The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	0	30261	5277702	terminase,head,capsid,tail,holin,portal	Enterobacteria_phage(92.11%)	38	NA	NA
WP_001254255.1|427_604_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_104457333.1|606_1008_+	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	97.7	4.6e-71
WP_104457334.1|967_1177_+	protein ninF	NA	G9L691	Escherichia_phage	95.7	2.2e-29
WP_104457335.1|1169_1382_+	hypothetical protein	NA	K7PK10	Enterobacteria_phage	98.6	1.4e-34
WP_041327960.1|1374_1665_+	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	2.2e-51
WP_104457336.1|1661_1985_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.1	3.1e-54
WP_104457337.1|2020_2209_+	protein ninH	NA	K7PH29	Enterobacteria_phage	98.4	9.4e-27
WP_001235461.1|2205_2829_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_003832349.1|3664_3943_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	100.0	3.9e-45
WP_061350480.1|3920_4487_+	lysozyme	NA	K7P7Q3	Enterobacteria_phage	100.0	1.9e-107
WP_104457338.1|4486_5023_+	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	97.8	2.7e-79
WP_016066216.1|5130_5376_+	hypothetical protein	NA	K7PKT0	Enterobacteria_phage	100.0	2.4e-38
WP_104457339.1|5435_5657_+	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	98.6	4.0e-37
WP_000453626.1|6791_7337_+|terminase	terminase small subunit	terminase	K7PJS9	Enterobacteria_phage	100.0	1.1e-94
WP_001027238.1|7311_9234_+|terminase	phage terminase large subunit family protein	terminase	K7PGW7	Enterobacteria_phage	100.0	0.0e+00
WP_000235410.1|9233_9440_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	100.0	4.5e-30
WP_000701346.1|9436_11029_+|portal	phage portal protein	portal	K7PHD3	Enterobacteria_phage	100.0	1.0e-310
WP_000929808.1|11009_12353_+|capsid	phage capsid assembly protein	capsid	K7PKQ1	Enterobacteria_phage	100.0	7.1e-217
WP_001018610.1|12362_12695_+|head	head decoration protein	head	E4WL24	Enterobacteria_phage	100.0	9.0e-57
WP_000118198.1|12762_13788_+|capsid	major capsid protein	capsid	K7PGW9	Enterobacteria_phage	100.0	9.2e-193
WP_023062982.1|13833_14268_+|capsid	phage capsid protein	capsid	K7PM13	Enterobacteria_phage	93.8	1.1e-41
WP_000753023.1|14278_14632_+|tail	tail attachment protein	tail	K7PHD8	Enterobacteria_phage	100.0	1.7e-61
WP_000023111.1|14641_15196_+|tail	phage tail protein	tail	K7PKQ5	Enterobacteria_phage	100.0	1.8e-81
WP_000682752.1|15192_15591_+|tail	tail protein	tail	K7PJT1	Enterobacteria_phage	100.0	1.0e-70
WP_000235019.1|15598_16336_+|tail	phage tail protein	tail	K7PGX1	Enterobacteria_phage	100.0	5.5e-131
WP_000479021.1|16372_16795_+|tail	phage minor tail protein G	tail	K7PM17	Enterobacteria_phage	100.0	6.7e-57
WP_000761928.1|16803_17124_+|tail	phage tail assembly protein T	tail	K7PHE1	Enterobacteria_phage	100.0	2.1e-55
WP_104457340.1|17101_19618_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	99.8	0.0e+00
WP_016066189.1|19623_19971_+|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	100.0	6.3e-61
WP_016066190.1|19967_20723_+|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	100.0	3.0e-148
WP_001249260.1|20724_21456_+	peptidase P60	NA	K7PM21	Enterobacteria_phage	100.0	3.7e-151
WP_001374340.1|21443_22034_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	100.0	3.5e-104
WP_104457341.1|22086_25542_+|tail	phage tail protein	tail	K7PKR4	Enterobacteria_phage	99.9	0.0e+00
WP_000807260.1|25845_26520_+	hypothetical protein	NA	K7PGX6	Enterobacteria_phage	100.0	5.1e-123
WP_001228569.1|26631_26865_+	hypothetical protein	NA	E4WL42	Enterobacteria_phage	100.0	2.3e-38
WP_104457342.1|26925_28200_+|tail	phage tail protein	tail	K7P6M1	Enterobacteria_phage	96.5	2.2e-228
WP_016063974.1|28264_28663_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	100.0	4.2e-69
WP_000830156.1|29094_30261_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.2	2.9e-227
>prophage 2
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	34603	36759	5277702		Klebsiella_phage(33.33%)	4	NA	NA
WP_000692323.1|34603_34825_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186773.1|34887_35364_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860076.1|35379_35859_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	8.9e-13
WP_001234629.1|35940_36759_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.9	2.6e-44
>prophage 3
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	55407	64858	5277702	transposase	Stx2-converting_phage(71.43%)	8	NA	NA
WP_103216080.1|55407_56680_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	5.7e-176
WP_077769291.1|56651_57110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001000409.1|57324_58860_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	2.0e-260
WP_000609174.1|58909_59257_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001201739.1|59253_59637_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
WP_001324957.1|62551_62929_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	89.7	3.5e-57
WP_000612629.1|62925_63273_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	98.3	2.2e-61
WP_061351262.1|63322_64858_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.0	1.6e-265
>prophage 4
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	87925	112581	5277702	integrase	Bacillus_phage(40.0%)	8	75163:75177	114138:114152
75163:75177	attL	CAGTTCCCGCCAGCA	NA	NA	NA	NA
WP_000369524.1|87925_97417_-	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.2e-49
WP_016240035.1|97504_103612_-	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	1.8e-33
WP_000140405.1|103802_104762_-	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_000098396.1|104928_106731_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.6	8.5e-32
WP_016240034.1|106717_108520_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
WP_001764637.1|108512_109793_+	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_000703040.1|109820_111125_+	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_024165620.1|111318_112581_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.0	3.1e-73
114138:114152	attR	TGCTGGCGGGAACTG	NA	NA	NA	NA
>prophage 5
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	117770	130361	5277702		Bacillus_phage(33.33%)	12	NA	NA
WP_001339045.1|117770_118442_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_016240031.1|118441_119800_+	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_000218214.1|119907_120759_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000824347.1|121351_122566_-	porin	NA	Q1MVN1	Enterobacteria_phage	53.7	4.0e-102
WP_001313057.1|123132_123498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365576.1|123537_124233_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	3.6e-07
WP_001157252.1|124299_125718_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	4.0e-101
WP_000785994.1|125698_126169_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	4.4e-33
WP_001212228.1|126157_127078_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922682.1|127250_128168_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009306.1|128246_128429_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001564714.1|128666_130361_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.7e-18
>prophage 6
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	145545	146217	5277702		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001543845.1|145545_146217_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	1.6e-81
>prophage 7
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	158436	159189	5277702		Bacillus_virus(100.0%)	1	NA	NA
WP_016240022.1|158436_159189_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	35.4	1.3e-26
>prophage 8
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	171180	172695	5277702		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001187819.1|171180_172695_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 9
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	182781	188425	5277702		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_016243616.1|182781_184443_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	7.6e-11
WP_000483221.1|184488_186090_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	8.3e-15
WP_000204335.1|186108_186969_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036371.1|186971_188021_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|188035_188425_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
>prophage 10
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	193678	195412	5277702	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025326.1|193678_195412_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 11
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	202028	202772	5277702		Synechococcus_phage(100.0%)	1	NA	NA
WP_000019585.1|202028_202772_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
>prophage 12
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	215718	220818	5277702		Salmonella_phage(33.33%)	4	NA	NA
WP_104457346.1|215718_217785_+	tape measure protein	NA	A0A0D4DAK9	Salmonella_phage	26.9	6.2e-55
WP_063121890.1|217958_218732_+	hypothetical protein	NA	A0A0N9SLL3	Escherichia_phage	71.8	1.6e-72
WP_063121891.1|218746_220270_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001410217.1|220323_220818_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.4	1.5e-71
>prophage 13
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	224836	231900	5277702		Bacillus_virus(50.0%)	9	NA	NA
WP_104457347.1|224836_225358_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	1.2e-10
WP_016240011.1|225359_225962_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_072094247.1|226032_226098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|226236_226848_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|226856_227867_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571479.1|228013_228799_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|228795_229551_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001342995.1|229629_230562_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|230577_231900_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 14
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	239372	240500	5277702		Planktothrix_phage(100.0%)	1	NA	NA
WP_000741720.1|239372_240500_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.5	3.6e-20
>prophage 15
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	254067	255543	5277702		Cyanophage(100.0%)	1	NA	NA
WP_000301720.1|254067_255543_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
>prophage 16
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	263599	268069	5277702		Klebsiella_phage(33.33%)	7	NA	NA
WP_000944256.1|263599_264262_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011660.1|264285_264942_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|265043_265274_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168738.1|265412_265787_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879286.1|265790_266663_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976472.1|266675_267017_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812740.1|267412_268069_+	protein-serine/threonine phosphatase	NA	A0A2D1GLI5	Escherichia_phage	50.0	1.2e-55
>prophage 17
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	275565	277614	5277702		Moraxella_phage(100.0%)	1	NA	NA
WP_001055778.1|275565_277614_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.2e-85
>prophage 18
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	282944	283154	5277702		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|282944_283154_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 19
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	288794	290351	5277702		Moraxella_phage(100.0%)	1	NA	NA
WP_104457350.1|288794_290351_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 20
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	294213	302319	5277702	tRNA	Pandoravirus(33.33%)	8	NA	NA
WP_000854969.1|294213_295575_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	1.5e-41
WP_000457334.1|295648_295828_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001300615.1|295947_296307_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|296668_297013_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128847.1|297144_299055_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001220966.1|299112_299808_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290576.1|299847_300429_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_000758422.1|300633_302319_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
>prophage 21
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	317073	321650	5277702		Bacillus_phage(100.0%)	3	NA	NA
WP_001295489.1|317073_318564_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	1.1e-08
WP_000616404.1|318744_320220_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000219686.1|320366_321650_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 22
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	324968	325823	5277702		Indivirus(100.0%)	1	NA	NA
WP_001186371.1|324968_325823_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	2.5e-10
>prophage 23
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	338075	338717	5277702		Tupanvirus(100.0%)	1	NA	NA
WP_001135075.1|338075_338717_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.9e-19
>prophage 24
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	343643	345605	5277702		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235787.1|343643_345605_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.7	1.1e-40
>prophage 25
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	351203	351857	5277702		Planktothrix_phage(100.0%)	1	NA	NA
WP_001324946.1|351203_351857_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.7	1.4e-13
>prophage 26
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	357902	359123	5277702		Klosneuvirus(100.0%)	1	NA	NA
WP_000081983.1|357902_359123_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
>prophage 27
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	366599	367427	5277702		Bacillus_virus(100.0%)	1	NA	NA
WP_000175021.1|366599_367427_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	2.0e-73
>prophage 28
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	373764	376026	5277702		Tupanvirus(100.0%)	1	NA	NA
WP_000077873.1|373764_376026_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.3e-143
>prophage 29
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	387324	408118	5277702	transposase,tRNA	Tupanvirus(20.0%)	19	NA	NA
WP_001144202.1|387324_389253_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
WP_001700733.1|389256_389799_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|389895_390093_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|390145_390502_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|390624_390669_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018596.1|390952_391936_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_000672380.1|391950_394338_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|394342_394642_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000956529.1|394742_395723_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154183.1|395785_396337_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029466.1|396336_397086_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001209795.1|397163_397628_+	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_000019445.1|398445_399426_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_000175705.1|399850_401287_+	YdiU family protein	NA	NA	NA	NA	NA
WP_104457351.1|401290_401482_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082226.1|401613_402660_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_000368046.1|402816_403650_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_000069375.1|403982_406361_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000553693.1|406417_408118_-	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	2.1e-32
>prophage 30
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	426713	431797	5277702		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_097719111.1|426713_427082_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	1.6e-14
WP_000089364.1|427090_428578_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000948875.1|428587_429334_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	2.9e-10
WP_000908026.1|429308_430580_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000577988.1|430576_431797_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
>prophage 31
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	440085	442352	5277702		Escherichia_phage(50.0%)	3	NA	NA
WP_001602609.1|440085_440754_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
WP_001069975.1|440750_441536_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_000587549.1|441539_442352_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 32
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	447856	456737	5277702		Orpheovirus(20.0%)	9	NA	NA
WP_000493947.1|447856_448498_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
WP_000098911.1|448537_449686_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	4.2e-85
WP_001182363.1|449976_451188_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000269493.1|451300_452233_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190982.1|452229_453255_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000102278.1|453553_453643_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000701040.1|453808_454978_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007277.1|455212_455794_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	47.0	4.0e-44
WP_000101193.1|455921_456737_-	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 33
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	465539	467038	5277702		Indivirus(50.0%)	2	NA	NA
WP_000250656.1|465539_466436_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
WP_001296937.1|466516_467038_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
>prophage 34
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	473949	475224	5277702	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|473949_475224_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 35
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	486600	487763	5277702	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_085947771.1|486600_487763_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 36
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	496370	498182	5277702		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945899.1|496370_498182_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.7	0.0e+00
>prophage 37
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	508077	509379	5277702		Bacillus_phage(100.0%)	1	NA	NA
WP_000732487.1|508077_509379_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	7.2e-17
>prophage 38
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	519479	711697	5277702	lysis,terminase,protease,head,capsid,tail,integrase,holin,portal,transposase,plate	Vibrio_phage(20.56%)	218	612415:612431	705447:705463
WP_001260857.1|519479_520301_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|520400_520484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|520576_520912_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|521308_522562_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019536.1|522668_523562_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225262.1|523696_524917_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|525041_525737_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071586743.1|525689_526982_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148706.1|527140_527755_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.8	3.3e-28
WP_000526505.1|527797_528652_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|528653_529271_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_104457354.1|529281_531708_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.7	4.0e-210
WP_001300836.1|531906_532212_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|532319_533030_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|533032_533593_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|533627_533969_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001295395.1|534103_534430_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
WP_001254932.1|536005_537157_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_032142258.1|538305_539814_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.3	1.2e-44
WP_084832530.1|540122_540494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001557860.1|542312_542420_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_000887491.1|542464_542677_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_001325325.1|543135_543414_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	7.4e-12
WP_001047135.1|544477_545230_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|545507_545597_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|545651_545864_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|546164_546380_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_011787758.1|546792_548403_-|transposase	IS1634-like element ISSpu7 family transposase	transposase	NA	NA	NA	NA
WP_104457355.1|548900_549128_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.2	2.9e-30
WP_000066495.1|550208_550421_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|550431_550620_+	cold-shock protein	NA	NA	NA	NA	NA
WP_122985912.1|550622_550688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309517.1|550767_550923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|551094_551268_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_074523751.1|551419_551830_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	78.7	9.4e-56
WP_001368374.1|551887_552121_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453603.1|552509_553055_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	8.1e-95
WP_001549229.1|553029_554955_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198149.1|554951_555158_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001324962.1|555154_556756_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	1.9e-309
WP_000123333.1|556736_558056_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.9	1.6e-234
WP_001549228.1|558065_558398_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000063224.1|558453_559479_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
WP_000158873.1|559520_559916_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.2	4.8e-57
WP_000752994.1|559927_560281_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000975060.1|560292_560871_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	96.9	5.0e-79
WP_000683143.1|560867_561263_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_001439072.1|561270_562011_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	4.0e-129
WP_000479139.1|562026_562449_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.4e-70
WP_000459480.1|562430_562865_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
WP_000840345.1|562857_565437_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	98.3	0.0e+00
WP_000847345.1|565433_565763_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001152580.1|565762_566461_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.4e-131
WP_000140764.1|566466_567210_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	4.5e-149
WP_016243429.1|567742_568330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016239630.1|568436_568673_+	transcriptional regulator	NA	A0A0C4UQU0	Shigella_phage	59.4	1.2e-15
WP_016239629.1|568672_570655_+	hypothetical protein	NA	A0A0C4UR24	Shigella_phage	51.1	8.3e-190
WP_016239628.1|570750_571689_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	47.2	1.0e-73
WP_016239627.1|571693_571933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016239626.1|571935_572226_+	hypothetical protein	NA	C9DGL7	Escherichia_phage	46.0	3.1e-13
WP_016239625.1|572240_572516_+	hypothetical protein	NA	A0A1C6ZDJ8	Pseudomonas_phage	52.9	2.8e-11
WP_016239624.1|572520_572772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016239623.1|572779_573307_+	hypothetical protein	NA	A0A125RNF6	Pseudomonas_phage	57.3	6.7e-46
WP_016239622.1|573396_574053_+	hypothetical protein	NA	A0A291AUJ5	Sinorhizobium_phage	48.9	3.2e-13
WP_016239621.1|574030_574558_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	49.4	2.2e-41
WP_016239620.1|574554_574962_+	hypothetical protein	NA	A0A0C4UR27	Shigella_phage	63.2	9.7e-37
WP_016239619.1|574966_575290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104457356.1|575386_575977_+	N-acetylmuramidase	NA	A0A2I7S9B9	Vibrio_phage	45.7	7.0e-36
WP_016239617.1|575978_576197_+	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	69.4	4.6e-25
WP_016239616.1|576189_576597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016239615.1|576584_577193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016239614.1|577189_577396_+	TraR family phage/conjugal plasmid C-4 type zinc finger protein	NA	NA	NA	NA	NA
WP_016239613.1|577396_577702_+	DUF2730 family protein	NA	M1Q558	Vibrio_phage	38.3	5.6e-13
WP_016239612.1|577714_578002_+	hypothetical protein	NA	M1PPT9	Vibrio_phage	64.5	4.6e-25
WP_016239611.1|578004_578379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016239610.1|578371_578650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016239609.1|578639_579218_+	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	54.5	4.8e-45
WP_016239608.1|579214_580798_+	hypothetical protein	NA	M4MHG0	Vibrio_phage	69.1	4.6e-199
WP_044068340.1|580797_582366_+	DUF935 domain-containing protein	NA	M4M9P3	Vibrio_phage	56.2	5.1e-158
WP_016239606.1|582358_583153_+	hypothetical protein	NA	M4M9M5	Vibrio_phage	57.5	6.0e-91
WP_016239605.1|583356_584313_+	hypothetical protein	NA	M1Q578	Vibrio_phage	51.0	2.6e-80
WP_016239604.1|584316_585210_+	hypothetical protein	NA	M4MB71	Vibrio_phage	56.4	1.3e-94
WP_016239603.1|585293_585887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016239602.1|585886_586327_+	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	47.9	1.4e-33
WP_016239601.1|586326_586869_+	hypothetical protein	NA	M4MB67	Vibrio_phage	59.2	1.4e-54
WP_016239600.1|586865_587489_+	hypothetical protein	NA	M4MHF0	Vibrio_phage	44.5	2.2e-35
WP_016239599.1|587469_587658_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_016239598.1|587657_589136_+	hypothetical protein	NA	M1Q565	Vibrio_phage	54.0	9.7e-151
WP_016239597.1|589145_589502_+	hypothetical protein	NA	A0A2I7S9D5	Vibrio_phage	44.6	2.0e-22
WP_016239596.1|589505_589901_+	hypothetical protein	NA	M1NVT1	Vibrio_phage	42.9	4.0e-19
WP_016239595.1|589987_591907_+	hypothetical protein	NA	M4MHE6	Vibrio_phage	34.5	1.6e-57
WP_016239594.1|591906_593238_+	hypothetical protein	NA	A0A2I7S9E8	Vibrio_phage	36.1	5.0e-74
WP_016239593.1|593237_594329_+	hypothetical protein	NA	M1PVV2	Vibrio_phage	46.3	4.1e-90
WP_016239592.1|594319_594862_+|plate	phage baseplate assembly protein V	plate	M1Q572	Vibrio_phage	40.9	6.5e-28
WP_016239591.1|594858_595311_+	hypothetical protein	NA	M1PPW1	Vibrio_phage	42.8	4.0e-23
WP_016239590.1|595300_596377_+|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	52.8	1.0e-101
WP_016239589.1|596361_596952_+	DUF2313 domain-containing protein	NA	M4M9M8	Vibrio_phage	50.3	9.8e-54
WP_104457357.1|596951_597620_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	76.8	6.0e-76
WP_039264109.1|597772_599365_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.8	1.9e-181
WP_021567584.1|599395_599746_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	3.3e-41
WP_021567585.1|599742_600150_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	37.8	6.1e-15
WP_104457358.1|600517_601120_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	89.4	2.1e-96
WP_104457599.1|601120_601633_-|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	58.0	8.8e-43
WP_016239587.1|601683_602238_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	3.1e-86
WP_104457600.1|602303_602612_+|tail	tail assembly protein	tail	A0A291AWV5	Escherichia_phage	80.8	1.6e-36
