.1|2233184_2234129_+	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.5	1.9e-35
WP_042946234.1|2234137_2235532_+	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	46.7	2.4e-103
WP_042945568.1|2235570_2236239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015365925.1|2236242_2236476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042945565.1|2236621_2237227_+	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	84.7	2.0e-94
WP_042945563.1|2237312_2238086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042945561.1|2238087_2238426_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	81.1	1.5e-46
WP_042945558.1|2238608_2238800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042945557.1|2238868_2239465_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	71.7	3.6e-80
WP_071889446.1|2239454_2239778_+	DUF968 domain-containing protein	NA	A0A2H4FS95	Methylophilaceae_phage	52.9	3.7e-23
WP_042945555.1|2239765_2240122_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042945553.1|2240118_2240412_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	72.2	7.5e-31
WP_042945551.1|2240481_2240715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042945549.1|2240698_2240959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042945547.1|2240965_2241418_+	phage packaging protein	NA	A3EYX3	Salmonella_phage	67.2	1.9e-49
WP_042945545.1|2241502_2242897_+	hypothetical protein	NA	A0A0H5ARR1	Pseudomonas_phage	46.4	6.1e-46
WP_042945543.1|2242896_2244561_+|head,tail	phage head-tail adapter protein	head,tail	A0A221SAN2	Ralstonia_phage	39.3	6.9e-105
WP_042945542.1|2244563_2244887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042945540.1|2244873_2245626_+	hypothetical protein	NA	M1I7K2	Pelagibacter_phage	24.0	4.8e-05
WP_042945539.1|2245636_2246632_+	phage protein	NA	W6MW28	Pseudomonas_phage	59.9	1.0e-103
WP_042945537.1|2246670_2247144_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	39.2	2.3e-13
2246784:2246798	attR	TGCGGGCGCTGGCGA	NA	NA	NA	NA
>prophage 7
NZ_CP026269	Klebsiella oxytoca strain KONIH4 chromosome, complete genome	6252643	2302489	2359101	6252643	tRNA,transposase,protease,coat	Escherichia_phage(23.08%)	55	NA	NA
WP_016947617.1|2302489_2303470_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_103433565.1|2303661_2305455_+	tape measure protein	NA	G0YPL2	Erwinia_phage	56.2	1.4e-172
WP_000019441.1|2305495_2306476_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
WP_158650803.1|2306457_2306733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077255277.1|2307466_2307913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042945486.1|2307912_2308173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047037288.1|2308176_2308368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133255920.1|2308360_2308699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009652068.1|2309227_2309794_-	hydrolase	NA	NA	NA	NA	NA
WP_042945485.1|2310062_2311850_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_004852138.1|2311851_2312295_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_004122063.1|2312325_2313066_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_014229855.1|2313103_2313625_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
WP_004103390.1|2313706_2314318_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_004852130.1|2314326_2315337_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.6	8.1e-08
WP_042945483.1|2315545_2316331_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_042945481.1|2316330_2317083_-	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.0	2.3e-15
WP_004852123.1|2317161_2318106_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_032750396.1|2318121_2319444_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	36.8	1.2e-14
WP_014229850.1|2319561_2320548_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_014229849.1|2320575_2321292_-	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_014838826.1|2321355_2323041_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_032694924.1|2323103_2324051_-	AEC family transporter	NA	NA	NA	NA	NA
WP_014229846.1|2324466_2325801_+	2-hydroxycarboxylate transporter family protein	NA	A0A140XAH4	Dickeya_phage	62.9	1.2e-22
WP_014229845.1|2325865_2327308_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_004852107.1|2327433_2328303_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004122041.1|2328664_2330140_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	3.7e-78
WP_025106126.1|2330360_2332172_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_004103368.1|2332209_2332851_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_032694922.1|2332895_2334074_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_042945479.1|2334209_2334569_+	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_032750391.1|2334713_2335394_+	DUF533 domain-containing protein	NA	NA	NA	NA	NA
WP_042945478.1|2335527_2337588_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_014229839.1|2337594_2338254_-	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	32.8	2.6e-15
WP_004103351.1|2338332_2338563_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	58.8	1.3e-14
WP_014229838.1|2338698_2339073_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_014229837.1|2339077_2339947_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_024274400.1|2339960_2340302_+	YebY family protein	NA	NA	NA	NA	NA
WP_042945476.1|2340686_2341646_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_042945474.1|2341660_2343991_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_042945473.1|2343993_2344758_-	molecular chaperone	NA	NA	NA	NA	NA
WP_004852079.1|2344776_2345295_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_032694913.1|2345317_2345869_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_009651986.1|2346448_2346592_-	Ecr family regulatory small membrane protein	NA	NA	NA	NA	NA
WP_042945472.1|2346703_2347648_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_014229829.1|2347812_2348466_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	52.1	1.7e-59
WP_004122014.1|2348462_2348654_-	YebW family protein	NA	NA	NA	NA	NA
WP_004852069.1|2348751_2348991_-	YebV family protein	NA	NA	NA	NA	NA
WP_071889472.1|2349106_2350540_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_025106139.1|2350618_2353252_-	PqiB family protein	NA	NA	NA	NA	NA
WP_042945468.1|2353220_2354504_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_014229825.1|2354636_2355134_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_004852059.1|2355231_2355915_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_014229824.1|2355934_2357983_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.1	4.4e-85
WP_014229823.1|2358219_2359101_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 8
NZ_CP026269	Klebsiella oxytoca strain KONIH4 chromosome, complete genome	6252643	2389670	2456465	6252643	head,protease,tRNA,portal,integrase,capsid,terminase,plate,tail	Enterobacteria_phage(41.67%)	74	2398382:2398399	2419983:2420000
WP_004852009.1|2389670_2390366_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_004852007.1|2390409_2390994_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_014229806.1|2391202_2392888_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	4.2e-33
WP_009651987.1|2392957_2394085_+	ribonuclease D	NA	NA	NA	NA	NA
WP_002910902.1|2394149_2394419_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_004103267.1|2394422_2395235_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_004852000.1|2395258_2395957_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_004138522.1|2396083_2396365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004851997.1|2396382_2397042_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_004851995.1|2397136_2397583_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_004103255.1|2397591_2397936_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_014229804.1|2398052_2398583_-	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
2398382:2398399	attL	GCGATTTTGGCGCAATGG	NA	NA	NA	NA
WP_014838798.1|2398711_2400265_-	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
WP_014229802.1|2400510_2401230_+	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_004138526.1|2401290_2402823_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_014229801.1|2403144_2404443_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_014229800.1|2404455_2405526_+	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_042946225.1|2405661_2405853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042946224.1|2405953_2406328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071889443.1|2406344_2407340_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	47.1	1.6e-80
WP_042945462.1|2407404_2407704_-	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	56.2	1.0e-22
WP_032737939.1|2407785_2408052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049870930.1|2408081_2408294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042945461.1|2408306_2408546_+	DUF4754 family protein	NA	NA	NA	NA	NA
WP_042946221.1|2408548_2408821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042945459.1|2409115_2409694_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	40.0	1.9e-33
WP_042945458.1|2409704_2410658_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	56.6	3.7e-87
WP_042945456.1|2410657_2410927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158413321.1|2410926_2411082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042945455.1|2411057_2412074_+	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	54.9	7.2e-97
WP_042945453.1|2412066_2414676_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	52.2	4.3e-194
WP_042946219.1|2415002_2415209_+	hypothetical protein	NA	I7LEF4	Yersinia_phage	56.9	1.9e-12
WP_042945449.1|2415310_2416006_+	DNA methylase	NA	A0A0M4S5U3	Salmonella_phage	71.1	1.0e-89
WP_042945448.1|2416124_2416478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042945446.1|2416877_2417930_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.1	5.5e-140
WP_042945445.1|2417929_2419651_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	66.0	6.2e-226
WP_042945443.1|2419810_2420644_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	64.1	5.5e-95
2419983:2420000	attR	GCGATTTTGGCGCAATGG	NA	NA	NA	NA
WP_042945442.1|2420668_2421718_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	54.5	5.1e-106
WP_042945440.1|2421765_2422686_+|terminase	terminase	terminase	B9A7B6	Serratia_phage	74.7	2.7e-87
