The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026323	Helicobacter pylori strain 26695-dRdM1dM2 chromosome, complete genome	1666879	1018467	1070386	1666879	tRNA,transposase,integrase	Helicobacter_phage(50.0%)	44	1028974:1028993	1080308:1080327
WP_001150920.1|1018467_1019379_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_000401714.1|1019392_1020331_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001862971.1|1020462_1020924_-	acyl carrier protein	NA	M4QDG5	Prochlorococcus_phage	47.1	1.3e-05
WP_001862974.1|1020916_1022260_-	dynamin-like GTPase family protein	NA	NA	NA	NA	NA
WP_010875568.1|1022256_1023348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010875569.1|1023257_1024589_-	dynamin-like GTPase family protein	NA	NA	NA	NA	NA
WP_010875570.1|1024585_1026235_-	GTPase	NA	NA	NA	NA	NA
WP_000271456.1|1026455_1026743_-	endoribonuclease VapD	NA	NA	NA	NA	NA
WP_000880322.1|1026812_1027094_-	DUF3240 family protein	NA	NA	NA	NA	NA
WP_000978968.1|1027109_1030172_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	25.7	2.8e-83
1028974:1028993	attL	ATGAGCATGCCTATAGCGAT	NA	NA	NA	NA
WP_000816822.1|1030168_1031248_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_103433688.1|1031244_1032480_-	TolC family protein	NA	NA	NA	NA	NA
WP_000555186.1|1032529_1034635_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000682021.1|1034746_1035808_+	hypothetical protein	NA	A0A2D1GN01	Pseudoalteromonas_phage	30.1	2.0e-09
WP_000057737.1|1035820_1037296_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001165207.1|1037310_1037592_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_001010809.1|1037711_1039022_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	NA	NA	NA	NA
WP_000574070.1|1039150_1040614_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_000400290.1|1040629_1042108_+	cell division protein FtsA	NA	NA	NA	NA	NA
WP_000233600.1|1042238_1043396_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_001863015.1|1044553_1044856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049794234.1|1044866_1045139_+	exonuclease VII large subunit	NA	NA	NA	NA	NA
WP_010875573.1|1045510_1046206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001169565.1|1046206_1046497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343415.1|1047055_1047880_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000923190.1|1048532_1048676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010875575.1|1048715_1049429_-	DUF1887 family protein	NA	NA	NA	NA	NA
WP_000886948.1|1050812_1051046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010875484.1|1051052_1051481_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RG71	Helicobacter_phage	97.9	8.6e-76
WP_000930565.1|1051550_1052834_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1S5REX3	Helicobacter_phage	85.0	2.6e-200
WP_010875578.1|1052982_1054785_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_001120382.1|1055934_1057002_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	26.7	1.7e-08
WP_000009099.1|1057318_1058122_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_000006537.1|1058093_1058345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010875576.1|1058930_1059560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080012132.1|1059564_1060278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000930564.1|1060326_1061610_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1S5REX3	Helicobacter_phage	85.2	1.2e-200
WP_010875484.1|1061679_1062108_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RG71	Helicobacter_phage	97.9	8.6e-76
WP_000587397.1|1062689_1063346_+	ParA family protein	NA	A2I303	Vibrio_virus	23.4	7.1e-05
WP_000394638.1|1063430_1063715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000665511.1|1063758_1064943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000065304.1|1067158_1067473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000254056.1|1068023_1068557_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_001862466.1|1069969_1070386_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	96.4	4.6e-74
1080308:1080327	attR	ATCGCTATAGGCATGCTCAT	NA	NA	NA	NA
>prophage 2
NZ_CP026323	Helicobacter pylori strain 26695-dRdM1dM2 chromosome, complete genome	1666879	1426944	1434664	1666879		Escherichia_phage(33.33%)	7	NA	NA
WP_103433681.1|1426944_1427586_-	copper response regulator transcription factor CrdR	NA	A0A1V0SKI5	Klosneuvirus	27.5	6.3e-06
WP_000412211.1|1428200_1428860_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_103433682.1|1429881_1430664_-	site-specific DNA-methyltransferase	NA	S0A0D5	Cellulophaga_phage	33.1	1.8e-18
WP_103433683.1|1430650_1431241_-	site-specific DNA-methyltransferase	NA	A0A1D8KJW7	Synechococcus_phage	36.6	5.2e-15
WP_022542381.1|1431394_1431859_-	AAC(3)-I family aminoglycoside 3-N-acetyltransferase	NA	NA	NA	NA	NA
WP_103433684.1|1432196_1433621_+	site-specific DNA-methyltransferase	NA	I7KLR2	Campylobacter_virus	52.3	9.7e-23
WP_103433685.1|1433626_1434664_+	site-specific DNA-methyltransferase	NA	A0A220NUF4	Escherichia_phage	52.6	3.6e-19