WP_000515751.1|602672_606152_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.8	0.0e+00
WP_001233182.1|606219_606819_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.5	2.5e-105
WP_000279189.1|606883_610234_+	hypothetical protein	NA	X2KTY7	Enterobacteria_phage	35.5	2.4e-11
WP_000885610.1|610233_610809_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086522.1|610906_611497_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
WP_000836768.1|611813_612047_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|612115_612229_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
612415:612431	attL	CTACACGGATTGGGTTT	NA	NA	NA	NA
WP_016243594.1|612831_614115_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527778.1|614203_615664_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.9	1.1e-42
WP_000214712.1|615699_615903_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000215549.1|616079_616766_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001324973.1|616854_617601_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_001549225.1|617737_619783_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_001024561.1|619827_620346_-	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_000671731.1|620621_621014_+	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_000592826.1|621268_622159_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.1e-19
WP_000901367.1|622377_622473_-	protein MgtS	NA	NA	NA	NA	NA
WP_001054189.1|622599_623787_-	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000087214.1|623981_624881_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_000803659.1|624911_625130_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091199.1|625161_625545_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000843419.1|625564_625999_-	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000273128.1|626217_626538_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	42.3	7.2e-19
WP_000268704.1|626527_626812_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000885033.1|626932_627598_+	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000210799.1|627622_628813_-	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000258573.1|628962_630078_-	putative protein YneK	NA	NA	NA	NA	NA
WP_000366501.1|630155_631037_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000156615.1|631137_632526_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000257409.1|632589_633516_+	glutaminase B	NA	NA	NA	NA	NA
WP_001191027.1|633515_633875_+	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000558029.1|634013_635432_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.9e-18
WP_000854633.1|635658_637110_+	tagaturonate reductase	NA	NA	NA	NA	NA
WP_001313828.1|637316_638231_+	bestrophin family inner membrane protein	NA	NA	NA	NA	NA
WP_001286597.1|638234_638993_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_000558527.1|639049_639340_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_000774187.1|639363_640239_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000172466.1|640265_641288_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_001222717.1|641299_642292_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000911184.1|642291_643320_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001194861.1|643313_644849_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	9.8e-21
WP_000154339.1|645097_646051_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_000113145.1|646129_647722_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001549224.1|648252_653673_+	autotransporter barrel domain-containing lipoprotein	NA	A0A2L1IV18	Escherichia_phage	38.1	3.6e-142
WP_001301023.1|653895_654162_+	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_001125439.1|654161_655484_+	type II toxin-antitoxin system serine/threonine protein kinase toxin HipA	NA	NA	NA	NA	NA
WP_016239971.1|655774_656581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016239970.1|656598_657039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016239969.1|657191_658553_-	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_000589340.1|658566_659370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611902.1|659428_660775_-|transposase	ISNCY-like element ISLad2 family transposase	transposase	NA	NA	NA	NA
WP_104457359.1|661104_661638_-	DUF2514 family protein	NA	NA	NA	NA	NA
WP_104457360.1|661634_662162_-	lysozyme	NA	H9C184	Pectobacterium_phage	78.4	6.0e-79
WP_104457361.1|662151_662337_-|holin	holin	holin	I6R0S9	Salmonella_phage	55.1	8.7e-09
WP_104457362.1|662337_662676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104457363.1|662675_663290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158649913.1|663371_663563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104457365.1|663572_665681_-	tape measure protein	NA	W8VLG7	Pseudomonas_phage	32.8	1.9e-14
WP_104457366.1|665808_666297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158649916.1|666296_666704_-	DUF3277 family protein	NA	NA	NA	NA	NA
WP_104457368.1|666725_668084_-	DUF3383 family protein	NA	A0A142IDK3	Pseudomonas_phage	22.8	7.6e-09
WP_104457369.1|668084_668873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104457370.1|668872_669226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104457371.1|669222_669696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104457372.1|669881_670079_-	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	89.2	9.2e-25
WP_104457373.1|670136_670496_-	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_104457374.1|670505_670763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104457375.1|670766_671705_-	DUF2184 domain-containing protein	NA	E5AGA8	Erwinia_phage	29.7	3.3e-27
WP_104457376.1|671722_672514_-	Ig domain-containing protein	NA	A0A1S5R5Y7	Pseudomonas_phage	57.0	1.3e-13
WP_104457377.1|672513_673530_-	DUF2213 domain-containing protein	NA	A0A291LCH5	Klebsiella_phage	29.5	8.2e-16
WP_104457378.1|673501_674863_-|head	phage head morphogenesis protein	head	D6PSX3	Lactobacillus_phage	23.9	1.8e-10
WP_104457379.1|674849_676232_-	DUF1073 domain-containing protein	NA	NA	NA	NA	NA
WP_104457380.1|676228_677638_-|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	34.7	3.4e-60
WP_104457381.1|677624_678173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104457382.1|678516_678672_-	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_104457383.1|679141_680770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104457384.1|680787_681303_+	recombinase	NA	Q5QBN4	Enterobacteria_phage	47.5	4.2e-37
WP_104457385.1|681415_682705_+	hypothetical protein	NA	C3V1V7	Escherichia_virus	33.0	2.6e-27
WP_104457386.1|682701_683133_+	hypothetical protein	NA	Q9MCR5	Enterobacteria_phage	50.6	4.0e-12
WP_104457387.1|683147_683420_-	hypothetical protein	NA	H6WRY4	Salmonella_phage	56.8	5.3e-23
WP_104457388.1|683505_684138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104457389.1|684137_684374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104457390.1|684370_684604_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_104457391.1|684596_685352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104457392.1|685351_686761_-|plate	baseplate protein	plate	Q2NPA2	Xanthomonas_phage	27.3	6.2e-06
WP_104457393.1|686747_687095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104457394.1|687094_687313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104457395.1|687309_687687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104457396.1|687695_688406_-|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_104457397.1|688402_689356_-	hypothetical protein	NA	A0A1D8EQC7	Escherichia_phage	24.4	1.1e-06
WP_104457398.1|689911_690133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104457399.1|690436_690694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104457400.1|690690_691575_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_104457401.1|691564_691927_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_104457402.1|691926_692358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104457403.1|692354_692621_-	hypothetical protein	NA	A1YZS4	Burkholderia_virus	54.8	8.1e-16
WP_104457404.1|692617_692986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104457405.1|692972_693251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104457406.1|693247_693517_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_104457407.1|693527_694250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104457408.1|694252_694780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104457409.1|694790_695081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059072.1|695816_696692_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000086929.1|696675_698226_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000716059.1|698222_700589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097719236.1|700588_700870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001118645.1|700916_701840_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	1.0e-166
WP_001101446.1|702157_703183_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_104457410.1|703179_703842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089551206.1|704164_705154_-	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_001493844.1|705689_707243_-	DNA-directed RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
705447:705463	attR	CTACACGGATTGGGTTT	NA	NA	NA	NA
WP_032175391.1|707517_708522_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001530084.1|709468_711697_-	DEAD/DEAH box helicase family protein	NA	Q9T1H9	Lactobacillus_phage	25.8	3.0e-23
>prophage 39
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	715146	716419	5277702	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_088765672.1|715146_716419_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 40
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	733084	735880	5277702		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_001384488.1|733084_735880_+	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	4.4e-19
>prophage 41
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	741250	744022	5277702		Bacillus_virus(100.0%)	1	NA	NA
WP_016239960.1|741250_744022_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	G3MA91	Bacillus_virus	29.3	2.5e-11
>prophage 42
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	748338	750244	5277702		Planktothrix_phage(100.0%)	2	NA	NA
WP_000193559.1|748338_749325_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	5.0e-18
WP_001285536.1|749317_750244_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	4.1e-14
>prophage 43
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	753517	754958	5277702		Tupanvirus(50.0%)	2	NA	NA
WP_000642432.1|753517_754528_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
WP_000781370.1|754673_754958_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 44
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	768341	769886	5277702		Escherichia_phage(100.0%)	1	NA	NA
WP_000702546.1|768341_769886_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	4.9e-20
>prophage 45
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	783059	784844	5277702		Ralstonia_phage(100.0%)	1	NA	NA
WP_104457412.1|783059_784844_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.4e-25
>prophage 46
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	789750	791853	5277702		Salmonella_phage(100.0%)	1	NA	NA
WP_000689315.1|789750_791853_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	4.7e-135
>prophage 47
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	798984	809158	5277702	transposase	Mycoplasma_phage(20.0%)	10	NA	NA
WP_000220434.1|798984_799998_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
WP_000047430.1|800015_801161_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000760630.1|801405_802812_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001270286.1|802890_803307_-	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000813794.1|803352_803529_-	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_000494244.1|803750_803981_+	YncJ family protein	NA	NA	NA	NA	NA
WP_001488038.1|804072_806034_-	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.6	1.6e-23
WP_000429169.1|806106_806643_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001324881.1|806695_807910_+	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000826408.1|807949_809158_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.8	1.3e-206
>prophage 48
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	820965	821914	5277702		Moraxella_phage(50.0%)	2	NA	NA
WP_000731833.1|820965_821139_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_000428998.1|821383_821914_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
>prophage 49
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	825853	829756	5277702		Klosneuvirus(100.0%)	1	NA	NA
WP_000139598.1|825853_829756_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.7	7.6e-54
>prophage 50
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	868885	869875	5277702		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|868885_869875_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 51
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	874835	876544	5277702		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000837924.1|874835_875969_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001082294.1|876109_876544_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
>prophage 52
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	881878	905616	5277702	integrase,tRNA	Escherichia_phage(62.5%)	28	876631:876644	905635:905648
876631:876644	attL	CACTGTTTTTATAT	NA	NA	NA	NA
WP_001676522.1|881878_883876_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
WP_016239946.1|884216_884639_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	6.3e-63
WP_000450660.1|884654_885416_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.0	1.7e-114
WP_016239945.1|885438_886185_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	79.7	1.5e-112
WP_001396581.1|886191_886980_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000693803.1|887057_887480_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001072342.1|887476_887731_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233319.1|887810_888230_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001169151.1|888662_888818_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|888814_889303_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|889744_889966_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|889965_890136_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|890210_890486_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001549183.1|890587_893188_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	4.4e-247
WP_000166319.1|893180_893990_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|894046_894241_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|894233_894443_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|894521_894737_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|894738_895974_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001157407.1|896025_896961_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123745.1|897089_898463_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001296046.1|898492_898666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387388.1|898940_899924_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001549182.1|900178_901411_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_001046829.1|901431_901995_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_104457413.1|903873_904974_+|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	56.6	5.8e-116
WP_096307836.1|905059_905377_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.0	1.1e-22
WP_104457414.1|905376_905616_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	51.9	2.8e-15
905635:905648	attR	CACTGTTTTTATAT	NA	NA	NA	NA
>prophage 53
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	908860	947073	5277702	terminase	Salmonella_phage(30.61%)	62	NA	NA
WP_104457415.1|908860_909742_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	60.2	2.1e-28
WP_102005247.1|909741_910515_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	54.4	2.6e-78
WP_104457416.1|910511_911708_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.6	4.3e-157
WP_104457417.1|911707_912061_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	78.6	3.0e-50
WP_104457418.1|912062_912716_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	51.0	7.0e-61
WP_158649914.1|912778_913120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104457420.1|913144_913381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104457421.1|913377_913938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104457601.1|914075_914309_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	51.3	9.9e-18
WP_104457422.1|914409_915441_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	52.8	1.9e-97
WP_104457423.1|915443_915746_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	1.2e-26
WP_070544622.1|915746_916346_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.1	1.1e-52
WP_104457424.1|916345_918364_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	59.0	2.1e-217
WP_049073657.1|918353_918506_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	86.0	1.7e-18
WP_070544624.1|918547_918997_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	55.3	9.7e-38
WP_064173837.1|919000_919441_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	79.5	9.5e-62
WP_104457425.1|919451_920603_-	DUF3383 family protein	NA	A0A0M4RD26	Salmonella_phage	82.0	2.5e-178
WP_104457426.1|920604_921156_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	44.9	2.0e-40
WP_009652660.1|921148_921553_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	71.5	1.1e-43
WP_104457427.1|921552_922059_-	hypothetical protein	NA	A0A2H4J488	uncultured_Caudovirales_phage	37.8	4.8e-17
WP_104457428.1|922055_922475_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	54.1	1.4e-35
WP_104457429.1|922443_922725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086076531.1|922764_923703_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	76.9	1.0e-137
WP_104457430.1|923714_924209_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.1	1.2e-49
WP_104457431.1|924212_925415_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	53.9	1.3e-105
WP_102005327.1|925464_926013_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_104457432.1|926068_927520_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.4	9.4e-191
WP_021312714.1|927757_929158_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.2	9.4e-188
WP_104457433.1|929108_929873_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	75.6	1.6e-11
WP_104457434.1|929932_930631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104457435.1|930911_931301_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	43.7	9.4e-21
WP_104457436.1|931297_931822_-	lysozyme	NA	Q71TF3	Escherichia_phage	53.6	8.4e-49
WP_104457437.1|931805_932048_-	hypothetical protein	NA	O64361	Escherichia_phage	34.0	3.3e-08
WP_104457438.1|932520_933099_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	58.3	2.2e-50
WP_104457439.1|933095_933755_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	80.5	2.4e-101
WP_032729779.1|933747_934056_-	DUF968 domain-containing protein	NA	Q6V7S4	Burkholderia_virus	56.5	1.6e-23
WP_023312767.1|934290_934560_-	hypothetical protein	NA	H6WRY4	Salmonella_phage	81.8	1.2e-35
WP_104457440.1|934632_934947_-	hypothetical protein	NA	A0A220NQY7	Salmonella_phage	37.5	1.8e-06
WP_104457441.1|935719_935908_-	diguanylate phosphodiesterase	NA	A0A192Y8X2	Salmonella_phage	87.1	8.2e-23
WP_104457442.1|935907_936375_-	hypothetical protein	NA	A0A077SLK5	Escherichia_phage	43.4	8.3e-16
WP_104457602.1|936371_936668_-	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	64.1	9.3e-29
WP_104457443.1|936670_937132_-	hypothetical protein	NA	H6WYJ9	Enterobacter_phage	54.5	5.2e-10
WP_104457444.1|937128_937914_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	49.8	1.1e-60
WP_023158880.1|937906_938128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032454809.1|938127_938523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104457445.1|938549_939644_-	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	42.3	2.5e-31
WP_023312759.1|939640_939895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064171437.1|940098_940380_-	hypothetical protein	NA	A2SY75	Escherichia_phage	58.2	2.4e-18
WP_023312757.1|940419_940638_-	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	52.2	2.8e-14
WP_104457446.1|940746_941406_+	helix-turn-helix domain-containing protein	NA	K7PGR7	Enterobacteria_phage	63.3	1.5e-71
WP_104457447.1|941464_941668_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	67.2	2.9e-18
WP_104457448.1|941901_942120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104457449.1|942085_942280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104457450.1|942758_943052_+	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_123640128.1|943124_943346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104457452.1|943577_943802_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	52.7	4.4e-15
WP_104457453.1|943798_944143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104457454.1|944135_944750_+	hypothetical protein	NA	R9VWB9	Serratia_phage	52.3	1.3e-56
WP_104457603.1|944749_945316_+	HNH endonuclease	NA	Q94MV4	Myxococcus_phage	60.9	3.6e-37
WP_104457455.1|945312_945588_+	hypothetical protein	NA	A0A1U8QJU8	Salmonella_virus	58.3	9.2e-23
WP_016530209.1|945707_945968_+	hypothetical protein	NA	A0A1L5C290	Pseudoalteromonas_phage	43.7	1.5e-11
WP_000945021.1|946557_947073_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
>prophage 54
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	965236	966319	5277702		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057972.1|965236_966319_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 55
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	976148	977300	5277702	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001549175.1|976148_977300_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	5.8e-42
>prophage 56
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	981546	982812	5277702		Klosneuvirus(100.0%)	1	NA	NA
WP_000069229.1|981546_982812_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	2.0e-24
>prophage 57
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	995727	1001384	5277702		Bacillus_virus(50.0%)	5	NA	NA
WP_000573407.1|995727_996534_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_000565727.1|996601_996955_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|997322_998111_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_001301103.1|998254_999382_+	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000484979.1|999449_1001384_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.6	6.9e-32
>prophage 58
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1009201	1009792	5277702		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|1009201_1009792_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 59
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1014717	1020009	5277702	protease	Tupanvirus(33.33%)	4	NA	NA
WP_001297122.1|1014717_1017315_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
WP_001031530.1|1017694_1017946_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422045.1|1017981_1019031_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_097719121.1|1019250_1020009_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	2.0e-06
>prophage 60
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1026977	1029935	5277702		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000763511.1|1026977_1028573_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001344826.1|1028576_1029935_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
>prophage 61
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1041593	1043608	5277702		Bacillus_virus(50.0%)	2	NA	NA
WP_000994905.1|1041593_1042598_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_000110954.1|1042594_1043608_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 62
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1052018	1063544	5277702	transposase	Citrobacter_phage(20.0%)	11	NA	NA
WP_104457456.1|1052018_1052636_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.1	1.1e-52
WP_088765672.1|1052792_1054065_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001287378.1|1054575_1054989_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718995.1|1055133_1056042_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_000193447.1|1056243_1057257_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_001295622.1|1057348_1058254_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_001362540.1|1058366_1058825_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555849.1|1058874_1059717_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001160110.1|1060621_1061299_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000571703.1|1061298_1062009_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702660.1|1062005_1063544_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
>prophage 63
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1074799	1081601	5277702		Spodoptera_litura_granulovirus(33.33%)	9	NA	NA
WP_001146444.1|1074799_1075030_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
WP_001295620.1|1075299_1076400_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_000170963.1|1076804_1076912_+	small toxic polypeptide LdrB	NA	NA	NA	NA	NA
WP_000170951.1|1077339_1077447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000811065.1|1077593_1078448_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_001257044.1|1078483_1079293_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000200386.1|1079296_1079689_-	SirB family protein	NA	NA	NA	NA	NA
WP_000456454.1|1079685_1080519_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000804726.1|1080518_1081601_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 64
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1084737	1087489	5277702		Tupanvirus(50.0%)	2	NA	NA
WP_001298109.1|1084737_1085685_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_104457458.1|1085809_1087489_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	6.0e-24
>prophage 65
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1114156	1115844	5277702		Salmonella_phage(50.0%)	2	NA	NA
WP_000457608.1|1114156_1115425_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.2	1.8e-209
WP_000897378.1|1115424_1115844_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
>prophage 66
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1123680	1126329	5277702		Escherichia_phage(100.0%)	1	NA	NA
WP_000768545.1|1123680_1126329_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	42.2	2.5e-85
>prophage 67
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1131870	1135603	5277702		Enterobacteria_phage(66.67%)	5	NA	NA
WP_000332303.1|1131870_1132602_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|1132822_1133227_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032082692.1|1133279_1133390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032140255.1|1133926_1134250_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	64.5	2.6e-40
WP_000444488.1|1134352_1135603_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	3.2e-22
>prophage 68
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1138739	1140110	5277702		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_001549160.1|1138739_1140110_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
>prophage 69
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1145131	1147109	5277702		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000531601.1|1145131_1146268_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000799401.1|1146251_1147109_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
>prophage 70
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1150366	1154107	5277702		Vibrio_phage(50.0%)	4	NA	NA