WP_042945438.1|2422788_2423286_+|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	70.9	3.4e-60
WP_042945437.1|2423285_2423486_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	66.2	1.8e-15
WP_019724763.1|2423476_2423758_+	hypothetical protein	NA	B9A7B8	Serratia_phage	58.4	7.5e-20
WP_042945435.1|2423754_2424306_+	lysozyme	NA	A0A0H4TH14	Yersinia_phage	43.8	4.9e-31
WP_071889442.1|2424546_2424846_+	peptidase	NA	NA	NA	NA	NA
WP_042945432.1|2424842_2425304_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	47.7	1.5e-33
WP_042945431.1|2425300_2425942_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	48.3	7.6e-44
WP_042945429.1|2425941_2426526_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	62.4	1.9e-62
WP_042945427.1|2426522_2426888_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	59.1	6.1e-30
WP_042945426.1|2426874_2427774_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	59.2	8.4e-89
WP_042945425.1|2427766_2428363_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	50.9	5.1e-42
WP_042945423.1|2428340_2430464_+	hypothetical protein	NA	A0A0H3YEH5	Pectobacterium_phage	34.4	9.8e-80
WP_042945420.1|2430475_2430730_+	hypothetical protein	NA	K4MPX1	Escherichia_phage	36.1	1.5e-06
WP_042945418.1|2430795_2431956_+|tail	phage tail protein	tail	S4TP62	Salmonella_phage	47.7	1.3e-41
WP_042945416.1|2432053_2432542_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	61.7	1.8e-53
WP_042945414.1|2432556_2435502_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	44.2	1.9e-206
WP_071814200.1|2435482_2435659_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	66.7	5.2e-11
WP_042945412.1|2435655_2435955_-	hypothetical protein	NA	B9A7B2	Serratia_phage	76.8	1.6e-33
WP_042945411.1|2436009_2436525_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	68.2	6.9e-64
WP_042945409.1|2436524_2437706_-|tail	tail protein	tail	A0A0A7NV69	Enterobacteria_phage	69.3	5.2e-155
WP_042945408.1|2437859_2439014_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	82.2	9.1e-181
WP_042945406.1|2439058_2439307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042945404.1|2439353_2439740_-	hypothetical protein	NA	B9A7A8	Serratia_phage	54.1	3.6e-33
WP_004851981.1|2439864_2441598_-	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_014229799.1|2441690_2442605_-	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_009651970.1|2442700_2443312_+	membrane-bound lytic murein transglycosylase EmtA	NA	A0A0H3V0Q1	Geobacillus_virus	40.7	3.0e-05
WP_042945402.1|2443416_2445165_-	alpha,alpha-trehalase	NA	NA	NA	NA	NA
WP_042945401.1|2445683_2447042_+	MFS transporter	NA	NA	NA	NA	NA
WP_014229796.1|2447144_2448536_+	glycoporin	NA	NA	NA	NA	NA
WP_042945400.1|2448619_2451400_+	beta-glucosidase	NA	NA	NA	NA	NA
WP_042945399.1|2451421_2452312_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014229793.1|2452519_2453959_+	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_004103215.1|2453952_2454882_+	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_014229792.1|2454878_2455694_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_014229791.1|2455712_2456465_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
>prophage 9
NZ_CP026269	Klebsiella oxytoca strain KONIH4 chromosome, complete genome	6252643	2662376	2700513	6252643	transposase,plate	uncultured_Caudovirales_phage(25.0%)	31	NA	NA
WP_042945325.1|2662376_2663717_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_032693533.1|2663713_2664403_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_032693534.1|2664399_2666109_+	OmpA family protein	NA	NA	NA	NA	NA
WP_014839086.1|2666114_2666606_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_032695050.1|2666892_2667258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042945322.1|2667254_2669597_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.1	3.9e-05
WP_042945320.1|2669596_2670469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042945318.1|2670493_2673631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038424617.1|2673642_2674449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042945317.1|2674482_2675292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042934107.1|2675325_2676126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032719381.1|2676159_2676960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032719392.1|2676993_2677803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077255273.1|2677838_2679113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042945314.1|2679109_2682580_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_071881737.1|2683069_2683348_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_032692932.1|2683447_2685202_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_014229647.1|2685165_2686251_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_032692931.1|2686228_2686774_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_042945312.1|2687277_2688366_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_025105882.1|2688437_2690207_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_032692928.1|2690199_2691270_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	9.8e-28
WP_014838693.1|2691326_2692097_-	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_014838692.1|2692120_2693800_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_004851637.1|2693810_2694590_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_014229640.1|2694696_2695569_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.3e-05
WP_004136705.1|2695597_2695810_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_032719374.1|2696573_2696744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001101446.1|2696880_2697906_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_032624899.1|2698224_2699148_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	9.6e-173
WP_001101446.1|2699487_2700513_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP026269	Klebsiella oxytoca strain KONIH4 chromosome, complete genome	6252643	3352796	3444781	6252643	protease,tRNA,plate,holin,tail,transposase	Enterobacteria_phage(17.24%)	79	NA	NA
WP_001553819.1|3352796_3355694_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_000509966.1|3355788_3356394_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	31.2	8.6e-13
WP_103433575.1|3356395_3357334_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_014838317.1|3357334_3357658_-	YdbL family protein	NA	NA	NA	NA	NA
WP_042945053.1|3357665_3357851_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_042945052.1|3357850_3360490_-	YdbH family protein	NA	NA	NA	NA	NA
WP_042945051.1|3360685_3361183_+	DedA family protein	NA	NA	NA	NA	NA
WP_004112629.1|3361332_3362322_+	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.7	1.9e-70
WP_014229134.1|3362447_3362888_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_004101621.1|3362884_3363157_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_042946201.1|3363442_3370141_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	84.0	2.0e-142
WP_038424422.1|3370203_3370818_-|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	70.1	5.5e-68
WP_038423189.1|3370985_3371720_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	83.6	5.3e-126
WP_014229131.1|3371721_3372474_-|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	76.7	2.5e-115
WP_014229130.1|3372470_3372818_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	60.9	5.4e-36
WP_014229129.1|3372840_3373950_-|tail	phage tail tape measure protein	tail	I6PCW3	Cronobacter_phage	48.5	5.9e-52
WP_071881731.1|3374034_3374280_-	hypothetical protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	41.2	6.1e-10
WP_014229128.1|3374342_3374654_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	62.1	1.5e-32
WP_014229127.1|3374726_3375389_-|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	65.0	7.0e-77
WP_004850340.1|3375508_3375928_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	51.5	9.4e-35
WP_032720807.1|3375983_3376526_-	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	66.7	6.8e-70
WP_071889438.1|3376533_3376806_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	54.2	7.0e-15
WP_009653048.1|3376795_3377188_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	66.2	1.3e-38
WP_032693411.1|3377264_3377627_-	hypothetical protein	NA	C6ZR44	Salmonella_phage	58.3	5.4e-31
WP_009653037.1|3378088_3378625_-	helix-turn-helix transcriptional regulator	NA	K7PKK1	Enterobacteria_phage	49.7	5.2e-30
WP_025107972.1|3379259_3382787_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_042945049.1|3383144_3384251_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.1	4.2e-106
WP_004850325.1|3384404_3384617_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_004101601.1|3384699_3385134_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	51.4	7.2e-30
WP_014229121.1|3385322_3385613_+	hypothetical protein	NA	C6ZCX3	Enterobacteria_phage	66.0	9.7e-31
WP_042934342.1|3386016_3386955_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_014838310.1|3387766_3388702_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.4	7.0e-139
WP_014229118.1|3388746_3390120_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	6.8e-50
WP_004850311.1|3390603_3391587_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_032693675.1|3391929_3392550_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_014229116.1|3393166_3393910_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.6	1.1e-14
WP_032693679.1|3393926_3394994_+	oxidoreductase	NA	NA	NA	NA	NA
WP_014229114.1|3395066_3396332_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	66.4	1.0e-156
WP_042945047.1|3396331_3396754_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	50.4	4.4e-32
WP_014229113.1|3397041_3397236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004850297.1|3397392_3397584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042945045.1|3397761_3398076_+	PTS cellobiose transporter subunit IIB	NA	NA	NA	NA	NA
WP_014229112.1|3398130_3398694_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_042945044.1|3398890_3399472_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_014838304.1|3399597_3400227_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071532263.1|3400596_3400785_-	cold-shock protein	NA	NA	NA	NA	NA
WP_042945042.1|3401623_3402649_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014229107.1|3402843_3403674_+	oxidoreductase	NA	NA	NA	NA	NA
WP_014229106.1|3403718_3404699_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_042945040.1|3404857_3405754_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014229104.1|3405854_3406739_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071889103.1|3406910_3408047_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032693667.1|3408255_3409377_+	MFS transporter	NA	NA	NA	NA	NA
WP_042946200.1|3409474_3409819_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_032693666.1|3409919_3410645_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	46.4	3.5e-45
WP_042945038.1|3410887_3411322_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_004850270.1|3411318_3412038_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_042945035.1|3412034_3413294_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014229096.1|3413295_3414018_+	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_014838292.1|3414014_3415238_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_042945033.1|3415234_3415768_+	DUF3833 domain-containing protein	NA	NA	NA	NA	NA
WP_014229093.1|3415782_3416742_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_042945031.1|3416805_3418188_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_032720920.1|3419068_3420523_+	MFS transporter	NA	NA	NA	NA	NA
WP_042945029.1|3420577_3422257_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_032720917.1|3422419_3423754_-	membrane protein	NA	NA	NA	NA	NA
WP_014838282.1|3423777_3424233_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_042945027.1|3424234_3424774_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_032694508.1|3424751_3425837_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_042945026.1|3425800_3427561_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_065365967.1|3427781_3431015_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_032694505.1|3431156_3432590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014229081.1|3432589_3432850_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_038424390.1|3432851_3434819_-	membrane protein	NA	A0A077K801	Ralstonia_phage	32.4	5.0e-62
WP_042945025.1|3437564_3440207_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.5	1.1e-96
WP_014229074.1|3440454_3440946_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_038424383.1|3441090_3442779_-	OmpA family protein	NA	NA	NA	NA	NA
WP_014229072.1|3442775_3443441_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_038424382.1|3443437_3444781_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 11
NZ_CP026269	Klebsiella oxytoca strain KONIH4 chromosome, complete genome	6252643	3447900	3491295	6252643	head,portal,integrase,capsid,terminase,plate,holin,tail	Klebsiella_phage(28.57%)	59	3440148:3440163	3490945:3490960
3440148:3440163	attL	TTCCATCGCACGGGCG	NA	NA	NA	NA
WP_019705237.1|3447900_3448149_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.0e-25
WP_042945021.1|3448543_3448966_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	1.9e-27
WP_042945018.1|3449163_3449481_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	62.5	4.0e-30
WP_042945016.1|3449482_3449722_-	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.7	7.5e-21
WP_042945014.1|3449828_3451229_-	hypothetical protein	NA	W6E8G0	Rhizobium_phage	30.5	4.0e-13
WP_042945012.1|3451231_3453388_-	right-handed parallel beta-helix repeat-containing protein	NA	A0A248XD04	Klebsiella_phage	63.8	6.4e-10
WP_049870915.1|3453521_3454193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071889437.1|3454232_3454901_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_042945010.1|3454897_3456046_-|plate	baseplate J/gp47 family protein	plate	R9TN81	Rhizobium_phage	25.5	1.4e-19
WP_042945008.1|3456035_3456485_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	45.1	1.7e-18
WP_103433618.1|3456481_3457021_-|plate	baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	37.8	1.4e-11
WP_042945004.1|3457056_3458133_-|tail	tail protein	tail	Q8SBG7	Shigella_phage	31.3	1.4e-37
WP_042945002.1|3458129_3459530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042945000.1|3459598_3459988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042944998.1|3460060_3461830_-	transglycosylase SLT domain-containing protein	NA	I6ZXX9	Escherichia_phage	48.5	2.5e-28
WP_042944996.1|3461974_3462253_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_042944995.1|3462256_3462625_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_042944993.1|3462628_3464146_-|tail	tail protein	tail	B5TK67	Pseudomonas_phage	43.8	1.7e-105
WP_042944991.1|3464146_3464326_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_042944989.1|3464329_3464875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042944987.1|3464871_3465231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042944986.1|3465236_3465605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042944984.1|3465606_3466656_-|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	33.7	2.1e-51
WP_042944983.1|3466753_3467158_-|head	head decoration protein	head	NA	NA	NA	NA
WP_042944982.1|3467157_3467736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042944980.1|3467737_3468607_-	S49 family peptidase	NA	K4I1N3	Providencia_phage	39.4	4.6e-52
WP_042944979.1|3468603_3470241_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.8	1.4e-89
WP_032735077.1|3470240_3470504_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_042944976.1|3470512_3472636_-|terminase	terminase	terminase	A0A0C5ABH4	Bacteriophage	34.4	4.4e-96
WP_042944975.1|3472577_3473141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047934963.1|3473457_3473964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042944973.1|3473995_3474634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014837906.1|3475836_3476112_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	35.6	3.0e-05
WP_042944971.1|3476108_3476453_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	84.2	2.9e-42
WP_042944969.1|3476449_3476992_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	77.0	1.7e-76
WP_142395353.1|3476988_3477288_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	98.0	3.2e-45
WP_158414542.1|3477732_3477909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042944967.1|3477907_3478405_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	50.3	4.7e-33
WP_042944965.1|3478693_3479509_-	molecular chaperone	NA	A0A286N2Q2	Klebsiella_phage	75.3	2.3e-109
WP_042944964.1|3479505_3479814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042944963.1|3479815_3481687_-	AAA family ATPase	NA	I6S1U6	Salmonella_phage	59.7	1.3e-224
WP_042944962.1|3481790_3482708_-	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	47.1	1.9e-35
WP_042946196.1|3482704_3482902_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_071889436.1|3482903_3483137_-	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	63.9	9.9e-18
WP_077253337.1|3483282_3483957_+	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	79.5	3.9e-99
WP_032692699.1|3484119_3484533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049077790.1|3484712_3484922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049077787.1|3484962_3485250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042944958.1|3485242_3485455_+	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	73.4	5.6e-20
WP_123829261.1|3485426_3485645_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	93.1	1.2e-30
WP_042944955.1|3485641_3486073_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	92.1	4.6e-69
WP_042946195.1|3486116_3486644_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	83.6	1.6e-76
WP_025714669.1|3486649_3487357_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	86.3	3.8e-105
WP_077255270.1|3487346_3487784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025714667.1|3487767_3487992_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	55.4	2.8e-17
WP_025714666.1|3488145_3488337_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	78.7	2.3e-20
WP_025714665.1|3488317_3489499_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.4	2.0e-199
WP_042944954.1|3489688_3490240_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_014229066.1|3490518_3491295_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.4	3.9e-34
3490945:3490960	attR	TTCCATCGCACGGGCG	NA	NA	NA	NA
>prophage 12
NZ_CP026269	Klebsiella oxytoca strain KONIH4 chromosome, complete genome	6252643	3936525	3979225	6252643	transposase,protease	Bacillus_phage(40.0%)	28	NA	NA
WP_004100829.1|3936525_3937185_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	53.9	3.8e-46
WP_004849563.1|3937273_3937603_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_004849561.1|3937599_3937881_-	acylphosphatase	NA	NA	NA	NA	NA
WP_014837988.1|3937931_3938720_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014228676.1|3938736_3939291_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_009651924.1|3939482_3940685_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_009651933.1|3940745_3941063_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_042944826.1|3941521_3942223_+	cyclic nucleotide-binding protein	NA	NA	NA	NA	NA
WP_042944824.1|3942236_3943175_-	peptidase	NA	NA	NA	NA	NA
WP_042944822.1|3943217_3946361_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016947617.1|3946655_3947636_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_014228672.1|3947758_3948964_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004849540.1|3948960_3951108_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	25.1	1.6e-24
WP_042944820.1|3951104_3952541_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_049870912.1|3952708_3963472_-	BapA prefix-like domain-containing protein	NA	NA	NA	NA	NA
WP_014228669.1|3964074_3964488_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_014228668.1|3964642_3965101_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_042944818.1|3965129_3967184_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	26.9	2.3e-17
WP_004849527.1|3967306_3967753_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_042944816.1|3967770_3969906_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_014228665.1|3969893_3970517_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_001101446.1|3970852_3971878_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001118621.1|3972196_3973120_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	100.0	8.4e-177
WP_001101446.1|3973459_3974485_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_014228664.1|3974793_3975303_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_004849520.1|3975656_3976727_+	porin OmpA	NA	NA	NA	NA	NA