WP_000952737.1|1150366_1151206_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.7e-23
WP_000291267.1|1151221_1152133_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_001251348.1|1152161_1153406_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001033694.1|1153405_1154107_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
>prophage 71
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1161396	1161654	5277702		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|1161396_1161654_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 72
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1173977	1175620	5277702		Streptococcus_virus(50.0%)	2	NA	NA
WP_104457459.1|1173977_1174982_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	36.0	1.3e-05
WP_001257000.1|1174978_1175620_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 73
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1178892	1180074	5277702		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|1178892_1179129_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_001008535.1|1179339_1180074_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
>prophage 74
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1185987	1187139	5277702	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001254932.1|1185987_1187139_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 75
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1193654	1194596	5277702		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|1193654_1194596_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 76
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1210477	1210723	5277702		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|1210477_1210723_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 77
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1215385	1216306	5277702		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|1215385_1216306_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 78
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1225614	1226148	5277702		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857410.1|1225614_1226148_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	2.0e-26
>prophage 79
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1230283	1231117	5277702		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|1230283_1231117_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 80
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1236637	1241533	5277702	transposase	Enterobacteria_phage(33.33%)	5	NA	NA
WP_001118645.1|1236637_1237561_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	1.0e-166
WP_104457463.1|1237597_1238566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389396.1|1238562_1238886_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_085947771.1|1238971_1240133_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000409885.1|1240174_1241533_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.2	1.9e-20
>prophage 81
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1248352	1249276	5277702		Cronobacter_phage(100.0%)	1	NA	NA
WP_001295604.1|1248352_1249276_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.2	4.1e-91
>prophage 82
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1264041	1266316	5277702		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001028095.1|1264041_1264536_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001325510.1|1264556_1265885_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.5	6.7e-236
WP_001273658.1|1266142_1266316_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
>prophage 83
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1270610	1282865	5277702		Klosneuvirus(20.0%)	13	NA	NA
WP_000420617.1|1270610_1271531_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
WP_000024560.1|1271530_1271836_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209893.1|1271928_1272528_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001549148.1|1272524_1275071_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.0e-70
WP_001230242.1|1275070_1276243_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120112.1|1276372_1277065_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264919.1|1277037_1278066_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_071586760.1|1278148_1280893_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_104457464.1|1280964_1282038_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|1282085_1282259_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001316982.1|1282248_1282479_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|1282453_1282642_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|1282652_1282865_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
>prophage 84
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1304110	1304323	5277702		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_104457466.1|1304110_1304323_+	AlpA family transcriptional regulator	NA	B7SYF9	Stenotrophomonas_phage	44.7	7.9e-06
>prophage 85
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1307687	1311140	5277702	transposase	Acinetobacter_phage(50.0%)	3	NA	NA
WP_085947771.1|1307687_1308850_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_104457474.1|1309034_1309505_-	DUF4756 family protein	NA	NA	NA	NA	NA
WP_104457475.1|1310405_1311140_-	DNA-binding protein	NA	M1Q742	Cellulophaga_phage	41.6	1.7e-26
>prophage 86
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1329664	1331947	5277702	protease,integrase	Ralstonia_phage(50.0%)	2	1329217:1329231	1331111:1331125
1329217:1329231	attL	CAAAAGAAAAAGGGG	NA	NA	NA	NA
WP_104457492.1|1329664_1330903_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.9	1.8e-78
WP_000375136.1|1331287_1331947_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
1331111:1331125	attR	CCCCTTTTTCTTTTG	NA	NA	NA	NA
>prophage 87
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1336180	1338235	5277702		Bacillus_phage(100.0%)	1	NA	NA
WP_000420536.1|1336180_1338235_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
>prophage 88
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1350845	1352753	5277702		Tupanvirus(100.0%)	1	NA	NA
WP_000053091.1|1350845_1352753_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
>prophage 89
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1364635	1365787	5277702	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001254932.1|1364635_1365787_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 90
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1369896	1382632	5277702	transposase,tRNA	Bacillus_virus(20.0%)	9	NA	NA
WP_001090506.1|1369896_1370664_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
WP_000193850.1|1370706_1373319_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	9.1e-19
WP_001297200.1|1373584_1374787_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|1374955_1376356_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_011787758.1|1377244_1378855_+|transposase	IS1634-like element ISSpu7 family transposase	transposase	NA	NA	NA	NA
WP_104457494.1|1378847_1379813_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.7	3.8e-87
WP_000462687.1|1379997_1381188_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_001109487.1|1381409_1382057_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|1382083_1382632_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 91
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1397337	1401878	5277702		Bacillus_phage(100.0%)	3	NA	NA
WP_000551270.1|1397337_1399086_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000705714.1|1399122_1401387_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|1401593_1401878_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 92
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1406964	1408053	5277702		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057149.1|1406964_1408053_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 93
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1412150	1415365	5277702		Tetraselmis_virus(100.0%)	2	NA	NA
WP_001292822.1|1412150_1414433_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000111043.1|1414624_1415365_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 94
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1421673	1512991	5277702	lysis,terminase,protease,head,capsid,tail,integrase,tRNA,portal,plate	Salmonella_phage(55.93%)	94	1417947:1417962	1515562:1515577
1417947:1417962	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_000213098.1|1421673_1422291_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850323.1|1422301_1424746_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	3.9e-221
WP_000886683.1|1424984_1426277_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067748.1|1426367_1427711_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.3	3.6e-80
WP_001295343.1|1427721_1428333_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077024.1|1428487_1432555_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|1432689_1433184_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537403.1|1433727_1434693_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_001043579.1|1434815_1436582_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_001202216.1|1436582_1438304_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	4.9e-21
WP_001241678.1|1438345_1439050_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|1439334_1439553_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|1440477_1442754_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|1442784_1443105_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|1443427_1443652_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188180.1|1443724_1445671_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746460.1|1445667_1446783_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_137468381.1|1446933_1447890_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599806.1|1447886_1449545_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001298299.1|1449970_1450666_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491142.1|1451160_1452060_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_104457495.1|1452203_1453856_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178677.1|1453867_1454836_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815362.1|1454968_1456687_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
WP_000566368.1|1456723_1457725_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136554.1|1457735_1459166_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|1459264_1460278_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255168.1|1460274_1461105_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|1461101_1461425_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270734.1|1461550_1462066_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|1462283_1463012_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|1463029_1463761_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001673.1|1463767_1464484_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|1464483_1465152_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|1465377_1466109_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149740.1|1466307_1467435_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
WP_000389260.1|1467475_1467964_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061665.1|1468023_1468869_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105444.1|1468865_1469819_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996005.1|1469828_1470962_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126072.1|1471056_1472169_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|1472519_1472996_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|1473083_1473986_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189162.1|1474046_1474769_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|1474752_1475040_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195225.1|1475199_1475457_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	3.0e-23
WP_000681108.1|1475486_1475864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024876.1|1476133_1477819_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|1478054_1478273_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001011791.1|1478363_1479464_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
WP_000980413.1|1479460_1479946_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_016243528.1|1479942_1483020_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.9	0.0e+00
WP_000763311.1|1483012_1483132_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|1483146_1483449_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207660.1|1483503_1484019_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_000046117.1|1484028_1485201_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	7.8e-204
WP_000905032.1|1485343_1485910_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_024191337.1|1486313_1486754_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	62.6	5.6e-46
WP_000368074.1|1486725_1487328_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.5	1.5e-97
WP_000104823.1|1487327_1488857_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	70.8	5.4e-197
WP_001086847.1|1488853_1489459_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	91.5	6.4e-109
WP_001240755.1|1489451_1490360_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	5.9e-143
WP_000177579.1|1490346_1490706_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_000993759.1|1490702_1491281_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	82.8	9.1e-89
WP_000829139.1|1491349_1491796_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	2.3e-63
WP_001039935.1|1491788_1492220_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	6.4e-71
WP_001080935.1|1492315_1492744_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	73.8	1.6e-45
WP_000727865.1|1492740_1493118_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
WP_001396370.1|1493119_1493593_-	lysozyme	NA	E5G6N1	Salmonella_phage	89.7	5.4e-79
WP_000171568.1|1493612_1493828_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|1493831_1494035_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673520.1|1494034_1494499_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
WP_000059193.1|1494594_1495245_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.4	4.3e-111
WP_000742501.1|1495248_1496307_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	92.8	9.3e-180
WP_000216257.1|1496323_1497157_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.3	2.2e-123
WP_016243525.1|1497299_1499066_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_000520346.1|1499065_1500100_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.5	5.1e-175
WP_016239485.1|1500169_1500835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001324710.1|1500834_1501269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000148121.1|1501281_1502388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104457496.1|1503023_1503215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000822802.1|1504786_1505086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001580533.1|1505153_1505342_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
WP_016243522.1|1505495_1507910_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.3	0.0e+00
WP_000104182.1|1507906_1508764_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.8	1.7e-160
WP_000752619.1|1508760_1508988_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_001244224.1|1508987_1509221_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_000996717.1|1509288_1509630_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_000956192.1|1509747_1510044_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_000460893.1|1510051_1510561_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188450.1|1510625_1510829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016243521.1|1510974_1511544_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.9	3.2e-38
WP_104457497.1|1511559_1511775_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	4.5e-09
WP_001459604.1|1511938_1512991_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.1e-105
1515562:1515577	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 95
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1519125	1520328	5277702		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001300708.1|1519125_1520328_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	1.1e-99
>prophage 96
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1531663	1533535	5277702		Planktothrix_phage(100.0%)	1	NA	NA
WP_001120571.1|1531663_1533535_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	6.8e-16
>prophage 97
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1536853	1545195	5277702		Synechococcus_phage(33.33%)	6	NA	NA
WP_001295294.1|1536853_1537516_-	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.1	3.3e-26
WP_001295295.1|1537646_1538546_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000209342.1|1538551_1540984_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	44.9	1.6e-09
WP_000114272.1|1541129_1541945_+	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000168797.1|1542096_1543362_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000961458.1|1543602_1545195_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 98
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1550192	1555417	5277702		Escherichia_phage(33.33%)	6	NA	NA
WP_001295296.1|1550192_1550708_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|1550760_1550826_-	protein YliM	NA	NA	NA	NA	NA
WP_001295297.1|1551060_1551948_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|1552246_1552750_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|1553153_1553900_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000569080.1|1554694_1555417_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
>prophage 99
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1559101	1573913	5277702		Erwinia_phage(14.29%)	13	NA	NA
WP_001325348.1|1559101_1559362_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	2.2e-05
WP_000430057.1|1559626_1561909_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990177.1|1561950_1562628_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000146343.1|1562701_1562968_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|1563232_1563493_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443530.1|1563721_1564807_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000386551.1|1564947_1565910_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001340191.1|1565937_1568088_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_001145127.1|1568207_1568690_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	2.6e-36
WP_000007101.1|1568921_1570286_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_016243520.1|1570514_1571186_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000743444.1|1571188_1572184_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996107.1|1572176_1573913_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
>prophage 100
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1584511	1585420	5277702		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|1584511_1585420_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 101
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1591900	1593190	5277702		Klosneuvirus(100.0%)	1	NA	NA
WP_001295303.1|1591900_1593190_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
>prophage 102
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1603545	1610120	5277702		Planktothrix_phage(33.33%)	7	NA	NA
WP_000891669.1|1603545_1604604_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.4	1.3e-19
WP_000604034.1|1604606_1605296_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000101984.1|1605295_1606069_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|1606235_1606385_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001147439.1|1606513_1607302_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000096877.1|1607369_1608842_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	5.5e-13
WP_001265449.1|1609103_1610120_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	4.7e-80
>prophage 103
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1614476	1617996	5277702		Klebsiella_phage(33.33%)	4	NA	NA
WP_001109198.1|1614476_1615529_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	4.4e-81
WP_000784349.1|1615844_1616225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000951292.1|1616338_1617280_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000345410.1|1617276_1617996_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
>prophage 104
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1654006	1654798	5277702		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114025.1|1654006_1654798_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	28.8	3.7e-08
>prophage 105
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1658176	1661226	5277702		Acinetobacter_phage(50.0%)	2	NA	NA
WP_001032694.1|1658176_1659658_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
WP_000207151.1|1659807_1661226_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.2	4.4e-60
>prophage 106
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1664465	1677192	5277702		uncultured_Caudovirales_phage(25.0%)	8	NA	NA
WP_104457498.1|1664465_1668665_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.2	2.8e-25
WP_000424924.1|1668907_1669114_-	YbfA family protein	NA	NA	NA	NA	NA
WP_001365534.1|1669426_1669516_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000730111.1|1669515_1671189_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_000087944.1|1671211_1673260_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.1	6.4e-28
WP_001297248.1|1673268_1673841_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_001325476.1|1673833_1676518_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.5	1.4e-11
WP_000186109.1|1676514_1677192_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	6.8e-27
>prophage 107
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1690584	1694463	5277702	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_001287154.1|1690584_1692249_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
WP_001023145.1|1692516_1694463_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
>prophage 108
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1699229	1700894	5277702		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337087.1|1699229_1700894_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.1	1.0e-84
>prophage 109
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1704988	1706068	5277702		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490852.1|1704988_1706068_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 110
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1714013	1717546	5277702		Planktothrix_phage(50.0%)	3	NA	NA
WP_000631384.1|1714013_1714739_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_104457499.1|1714856_1715792_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_001549065.1|1715875_1717546_+	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.6	4.0e-76
>prophage 111
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1724485	1727068	5277702	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001297565.1|1724485_1727068_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 112
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1734078	1736518	5277702		Synechococcus_phage(50.0%)	2	NA	NA
WP_001231428.1|1734078_1735167_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092082.1|1735306_1736518_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 113
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1741333	1741980	5277702		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000939738.1|1741333_1741717_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|1741770_1741980_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 114
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1757405	1759520	5277702		Morganella_phage(50.0%)	2	NA	NA
WP_000278505.1|1757405_1757834_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
WP_000887629.1|1757954_1759520_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 115
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1762704	1764527	5277702		Streptococcus_phage(50.0%)	2	NA	NA
WP_000029826.1|1762704_1763925_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.3	2.3e-57
WP_000502936.1|1763897_1764527_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	3.8e-56
>prophage 116
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1778882	1784925	5277702		Klosneuvirus(50.0%)	3	NA	NA
WP_000140647.1|1778882_1779698_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
WP_000096692.1|1779694_1780828_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000077795.1|1781043_1784925_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.0	1.6e-59
>prophage 117
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1802151	1806911	5277702		Bacillus_phage(50.0%)	3	NA	NA
WP_000770953.1|1802151_1802835_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000253818.1|1802824_1804273_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_000103231.1|1805009_1806911_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	3.0e-27
>prophage 118
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1820016	1823147	5277702	tRNA	Enterococcus_phage(50.0%)	4	NA	NA
WP_000729160.1|1820016_1820883_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|1820884_1821097_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143552.1|1821204_1821726_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|1821761_1823147_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 119
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1834625	1835771	5277702		Streptococcus_phage(100.0%)	1	NA	NA
WP_000706355.1|1834625_1835771_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
>prophage 120
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1841961	1843743	5277702		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001549045.1|1841961_1843743_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	6.0e-38
>prophage 121
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1850650	1851337	5277702		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110570.1|1850650_1851337_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.2	2.5e-32
>prophage 122
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1854473	1855151	5277702		Bacillus_virus(100.0%)	1	NA	NA
WP_001157550.1|1854473_1855151_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	3.1e-27
>prophage 123
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1859690	1862751	5277702		uncultured_virus(50.0%)	2	NA	NA
WP_016239846.1|1859690_1862195_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.2	8.5e-115
WP_001344274.1|1862409_1862751_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	1.8e-39
>prophage 124
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1870942	1879503	5277702		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
WP_000801859.1|1870942_1871902_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.0	8.5e-15
WP_001250096.1|1871898_1872861_-	ferrochelatase	NA	NA	NA	NA	NA
WP_001220233.1|1873096_1873741_-	adenylate kinase	NA	NA	NA	NA	NA
WP_000678201.1|1873920_1875795_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001195025.1|1875904_1876510_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|1876509_1876839_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000122015.1|1876891_1878823_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000127356.1|1878951_1879503_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 125
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1884699	1890884	5277702	transposase	Staphylococcus_phage(50.0%)	3	NA	NA
WP_001254932.1|1884699_1885851_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001295324.1|1886518_1887712_+	multidrug efflux RND transporter periplasmic adaptor subunit AcrA	NA	NA	NA	NA	NA