WP_014228663.1|3976829_3977282_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_042944815.1|3977467_3979225_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
>prophage 13
NZ_CP026269	Klebsiella oxytoca strain KONIH4 chromosome, complete genome	6252643	4103193	4158504	6252643	protease,portal,terminase,tail,transposase	Klebsiella_phage(17.95%)	63	NA	NA
WP_038424262.1|4103193_4103679_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	2.3e-61
WP_025108027.1|4105349_4105745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038424952.1|4105747_4106674_-	AAA family ATPase	NA	E9LUK9	Lactobacillus_phage	28.5	7.9e-18
WP_077255293.1|4107238_4107658_+	bacteriophage CI repressor	NA	A0A1S6KZZ7	Salmonella_phage	46.9	6.1e-26
WP_016947617.1|4107698_4108679_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_025108030.1|4110098_4110680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014228592.1|4110849_4111392_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014228591.1|4111574_4112777_+	MFS transporter	NA	NA	NA	NA	NA
WP_042944796.1|4112776_4113592_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_042944794.1|4113639_4114875_-	MFS transporter	NA	NA	NA	NA	NA
WP_004849347.1|4115193_4115787_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_004849345.1|4115912_4116671_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	27.2	2.0e-11
WP_038423245.1|4116702_4117905_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	46.7	2.7e-95
WP_042944791.1|4118762_4120016_+|tail	phage tail fiber protein	tail	A0A1J0MHZ5	Klebsiella_phage	44.4	1.9e-86
WP_042944789.1|4120016_4121222_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_042944787.1|4121586_4123020_-	hypothetical protein	NA	A0A1D8KLY0	Synechococcus_phage	30.3	9.4e-18
WP_158650804.1|4123022_4123193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042944786.1|4123189_4125202_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	71.6	3.7e-52
WP_042944783.1|4125279_4128345_-	kinase	NA	A0A286S259	Klebsiella_phage	69.5	0.0e+00
WP_042944781.1|4128341_4128722_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	50.8	1.1e-34
WP_014228581.1|4128729_4129212_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.2	3.6e-54
WP_071889430.1|4129198_4129672_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	57.8	7.6e-49
WP_042944778.1|4129671_4132368_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	59.0	8.9e-195
WP_042944776.1|4132348_4132666_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	51.5	5.5e-19
WP_042944775.1|4132686_4133085_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_074187854.1|4133127_4133610_-|tail	phage tail protein	tail	O64327	Escherichia_phage	68.2	1.8e-58
WP_042944774.1|4133617_4134016_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	60.2	8.3e-41
WP_042944772.1|4134012_4134564_-|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	66.0	4.5e-53
WP_042944770.1|4134553_4134847_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_042944768.1|4134839_4135166_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	66.4	1.8e-33
WP_042944767.1|4135247_4137263_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	83.9	0.0e+00
WP_042944766.1|4137207_4138707_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.6	1.1e-247
WP_042944764.1|4138703_4138919_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	78.6	4.5e-25
WP_042944762.1|4138915_4141024_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	82.8	0.0e+00
WP_042944760.1|4141023_4141515_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	85.3	7.6e-68
WP_077255292.1|4141872_4142133_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_016947617.1|4142875_4143856_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_032694881.1|4144861_4145470_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	60.2	9.0e-71
WP_042944756.1|4145466_4145607_-	YlcG family protein	NA	NA	NA	NA	NA
WP_042944755.1|4145603_4146245_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	76.1	1.8e-85
WP_042944750.1|4146519_4146825_-	DUF968 domain-containing protein	NA	A0A2I7R8F9	Vibrio_phage	56.5	2.1e-23
WP_042944747.1|4147346_4147664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042944744.1|4147844_4148042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042944742.1|4148034_4148520_-	hypothetical protein	NA	C6ZR26	Salmonella_phage	51.1	1.9e-10
WP_048257891.1|4148516_4149131_-	hypothetical protein	NA	Q8HAA6	Salmonella_phage	66.0	3.4e-09
WP_042944739.1|4149127_4149508_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	92.6	3.7e-62
WP_004849245.1|4149966_4150176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004849243.1|4150172_4150376_-	hypothetical protein	NA	A0A2P1JU43	Erwinia_phage	50.0	3.6e-08
WP_004849240.1|4150369_4150831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042944737.1|4150827_4151613_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.9	1.2e-62
WP_042944735.1|4151605_4151818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042944734.1|4151814_4152108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042944732.1|4152120_4153197_-	hypothetical protein	NA	U5P0A0	Shigella_phage	36.2	9.5e-23
WP_042944730.1|4153462_4153876_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	69.8	3.2e-43
WP_042944728.1|4153934_4154147_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042944726.1|4154255_4154852_+	helix-turn-helix transcriptional regulator	NA	K7P850	Enterobacteria_phage	27.1	3.7e-08
WP_042944725.1|4155190_4155514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142395356.1|4155484_4155934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042944723.1|4156251_4156545_+	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_123828190.1|4156610_4156844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042944716.1|4156886_4157111_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	59.5	1.4e-16
WP_042944714.1|4157107_4157803_+	hypothetical protein	NA	R9VWB9	Serratia_phage	59.5	4.2e-72
WP_042944712.1|4157799_4158504_+	hypothetical protein	NA	A0A1W6JP46	Morganella_phage	32.6	3.0e-25
>prophage 14
NZ_CP026269	Klebsiella oxytoca strain KONIH4 chromosome, complete genome	6252643	4244826	4284157	6252643	head,integrase,terminase,plate,tail,transposase	Pseudomonas_phage(40.0%)	50	4274071:4274084	4284163:4284176
WP_103433578.1|4244826_4246227_-	hypothetical protein	NA	W6E8G0	Rhizobium_phage	30.5	1.4e-13
WP_047935338.1|4248348_4248975_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	41.2	4.1e-34
WP_047935337.1|4248974_4249718_-|tail	tail fiber protein	tail	A0A060BN58	Escherichia_phage	57.1	6.2e-21
WP_047935335.1|4249729_4250386_-	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	39.3	3.1e-32
WP_047935334.1|4250382_4251444_-|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	50.1	1.1e-79
WP_047935333.1|4251443_4251800_-	phage GP46 family protein	NA	A0A0M3LQK5	Mannheimia_phage	55.1	3.0e-26
WP_047935332.1|4251865_4252447_-|plate	phage baseplate assembly protein	plate	F6MIL4	Haemophilus_phage	51.2	1.7e-34
WP_047935331.1|4252430_4253675_-|tail	tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	34.9	7.0e-70
WP_047935328.1|4253658_4254972_-	multidrug DMT transporter permease	NA	A0A0M3LQ21	Mannheimia_phage	21.8	1.6e-24
WP_047935327.1|4254971_4257194_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	36.5	2.8e-77
WP_047935345.1|4257313_4257556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047935326.1|4257717_4258092_-	hypothetical protein	NA	A0A0M3LRV6	Mannheimia_phage	52.5	8.4e-27
WP_047935324.1|4258103_4259522_-|tail	tail sheath protein	tail	B7SDP8	Haemophilus_phage	44.8	3.2e-87
WP_047935322.1|4259521_4259719_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_047935321.1|4259708_4260359_-	DUF1834 family protein	NA	NA	NA	NA	NA
WP_047935319.1|4260355_4260784_-	DUF1320 domain-containing protein	NA	NA	NA	NA	NA
WP_047935317.1|4260796_4261249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047935315.1|4261249_4262158_-|head	head protein	head	H1ZZF0	Pseudomonas_virus	56.3	6.4e-97
WP_047935313.1|4262169_4262565_-	hypothetical protein	NA	J9RWG0	Pseudomonas_phage	50.8	1.8e-24
WP_047935312.1|4262557_4263643_-	mu-like prophage I family protein	NA	A0A0M5N0Q6	Ralstonia_phage	39.9	4.6e-49
WP_047935311.1|4263877_4264423_-	phage virion morphogenesis protein	NA	A0A2D1GNX5	Pseudomonas_phage	31.5	1.0e-09
WP_047935309.1|4264412_4265684_-	hypothetical protein	NA	H6V8N8	Pseudomonas_phage	36.0	1.2e-51
WP_047935308.1|4265676_4267245_-	DUF935 domain-containing protein	NA	A0A1C6ZDK1	Pseudomonas_phage	46.3	1.3e-124
WP_047935307.1|4267244_4268945_-|terminase	phage terminase large subunit	terminase	H6V8N6	Pseudomonas_phage	64.7	6.7e-196
WP_047935305.1|4268947_4269277_-	hypothetical protein	NA	G8GWD9	Rhodobacter_phage	65.6	3.8e-31
WP_047935304.1|4269280_4269484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047935302.1|4269524_4270013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023158168.1|4270057_4270558_-	DUF1804 family protein	NA	A0A0A1IX73	Pseudomonas_phage	53.6	2.8e-46
WP_047935299.1|4270559_4270874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047935298.1|4270870_4271116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047935296.1|4271112_4271748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047935294.1|4271737_4271986_-	DUF2644 domain-containing protein	NA	NA	NA	NA	NA
WP_047935293.1|4271967_4272621_-	glycoside hydrolase family 19 protein	NA	A0A2D1GNI0	Pseudomonas_phage	57.1	1.3e-59
WP_047935291.1|4272701_4273229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047935289.1|4273244_4273679_-	hypothetical protein	NA	A0A2D1GNW5	Pseudomonas_phage	45.6	3.4e-27
WP_047935288.1|4273623_4274100_-	regulatory protein GemA	NA	A0A2D1GNN4	Pseudomonas_phage	63.7	8.2e-43
4274071:4274084	attL	GATAAGGCCGCGTT	NA	NA	NA	NA
WP_047935286.1|4274160_4274376_-	hypothetical protein	NA	A0A2D1GNS9	Pseudomonas_phage	63.4	1.3e-19
WP_047935283.1|4274996_4275674_-	hypothetical protein	NA	A0A076G7C3	Sinorhizobium_phage	36.3	3.6e-28
WP_047935281.1|4275822_4276362_-	hypothetical protein	NA	A0A2D1GNL9	Pseudomonas_phage	69.8	2.9e-60
WP_047935279.1|4276358_4276583_-	hypothetical protein	NA	A0A2D1GNI2	Pseudomonas_phage	52.8	9.8e-15
WP_047935277.1|4276756_4277128_-	hypothetical protein	NA	A0A1X9SG60	Bacillus_phage	48.3	2.1e-22
WP_047935273.1|4277390_4278029_-	DUF3164 family protein	NA	Q6QIE4	Burkholderia_phage	60.1	1.3e-67
WP_047935272.1|4278021_4278213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047935271.1|4278214_4278448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047935269.1|4278466_4278685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047935267.1|4278693_4279587_-	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	59.8	3.0e-99
WP_047935265.1|4279597_4281649_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	48.8	5.2e-171
WP_072049705.1|4281672_4281936_-	Nlp family transcriptional regulator	NA	A0A2P9JZG5	Alteromonadaceae_phage	62.7	1.2e-24
WP_047935264.1|4282113_4282848_+	helix-turn-helix transcriptional regulator	NA	A5X9F5	Aeromonas_virus	38.5	4.2e-30
WP_042944674.1|4283251_4284157_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	27.7	4.1e-27
4284163:4284176	attR	AACGCGGCCTTATC	NA	NA	NA	NA
>prophage 15
NZ_CP026269	Klebsiella oxytoca strain KONIH4 chromosome, complete genome	6252643	5817521	5848989	6252643	transposase	Escherichia_phage(16.67%)	24	NA	NA
WP_016947617.1|5817521_5818502_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_014837142.1|5819187_5819877_-	LrgB family protein	NA	NA	NA	NA	NA
WP_004097823.1|5819869_5820280_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_014227557.1|5820383_5821265_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032695080.1|5821313_5822960_-	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_014227555.1|5823107_5824457_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.8	6.7e-159
WP_014227554.1|5824845_5825514_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_004097815.1|5825771_5826230_-	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_004097813.1|5826314_5826644_+	superoxide response transcriptional regulator SoxS	NA	NA	NA	NA	NA
WP_042944108.1|5826628_5828233_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004097808.1|5828776_5829058_+	membrane protein	NA	NA	NA	NA	NA
WP_071889416.1|5829214_5829604_-	anti-adapter protein IraM	NA	NA	NA	NA	NA
WP_025107695.1|5829923_5832347_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_014227551.1|5832792_5833143_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014227550.1|5833412_5835674_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_042944104.1|5836269_5837847_+	lytic transglycosylase F	NA	K7RVN3	Vibrio_phage	31.7	2.4e-06
WP_001548021.1|5838131_5838377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103433594.1|5838481_5839754_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	3.0e-169
WP_001101446.1|5840345_5841371_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_032624899.1|5841710_5842634_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	9.6e-173
WP_001101446.1|5842952_5843978_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_042944099.1|5844285_5844606_+	hypothetical protein	NA	J9Q750	Salmonella_phage	51.9	9.1e-30
WP_042944097.1|5845644_5847678_-	alpha-amylase	NA	NA	NA	NA	NA
WP_001101446.1|5847963_5848989_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP026269	Klebsiella oxytoca strain KONIH4 chromosome, complete genome	6252643	6079772	6151755	6252643	head,protease,tRNA,portal,integrase,capsid,terminase,plate,tail	Enterobacteria_phage(35.9%)	79	6114631:6114672	6147510:6147551
WP_042944062.1|6079772_6080873_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_004856046.1|6080918_6081278_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_004107582.1|6081293_6081929_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_004116922.1|6082125_6083526_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_014227441.1|6083508_6084426_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_014227439.1|6084693_6086067_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_088941751.1|6086144_6086921_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_014227437.1|6086927_6087932_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_014227436.1|6088116_6089268_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_004856030.1|6089521_6092173_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_032693277.1|6092266_6092914_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_014227434.1|6093065_6093929_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004107558.1|6094134_6094797_+	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	34.0	3.5e-28
WP_014227433.1|6094852_6095956_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_014227432.1|6096084_6096834_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	34.1	6.0e-24
WP_004856019.1|6096956_6097844_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_042944060.1|6098010_6098916_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004856015.1|6099006_6099378_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_014227430.1|6099417_6101850_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_014227429.1|6101852_6103013_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_004107547.1|6103279_6103597_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_004107543.1|6103694_6103910_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_042944059.1|6104140_6106336_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_004856005.1|6106486_6107515_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_071889412.1|6107606_6108572_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_004107530.1|6108662_6109193_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_004127247.1|6109202_6110537_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	30.3	1.1e-44
WP_032693284.1|6110921_6111848_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_004127241.1|6111940_6112426_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_004127238.1|6112485_6113448_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_014227425.1|6113650_6114547_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
6114631:6114672	attL	AAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTG	NA	NA	NA	NA
WP_042946155.1|6114776_6115160_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	55.9	2.9e-38
WP_071889411.1|6115251_6115500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042946154.1|6115544_6116699_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	80.9	6.5e-179
WP_042944054.1|6116852_6118034_+|tail	tail protein	tail	A0A0A7NV69	Enterobacteria_phage	69.3	3.0e-155
WP_023328126.1|6118033_6118549_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	68.8	3.1e-64
WP_042944053.1|6118603_6118903_+	hypothetical protein	NA	B9A7B2	Serratia_phage	79.2	2.2e-33
WP_071889410.1|6118899_6119076_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	71.4	3.0e-11
WP_158650806.1|6119056_6121846_+|tail	phage tail tape measure protein	tail	F1BUT7	Erwinia_phage	48.6	1.8e-126
WP_042944051.1|6121857_6122346_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.3	1.8e-53
WP_042944050.1|6122484_6123651_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	49.0	7.4e-45
WP_042944048.1|6123716_6123971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142395362.1|6123980_6126074_-	hypothetical protein	NA	A0A0H3YEH5	Pectobacterium_phage	34.1	5.1e-81
WP_042944045.1|6126081_6126678_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	44.0	7.3e-41
WP_042944042.1|6126670_6127570_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	59.5	2.9e-89
WP_042944040.1|6127556_6127925_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	59.1	3.6e-30
WP_042944038.1|6127921_6128506_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	61.9	3.0e-63
WP_042944037.1|6128505_6129147_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	47.8	3.2e-42
WP_042944035.1|6129143_6129602_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	46.4	9.0e-31
WP_071889409.1|6129598_6129898_-	peptidase	NA	NA	NA	NA	NA
WP_042944031.1|6130138_6130690_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	41.3	2.3e-28
WP_032737914.1|6130686_6130968_-	hypothetical protein	NA	B9A7B8	Serratia_phage	54.5	3.1e-18
WP_032737915.1|6130958_6131159_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	9.7e-14
WP_042946153.1|6131158_6131656_-|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	69.7	1.3e-59
WP_042946152.1|6131758_6132655_-|terminase	terminase	terminase	B9A7B6	Serratia_phage	73.9	1.2e-90
WP_042944028.1|6132702_6133752_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	54.8	1.8e-106
WP_042944025.1|6133776_6134610_-|capsid	phage capsid scaffolding protein	capsid	B9A7B4	Serratia_phage	74.7	6.9e-114
WP_042944024.1|6134767_6136489_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	65.6	1.3e-223
WP_042944023.1|6136488_6137541_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.0	2.7e-139
WP_142255201.1|6137983_6138343_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_042944019.1|6138347_6140963_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	51.1	8.1e-193
WP_103433596.1|6140955_6141852_-	hypothetical protein	NA	H2BDG1	Pseudomonas_virus	54.8	2.5e-24
WP_158413322.1|6141948_6142104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042944017.1|6142103_6142373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042944016.1|6142372_6143326_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	56.6	3.4e-88
WP_042944014.1|6143336_6143915_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	40.5	6.4e-34
WP_042944012.1|6143911_6144136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042944011.1|6144205_6144478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042944009.1|6144493_6144880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042944006.1|6144896_6145115_-	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	9.6e-07
WP_042944004.1|6145141_6145414_-	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	86.7	5.7e-41
WP_103433597.1|6145597_6145894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042944001.1|6146047_6146341_+	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	76.3	5.9e-36
WP_042943998.1|6146410_6147391_+|integrase	tyrosine-type recombinase/integrase	integrase	U5N0A8	Enterobacteria_phage	81.8	2.0e-152
WP_004855993.1|6147575_6148079_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
6147510:6147551	attR	AAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTG	NA	NA	NA	NA
WP_004127228.1|6148228_6148927_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
WP_004107505.1|6148923_6150297_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	23.3	4.5e-09
WP_014227423.1|6150388_6151063_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_004127220.1|6151134_6151755_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