WP_104457502.1|1887734_1890884_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.8	1.4e-53
>prophage 126
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1899720	1903267	5277702		Bacillus_phage(100.0%)	2	NA	NA
WP_001256211.1|1899720_1901502_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	5.2e-42
WP_001235611.1|1901494_1903267_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.6e-49
>prophage 127
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1906590	1907286	5277702		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817237.1|1906590_1907286_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.1	1.2e-87
>prophage 128
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1910426	1915473	5277702	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_001043542.1|1910426_1910699_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_001295325.1|1910907_1913262_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_000130305.1|1913449_1914724_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_000122253.1|1914849_1915473_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 129
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1937035	1946016	5277702	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_001021161.1|1937035_1937506_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_001150446.1|1937594_1938698_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.2	3.4e-52
WP_000543535.1|1938701_1939151_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001295327.1|1939301_1939841_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_001295328.1|1940139_1941024_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000974813.1|1941200_1941548_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_000046637.1|1941676_1942648_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934822.1|1942658_1944506_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|1944533_1944866_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667319.1|1944888_1946016_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 130
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1952968	1962940	5277702		Bacillus_phage(60.0%)	7	NA	NA
WP_000893623.1|1952968_1954264_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.7e-26
WP_000113933.1|1954321_1955011_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_001221319.1|1955200_1956403_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000698946.1|1956399_1959543_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001306939.1|1959668_1960853_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001219312.1|1960995_1961904_-	fructokinase	NA	NA	NA	NA	NA
WP_001298537.1|1962028_1962940_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
>prophage 131
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1967229	1968345	5277702		Bacillus_phage(100.0%)	1	NA	NA
WP_000484053.1|1967229_1968345_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 132
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1977527	1982401	5277702	transposase	uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_000830754.1|1977527_1978685_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	6.7e-06
WP_001295335.1|1978685_1979309_-	hydrogen peroxide resistance inhibitor IprA	NA	NA	NA	NA	NA
WP_104457505.1|1981128_1982401_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 133
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1987061	1987829	5277702		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939399.1|1987061_1987829_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-25
>prophage 134
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1993126	1994236	5277702		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|1993126_1994236_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 135
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	1997514	1999475	5277702		Micromonas_sp._RCC1109_virus(50.0%)	2	NA	NA
WP_001013499.1|1997514_1998528_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
WP_000044314.1|1998524_1999475_-	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
>prophage 136
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2004885	2009165	5277702		Enterobacteria_phage(50.0%)	2	NA	NA
WP_104457506.1|2004885_2005968_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	98.6	3.5e-190
WP_000177962.1|2006090_2009165_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	98.9	0.0e+00
>prophage 137
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2013703	2014603	5277702		Lactobacillus_phage(100.0%)	1	NA	NA
WP_000952500.1|2013703_2014603_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	5.5e-16
>prophage 138
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2017611	2019498	5277702		Staphylococcus_phage(100.0%)	1	NA	NA
WP_016243499.1|2017611_2019498_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	9.1e-53
>prophage 139
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2028179	2029229	5277702		Tupanvirus(100.0%)	1	NA	NA
WP_104457507.1|2028179_2029229_-	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	9.8e-73
>prophage 140
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2040615	2197000	5277702	lysis,terminase,protease,head,capsid,tail,integrase,holin,portal,transposase,plate	Shigella_phage(36.25%)	154	2135981:2136030	2179905:2179954
WP_000131056.1|2040615_2042649_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.7	2.6e-21
WP_001335745.1|2042777_2043365_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|2043378_2044851_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|2044864_2046535_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_024246162.1|2048116_2048302_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000860996.1|2048573_2049200_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000388269.1|2049290_2050022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000192349.1|2051675_2052722_+	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_001549021.1|2052830_2053763_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_001373486.1|2053749_2055153_-	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000213416.1|2055427_2056639_-	3-(3-hydroxy-phenyl)propionate transporter MhpT	NA	NA	NA	NA	NA
WP_001013515.1|2056708_2057722_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	30.8	1.2e-43
WP_000044263.1|2057718_2058669_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.0	4.0e-33
WP_000184938.1|2058665_2059475_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_000222149.1|2059484_2060351_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_000543445.1|2060379_2061333_-	3-carboxyethylcatechol 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_001189111.1|2063817_2065326_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_000227969.1|2065867_2066944_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000342159.1|2067166_2068465_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	48.6	2.3e-47
WP_001247776.1|2068791_2069055_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001549018.1|2069069_2069333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000643628.1|2069561_2069843_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350435.1|2069877_2070447_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_000101612.1|2070552_2073435_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.2	1.2e-128
WP_001295707.1|2073434_2073626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000412528.1|2073686_2075414_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	C7U047	Ostreococcus_tauri_virus	37.7	4.4e-86
WP_001275372.1|2075501_2075960_+	small heat shock protein sHSP20-GI	NA	NA	NA	NA	NA
WP_001022485.1|2075982_2076897_+	heat resistance protein YfdX1	NA	NA	NA	NA	NA
WP_001005473.1|2076999_2077887_+	heat resistance protein YfdX2	NA	NA	NA	NA	NA
WP_001090787.1|2077976_2078588_+	heat resistance membrane protein HdeD-GI	NA	NA	NA	NA	NA
WP_001166995.1|2078667_2079813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786817.1|2079802_2080243_+	heat resistance system thioredoxin Trx-GI	NA	A0A1J0GW78	Streptomyces_phage	37.2	3.4e-11
WP_001295706.1|2080246_2081962_+	heat resistance system K+/H+ antiporter KefB-GI	NA	NA	NA	NA	NA
WP_000843382.1|2081958_2082456_+	heat resistance protein PsiE-GI	NA	NA	NA	NA	NA
WP_000196689.1|2082433_2083399_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_000323729.1|2083423_2084575_+|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	7.5e-26
WP_001065555.1|2086490_2087354_+	GTPase family protein	NA	NA	NA	NA	NA
WP_000197388.1|2087445_2088267_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.7	1.8e-45
WP_000189411.1|2088483_2089185_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_001144031.1|2089225_2089462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547764.1|2089461_2089905_+	phage transcriptional regulator	NA	NA	NA	NA	NA
WP_001547765.1|2089927_2090395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194654.1|2090471_2090711_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001548150.1|2090808_2091267_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	9.0e-15
WP_000811693.1|2091282_2091759_+	RadC family protein	NA	NA	NA	NA	NA
WP_000691994.1|2091767_2091989_+	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000070396.1|2092007_2092325_+	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000854680.1|2092345_2092687_+	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_039264109.1|2092855_2094448_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.8	1.9e-181
WP_021567584.1|2094478_2094829_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	3.3e-41
WP_021567585.1|2094825_2095233_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	37.8	6.1e-15
WP_000723924.1|2096009_2097476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001333214.1|2097791_2098211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000355484.1|2098715_2099489_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000905043.1|2099549_2100104_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	86.7	1.4e-86
WP_016240346.1|2100264_2100504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000978831.1|2100503_2100947_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	62.4	3.3e-46
WP_000613358.1|2100918_2101512_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	64.4	2.7e-59
WP_016243480.1|2102334_2102919_-	YmfQ family protein	NA	O22003	Shigella_phage	99.0	7.0e-113
WP_016243479.1|2102909_2103968_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.3	5.2e-199
WP_042027905.1|2103954_2104380_-|tail	phage tail protein	tail	U5P0R9	Shigella_phage	99.3	3.9e-81
WP_001542670.1|2104379_2104928_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	96.2	5.2e-94
WP_016243477.1|2104927_2106007_-|tail	phage tail protein	tail	U5P0H6	Shigella_phage	99.4	7.7e-206
WP_016243476.1|2106003_2107332_-|tail	phage tail/DNA circulation protein	tail	Q8SBG8	Shigella_phage	97.5	3.9e-244
WP_000679479.1|2107393_2107924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016243475.1|2108015_2109848_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	97.5	4.8e-301
WP_000661051.1|2109989_2110259_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	6.0e-43
WP_000090998.1|2110258_2110615_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_001759749.1|2110614_2112111_-|tail	phage tail sheath family protein	tail	U5P0H3	Shigella_phage	99.0	3.4e-276
WP_016243474.1|2112094_2112265_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	6.1e-25
WP_016243473.1|2112273_2112834_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	97.8	4.4e-104
WP_016243472.1|2112830_2113337_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	98.2	7.2e-90
WP_016243471.1|2113311_2113722_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	95.6	5.5e-72
WP_016243470.1|2113718_2114042_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	96.3	4.8e-55
WP_016243469.1|2114016_2114244_-	hypothetical protein	NA	S5FNU1	Shigella_phage	98.3	1.5e-23
WP_016243468.1|2114293_2115499_-|capsid	phage major capsid protein	capsid	A0A1B5FPI9	Escherichia_phage	98.5	1.5e-221
WP_001193631.1|2115513_2116164_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_016243466.1|2116141_2117383_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_000605606.1|2117382_2117565_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_123001298.1|2117576_2119073_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	99.6	7.4e-300
WP_000929173.1|2119306_2119801_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	100.0	1.3e-88
WP_001764251.1|2119926_2120277_-	HNH endonuclease	NA	Q8SBD7	Shigella_phage	94.0	2.2e-61
WP_000892817.1|2120443_2120668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001701537.1|2120935_2121397_-|lysis	lysis protein	lysis	K7P735	Enterobacteria_phage	90.8	1.3e-69
WP_001764250.1|2121380_2121857_-	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	96.8	3.2e-87
WP_000544527.1|2121843_2122149_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	86.6	1.6e-39
WP_000606308.1|2122300_2122636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047109.1|2122821_2123574_-	antitermination protein	NA	Q8SBE4	Shigella_phage	99.2	9.0e-137
WP_001764249.1|2123587_2124577_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.2e-194
WP_001061403.1|2124584_2125382_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	2.0e-150
WP_000767113.1|2125401_2125791_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210164.1|2125787_2126114_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
WP_001764248.1|2126110_2126764_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	99.5	4.3e-127
WP_072278691.1|2126763_2127258_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	97.0	6.2e-86
WP_000104967.1|2127254_2128196_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	100.0	1.3e-153
WP_071595713.1|2128185_2128365_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.4	1.6e-15
WP_000515829.1|2128540_2129098_-	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	1.1e-96
WP_000649477.1|2129141_2129342_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|2129432_2130107_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_001764244.1|2130596_2131193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000008356.1|2131615_2132152_+	HD family hydrolase	NA	S5MW55	Escherichia_phage	88.2	3.9e-86
WP_104457509.1|2132142_2132490_+	hypothetical protein	NA	U5P092	Shigella_phage	95.5	1.1e-57
WP_011787758.1|2132590_2134201_+|transposase	IS1634-like element ISSpu7 family transposase	transposase	NA	NA	NA	NA
WP_000206736.1|2134271_2134577_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	6.4e-49
WP_000433939.1|2134576_2134927_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
WP_016243462.1|2134803_2135967_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.5	1.5e-228
2135981:2136030	attL	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAATGCG	NA	NA	NA	NA
WP_008321061.1|2136213_2137533_+|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	27.7	4.5e-06
WP_008321064.1|2138069_2138291_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_008321066.1|2138413_2139178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008321072.1|2139639_2140260_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_003029581.1|2140315_2140972_-	hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	82.1	6.2e-09
WP_003029582.1|2141000_2141309_-	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_077258089.1|2141818_2141989_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003029584.1|2142217_2143141_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_003029587.1|2143306_2144824_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_000345204.1|2144961_2146332_+	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_003029589.1|2146331_2147732_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	26.1	2.0e-20
WP_003029591.1|2147761_2148766_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001189123.1|2149199_2150708_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_001254932.1|2151815_2152967_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_016243458.1|2154586_2155438_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.2	8.3e-46
WP_001000409.1|2155957_2157493_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	2.0e-260
WP_000609174.1|2157542_2157890_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001201739.1|2157886_2158270_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
WP_016243455.1|2158934_2159828_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016243451.1|2162153_2162405_+	DUF1471 domain-containing protein	NA	A0A1B2IE60	Erwinia_phage	55.8	7.6e-08
WP_001101446.1|2162558_2163584_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_016243450.1|2163923_2164847_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.8	1.0e-166
WP_001460380.1|2168705_2168918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000951129.1|2169799_2170114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000947155.1|2170483_2171434_+	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_001460378.1|2172662_2173457_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_001460377.1|2173538_2173892_-	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_020244701.1|2174174_2174456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020246260.1|2175377_2175692_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_020244573.1|2175956_2178446_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_001460375.1|2178454_2179441_-	ATP-binding protein	NA	E5EQU5	Bathycoccus_sp._RCC1105_virus	27.6	4.8e-13
WP_000893260.1|2180095_2181349_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
2179905:2179954	attR	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAATGCG	NA	NA	NA	NA
WP_001285288.1|2181360_2182464_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|2182751_2183807_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174677.1|2183845_2184247_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189541.1|2184304_2185549_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|2185640_2186099_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001292997.1|2186359_2187817_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001295202.1|2188173_2188440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059881.1|2188746_2189199_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001226182.1|2189195_2190251_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_032140409.1|2190321_2191092_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001325255.1|2191051_2192791_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000006260.1|2193014_2193512_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_000009292.1|2193687_2194446_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.1e-20
WP_001225679.1|2194737_2195478_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333379.1|2195448_2196216_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|2196421_2197000_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
>prophage 141
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2202463	2210317	5277702		Bradyrhizobium_phage(25.0%)	9	NA	NA
WP_001300756.1|2202463_2203195_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.1	1.3e-39
WP_000917883.1|2203259_2203727_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001295200.1|2203723_2204446_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052721.1|2204479_2205235_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|2205306_2206665_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211681.1|2206713_2207484_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|2207561_2208362_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648577.1|2208602_2209517_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997036.1|2209513_2210317_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	7.1e-39
>prophage 142
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2216827	2217859	5277702		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|2216827_2217859_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 143
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2230817	2234933	5277702		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_001294774.1|2230817_2234300_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569425.1|2234336_2234933_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.5	5.1e-26
>prophage 144
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2243761	2244520	5277702		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|2243761_2244520_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 145
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2257118	2258543	5277702	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|2257118_2258543_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 146
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2262472	2262817	5277702		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|2262472_2262817_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 147
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2268851	2269649	5277702		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158931.1|2268851_2269649_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	2.7e-14
>prophage 148
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2274892	2281698	5277702	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_001548116.1|2274892_2277322_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	28.8	1.0e-40
WP_001294674.1|2277395_2277926_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396036.1|2277940_2278645_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|2278822_2279278_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000937398.1|2279314_2280241_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174633.1|2280279_2281698_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 149
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2291580	2292483	5277702		Sodalis_phage(100.0%)	1	NA	NA
WP_000339959.1|2291580_2292483_-	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	50.2	2.8e-60
>prophage 150
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2295745	2302368	5277702		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_000150637.1|2295745_2296672_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000651599.1|2296780_2297443_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683335.1|2297483_2298020_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_001325285.1|2298225_2300616_+	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_097719039.1|2300817_2302368_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	1.6e-18
>prophage 151
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2310114	2311539	5277702		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|2310114_2311539_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 152
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2320049	2320601	5277702		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923726.1|2320049_2320601_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.5e-11
>prophage 153
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2324846	2325890	5277702		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|2324846_2325890_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 154
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2351979	2353704	5277702		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001295534.1|2351979_2353704_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.4e-36
>prophage 155
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2366388	2367087	5277702		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916295.1|2366388_2367087_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.1e-23
>prophage 156
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2373535	2378958	5277702		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_000035669.1|2373535_2375887_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.8e-37
WP_001117011.1|2376051_2378958_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 157
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2386702	2388663	5277702		Microcystis_phage(50.0%)	4	NA	NA
WP_000257189.1|2386702_2387551_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
WP_001160971.1|2387547_2387862_-	CcdB family protein	NA	NA	NA	NA	NA
WP_000125566.1|2387864_2388098_-	antitoxin	NA	NA	NA	NA	NA
WP_001487721.1|2388183_2388663_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	45.7	1.2e-28
>prophage 158
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2396560	2402221	5277702		Vibrio_phage(50.0%)	4	NA	NA
WP_000787103.1|2396560_2398075_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
WP_000347117.1|2398105_2399248_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_104457510.1|2399376_2400594_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000351353.1|2400667_2402221_+	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.1	1.6e-34
>prophage 159
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2407814	2408963	5277702		Halovirus(100.0%)	1	NA	NA
WP_001548984.1|2407814_2408963_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 160
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2413406	2416223	5277702	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286857.1|2413406_2416223_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 161
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2423277	2432345	5277702		uncultured_Caudovirales_phage(20.0%)	9	NA	NA
WP_000681368.1|2423277_2424444_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.8	9.2e-88
WP_001325271.1|2424972_2425182_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	3.0e-18
WP_001118462.1|2425285_2426416_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.4	7.9e-28
WP_000516135.1|2426504_2428421_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_000843559.1|2428797_2429202_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102383.1|2429227_2429941_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528538.1|2430089_2430656_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001094682.1|2430689_2431277_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130185.1|2431391_2432345_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
>prophage 162
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2444119	2446233	5277702		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_001219614.1|2444119_2445544_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.6e-09
WP_001188664.1|2445543_2446233_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	1.1e-29
>prophage 163
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2449459	2454815	5277702		Bacillus_phage(33.33%)	3	NA	NA
WP_000409451.1|2449459_2451397_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|2451607_2453275_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093812.1|2453582_2454815_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
>prophage 164
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2461558	2462881	5277702		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|2461558_2462881_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 165
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2468920	2471796	5277702		Salmonella_phage(50.0%)	3	NA	NA
WP_000490275.1|2468920_2469082_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|2469208_2469814_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000175943.1|2470206_2471796_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
>prophage 166
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2479707	2480987	5277702		Salmonella_phage(50.0%)	2	NA	NA
WP_000098818.1|2479707_2480247_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
WP_000799911.1|2480249_2480987_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 167
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2484214	2489578	5277702		Tupanvirus(50.0%)	4	NA	NA
WP_000106030.1|2484214_2485237_-	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
WP_000091587.1|2485375_2486290_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000410144.1|2486503_2487865_+	MFS transporter	NA	NA	NA	NA	NA