>prophage 1
NZ_CP026271	Klebsiella oxytoca strain KONIH4 plasmid pKOX-4655, complete sequence	73495	19911	28346	73495		Emiliania_huxleyi_virus(16.67%)	12	NA	NA
WP_103433627.1|19911_21912_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.8	3.3e-21
WP_020804458.1|21982_22231_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_020804459.1|22280_22838_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	75.2	5.2e-49
WP_020803883.1|23703_24024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032425679.1|24048_24312_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	53.8	3.4e-14
WP_020803881.1|24512_24704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020803879.1|24744_25251_-	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	31.9	6.9e-08
WP_032744250.1|25295_25724_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.9	2.2e-10
WP_020804421.1|26156_26921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020804419.1|26967_27378_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_020804418.1|27423_27645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032744253.1|27644_28346_-	methylase	NA	A0A2K9VH43	Faecalibacterium_phage	34.3	2.6e-21
>prophage 1
NZ_CP026274	Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence	235655	0	45077	235655	protease,transposase,integrase	Escherichia_phage(33.33%)	52	16223:16282	25873:26696
WP_000447669.1|813_1239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000881513.1|1296_1701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000932975.1|1710_1950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000545925.1|2835_3132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001750003.1|3128_3488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001750002.1|3556_3841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012561126.1|4049_4382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000129958.1|5734_6244_+	antirestriction protein ArdA	NA	NA	NA	NA	NA
WP_000214483.1|6970_7150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749971.1|7204_7525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048968061.1|7635_7869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000414913.1|8161_8530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749973.1|8531_9248_-	StdB	NA	NA	NA	NA	NA
WP_020319858.1|9256_9394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749975.1|10166_10583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342688.1|10584_12114_+	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012561166.1|12113_15350_+	conjugative relaxase	NA	U5J9B0	Bacillus_phage	27.3	2.4e-05
WP_012561167.1|15349_15715_+	hypothetical protein	NA	NA	NA	NA	NA
16223:16282	attL	TGGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGC	NA	NA	NA	NA
WP_001067855.1|16287_16992_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032951259.1|18093_19383_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.5	6.2e-170
WP_047716085.1|19440_19869_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	5.2e-49
WP_047716084.1|19941_20451_+	arsenate reductase ArsC	NA	A0A2H4J437	uncultured_Caudovirales_phage	39.1	1.0e-14
WP_047935036.1|20629_21127_+	phosphatase	NA	NA	NA	NA	NA
WP_047716082.1|21402_22416_+	permease	NA	NA	NA	NA	NA
WP_047716080.1|22527_22851_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_047716078.1|22859_23582_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	70.0	2.2e-95
WP_047716077.1|23671_24202_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_047935034.1|24348_24993_-	recombinase family protein	NA	NA	NA	NA	NA
WP_077257771.1|25252_25657_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.5	1.1e-19
WP_001067855.1|25937_26642_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_047935038.1|26968_27469_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
25873:26696	attR	TGGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCCC	NA	NA	NA	NA
WP_004118541.1|27669_30678_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	62.8	0.0e+00
WP_001067855.1|30988_31693_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_003032641.1|32724_33516_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_077255298.1|33574_34921_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004098919.1|35129_35612_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004098921.1|35599_35866_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004118702.1|36041_36296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098928.1|36371_36629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098931.1|36677_36881_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_042946273.1|36911_37280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013023776.1|37323_37818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009654312.1|37848_38415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009310051.1|38411_38675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009654302.1|38964_39543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009654304.1|39681_40683_-|protease	CAAX amino protease	protease	NA	NA	NA	NA
WP_009654315.1|40838_41420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118349.1|41706_41886_+	antitoxin	NA	NA	NA	NA	NA
WP_042946272.1|41851_41971_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_004118347.1|42349_42784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009654301.1|42999_44400_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.9	6.4e-19
WP_001188930.1|44396_45077_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
>prophage 2
NZ_CP026274	Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence	235655	50171	57428	235655		uncultured_Caudovirales_phage(33.33%)	5	NA	NA
WP_000287501.1|50171_50909_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	31.9	1.3e-10
WP_000843494.1|50942_51140_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_001514621.1|51180_53628_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.4	3.8e-83
WP_009654300.1|53754_54195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042946271.1|54281_57428_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.6	1.0e-61
>prophage 3
NZ_CP026274	Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence	235655	60801	64125	235655		Bacillus_phage(66.67%)	4	NA	NA
WP_000697968.1|60801_61482_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
WP_007374412.1|61474_62950_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_009309902.1|63195_63627_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_004187110.1|63774_64125_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	51.4	6.0e-19
>prophage 4
NZ_CP026274	Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence	235655	71198	118489	235655	transposase,integrase	Escherichia_phage(30.0%)	47	95604:95619	118929:118944
WP_047722707.1|71198_71987_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	4.2e-52
WP_032700766.1|72043_72301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118622.1|73112_74612_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_038423655.1|74608_75364_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	2.4e-33
WP_001568031.1|77049_77805_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	2.0e-136
WP_153459032.1|78273_78423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977818.1|78552_79758_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
WP_087653730.1|79754_80732_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.8	8.5e-87
WP_001568036.1|82084_82516_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_040220197.1|82923_84408_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.1	1.1e-29
WP_032425559.1|84656_85628_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.4e-73
WP_032700854.1|85630_86302_+	Mediator of plasmid stability	NA	NA	NA	NA	NA
WP_032700853.1|86365_86596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032700852.1|87570_88251_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	35.5	2.4e-27
WP_032700851.1|88250_88472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032700850.1|88483_88903_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_042946295.1|88956_89742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032700848.1|89911_90340_+	antirestriction protein	NA	NA	NA	NA	NA
WP_032700847.1|90417_90609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063858701.1|90788_91040_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	49.4	1.3e-12
WP_032700845.1|91832_92063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086544384.1|92188_93496_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_032700843.1|93544_94108_+	methyltransferase	NA	A0A2I7RHK4	Vibrio_phage	36.7	3.7e-18
WP_009654061.1|94941_95490_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	73.8	3.9e-49
WP_009654057.1|95538_95772_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
95604:95619	attL	GGCGGCACAGTTTGAA	NA	NA	NA	NA
WP_032700842.1|95839_97897_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.2	1.4e-22
WP_004118968.1|97940_98372_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_004118966.1|98368_99097_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_004118963.1|99500_99830_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	3.1e-09
WP_004118961.1|99810_100092_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_032700867.1|100910_101186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032700837.1|101182_101401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032700835.1|101426_101774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032700834.1|101867_102014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032716647.1|102698_103229_+	antirestriction protein	NA	NA	NA	NA	NA
WP_074182926.1|103266_103674_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_032736874.1|104176_104569_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_032736872.1|104807_105509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060415469.1|105593_105794_+	TraY domain-containing protein	NA	NA	NA	NA	NA
WP_032736871.1|105862_106231_+	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_000509966.1|106351_106957_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_004152391.1|108889_110605_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004152392.1|110714_113744_+|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|113850_114876_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|114872_115652_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199234.1|116038_116920_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152397.1|117169_118489_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
118929:118944	attR	GGCGGCACAGTTTGAA	NA	NA	NA	NA
>prophage 5
NZ_CP026274	Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence	235655	133478	136962	235655		Aphanizomenon_phage(50.0%)	5	NA	NA
WP_020323375.1|133478_134270_+	hypothetical protein	NA	A0A2H4PB09	Aphanizomenon_phage	55.7	3.4e-09
WP_020323374.1|134438_134708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020323376.1|134749_134950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020323377.1|135004_135502_+	ROS/MUCR transcriptional regulator domain protein	NA	NA	NA	NA	NA
WP_020323167.1|136284_136962_+	DUF5417 domain-containing protein	NA	G5DME7	Enterobacter_virus	41.1	4.9e-09
>prophage 6
NZ_CP026274	Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence	235655	142034	178809	235655	transposase,integrase	Enterobacteria_phage(22.22%)	37	160917:160976	177767:179158
WP_020323154.1|142034_145253_+	conjugative relaxase	NA	A0A2R8FDQ9	Cedratvirus	30.5	2.4e-05
WP_020323157.1|145249_145915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020323170.1|145907_146270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032416518.1|146885_147197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046092601.1|147193_147661_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	37.6	1.7e-24
WP_020323165.1|147717_148719_-	Flp pilus assembly complex ATPase component	NA	NA	NA	NA	NA
WP_020323153.1|148769_149903_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_103433645.1|149902_150721_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_001553819.1|150651_153549_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_000509966.1|153643_154249_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_001208352.1|154469_155165_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_020323169.1|155383_156421_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_000858958.1|156437_156680_-	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_020323143.1|156689_157391_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_103215792.1|157406_158234_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001101446.1|158589_159615_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_032442165.1|159954_160878_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	4.9e-177
160917:160976	attL	GATTTATTCATAGATGGTCGCCTCCTGTTTGCCAAGCTAAATATGTTGTGGTGGCTTTAC	NA	NA	NA	NA
WP_001101446.1|161196_162222_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000462629.1|163794_164112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015060075.1|164151_164448_-	conjugal transfer protein TraM	NA	NA	NA	NA	NA
WP_032416587.1|164694_165477_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_032449361.1|165576_165894_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_032416642.1|165897_166248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032416645.1|166358_166583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032416643.1|166586_166895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006118530.1|167179_167365_+	ribbon-helix-helix domain-containing protein	NA	A0A0A7RUX5	Clostridium_phage	57.8	2.6e-05
WP_032449362.1|167361_167970_-	recombinase family protein	NA	Q2A092	Sodalis_phage	27.2	5.1e-05
WP_020323168.1|168135_168468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020323144.1|168607_169489_+	plasmid encoded RepA protein	NA	NA	NA	NA	NA
WP_020323151.1|170063_170393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103433646.1|170509_170998_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	79.5	3.5e-49
WP_042944088.1|171157_172405_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_042944089.1|172391_173954_+	recombinase	NA	NA	NA	NA	NA
WP_042944091.1|173946_175980_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_077255290.1|176131_176392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001101446.1|176520_177546_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_042944095.1|177885_178809_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	7.3e-173
177767:179158	attR	GTAAAGCCACCACAACATATTTAGCTTGGCAAACAGGAGGCGACCATCTATGAATAAATCGAACTTTTGCTGAGTTGAAGGATCAGATCACGTATCTTCCCGACAACGCAGACCGTTCCGTGGCAAAGCAAAAGTTCAAAATCACCAACTGGCCCACCTACAATAAAGCCCTCATCAACCGTGGCCCCATAACTTTCTGGCTGGATGATGAAGCTATTCAGGCCTGGTATGAGTCAGCAACACCTTCTTCACGAGGCAGACCTCAGCGCTATTCTGACCTTGCCATCACGACTGTGCTGGTCATTAAACGCGTATTCAGGCTGACCCTGCGGGCTGCACAGGGTTTTATTGATTCCATTTTTACACTGATGAATGTTCCGTTGCGCTGCCCGGATTACACCAGTGTCAGCAAGCGCGCAAAGTCGGTTAATGTCAGTTTCAAAACGTTCACCCGGGGTGAAATCGCGCATCTGGTGATTGATTCCACCGGGCTGAAGGTCTTTGGTGAAGGCGAATGGAAAGTCAAAAAGCATGGCCAGGAACGCCGTCGTATATGGCGAAAGTTGCATCTGGCAGTTGACAGCAAAACACATGAAATCATCTGTGCAGACCTGTCGCTGAATAATGTGACGGACTCAGAAGCCTTCCCGGGTCTTATCCGGCAGACTCACAGAAAAATCAGGGCAGCATCGGCAGACGGCGCTTACGACACCCGGCTCTGTCACGATGAACTGCGGCGTAAGAAAATCAGCGCGCTTATCCCGCCCCGAAAAGGTGCGGGTTACTGGCCCGGTGAATATGCAGACCGTAACCGTGCAGTGGCTAATCAGCGAATGACCGGGAGTAATGCGCGGTGGAAATGGACAACAGATTACAACCGTCGCTCGATAGCGGAAACGGCGATGTACCGGGTAAAACAGCTGTTCGGGGGTTCACTGACGCTGCGTGACTACGATGGTCAGGTTGCGGAGGCTATGGCCCTGGTACGAGCGCTGAACAAAATGACGAAAGCAGGTATGCCTGAAAGCGTGCGTATTGCCTGAAAACACAACCCGCTACGGGGGAGACTTACCCGAAATCTGATTTATTCAACAAAGCCATTCCGAATTGCTGTCATCTGAAATCGGTTTCTGCGGCGCATCGCCAGCGCGAAAATGCGAGCTTCGTCTCATTTTTAGCCTATTTTTTGAGCGGTGTCACTCACCCCTTTTCATCCTCCTGGTAAAACGCGCGTCAGGATGAGTTCACCCGCGCGGCGACAAGGCACACTAGATAAAAACCGCTCACAGGATCTCGCAATGAAACTCGCTGCGCTTGCCACGTTATTCGTGCCTGGGATGGCCTTTGCCGCCTGGACTACCACCGACTTTCCTGCTTTTACCGAAGAAGGGA	NA	NA	NA	NA
>prophage 7
NZ_CP026274	Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence	235655	182136	185513	235655	transposase	Salmonella_phage(33.33%)	3	NA	NA
WP_042944099.1|182136_182457_-	hypothetical protein	NA	J9Q750	Salmonella_phage	51.9	9.1e-30
WP_032624899.1|182755_183679_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	9.6e-173
WP_103433594.1|184239_185513_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	3.0e-169
>prophage 8
NZ_CP026274	Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence	235655	200650	205289	235655	transposase	Escherichia_phage(50.0%)	4	NA	NA
WP_004199214.1|200650_201676_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|201672_202452_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199234.1|202838_203720_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152397.1|203969_205289_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
>prophage 9
NZ_CP026274	Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence	235655	209306	209840	235655		Wolbachia_phage(100.0%)	1	NA	NA
WP_000792636.1|209306_209840_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
>prophage 10
NZ_CP026274	Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence	235655	222886	235626	235655	protease,transposase,integrase	Burkholderia_phage(37.5%)	11	222153:222170	229337:229354
222153:222170	attL	CCTGATAGATTTGCTCAC	NA	NA	NA	NA
WP_001288432.1|222886_224320_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_004098817.1|224353_225568_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001389365.1|225828_226593_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001144737.1|226735_227002_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_004201280.1|227222_227696_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_000845048.1|227851_228865_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001749988.1|229257_229827_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
229337:229354	attR	GTGAGCAAATCTATCAGG	NA	NA	NA	NA
WP_001749982.1|231783_232503_-	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.9	8.6e-20
WP_000057569.1|233062_233404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001452808.1|233418_234210_-|protease	zinc metalloprotease	protease	NA	NA	NA	NA
WP_001749980.1|234360_235626_-	translesion error-prone DNA polymerase V subunit MucB	NA	F1C5A5	Cronobacter_phage	53.8	2.2e-119
>prophage 1
NZ_CP026272	Klebsiella oxytoca strain KONIH4 plasmid pKPC-f607, complete sequence	144055	2553	47039	144055	transposase,integrase	Escherichia_phage(29.41%)	38	13769:13782	47980:47993
WP_004197635.1|2553_3348_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
WP_077253981.1|3843_4023_-	Par-like protein	NA	NA	NA	NA	NA
WP_004197649.1|4142_4769_-	ParA family plasmid-partitioning AAA ATPase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
WP_004098982.1|5401_6277_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
WP_103433632.1|6688_7888_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	62.6	1.0e-134
WP_001067855.1|7912_8617_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000427619.1|10513_11518_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000954592.1|11699_11876_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001043260.1|12205_13021_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082319.1|13081_13885_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
13769:13782	attL	GCGCCAGATGAAGC	NA	NA	NA	NA
WP_000480968.1|13884_14721_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000427623.1|15647_16652_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001138073.1|16730_19703_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|19705_20263_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_000993245.1|20392_20605_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001446012.1|20567_20687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087807.1|20670_20907_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277463.1|20903_21269_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000281123.1|21286_22969_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	1.9e-38
WP_000522993.1|23007_23415_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732276.1|23442_23718_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294660.1|23733_24084_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_001166628.1|24155_24611_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000027057.1|26083_26944_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000722315.1|27643_28468_-	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
WP_001206315.1|28527_29316_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_014454105.1|29385_29940_-	aminoglycoside N-acetyltransferase AAC(6')-Ib'	NA	NA	NA	NA	NA