WP_000919537.1|2487913_2489578_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 168
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2502179	2502734	5277702		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151855.1|2502179_2502734_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 169
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2509257	2510718	5277702		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208224.1|2509257_2510718_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.4	1.4e-48
>prophage 170
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2520922	2522598	5277702		Escherichia_phage(100.0%)	2	NA	NA
WP_000044711.1|2520922_2521519_-	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
WP_001548975.1|2521995_2522598_-	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
>prophage 171
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2531390	2544839	5277702	tRNA	Aeromonas_phage(20.0%)	9	NA	NA
WP_000190110.1|2531390_2531951_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	39.9	4.2e-22
WP_000908169.1|2532926_2533841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300770.1|2534634_2535654_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
WP_001324723.1|2535783_2537286_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	6.1e-84
WP_001295681.1|2537446_2538529_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584117.1|2538528_2539629_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|2539895_2541407_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_001188289.1|2541501_2541984_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416390.1|2541983_2544839_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.8	2.1e-141
>prophage 172
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2553175	2559632	5277702	transposase	Paramecium_bursaria_Chlorella_virus(66.67%)	7	NA	NA
WP_000013046.1|2553175_2554111_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|2554123_2554585_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047543.1|2554657_2555044_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_001118333.1|2555109_2555565_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000471861.1|2555609_2558306_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	2.0e-45
WP_001387276.1|2558446_2558500_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181324.1|2558684_2559632_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
>prophage 173
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2563270	2566053	5277702		Vibrio_phage(50.0%)	2	NA	NA
WP_000187798.1|2563270_2565409_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001009182.1|2565588_2566053_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	8.5e-53
>prophage 174
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2570296	2576782	5277702		Klosneuvirus(33.33%)	6	NA	NA
WP_000853753.1|2570296_2571295_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000595993.1|2571327_2572323_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001548970.1|2572309_2573332_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001095667.1|2573345_2574848_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_000265933.1|2574985_2575942_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055072.1|2576251_2576782_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
>prophage 175
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2621163	2622327	5277702		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943962.1|2621163_2622327_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.8e-80
>prophage 176
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2629646	2697469	5277702	protease,transposase,integrase,tRNA	Shigella_phage(11.11%)	60	2650121:2650136	2703704:2703719
WP_088765672.1|2629646_2630919_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_000400401.1|2630953_2631733_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001293282.1|2631809_2632541_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076313.1|2632720_2635162_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	4.9e-67
WP_001177643.1|2635200_2635626_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|2635830_2637129_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|2637232_2637430_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|2637511_2638516_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|2638518_2639778_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|2639863_2641144_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|2641220_2641529_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280345.1|2641614_2642565_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_039060489.1|2642557_2644405_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_000990333.1|2644414_2645752_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|2645770_2646232_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_001325483.1|2646203_2647751_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001325482.1|2647749_2648889_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010723271.1|2648871_2648925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|2649788_2650334_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
2650121:2650136	attL	CCAGCCCGCTGGCGGT	NA	NA	NA	NA
WP_000041970.1|2650428_2651481_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_000934920.1|2651577_2652546_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_104457513.1|2652567_2655891_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001339478.1|2656041_2657544_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004770.1|2657762_2658740_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	1.2e-27
WP_001192973.1|2659064_2660873_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|2660865_2661600_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000208757.1|2661610_2662006_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000609663.1|2662016_2662376_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001295185.1|2662438_2663572_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001238371.1|2663660_2664194_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.1e-47
WP_000118482.1|2664190_2664508_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000239596.1|2664683_2664830_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977757.1|2664940_2665066_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|2665117_2665684_-	elongation factor P	NA	NA	NA	NA	NA
WP_000940548.1|2665725_2666754_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_001008046.1|2667148_2668018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000558209.1|2668210_2668564_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|2668701_2670348_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|2670391_2670685_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000015852.1|2670960_2672217_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267445.1|2672232_2672709_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_001385092.1|2673045_2674482_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961959.1|2674599_2675901_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000883400.1|2676016_2676355_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000068974.1|2676330_2678028_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001188520.1|2678064_2678640_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001218854.1|2679019_2680282_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	7.6e-80
WP_024195749.1|2681826_2682063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547725.1|2682078_2682351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547726.1|2682381_2682591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001547728.1|2682687_2683725_-	hypothetical protein	NA	K4F6Z8	Cronobacter_phage	24.4	1.4e-07
WP_001547729.1|2683749_2684094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000227969.1|2684583_2685660_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_032142258.1|2686201_2687710_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.3	1.2e-44
WP_077633943.1|2688018_2688390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547734.1|2689206_2689716_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_050559247.1|2690008_2690335_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	50.0	2.5e-11
WP_001547737.1|2691957_2692308_-|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	5.2e-39
WP_104457514.1|2693159_2696309_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	51.1	1.4e-101
WP_001547740.1|2696488_2697469_+|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	97.8	8.3e-183
2703704:2703719	attR	ACCGCCAGCGGGCTGG	NA	NA	NA	NA
>prophage 177
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2702216	2702984	5277702		Bacillus_virus(100.0%)	1	NA	NA
WP_000932310.1|2702216_2702984_-	taurine ABC transporter ATP-binding subunit	NA	G3M9Y6	Bacillus_virus	39.6	1.2e-40
>prophage 178
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2708542	2710327	5277702		Bacillus_phage(100.0%)	1	NA	NA
WP_001217015.1|2708542_2710327_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.3	2.2e-16
>prophage 179
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2714181	2714640	5277702		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001548150.1|2714181_2714640_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	9.0e-15
>prophage 180
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2724067	2727279	5277702	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_000856829.1|2724067_2725525_+	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	6.8e-48
WP_001295074.1|2725761_2727279_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
>prophage 181
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2748621	2750124	5277702		Burkholderia_virus(100.0%)	1	NA	NA
WP_001298520.1|2748621_2750124_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	2.4e-56
>prophage 182
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2755061	2755850	5277702		Cedratvirus(100.0%)	1	NA	NA
WP_001193406.1|2755061_2755850_+	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	4.2e-12
>prophage 183
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2761454	2763004	5277702		Bacillus_virus(50.0%)	2	NA	NA
WP_001075517.1|2761454_2762213_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	4.7e-16
WP_000611405.1|2762323_2763004_+	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	7.1e-08
>prophage 184
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2766989	2768975	5277702		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001066016.1|2766989_2768975_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	2.1e-148
>prophage 185
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2774220	2776368	5277702		Escherichia_phage(100.0%)	1	NA	NA
WP_077254887.1|2774220_2776368_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.7	2.0e-32
>prophage 186
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2785651	2787610	5277702		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078239.1|2785651_2787610_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 187
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2793195	2794545	5277702		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|2793195_2794545_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 188
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2798362	2801975	5277702		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|2798362_2798899_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357740.1|2799152_2801975_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
>prophage 189
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2806183	2808731	5277702		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
WP_001147328.1|2806183_2807263_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
WP_000918363.1|2807315_2808731_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
>prophage 190
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2815321	2815930	5277702		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|2815321_2815930_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 191
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2826912	2828028	5277702		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|2826912_2828028_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 192
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2847300	2850984	5277702		Dickeya_phage(100.0%)	1	NA	NA
WP_001548916.1|2847300_2850984_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 193
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2866356	2867946	5277702		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187535.1|2866356_2867946_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	2.9e-68
>prophage 194
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2873308	2875072	5277702		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|2873308_2873581_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000940106.1|2873767_2874358_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362388.1|2874400_2875072_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 195
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2884289	2892618	5277702		Vibrio_phage(50.0%)	2	NA	NA
WP_104457516.1|2884289_2888513_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	1.9e-66
WP_000263098.1|2888589_2892618_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 196
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2896734	2899787	5277702		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|2896734_2897919_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_104457518.1|2898836_2899787_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	6.7e-28
>prophage 197
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	2908125	3010017	5277702	protease,head,capsid,tail,integrase,holin,tRNA,portal,plate	Salmonella_phage(61.7%)	101	2930254:2930277	3019190:3019213
WP_000591359.1|2908125_2909970_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
WP_000187048.1|2910338_2911439_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000806411.1|2911478_2911838_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_001309117.1|2911837_2912488_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_001120810.1|2912818_2914219_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_001025939.1|2914201_2915119_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_001230087.1|2915385_2916759_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_001302318.1|2916819_2917596_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_000935370.1|2917603_2918608_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_001295506.1|2918761_2919913_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_001005586.1|2920264_2922916_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_000556295.1|2923098_2924832_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000274624.1|2925046_2925898_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000323846.1|2925884_2926226_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000204143.1|2926227_2927106_-	[formate-C-acetyltransferase]-activating enzyme	NA	NA	NA	NA	NA
WP_000184886.1|2927071_2929369_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|2929419_2929740_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004446.1|2929754_2930834_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
2930254:2930277	attL	CCGCCCATATCGAACGCCAGCATC	NA	NA	NA	NA
WP_001185133.1|2931142_2933644_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424841.1|2933655_2934318_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	4.2e-29
WP_000374004.1|2934328_2935432_+	bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_000647893.1|2935706_2936324_+	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_001411974.1|2936350_2937256_-	cystine transporter YijE	NA	NA	NA	NA	NA
WP_001295695.1|2937348_2939529_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_000007523.1|2939857_2940748_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_000110772.1|2941096_2943529_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_001548907.1|2943531_2944692_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000852812.1|2944968_2945286_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_000797341.1|2945469_2946078_+	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000644414.1|2947070_2947307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016240315.1|2947308_2951493_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.0	1.4e-24
WP_000710769.1|2951652_2951865_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001295520.1|2952067_2954266_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_000068828.1|2955540_2956500_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000208242.1|2956592_2957123_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293341.1|2957132_2958464_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|2958530_2959457_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|2959549_2960035_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|2960119_2960365_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|2960789_2961635_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|2961657_2963166_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|2963300_2964311_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796332.1|2964407_2965154_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323556.1|2965158_2965587_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655986.1|2965613_2965913_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155257.1|2966124_2966565_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802214.1|2966665_2967265_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216325.1|2967372_2968140_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000708998.1|2968194_2968950_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_016243413.1|2969055_2970045_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591795.1|2970364_2971327_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|2971507_2972410_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_001514748.1|2972696_2973419_+	hypothetical protein	NA	Q37850	Escherichia_phage	45.0	9.8e-48
WP_001514747.1|2973462_2973705_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_024191288.1|2973751_2974879_-	phage late control D family protein	NA	A0A0M4REC6	Salmonella_phage	87.8	2.9e-171
WP_001514745.1|2975040_2976237_+	hypothetical protein	NA	A0A0M4S6M1	Salmonella_phage	93.0	1.2e-212
WP_001514744.1|2976249_2976765_+|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	90.1	7.6e-87
WP_001514743.1|2976779_2977118_+|tail	phage tail assembly protein	tail	A0A0M4RCV2	Salmonella_phage	80.6	2.1e-40
WP_015698216.1|2977126_2977243_+|tail	GpE family phage tail protein	tail	A0A0M3ULA8	Salmonella_phage	91.9	6.2e-13
WP_001514742.1|2977243_2980174_+|tail	phage tail tape measure protein	tail	A0A0M4R2V3	Salmonella_phage	64.5	2.9e-239
WP_001514741.1|2980185_2980635_+|tail	phage tail protein	tail	A0A1J0I2L5	Salmonella_phage	77.7	1.0e-63
WP_097755622.1|2980763_2981267_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	56.1	1.8e-40
WP_025790319.1|2981266_2981869_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	1.0e-98
WP_024191337.1|2981840_2982281_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	62.6	5.6e-46
WP_104457519.1|2982283_2983444_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	59.8	4.2e-117
WP_001514737.1|2983433_2984051_-|tail	phage tail protein I	tail	A0A1J0I2I4	Salmonella_phage	85.2	3.5e-94
WP_104457520.1|2984043_2984955_-|plate	baseplate assembly protein	plate	A0A0M4REB7	Salmonella_phage	84.2	2.6e-138
WP_001514735.1|2984951_2985317_-	hypothetical protein	NA	A0A0M4S6L5	Salmonella_phage	68.9	2.9e-40
WP_001514734.1|2985313_2985949_-|plate	phage baseplate assembly protein V	plate	A0A0M3ULA5	Salmonella_phage	57.1	3.6e-62
WP_001514733.1|2986129_2986762_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	79.6	1.8e-90
WP_001514732.1|2986762_2987230_-|tail	phage tail protein	tail	A0A0M4R2U5	Salmonella_phage	77.0	3.1e-63
WP_001514731.1|2987232_2987769_-	DUF2514 family protein	NA	A0A0M4S5V1	Salmonella_phage	72.5	4.8e-07
WP_001514730.1|2987765_2988155_-	M15 family metallopeptidase	NA	A0A060DAL8	Salmonella_phage	86.8	7.6e-63
WP_001514729.1|2988147_2988477_-|holin	phage holin, lambda family	holin	A0A0M3ULH4	Salmonella_phage	90.8	1.7e-47
WP_001514728.1|2988486_2988690_-	hypothetical protein	NA	A0A0M4RTN6	Salmonella_phage	73.1	9.8e-22
WP_001514727.1|2988689_2989178_-|head	head completion/stabilization protein	head	A0A0M4QWR7	Salmonella_phage	88.8	1.4e-77
WP_001514726.1|2989277_2990123_-	hypothetical protein	NA	A0A0M4R523	Salmonella_phage	65.4	3.1e-77
WP_001514725.1|2990167_2991214_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	90.8	6.1e-184
WP_001514724.1|2991253_2992093_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1J0I2E9	Salmonella_phage	61.7	7.5e-92
WP_024191286.1|2992239_2993955_+	oxidoreductase	NA	A0A0M4S6K7	Salmonella_phage	73.9	3.5e-237
WP_001514722.1|2993957_2995004_+|portal	phage portal protein	portal	A0A0M5M1H6	Salmonella_phage	75.5	3.0e-154
WP_001514720.1|2995414_2995720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001514719.1|2995926_2996436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001514717.1|2999008_2999317_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	65.9	1.1e-27
WP_001514716.1|2999316_2999526_-	hypothetical protein	NA	K7PKS4	Enterobacteria_phage	57.6	8.6e-13
WP_001514715.1|2999528_2999765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104457521.1|2999764_3000706_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	63.8	2.0e-109
WP_104457605.1|3000775_3001129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001514712.1|3001253_3001436_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001514711.1|3001435_3001867_-	tellurite resistance protein	NA	Q1MVI3	Enterobacteria_phage	89.6	6.9e-65
WP_001514710.1|3001953_3002181_-	DUF2724 domain-containing protein	NA	A0A0M4S6M9	Salmonella_phage	68.0	9.6e-26
WP_001514707.1|3002356_3002560_-	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	66.2	1.9e-17
WP_001514706.1|3002572_3002854_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	96.8	3.4e-49
WP_001514705.1|3002974_3003283_+	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	53.0	8.5e-17
WP_104457522.1|3003349_3004330_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	95.7	3.5e-181
WP_001223800.1|3004506_3005007_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_001033722.1|3005156_3005855_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580429.1|3005851_3007225_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	2.9e-16
WP_001270260.1|3007330_3008005_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166064.1|3008153_3009137_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001297064.1|3009396_3010017_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
3019190:3019213	attR	GATGCTGGCGTTCGATATGGGCGG	NA	NA	NA	NA
>prophage 198
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3024795	3027846	5277702		Escherichia_phage(100.0%)	1	NA	NA
WP_077628414.1|3024795_3027846_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 199
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3035163	3037943	5277702		Escherichia_phage(50.0%)	3	NA	NA
WP_000059678.1|3035163_3035949_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
WP_000621656.1|3035982_3036879_-	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000718893.1|3037046_3037943_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
>prophage 200
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3054166	3056637	5277702		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000190577.1|3054166_3055216_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
WP_001188776.1|3055227_3056637_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 201
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3060715	3063502	5277702		uncultured_virus(100.0%)	1	NA	NA
WP_000250006.1|3060715_3063502_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 202
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3077190	3077805	5277702		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295262.1|3077190_3077805_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 203
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3086686	3089973	5277702		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109938.1|3086686_3087463_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	8.7e-26
WP_000459594.1|3087465_3087981_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001295260.1|3087984_3088254_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187530.1|3088332_3089973_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
>prophage 204
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3102386	3104216	5277702		Catovirus(100.0%)	1	NA	NA
WP_024191373.1|3102386_3104216_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	5.7e-84
>prophage 205
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3111643	3115502	5277702		Bacillus_phage(100.0%)	3	NA	NA
WP_000383406.1|3111643_3113806_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
WP_001213584.1|3113889_3114606_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000130686.1|3114605_3115502_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	1.1e-24
>prophage 206
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3133997	3140141	5277702		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000612043.1|3133997_3135128_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
WP_001145183.1|3135132_3135807_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000676056.1|3135784_3136666_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001226588.1|3136684_3137752_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	3.5e-102
WP_000006625.1|3137751_3139014_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_001411839.1|3139010_3140141_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.4	6.7e-27
>prophage 207
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3144183	3149597	5277702		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|3144183_3144513_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047499.1|3144643_3145909_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001295254.1|3146044_3147529_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001238890.1|3147575_3149597_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	3.8e-113
>prophage 208
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3158012	3159659	5277702		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012603.1|3158012_3159659_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.6	4.8e-66
>prophage 209
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3173050	3178903	5277702		Enterobacteria_phage(33.33%)	5	NA	NA
WP_001056273.1|3173050_3173941_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
WP_000211858.1|3173965_3174931_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000387752.1|3174935_3176441_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000715936.1|3176448_3176868_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000102319.1|3177034_3178903_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
>prophage 210
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3182071	3183064	5277702		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845104.1|3182071_3183064_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 211
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3195018	3198380	5277702		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000933736.1|3195018_3196389_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
WP_000334099.1|3196550_3198380_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
>prophage 212
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3203911	3207844	5277702		Cyanophage(50.0%)	4	NA	NA
WP_000867146.1|3203911_3204952_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000741620.1|3205038_3205998_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_001251991.1|3205997_3206888_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063125.1|3207070_3207844_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 213
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3218832	3220170	5277702		Moraxella_phage(100.0%)	1	NA	NA
WP_000019349.1|3218832_3220170_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	3.4e-62
>prophage 214
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3230369	3237738	5277702		Staphylococcus_phage(33.33%)	8	NA	NA
WP_001307474.1|3230369_3230627_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239730.1|3230590_3230950_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|3230966_3231107_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_120795392.1|3231336_3231417_-	protein YsdD	NA	NA	NA	NA	NA
WP_000059111.1|3231713_3233117_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673464.1|3233121_3234222_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000060112.1|3234221_3235295_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000072067.1|3235323_3237738_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
>prophage 215
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3242444	3243593	5277702		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|3242444_3243593_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 216
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3248020	3248974	5277702		Cyanophage(50.0%)	2	NA	NA
WP_001243437.1|3248020_3248434_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_001243431.1|3248545_3248974_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
>prophage 217
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3255755	3264777	5277702		Aeromonas_phage(25.0%)	10	NA	NA
WP_001087147.1|3255755_3257471_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
WP_000828499.1|3257467_3258961_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	26.2	5.9e-31
WP_000511291.1|3259007_3259457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000703959.1|3259565_3259913_+	YidH family protein	NA	NA	NA	NA	NA
WP_001113432.1|3259902_3260265_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000148063.1|3260261_3260759_+	radical SAM protein	NA	NA	NA	NA	NA
WP_000828746.1|3260766_3261951_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000060506.1|3262230_3262320_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001312198.1|3262884_3262983_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000168461.1|3263088_3264777_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.4	6.0e-56
>prophage 218
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3272081	3273416	5277702		Moraxella_phage(100.0%)	1	NA	NA
WP_001058151.1|3272081_3273416_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.2	8.6e-66
>prophage 219
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3279817	3280980	5277702	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_085947771.1|3279817_3280980_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 220
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3288508	3289900	5277702		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|3288508_3289900_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 221
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3294333	3301083	5277702		Bordetella_phage(25.0%)	6	NA	NA
WP_000280488.1|3294333_3296442_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|3296460_3296736_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001295237.1|3296790_3297414_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000870047.1|3297671_3299354_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	1.5e-22
WP_000924289.1|3299350_3299968_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001411731.1|3300258_3301083_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	2.8e-91
>prophage 222
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3305727	3316398	5277702	transposase,integrase	Morganella_phage(50.0%)	14	3313180:3313193	3321274:3321287
WP_104457529.1|3305727_3308169_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	38.7	2.6e-137
WP_086872399.1|3308161_3308503_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	63.3	1.2e-35
WP_104457530.1|3308512_3309139_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	37.2	1.0e-24
WP_104457531.1|3309135_3309357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002436684.1|3309353_3309533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104457532.1|3309529_3309727_-	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	45.3	3.2e-09
WP_104457533.1|3309723_3310554_-	ash family protein	NA	NA	NA	NA	NA
WP_057621710.1|3310540_3310723_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_104457534.1|3310715_3311549_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	46.7	1.2e-20
WP_000412540.1|3311561_3311993_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.7	3.0e-28
WP_001090781.1|3311992_3312196_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_011787758.1|3312395_3314006_+|transposase	IS1634-like element ISSpu7 family transposase	transposase	NA	NA	NA	NA
3313180:3313193	attL	TCGGTCATGGCTAC	NA	NA	NA	NA
WP_001000004.1|3314077_3315043_-	hypothetical protein	NA	A0A1W6JPD1	Morganella_phage	51.2	3.9e-07
WP_001339895.1|3315138_3316398_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	78.1	1.1e-192
3321274:3321287	attR	TCGGTCATGGCTAC	NA	NA	NA	NA
>prophage 223
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3319738	3324301	5277702		Xanthomonas_phage(25.0%)	7	NA	NA
WP_001298007.1|3319738_3320194_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
WP_000050109.1|3320174_3321395_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	8.5e-44
WP_001295236.1|3321566_3322235_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000091955.1|3322451_3322688_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|3322708_3322876_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114533.1|3322973_3323783_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001171866.1|3323821_3324301_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
>prophage 224
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3331739	3333833	5277702		Archaeal_BJ1_virus(50.0%)	2	NA	NA
WP_000364795.1|3331739_3332765_+	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.9	4.2e-12
WP_000064004.1|3332849_3333833_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	2.4e-12
>prophage 225
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3337232	3346739	5277702		Synechococcus_phage(16.67%)	9	NA	NA
WP_000587784.1|3337232_3338165_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	5.0e-36
WP_001213834.1|3338378_3339575_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000646008.1|3339584_3340610_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	1.8e-18
WP_000982103.1|3340848_3341883_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000483856.1|3341869_3342829_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214147.1|3342832_3344116_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000116565.1|3344125_3345670_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001295234.1|3345914_3346346_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024393.1|3346487_3346739_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	53.4	1.7e-15
>prophage 226
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3369101	3379251	5277702	tRNA	uncultured_Caudovirales_phage(66.67%)	6	NA	NA
WP_001346013.1|3369101_3369935_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	47.0	3.3e-23
WP_000072850.1|3370087_3370930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103216017.1|3370950_3375084_-	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	2.7e-25
WP_000779792.1|3375312_3375921_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_000206271.1|3376018_3377410_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000582492.1|3377406_3379251_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	6.7e-16
>prophage 227
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3408451	3409993	5277702		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146474.1|3408451_3409993_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	5.6e-16
>prophage 228
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3415311	3416307	5277702		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182650.1|3415311_3416307_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 229
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3420165	3422186	5277702	transposase	Macacine_betaherpesvirus(50.0%)	3	NA	NA
WP_088765664.1|3420165_3421513_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	2.7e-107
WP_001135732.1|3421636_3421789_+	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_000014594.1|3421973_3422186_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 230
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3425840	3428174	5277702		Escherichia_phage(100.0%)	1	NA	NA
WP_001549811.1|3425840_3428174_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	2.7e-70
>prophage 231
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3438063	3440048	5277702		Planktothrix_phage(50.0%)	2	NA	NA
WP_001196486.1|3438063_3439047_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
WP_000107012.1|3439043_3440048_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
>prophage 232
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3488235	3488883	5277702		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|3488235_3488883_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 233
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3492276	3494411	5277702		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000065769.1|3492276_3492702_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
WP_000922639.1|3492714_3494004_-	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000008957.1|3494057_3494411_-	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
>prophage 234
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3497756	3499799	5277702		Indivirus(100.0%)	1	NA	NA
WP_001295214.1|3497756_3499799_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	3.4e-45
>prophage 235
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3513398	3514907	5277702		Pseudomonas_phage(100.0%)	1	NA	NA
WP_158649917.1|3513398_3514907_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.3	2.1e-44
>prophage 236
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3520597	3523926	5277702		Bacillus_phage(66.67%)	4	NA	NA
WP_000647571.1|3520597_3520948_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	61.4	8.1e-16
WP_000790485.1|3521095_3521527_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_000555733.1|3521771_3523253_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.8e-27
WP_000697967.1|3523245_3523926_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.7e-31
>prophage 237
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3531098	3534555	5277702		uncultured_virus(50.0%)	3	NA	NA
WP_104457539.1|3531098_3533546_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.6	2.9e-83
WP_000843494.1|3533586_3533784_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_000287499.1|3533817_3534555_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	41.0	1.0e-12
>prophage 238
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3539635	3545899	5277702	transposase	Bacillus_phage(40.0%)	6	NA	NA
WP_001188930.1|3539635_3540316_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_001211180.1|3540312_3541713_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
WP_000723069.1|3541930_3542365_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_001000409.1|3543586_3545122_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	2.0e-260
WP_000609174.1|3545171_3545519_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001201739.1|3545515_3545899_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
>prophage 239
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3552623	3558520	5277702		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000149123.1|3552623_3555359_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	5.4e-22
WP_001488398.1|3555358_3556483_+	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_001259385.1|3556555_3556831_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	50.0	3.7e-16
WP_000593555.1|3556827_3557187_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001190062.1|3557306_3557708_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000173666.1|3557713_3558520_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	4.5e-17
>prophage 240
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3566413	3570545	5277702		Dickeya_phage(50.0%)	4	NA	NA
WP_001100469.1|3566413_3567079_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.1	2.8e-57
WP_000130621.1|3567299_3567545_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_000106560.1|3567646_3569845_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.3	1.5e-118
WP_000964718.1|3569918_3570545_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 241
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3573548	3576367	5277702		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000617723.1|3573548_3574217_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
WP_001042003.1|3574209_3575268_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|3575512_3576367_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 242
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3582100	3583583	5277702		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000082110.1|3582100_3582868_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
WP_000416880.1|3582869_3583583_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	29.4	2.0e-13
>prophage 243
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3587124	3588935	5277702		Planktothrix_phage(50.0%)	2	NA	NA
WP_000907793.1|3587124_3588195_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
WP_000073599.1|3588191_3588935_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	2.9e-10
>prophage 244
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3608946	3611394	5277702		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|3608946_3611394_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 245
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3620621	3621848	5277702		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105482.1|3620621_3621848_+	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	59.8	4.4e-133
>prophage 246
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3626227	3628621	5277702		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_001411461.1|3626227_3628621_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 247
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3634654	3635533	5277702		Sodalis_phage(100.0%)	1	NA	NA
WP_000039058.1|3634654_3635533_-	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.0	1.4e-67
>prophage 248
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3642096	3646607	5277702		Bacillus_phage(66.67%)	5	NA	NA
WP_001157751.1|3642096_3642816_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253696.1|3642812_3644165_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_000650976.1|3644195_3644492_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000493758.1|3644550_3644868_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001298201.1|3644984_3646607_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
>prophage 249
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3663510	3664347	5277702		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|3663510_3664347_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 250
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3688537	3698077	5277702		Acinetobacter_phage(25.0%)	9	NA	NA
WP_000601847.1|3688537_3689101_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
WP_000963824.1|3689186_3690407_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001325239.1|3690472_3692563_-	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000242755.1|3692613_3693246_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001148908.1|3693547_3693952_+	OsmC family protein	NA	NA	NA	NA	NA
WP_001274680.1|3694006_3694876_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_000907085.1|3694929_3695148_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_000057356.1|3695141_3696164_-	hydrolase	NA	NA	NA	NA	NA
WP_000634798.1|3696163_3698077_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
>prophage 251
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3703647	3712206	5277702		uncultured_Caudovirales_phage(40.0%)	8	NA	NA
WP_001209680.1|3703647_3704034_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	3.3e-18
WP_000820714.1|3704033_3704393_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_000903373.1|3704400_3704688_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|3704813_3705188_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|3705284_3705755_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|3705851_3707966_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_000031783.1|3708036_3709221_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000773174.1|3709512_3712206_+	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	36.0	8.7e-41
>prophage 252
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3721036	3722989	5277702		Vibrio_phage(100.0%)	1	NA	NA
WP_001325055.1|3721036_3722989_-	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	30.9	5.4e-32
>prophage 253
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3744204	3745676	5277702	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000004454.1|3744204_3745152_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
WP_000114984.1|3745166_3745676_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
>prophage 254
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3756170	3760324	5277702		Bacillus_virus(50.0%)	4	NA	NA
WP_000078349.1|3756170_3756929_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	9.1e-20
WP_001549761.1|3756936_3758040_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000019655.1|3758049_3759231_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000738568.1|3759298_3760324_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	1.8e-71
>prophage 255
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3766786	3767671	5277702		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258914.1|3766786_3767671_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	4.2e-24
>prophage 256
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3778236	3779280	5277702		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|3778236_3779280_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 257
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3795775	3798300	5277702	protease	uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_000497723.1|3795775_3796843_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295271.1|3796932_3798300_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
>prophage 258
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3802266	3802764	5277702	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366126.1|3802266_3802764_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
>prophage 259
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3806402	3807893	5277702		Burkholderia_virus(100.0%)	1	NA	NA
WP_000108461.1|3806402_3807893_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 260
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3817589	3832384	5277702		Staphylococcus_phage(25.0%)	17	NA	NA
WP_001299745.1|3817589_3818519_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_000809752.1|3818614_3820951_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001300411.1|3821180_3821834_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000047091.1|3821830_3822559_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000620405.1|3822555_3823188_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|3823401_3823674_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|3823670_3824525_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000183676.1|3824570_3825062_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|3825179_3825467_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000809051.1|3825489_3826923_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|3826970_3827696_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000669785.1|3827702_3828260_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000030537.1|3828228_3828804_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030011.1|3828800_3829367_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.0	4.2e-54
WP_001325168.1|3829387_3830374_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	3.3e-38
WP_000922872.1|3830387_3831365_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000438245.1|3831574_3832384_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 261
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3836452	3837929	5277702		Vibrio_phage(50.0%)	2	NA	NA
WP_000445413.1|3836452_3836731_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
WP_001047336.1|3836957_3837929_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 262
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3844703	3847576	5277702	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107467.1|3844703_3846638_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000764731.1|3846727_3847576_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 263
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3851658	3858297	5277702		Dickeya_phage(50.0%)	4	NA	NA
WP_000207683.1|3851658_3853002_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_001300397.1|3853632_3854085_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031057.1|3854112_3855600_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133049.1|3855624_3858297_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
>prophage 264
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3863778	3865668	5277702		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|3863778_3865668_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 265
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3871370	3879164	5277702		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
WP_000189314.1|3871370_3871673_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
WP_000449030.1|3871723_3872167_+	YhbP family protein	NA	NA	NA	NA	NA
WP_000037608.1|3872146_3872665_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_001549692.1|3872792_3873428_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000147574.1|3873500_3874541_+	permease	NA	NA	NA	NA	NA
WP_000646033.1|3874654_3875230_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158034.1|3875239_3875830_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000246826.1|3875849_3876245_-	YraN family protein	NA	NA	NA	NA	NA
WP_000249103.1|3876202_3878239_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000809262.1|3878303_3879164_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.5e-50
>prophage 266
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3883522	3884685	5277702	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_085947771.1|3883522_3884685_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 267
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3903723	3904869	5277702		Streptococcus_phage(100.0%)	1	NA	NA
WP_001300387.1|3903723_3904869_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 268
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3912970	3915265	5277702		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861720.1|3912970_3915265_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	1.7e-157
>prophage 269
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3935987	3936953	5277702		Escherichia_phage(100.0%)	1	NA	NA
WP_001098805.1|3935987_3936953_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 270
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3949900	3966096	5277702	tRNA	Herpes_simplex_virus(16.67%)	12	NA	NA
WP_001082931.1|3949900_3952993_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.2	3.4e-158
WP_000212445.1|3953176_3954160_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_000450589.1|3954378_3954711_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000627220.1|3954752_3956243_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.2e-33
WP_000094682.1|3956549_3958070_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_000018003.1|3958223_3958847_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001066492.1|3959134_3959899_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_104457548.1|3960152_3960659_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000437371.1|3960737_3962579_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000918827.1|3962773_3964519_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_001144069.1|3964629_3964845_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264352.1|3965082_3966096_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
>prophage 271
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3972496	3973735	5277702	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708487.1|3972496_3973735_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.9	3.5e-93
>prophage 272
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3978872	3980306	5277702		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869199.1|3978872_3980306_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.2	2.0e-39
>prophage 273
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3983984	3985258	5277702	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_088765672.1|3983984_3985258_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 274
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	3991156	4002119	5277702		Staphylococcus_phage(20.0%)	12	NA	NA
WP_001076997.1|3991156_3991810_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
WP_000469266.1|3992071_3992242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001375105.1|3992299_3993073_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000188376.1|3993188_3994004_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_000442860.1|3994041_3995202_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000831543.1|3995207_3995879_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000735278.1|3996026_3997508_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917138.1|3997712_3998342_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	4.1e-18
WP_000833393.1|3998342_3998765_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000444747.1|3998789_3999617_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000105733.1|3999616_4000198_+	esterase YqiA	NA	NA	NA	NA	NA
WP_000195296.1|4000226_4002119_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
>prophage 275
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4007076	4007469	5277702		Stx_converting_phage(100.0%)	1	NA	NA
WP_000712658.1|4007076_4007469_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 276
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4010779	4020130	5277702		Bacillus_virus(33.33%)	7	NA	NA
WP_001281881.1|4010779_4013038_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
WP_000965712.1|4013271_4014009_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_000059388.1|4014083_4015496_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000095154.1|4015606_4017826_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000848528.1|4017868_4018126_-	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000691619.1|4018176_4019103_-	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000013149.1|4019302_4020130_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
>prophage 277
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4026206	4027091	5277702		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018760.1|4026206_4027091_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 278