WP_001217881.1|30173_30731_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_004152391.1|31845_33561_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004152392.1|33670_36700_+|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|36806_37832_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|37828_38608_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199234.1|38994_39876_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152397.1|40125_41445_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_103433629.1|42920_43466_-	response regulator	NA	NA	NA	NA	NA
WP_004118230.1|43462_44590_-	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118231.1|44874_45042_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_020326536.1|46043_47039_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	27.9	4.1e-20
47980:47993	attR	GCGCCAGATGAAGC	NA	NA	NA	NA
>prophage 2
NZ_CP026272	Klebsiella oxytoca strain KONIH4 plasmid pKPC-f607, complete sequence	144055	76652	140968	144055	transposase	Escherichia_phage(27.27%)	51	NA	NA
WP_001101446.1|76652_77678_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001118621.1|78017_78941_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	100.0	8.4e-177
WP_042946290.1|80809_81193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032736863.1|81279_81579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088912318.1|81575_81794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042946291.1|82061_82340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042946293.1|82451_83021_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_154235504.1|83040_83202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032736866.1|83194_84616_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_032736867.1|84615_85350_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_032736869.1|85336_85903_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_001553819.1|86192_89090_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_000509966.1|89184_89790_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_001101446.1|90598_91624_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_020804634.1|92624_94847_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000183578.1|94944_95754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001101446.1|96896_97922_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_023279823.1|98240_99164_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	9.6e-173
WP_001101446.1|99503_100529_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_047718110.1|100604_100802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017900603.1|102173_102497_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_017900604.1|102480_103029_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032744126.1|103531_106213_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001101446.1|106590_107616_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_032442165.1|107934_108858_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	4.9e-177
WP_001101446.1|109197_110223_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_020805035.1|110312_111245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032744124.1|111248_112244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032743941.1|113748_115941_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_032690514.1|116070_117354_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_004197677.1|117443_118877_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_032690516.1|118895_121343_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	70.5	9.4e-26
WP_004197675.1|121447_123091_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	25.0	1.5e-22
WP_001101446.1|123616_124642_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_032442165.1|124960_125884_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	4.9e-177
WP_001101446.1|126223_127249_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_004197671.1|128168_128447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001515737.1|129845_131123_-	serine dehydratase subunit alpha family protein	NA	NA	NA	NA	NA
WP_000948259.1|131470_132112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449980.1|132111_133050_-	MCE family protein	NA	NA	NA	NA	NA
WP_001446567.1|133051_133852_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.7	1.8e-10
WP_001325018.1|133848_134994_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001067855.1|135236_135941_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001247892.1|136853_137144_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001293886.1|137140_137542_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_003465043.1|137531_137888_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003100858.1|138142_138469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|138465_138966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100853.1|138962_139334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100847.1|139327_139885_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_000427623.1|139963_140968_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP026270	Klebsiella oxytoca strain KONIH4 plasmid unnamed, complete sequence	52919	1026	52152	52919	head,capsid,tail,terminase,portal	Klebsiella_phage(90.0%)	56	NA	NA
WP_102811960.1|1026_2190_+	plasmid-partitioning protein SopA	NA	Q6UAV7	Klebsiella_phage	99.5	1.3e-227
WP_102811961.1|2192_3164_+	ParB/RepB/Spo0J family plasmid partition protein	NA	Q6UAV8	Klebsiella_phage	97.8	5.2e-177
WP_004122957.1|3246_3630_-	hypothetical protein	NA	Q6UAV9	Klebsiella_phage	90.6	5.2e-64
WP_102811962.1|3747_4890_-|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	37.7	3.6e-36
WP_103433621.1|4928_15476_-	DUF1983 domain-containing protein	NA	A0A0P0IKE4	Klebsiella_phage	52.2	0.0e+00
WP_102811964.1|15540_16131_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	72.9	3.8e-74
WP_102811965.1|16183_16531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102811966.1|16563_17274_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	94.5	5.1e-142
WP_102811967.1|17275_18031_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	90.0	8.2e-138
WP_102811968.1|18027_18366_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	96.4	2.5e-62
WP_102811980.1|18365_21713_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	96.8	0.0e+00
WP_015974457.1|21951_22320_-|tail	putative tail assembly chaperone	tail	Q6UAW8	Klebsiella_phage	100.0	2.2e-59
WP_102811969.1|22383_22851_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	99.4	4.6e-83
WP_015974455.1|22885_23287_-	Gp11	NA	Q6UAX1	Klebsiella_phage	100.0	2.0e-66
WP_015974454.1|23283_23673_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	100.0	1.6e-68
WP_015974453.1|23653_23992_-|head	phage head closure protein	head	Q6UAX3	Klebsiella_phage	100.0	3.4e-59
WP_102811970.1|23988_24306_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	95.9	9.5e-48
WP_102811971.1|24286_24559_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	67.5	1.1e-23
WP_102811972.1|24617_25904_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.5	5.7e-216
WP_102811973.1|25978_26899_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	96.4	3.2e-160
WP_015974449.1|26935_28201_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	100.0	9.8e-245
WP_103433622.1|28373_30083_-|terminase	terminase large subunit	terminase	Q6UAY0	Klebsiella_phage	99.6	0.0e+00
WP_102811975.1|30117_30441_-|terminase	P27 family phage terminase small subunit	terminase	Q6UAY1	Klebsiella_phage	100.0	3.7e-55
WP_102811976.1|30969_31398_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	60.6	4.2e-38
WP_102811977.1|31397_31712_-	hypothetical protein	NA	Q6UAS1	Klebsiella_phage	44.2	1.6e-07
WP_102811978.1|31708_32071_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	92.5	9.2e-63
WP_103433623.1|32070_32793_-	hypothetical protein	NA	Q6UAS3	Klebsiella_phage	76.6	6.9e-102
WP_102811950.1|33071_33371_-	DUF4406 domain-containing protein	NA	Q6UAS4	Klebsiella_phage	94.9	6.7e-51
WP_158650807.1|33379_33598_-	hypothetical protein	NA	Q6UAS5	Klebsiella_phage	93.9	6.4e-11
WP_102811951.1|33624_34095_-	hypothetical protein	NA	Q6UAS7	Klebsiella_phage	82.1	5.9e-62
WP_102811952.1|34111_34603_-	hypothetical protein	NA	Q6UAS8	Klebsiella_phage	90.2	1.1e-82
WP_102811953.1|34605_34911_-	hypothetical protein	NA	Q6UAS9	Klebsiella_phage	91.1	1.5e-45
WP_102811954.1|34969_36031_-	site-specific DNA-methyltransferase	NA	Q6UAT0	Klebsiella_phage	92.9	2.4e-172
WP_048336167.1|36301_36529_-	winged helix-turn-helix domain-containing protein	NA	Q6UAT1	Klebsiella_phage	85.3	1.9e-29
WP_048336181.1|36538_36760_-	hypothetical protein	NA	Q6UAT2	Klebsiella_phage	98.6	1.7e-35
WP_023339392.1|36929_37238_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	94.2	3.9e-46
WP_048336165.1|37237_37525_+	helix-turn-helix transcriptional regulator	NA	Q6UAT4	Klebsiella_phage	95.8	2.2e-43
WP_048336179.1|37571_37775_-	hypothetical protein	NA	Q6UAT5	Klebsiella_phage	78.1	2.0e-19
WP_048336163.1|37878_38106_-	hypothetical protein	NA	O64355	Escherichia_phage	74.6	3.4e-23
WP_048336160.1|38126_38453_-	hypothetical protein	NA	Q6UAT7	Klebsiella_phage	95.4	1.0e-52
WP_048336158.1|38445_39093_-	hypothetical protein	NA	Q6UAT8	Klebsiella_phage	65.1	1.1e-63
WP_102811955.1|39252_39522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048336156.1|39514_39718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048336154.1|40402_41011_-	3'-5' exonuclease	NA	Q6UAU3	Klebsiella_phage	92.5	4.8e-104
WP_048336175.1|41422_42160_-	phage antitermination Q family protein	NA	Q6UAU4	Klebsiella_phage	94.3	4.2e-131
WP_072065721.1|42149_42359_-	hypothetical protein	NA	Q6UAU5	Klebsiella_phage	91.3	1.3e-29
WP_047057767.1|42439_43048_+	XRE family transcriptional regulator	NA	Q6UAU6	Klebsiella_phage	97.0	6.4e-109
WP_048336150.1|43298_47303_+	hypothetical protein	NA	A0A2I6TD01	Escherichia_phage	81.5	0.0e+00
WP_048336148.1|47295_47592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103433624.1|47709_48282_+	DUF5448 family protein	NA	Q6UAU9	Klebsiella_phage	89.7	5.5e-86
WP_102811957.1|48271_48655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158650808.1|48879_49056_+	hypothetical protein	NA	O21968	Escherichia_phage	86.2	1.7e-06
WP_032413547.1|49015_49180_+	host cell division inhibitor Icd-like protein	NA	Q6UAV3	Klebsiella_phage	96.3	2.8e-19
WP_102811958.1|49176_49407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103433625.1|49403_50174_+	hypothetical protein	NA	O64341	Escherichia_phage	79.0	7.3e-118
WP_102811959.1|50229_52152_-	protelomerase	NA	Q6UAV6	Klebsiella_phage	98.0	0.0e+00