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4049307	4050480	5277702		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524988.1|4049307_4050480_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	31.0	9.4e-40
>prophage 279
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4068542	4072322	5277702	transposase,integrase	Pseudomonas_phage(33.33%)	5	4066689:4066702	4080561:4080574
4066689:4066702	attL	GTTGCCGGATGCAA	NA	NA	NA	NA
WP_000211838.1|4068542_4069001_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|4069098_4069338_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|4069432_4070137_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_104457552.1|4070127_4071090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104457553.1|4071134_4072322_-|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	30.7	2.8e-31
4080561:4080574	attR	TTGCATCCGGCAAC	NA	NA	NA	NA
>prophage 280
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4097070	4098225	5277702		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|4097070_4098225_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 281
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4126473	4127706	5277702		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|4126473_4127706_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 282
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4135841	4141219	5277702		Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000195062.1|4135841_4138715_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	2.2e-263
WP_001389468.1|4139785_4141219_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.3	2.6e-31
>prophage 283
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4145143	4160535	5277702	tRNA	Brevibacillus_phage(14.29%)	13	NA	NA
WP_000806638.1|4145143_4146040_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
WP_000715213.1|4146064_4146775_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000813200.1|4146780_4148514_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.9e-60
WP_001701073.1|4148604_4149702_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003078.1|4149712_4151230_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	1.2e-87
WP_001192818.1|4151272_4151821_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_120795390.1|4151875_4151947_+	protein YqfH	NA	NA	NA	NA	NA
WP_001488323.1|4151943_4152069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295374.1|4152070_4153519_-	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001549659.1|4153954_4155874_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_000012163.1|4156397_4157765_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_001549658.1|4157800_4159117_-	guanine deaminase	NA	NA	NA	NA	NA
WP_001280192.1|4159134_4160535_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 284
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4184814	4185570	5277702		Clostridium_phage(100.0%)	1	NA	NA
WP_001301085.1|4184814_4185570_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 285
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4205976	4208471	5277702		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000603504.1|4205976_4206738_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
WP_000256438.1|4207052_4208471_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
>prophage 286
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4218102	4224875	5277702		Moraxella_phage(33.33%)	6	NA	NA
WP_000895624.1|4218102_4218816_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_000082188.1|4218884_4219574_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564489.1|4220258_4220789_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957910.1|4220801_4223048_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000204658.1|4223198_4224074_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816232.1|4224080_4224875_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 287
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4230352	4245900	5277702	tRNA	Bacillus_phage(33.33%)	9	NA	NA
WP_001138207.1|4230352_4233241_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	4.0e-68
WP_001410993.1|4233233_4236776_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.9	1.5e-08
WP_000775949.1|4236775_4238602_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.7	5.9e-25
WP_000237947.1|4238663_4239995_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_016243814.1|4240226_4241480_+	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	29.0	5.9e-16
WP_000678646.1|4242058_4243156_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000117728.1|4243394_4244201_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000184261.1|4244251_4244695_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_001295151.1|4244694_4245900_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.2	6.0e-74
>prophage 288
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4257426	4258182	5277702		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|4257426_4258182_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 289
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4263040	4263889	5277702		Vibrio_phage(100.0%)	1	NA	NA
WP_000100432.1|4263040_4263889_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	1.2e-41
>prophage 290
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4271423	4275538	5277702		Hokovirus(50.0%)	2	NA	NA
WP_000186442.1|4271423_4274180_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	8.3e-55
WP_000046790.1|4274236_4275538_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	2.0e-38
>prophage 291
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4279570	4285266	5277702		Only_Syngen_Nebraska_virus(33.33%)	4	NA	NA
WP_000210878.1|4279570_4281208_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_104457555.1|4281295_4282594_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	4.4e-131
WP_001549631.1|4284315_4284456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001199979.1|4284594_4285266_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
>prophage 292
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4289983	4290769	5277702		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021322.1|4289983_4290769_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	6.5e-21
>prophage 293
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4315474	4317507	5277702		Hokovirus(50.0%)	2	NA	NA
WP_001090361.1|4315474_4316902_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
WP_001173673.1|4316901_4317507_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
>prophage 294
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4320619	4333802	5277702		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|4320619_4321381_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|4321374_4322001_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_104457557.1|4322140_4323280_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|4323342_4324335_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104466.1|4324428_4325793_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136936.1|4325881_4326658_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|4326662_4327301_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590398.1|4327297_4328560_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|4328556_4329465_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001300386.1|4329660_4330428_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141341.1|4330478_4331135_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	45.3	5.2e-48
WP_001272924.1|4331240_4333802_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 295
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4353269	4354283	5277702		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000989159.1|4353269_4354283_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	1.0e-26
>prophage 296
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4361759	4362725	5277702		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287415.1|4361759_4362725_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 297
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4368192	4373752	5277702	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_001325225.1|4368192_4368690_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	7.5e-31
WP_000963143.1|4368769_4369831_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000140506.1|4370073_4370574_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000047170.1|4370701_4373332_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|4373566_4373752_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 298
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4386802	4392098	5277702		Bacillus_virus(20.0%)	5	NA	NA
WP_000985499.1|4386802_4388005_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	3.8e-28
WP_000777969.1|4388359_4389319_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_000246516.1|4389328_4391473_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.4	2.2e-196
WP_000080947.1|4391445_4391856_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001223227.1|4391852_4392098_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 299
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4396034	4400086	5277702		Clostridium_phage(50.0%)	4	NA	NA
WP_000522415.1|4396034_4396484_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156811.1|4396484_4397147_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001295173.1|4397167_4398568_-	GABA permease	NA	NA	NA	NA	NA
WP_000097662.1|4398805_4400086_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.4e-33
>prophage 300
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4404071	4492300	5277702	lysis,terminase,protease,tail,integrase,tRNA,portal,transposase	Enterobacteria_phage(35.19%)	92	4416200:4416222	4481036:4481058
WP_000156884.1|4404071_4405094_+|transposase	IS110-like element IS5708 family transposase	transposase	NA	NA	NA	NA
WP_016240246.1|4405534_4406542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001324816.1|4406583_4407435_-	alpha-1,2-mannosidase	NA	NA	NA	NA	NA
WP_016240245.1|4407462_4407786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072097107.1|4410908_4411118_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	68.1	1.3e-08
WP_001120794.1|4411272_4411392_+	hypothetical protein	NA	NA	NA	NA	NA
4416200:4416222	attL	GCTGGCGGGAGTTGAACCCGCGT	NA	NA	NA	NA
WP_016243807.1|4416350_4416974_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_016243806.1|4416977_4417667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016243805.1|4417699_4418869_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.3	2.3e-147
WP_001331174.1|4418829_4419036_-	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_001331173.1|4419095_4419311_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	65.1	1.2e-14
WP_001222408.1|4419307_4419670_-	phage protein	NA	K7PH61	Enterobacteria_phage	96.7	2.0e-65
WP_000008202.1|4419660_4420197_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	99.4	9.7e-101
WP_000081294.1|4420324_4421149_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	100.0	3.5e-150
WP_000135680.1|4421213_4421576_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000917896.1|4422176_4422473_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000450737.1|4422658_4423285_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	1.9e-47
WP_000205494.1|4423382_4423583_+	cell division protein	NA	NA	NA	NA	NA
WP_000515869.1|4423620_4424178_+	protein YmfL	NA	U5P4K1	Shigella_phage	96.8	8.8e-97
WP_001250269.1|4424353_4424533_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104954.1|4424522_4425464_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	4.3e-144
WP_077125183.1|4425460_4425955_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	1.6e-86
WP_000066917.1|4425954_4426608_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210170.1|4426604_4426931_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_104457559.1|4426927_4427317_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	3.5e-68
WP_001061444.1|4427336_4428146_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_061157959.1|4428153_4429143_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	3.1e-193
WP_001205460.1|4429160_4429502_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001131905.1|4429514_4430063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000868396.1|4430049_4430976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917724.1|4431240_4431444_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_016243801.1|4431594_4432647_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.7	6.1e-208
WP_000839596.1|4432714_4432930_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135250.1|4432929_4433427_+	lysozyme	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_016243800.1|4433423_4433891_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	98.7	6.5e-77
WP_001139675.1|4433878_4434031_+	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	100.0	1.2e-21
WP_000373425.1|4434706_4435201_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_023307630.1|4435200_4437303_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.9	0.0e+00
WP_001072975.1|4437299_4437512_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_016243798.1|4437511_4439020_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.6	3.5e-289
WP_016243797.1|4438964_4440992_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.8	0.0e+00
WP_001097050.1|4441078_4441402_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|4441394_4441670_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677102.1|4441681_4442260_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
WP_001079398.1|4442256_4442658_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211129.1|4442668_4443412_+|tail	tail protein	tail	A5LH35	Enterobacteria_phage	99.6	1.0e-132
WP_001300035.1|4443472_4443859_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_001161009.1|4443867_4444197_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_052994248.1|4444168_4447234_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.5	0.0e+00
WP_000447253.1|4447233_4447563_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_104457560.1|4447572_4448271_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.3	3.6e-132
WP_032159042.1|4448276_4449020_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.9	3.0e-145
WP_000741589.1|4448917_4449565_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
WP_016243793.1|4449625_4453123_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	96.7	0.0e+00
WP_001233071.1|4453193_4453793_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
WP_104457606.1|4453857_4456818_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	53.7	4.0e-55
WP_016243792.1|4456817_4457402_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	6.0e-104
WP_000355482.1|4457471_4458245_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	37.7	4.1e-36
WP_001288444.1|4458651_4460085_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.1	4.1e-106
WP_012602456.1|4460119_4461334_-	type II restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	7.9e-34
WP_001067212.1|4461854_4462700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000795663.1|4462980_4463187_+	AlpA family transcriptional regulator	NA	A0A0R6PGY4	Moraxella_phage	41.1	8.5e-05
WP_001019190.1|4463207_4463507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322898.1|4463801_4465004_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_008322896.1|4464996_4466301_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001059592.1|4466297_4468172_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001062150.1|4468186_4468573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000360018.1|4468669_4469095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708681.1|4469145_4469460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001078959.1|4469479_4469866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104457561.1|4470404_4471577_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_087812862.1|4471545_4471986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124304488.1|4472090_4473332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045889046.1|4473759_4474173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071698745.1|4474219_4474426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124302410.1|4474429_4475332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052697485.1|4475653_4477798_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_069683831.1|4477800_4479552_+	ATP-dependent helicase	NA	H9C0J4	Bdellovibrio_phage	25.2	4.8e-08
WP_045889044.1|4479633_4480905_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	90.7	4.0e-214
WP_000162574.1|4481605_4482088_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
4481036:4481058	attR	GCTGGCGGGAGTTGAACCCGCGT	NA	NA	NA	NA
WP_000600190.1|4482219_4482696_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|4482685_4482976_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|4483037_4483379_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|4483527_4485189_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|4485274_4486153_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|4486275_4486869_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|4486923_4488210_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|4488230_4489022_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|4489188_4490550_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|4490686_4490935_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|4490953_4491502_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|4491532_4492300_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 301
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4495721	4496792	5277702		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168045.1|4495721_4496792_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 302
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4502698	4505272	5277702		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|4502698_4505272_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 303
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4511137	4512436	5277702		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841103.1|4511137_4512436_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 304
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4517729	4523812	5277702	tRNA	Achromobacter_phage(25.0%)	7	NA	NA
WP_001098726.1|4517729_4518149_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|4518355_4519393_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262713.1|4519440_4520130_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	9.3e-56
WP_000627807.1|4520434_4520818_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189207.1|4520873_4521461_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001410849.1|4521563_4522445_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|4522477_4523812_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 305
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4529583	4533326	5277702		Tupanvirus(50.0%)	3	NA	NA
WP_000790168.1|4529583_4531383_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|4531398_4532373_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068340.1|4532645_4533326_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	3.3e-21
>prophage 306
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4536785	4537046	5277702		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|4536785_4537046_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 307
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4541165	4552455	5277702		Bacillus_phage(50.0%)	7	NA	NA
WP_016240195.1|4541165_4545053_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	5.9e-131
WP_001297612.1|4545610_4547038_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_001215861.1|4547202_4547916_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001325465.1|4547905_4549240_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	36.3	3.3e-09
WP_000717694.1|4549300_4549639_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000883122.1|4549683_4550874_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919159.1|4551201_4552455_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 308
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4558347	4559859	5277702		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493502.1|4558347_4559859_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	4.3e-13
>prophage 309
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4574994	4581451	5277702		Faustovirus(20.0%)	8	NA	NA
WP_001295373.1|4574994_4576209_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|4576236_4576623_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|4576639_4576963_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000384411.1|4577058_4577574_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196613.1|4577590_4579441_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_001124469.1|4579442_4579778_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523616.1|4579789_4579990_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_016240191.1|4580167_4581451_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	9.9e-35
>prophage 310
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4591337	4591769	5277702		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|4591337_4591769_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 311
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4600599	4610726	5277702	transposase	Escherichia_phage(37.5%)	9	NA	NA
WP_016240186.1|4600599_4601970_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.8	4.0e-42
WP_001299507.1|4602131_4603598_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138282.1|4603666_4605244_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_000755178.1|4605336_4605876_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
WP_000669412.1|4605891_4606407_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_001344399.1|4606720_4606894_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
WP_061351262.1|4608419_4609955_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.0	1.6e-265
WP_000612629.1|4610004_4610352_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	98.3	2.2e-61
WP_001324957.1|4610348_4610726_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	89.7	3.5e-57
>prophage 312
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4615776	4619778	5277702		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_001028614.1|4615776_4616415_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
WP_001295474.1|4616414_4617452_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001295473.1|4617776_4618403_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198328.1|4618488_4619778_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
>prophage 313
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4641076	4641790	5277702		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|4641076_4641790_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 314
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4659078	4660029	5277702		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|4659078_4660029_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 315
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4673634	4712353	5277702	transposase,integrase	Escherichia_phage(20.0%)	40	4668206:4668221	4721437:4721452
4668206:4668221	attL	GCATTGCCGGGCTGGG	NA	NA	NA	NA
WP_097293518.1|4673634_4674328_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.7	2.4e-128
WP_000490354.1|4674447_4675257_-	glutamate racemase	NA	NA	NA	NA	NA
WP_000063570.1|4675290_4676751_-	amino acid permease	NA	NA	NA	NA	NA
WP_071840637.1|4676743_4677022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001459964.1|4677002_4677488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032142258.1|4678353_4679862_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.3	1.2e-44
WP_077633943.1|4680170_4680542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000806589.1|4681330_4681537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072278726.1|4681575_4681905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000338533.1|4682001_4682544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001533176.1|4682561_4682825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999973.1|4682964_4683156_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071840636.1|4683618_4684158_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A0D4DBR3	Acinetobacter_phage	41.1	3.0e-25
WP_000769961.1|4684346_4685708_+	ethanolamine ammonia-lyase subunit EutB	NA	NA	NA	NA	NA
WP_000372374.1|4685728_4686616_+	ethanolamine ammonia-lyase subunit EutC	NA	NA	NA	NA	NA
WP_001111027.1|4686625_4687285_+	ethanolamine utilization microcompartment protein EutL	NA	NA	NA	NA	NA
WP_001295463.1|4687297_4687798_+	ethanolamine utilization microcompartment protein EutK	NA	NA	NA	NA	NA
WP_016240169.1|4687843_4688896_+	HTH-type transcriptional regulator EutR	NA	NA	NA	NA	NA
WP_016240168.1|4688901_4689801_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_000102891.1|4689804_4690674_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
WP_000406000.1|4690887_4691313_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_016240167.1|4691299_4691749_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_016243754.1|4691809_4692385_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000084590.1|4692480_4693380_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_001383656.1|4693437_4694742_-	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	24.2	1.2e-08
WP_001400779.1|4694746_4696171_-	PTS N-acetylmuramic acid transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001400778.1|4696174_4697071_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_016240166.1|4697234_4698092_+	HTH-type transcriptional regulator MurR	NA	NA	NA	NA	NA
WP_000517443.1|4698220_4699012_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	6.8e-18
WP_000290223.1|4699315_4700332_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016240165.1|4700331_4701165_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000852686.1|4701164_4702040_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000021036.1|4702029_4703127_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_016240164.1|4703260_4704172_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.3	8.5e-57
WP_000745534.1|4704360_4705095_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_000719962.1|4705127_4705502_-	YfeK family protein	NA	NA	NA	NA	NA
WP_024551180.1|4706434_4707277_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_024551181.1|4707263_4709387_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001118618.1|4710064_4710988_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	4.9e-177
WP_001101446.1|4711327_4712353_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
4721437:4721452	attR	GCATTGCCGGGCTGGG	NA	NA	NA	NA
>prophage 316
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4722788	4730721	5277702		Salmonella_phage(40.0%)	13	NA	NA
WP_000130751.1|4722788_4723580_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	25.4	7.3e-12
WP_000942288.1|4723582_4724281_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	4.4e-13
WP_001166628.1|4724526_4724982_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294653.1|4725053_4725449_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000732275.1|4725464_4725740_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|4725767_4726193_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000209296.1|4726231_4727917_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_001277466.1|4727934_4728300_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|4728296_4728533_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001446012.1|4728516_4728636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993245.1|4728598_4728811_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_016236504.1|4728940_4729498_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	82.1	2.6e-48
WP_109544644.1|4729500_4730721_+	DUF4158 domain-containing protein	NA	A0A1B0V7H9	Salmonella_phage	56.7	4.4e-117
>prophage 317
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4735108	4735642	5277702		Wolbachia_phage(100.0%)	1	NA	NA
WP_000792636.1|4735108_4735642_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
>prophage 318
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4740981	4744309	5277702		Bacillus_phage(66.67%)	4	NA	NA
WP_008786877.1|4740981_4741332_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	51.4	2.3e-18
WP_023165800.1|4741478_4741910_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_023165801.1|4742160_4743636_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	6.1e-28
WP_000697966.1|4743628_4744309_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.1	6.0e-31
>prophage 319
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4751450	4759591	5277702	transposase	Stx2-converting_phage(60.0%)	6	NA	NA
WP_131631839.1|4751450_4753925_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.4	5.3e-85
WP_000843494.1|4753965_4754163_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_021567585.1|4755573_4755981_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	37.8	6.1e-15
WP_021567584.1|4755977_4756328_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	3.3e-41
WP_039264109.1|4756358_4757951_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.8	1.9e-181
WP_072203122.1|4758988_4759591_+	heavy metal sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.6	1.3e-13
>prophage 320
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4763203	4770848	5277702		Hokovirus(33.33%)	6	NA	NA
WP_000623136.1|4763203_4764931_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000487600.1|4764975_4765233_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034402.1|4765616_4766588_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000254839.1|4766772_4767534_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_016240162.1|4767763_4768762_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000443665.1|4768832_4770848_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	6.5e-150
>prophage 321
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4792391	4793126	5277702		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|4792391_4793126_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 322
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4796943	4797864	5277702		Morganella_phage(100.0%)	1	NA	NA
WP_000484405.1|4796943_4797864_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	6.4e-76
>prophage 323
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4801051	4808628	5277702		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_001283490.1|4801051_4802746_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.4e-23
WP_000955028.1|4802815_4803760_+	transporter YfdV	NA	NA	NA	NA	NA
WP_001296867.1|4803833_4804979_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_016243745.1|4805034_4808628_-	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	31.8	6.6e-36
>prophage 324
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4816046	4817480	5277702		Bacillus_phage(100.0%)	1	NA	NA
WP_000194515.1|4816046_4817480_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 325
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4820519	4821452	5277702		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000368131.1|4820519_4821452_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 326
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4839331	4840417	5277702		Pandoravirus(100.0%)	1	NA	NA
WP_001333535.1|4839331_4840417_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
>prophage 327
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4848981	4850118	5277702		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699149.1|4848981_4850118_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	5.9e-23
>prophage 328
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4856594	4858112	5277702		Mollivirus(100.0%)	1	NA	NA
WP_000334221.1|4856594_4858112_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
>prophage 329
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4862323	4863097	5277702		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_001293612.1|4862323_4863097_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 330
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4874743	4877971	5277702		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001203392.1|4874743_4875394_+	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	35.4	3.1e-08
WP_001012899.1|4875480_4877313_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000813859.1|4877371_4877971_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 331
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4912384	4917388	5277702		Tupanvirus(50.0%)	4	NA	NA
WP_000860273.1|4912384_4914367_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
WP_000461657.1|4914366_4915335_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
WP_001300684.1|4915338_4916478_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	31.7	1.2e-31
WP_000879112.1|4916785_4917388_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
>prophage 332
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4920992	4925503	5277702	transposase	Oenococcus_phage(50.0%)	5	NA	NA
WP_001338959.1|4920992_4922198_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.2e-26
WP_001295288.1|4922254_4923544_+	MFS transporter	NA	NA	NA	NA	NA
WP_000992954.1|4923561_4924365_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_000150333.1|4924405_4924591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104457568.1|4924603_4925503_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	55.2	5.6e-69
>prophage 333
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4931396	4945611	5277702		Pseudomonas_phage(33.33%)	8	NA	NA
WP_000779090.1|4931396_4932473_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_000301050.1|4932935_4933586_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000135040.1|4933639_4933894_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000332036.1|4933893_4935024_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_104457569.1|4935258_4937544_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.1e-283
WP_016243727.1|4938239_4941974_+	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	26.1	3.3e-22
WP_000990753.1|4942114_4942837_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001281242.1|4942983_4945611_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
>prophage 334
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4960533	4965376	5277702		Bacillus_phage(50.0%)	2	NA	NA
WP_000559125.1|4960533_4962360_-	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	27.3	1.5e-20
WP_000876026.1|4962526_4965376_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.9e-41
>prophage 335
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	4969653	5072804	5277702	lysis,terminase,protease,head,capsid,tail,integrase,portal,transposase,plate	Salmonella_phage(17.31%)	109	4997404:4997452	5043035:5043083
WP_000865603.1|4969653_4970760_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.4	1.2e-118
WP_000406106.1|4970871_4971927_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000710375.1|4972000_4973065_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000884919.1|4973064_4973715_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000422189.1|4973790_4975434_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	1.2e-13
WP_000758073.1|4975651_4977298_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000849209.1|4978014_4978503_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000686723.1|4978910_4979405_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_000557378.1|4979394_4979658_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778038.1|4979654_4980050_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_000427623.1|4980231_4981236_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000091291.1|4983474_4984170_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013515.1|4984156_4985020_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835177.1|4985016_4985466_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_097719227.1|4985475_4986078_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888560.1|4986096_4986714_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
WP_000971730.1|4986710_4987373_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_001295447.1|4987414_4988152_+	heme exporter protein CcmC	NA	NA	NA	NA	NA
WP_000186540.1|4988148_4988358_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001026418.1|4988354_4988834_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982447.1|4988830_4990774_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000824439.1|4990770_4991328_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_001211589.1|4991324_4992377_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001113637.1|4992411_4993059_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_085947917.1|4993599_4994873_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
4997404:4997452	attL	TTTTGGTCGGCACGAGAGGATTTGAACCTCCGACCCCCGACACCCCATG	NA	NA	NA	NA
WP_001515622.1|4997749_4998109_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001515619.1|4999017_5000199_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1GN00	Marinobacter_phage	30.0	1.9e-32
WP_001515618.1|5000201_5000411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001515617.1|5000455_5001028_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	81.9	1.0e-92
WP_001515615.1|5001206_5001446_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	59.4	2.3e-14
WP_016240145.1|5001870_5002140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016240144.1|5002132_5002489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054623526.1|5002485_5002803_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	60.2	2.3e-33
WP_001515612.1|5002799_5003054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001515610.1|5003214_5003754_-	phage protein	NA	A0A192Y8M4	Salmonella_phage	69.3	5.9e-66
WP_001515609.1|5003882_5004710_-	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	92.0	2.7e-142
WP_001515608.1|5004766_5005138_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	92.7	1.1e-58
WP_016240143.1|5005471_5005837_-	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	51.6	9.7e-12
WP_032140310.1|5006081_5006801_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	34.7	1.8e-25
WP_024195799.1|5006870_5007128_+	hypothetical protein	NA	H6WRX5	Salmonella_phage	41.1	3.5e-08
WP_016240141.1|5007159_5007723_+	hypothetical protein	NA	S5FXP0	Shigella_phage	27.1	6.5e-07
WP_071840634.1|5007898_5008078_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	65.4	7.3e-13
WP_104457572.1|5008067_5008952_+	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	82.2	1.6e-55
WP_072185864.1|5008951_5010283_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	50.8	7.4e-118
WP_001515600.1|5012226_5012919_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	55.1	3.1e-59
WP_053266458.1|5012915_5013977_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	54.9	1.0e-109
WP_053266457.1|5013998_5014691_+	antitermination protein	NA	NA	NA	NA	NA
WP_053266456.1|5015160_5015916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000116520.1|5015915_5016320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053266455.1|5016529_5017582_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	81.4	7.6e-174
WP_000783336.1|5017650_5017953_+	hypothetical protein	NA	O64361	Escherichia_phage	66.3	5.4e-32
WP_000535562.1|5017952_5018486_+	lysozyme	NA	K7PM52	Enterobacteria_phage	89.0	2.5e-88
WP_000088936.1|5018485_5018947_+|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	63.8	3.9e-42
WP_001165319.1|5018979_5019384_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_054623525.1|5019460_5020102_+	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	32.1	8.2e-06
WP_104457573.1|5020340_5020910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054623524.1|5020851_5022975_+|terminase	terminase	terminase	A0A2K9V3X4	Faecalibacterium_phage	35.9	2.3e-97
WP_000483309.1|5022983_5023247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001045359.1|5023246_5024884_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.2	3.3e-91
WP_001052909.1|5024880_5025747_+	S49 family peptidase	NA	A0A2D1GN02	Marinobacter_phage	37.9	4.8e-49
WP_001472856.1|5025748_5026339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001472189.1|5026338_5026743_+|head	head decoration protein	head	NA	NA	NA	NA
WP_000427679.1|5026840_5027890_+|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	33.7	1.6e-51
WP_001515588.1|5027861_5028272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000537794.1|5028276_5028636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001083242.1|5028632_5029178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000497745.1|5029181_5029379_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_001515586.1|5029375_5030878_+	hypothetical protein	NA	B5TK67	Pseudomonas_phage	42.3	1.2e-100
WP_104457574.1|5030881_5031253_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000807719.1|5031254_5031533_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001568796.1|5031674_5033603_+	hypothetical protein	NA	T1SBJ1	Salmonella_phage	43.2	5.1e-19
WP_001139208.1|5033946_5035350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104457575.1|5035346_5036432_+|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	31.5	9.9e-44
WP_000900614.1|5036470_5037013_+|plate	baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	30.8	5.9e-05
WP_001279799.1|5037009_5037447_+	hypothetical protein	NA	B5TK74	Pseudomonas_phage	45.8	4.0e-12
WP_001116110.1|5037448_5038591_+|plate	baseplate J/gp47 family protein	plate	A0A0A8WEY6	Clostridium_phage	34.8	6.2e-12
WP_000051911.1|5038587_5039181_+	YmfQ family protein	NA	NA	NA	NA	NA
WP_104457607.1|5039520_5039976_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	69.6	6.8e-55
WP_054623568.1|5039975_5040578_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	91.0	7.8e-99
WP_104457576.1|5040549_5041017_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	96.1	1.8e-79
WP_054623286.1|5041401_5041962_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	82.7	1.6e-82
WP_001515579.1|5042005_5042272_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	94.3	2.3e-39
WP_001515577.1|5042611_5042932_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	74.5	4.6e-42
WP_000256166.1|5043188_5044949_-	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
5043035:5043083	attR	TTTTGGTCGGCACGAGAGGATTTGAACCTCCGACCCCCGACACCCCATG	NA	NA	NA	NA
WP_001135667.1|5044968_5045196_-	YejL family protein	NA	NA	NA	NA	NA
WP_000050789.1|5045377_5046385_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
WP_000494183.1|5046523_5046808_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_016243719.1|5046932_5048693_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.0	8.4e-101
WP_001234850.1|5048842_5049538_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213361.1|5049565_5050756_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_000202798.1|5051088_5051433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194915.1|5051436_5053026_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
WP_000088916.1|5053027_5054053_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000501611.1|5054052_5055147_-	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001295450.1|5055147_5056962_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_097719106.1|5057043_5058600_-	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000241011.1|5058780_5059347_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_000594599.1|5059758_5060472_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000198828.1|5060510_5061497_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_001091940.1|5061614_5063081_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	2.3e-43
WP_001136827.1|5063303_5063876_-	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000389030.1|5064030_5064285_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_011787801.1|5065415_5066906_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	82.2	8.6e-224
WP_055329964.1|5066940_5067798_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	48.4	6.6e-67
WP_011787803.1|5067888_5068221_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
WP_011787804.1|5068338_5068959_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	37.1	1.7e-24
WP_011787805.1|5069128_5069389_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_011918375.1|5069388_5069700_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011787830.1|5069723_5072804_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
>prophage 336
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	5085556	5086414	5277702		Catovirus(100.0%)	1	NA	NA
WP_000873894.1|5085556_5086414_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	4.0e-24
>prophage 337
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	5090484	5094270	5277702		Acinetobacter_phage(50.0%)	3	NA	NA
WP_000489247.1|5090484_5092476_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
WP_000425438.1|5092507_5093344_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001139613.1|5093601_5094270_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 338
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	5097964	5099485	5277702		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255039.1|5097964_5099485_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 339
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	5119735	5129177	5277702		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569357.1|5119735_5120662_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|5120666_5121398_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|5121378_5121486_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|5121545_5122277_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|5122498_5124184_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|5124180_5124900_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|5124946_5125417_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|5125457_5125919_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_047399903.1|5126043_5128044_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001292777.1|5128040_5129177_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	5.5e-162
>prophage 340
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	5140810	5142844	5277702	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001295427.1|5140810_5142844_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 341
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	5156037	5159594	5277702		Paenibacillus_phage(50.0%)	4	NA	NA
WP_047399921.1|5156037_5156856_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_047399923.1|5156907_5157654_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011973.1|5157627_5158593_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846217.1|5158589_5159594_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
>prophage 342
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	5168813	5175686	5277702	tRNA	Bacillus_phage(50.0%)	8	NA	NA
WP_000807362.1|5168813_5169713_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001318299.1|5170126_5170444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047399940.1|5170773_5172135_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	3.2e-217
WP_001220181.1|5172237_5172534_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001307279.1|5172535_5172832_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000929408.1|5173040_5173373_-	YegP family protein	NA	NA	NA	NA	NA
WP_047399943.1|5173563_5174286_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	2.4e-30
WP_000675146.1|5174282_5175686_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
>prophage 343
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	5189118	5190471	5277702		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_047399959.1|5189118_5190471_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.6	3.5e-06
>prophage 344
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	5195196	5206921	5277702		Catovirus(16.67%)	9	NA	NA
WP_047400267.1|5195196_5195838_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234767.1|5195929_5196511_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001252336.1|5196532_5198386_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_000687872.1|5198438_5198729_-	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	37.2	2.1e-09
WP_104457583.1|5199908_5201492_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_000978094.1|5202150_5203290_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000482901.1|5203295_5203739_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_047399969.1|5203741_5205904_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000654503.1|5206081_5206921_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
>prophage 345
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	5211164	5217958	5277702		Synechococcus_phage(25.0%)	6	NA	NA
WP_047399972.1|5211164_5212286_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
WP_104457584.1|5212288_5213257_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.5	9.3e-86
WP_000479838.1|5213256_5213736_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000699714.1|5213732_5214956_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_047399974.1|5214958_5216395_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.4	3.9e-48
WP_047399976.1|5216587_5217958_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	1.7e-32
>prophage 346
NZ_CP026399	Escherichia coli strain ECONIH4 chromosome, complete genome	5277702	5223573	5277609	5277702	protease,transposase,integrase	Enterobacteria_phage(48.57%)	62	5244093:5244152	5271102:5272867
WP_047399983.1|5223573_5224968_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.2	8.3e-19
WP_000183060.1|5225142_5226036_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000699403.1|5226408_5227494_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	5.7e-100
WP_001023625.1|5227493_5228393_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	2.6e-29
WP_011787758.1|5228766_5230377_+|transposase	IS1634-like element ISSpu7 family transposase	transposase	NA	NA	NA	NA
WP_001100804.1|5231101_5231647_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.3	3.5e-50
WP_104457585.1|5231662_5232919_+	O13/O129/O135 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001087599.1|5232948_5233839_+	rhamnosyltransferase	NA	NA	NA	NA	NA
WP_001524982.1|5233867_5234737_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_011787758.1|5235473_5237084_-|transposase	IS1634-like element ISSpu7 family transposase	transposase	NA	NA	NA	NA
WP_000912441.1|5237676_5238051_+	bactoprenol glucosyl transferase	NA	U5P0S6	Shigella_phage	46.0	1.6e-17
WP_097767169.1|5238113_5239040_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_001313975.1|5240478_5240838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000043428.1|5240946_5242353_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	6.2e-38
WP_047399991.1|5242598_5243765_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.4	1.0e-110
5244093:5244152	attL	TATCCGACATTCCGCAGCTAATTTAGGAATAAACTACCTCATAGAATCTACCGAGTAATT	NA	NA	NA	NA
WP_011787758.1|5244114_5245725_-|transposase	IS1634-like element ISSpu7 family transposase	transposase	NA	NA	NA	NA
WP_000954897.1|5246750_5247362_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_000880182.1|5247355_5248132_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_000586485.1|5248113_5248851_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_047399993.1|5248850_5249441_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_000080097.1|5249440_5250508_-	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_000108970.1|5250507_5251578_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_032218856.1|5251574_5252879_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_000131776.1|5252884_5253784_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
WP_001364200.1|5253929_5253980_-	his operon leader peptide	NA	NA	NA	NA	NA
WP_001259255.1|5254262_5254514_+	YoeB-YefM toxin-antitoxin system antitoxin YefM	NA	NA	NA	NA	NA
WP_000767829.1|5254510_5254765_+	type II toxin-antitoxin system mRNA interferase toxin YoeB	NA	NA	NA	NA	NA
WP_000754758.1|5254847_5255672_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000803351.1|5255717_5256647_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010723108.1|5256861_5256924_+	membrane protein YoeI	NA	NA	NA	NA	NA
WP_000019197.1|5256913_5258272_+	putrescine/proton symporter PlaP	NA	NA	NA	NA	NA
WP_000492312.1|5258450_5259509_+	transport protein YeeE	NA	NA	NA	NA	NA
WP_000985278.1|5259522_5259750_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_039022114.1|5259792_5261217_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_054623412.1|5261398_5262577_+|integrase	site-specific integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	99.5	2.6e-231
WP_000132739.1|5262557_5262749_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_098031474.1|5262826_5263171_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	1.7e-58
WP_032229698.1|5263278_5263539_-	hypothetical protein	NA	A0A1B1W289	Salmonella_phage	97.6	9.3e-41
WP_104457586.1|5263535_5264333_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	54.6	3.0e-74
WP_104457587.1|5264335_5264617_-	hypothetical protein	NA	A0A077KAZ4	Edwardsiella_phage	77.3	1.6e-30
WP_104457588.1|5264618_5265032_-	ead/Ea22-like family protein	NA	K7P6V8	Enterobacteria_phage	47.3	8.7e-09
WP_104457589.1|5265028_5265301_-	antitoxin	NA	NA	NA	NA	NA
WP_104457590.1|5265297_5265795_-	hNH endonuclease	NA	K7PJM1	Enterobacteria_phage	60.0	8.8e-40
WP_096965523.1|5265791_5265956_-	DUF2737 family protein	NA	K7P7R0	Enterobacteria_phage	98.1	1.9e-23
WP_104457591.1|5265966_5266263_-	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	86.7	3.1e-40
WP_000098523.1|5266276_5266783_-	single-stranded DNA-binding protein	NA	K7PHK1	Enterobacteria_phage	98.8	6.8e-80
WP_000018646.1|5266779_5267247_-	hypothetical protein	NA	A0A2I7QWC6	Vibrio_phage	62.0	1.2e-46
WP_104457592.1|5267247_5267955_-	recombinase	NA	K7PKU3	Enterobacteria_phage	99.6	1.0e-137
WP_122986066.1|5268148_5268262_-	host cell division inhibitory peptide Kil	NA	G9L669	Escherichia_phage	97.3	1.0e-12
WP_016246170.1|5268254_5268401_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A2D1GLZ1	Escherichia_phage	100.0	3.8e-20
WP_104457594.1|5268424_5269393_-	cell envelope biogenesis protein TolA	NA	G5DA88	Enterobacteria_phage	99.7	1.7e-55
WP_011787758.1|5269528_5271139_+|transposase	IS1634-like element ISSpu7 family transposase	transposase	NA	NA	NA	NA
WP_000167595.1|5271303_5271774_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_016063548.1|5272048_5272381_-	antitermination protein N	NA	K7PJZ2	Enterobacterial_phage	100.0	1.1e-54
WP_000470488.1|5272858_5273155_-	hypothetical protein	NA	K7PL18	Enterobacteria_phage	96.9	8.9e-48
5271102:5272867	attR	AATTACTCGGTAGATTCTATGAGGTAGTTTATTCCTAAATTAGCTGCGGAATGTCGGATATATCCTCCGTCAAAAAAATTGCCCTCACACTGGAGGGCAAAGAAGATTTCCAATAATCAGAACAAGTCGGCTCCTGTTTAGTTACGAGCGACATTGCTCCGTGTATTCACTCGTTGGAATGAATACACAGTGCTTATTTGTACTAATAAAATACCCAATTTTCTGTTTCTTGGTTGTGTCCAAAGTTATATTCAATATCTGGTGTTGATGTATCAATATTCTTCATCCCATCAACAAGAGTTGATACAACAGCCAAATCTTGTTTGATTCTCATCAAATGGTATTTCTTCCGGCGCAATAAACTTTCAATGGCAAGTTTCTTCGTCGGGAACGCAAAAGATCTTTCTGCATTTTTTGCTACTTTCTTAATTGCATATCTATTTCTCCTTTGTTTCCATTCCTGTAACCACTGATTTGGTGCTGGTTTAAAATTAACAATCCAATGCGCAGGAACCAACCATGCATAATGCTCTGTCTGATGAAAAGCTATATATTGAAGTGCGAATATTTTTATTCCATCTTCTTCAACTGTCGCTTGGAATCTCCAGAAAACAGGCATTCCATCATGTTCAGTTTCTGATTCAGGAAAAGGTACGCTCCATGATTTTGTCATATCTCACCTCAAATAATTCAGTGCAGTGTTTATTCTGTTGTTTATGCCAAAAATAAAGGCCGACTATGCGGCATAATTATTTTTAACTATCATCAATACATGGCACTTTATTCCAGTCGATATCGTTTTTATTGTCGTCCCACATGTCTTTGTTTTTGTATTTCTCGCTACATCCTAGGCAAATGTTGTATGGCCTACCGATAAGGTTTAACGAAATACGTTGCATTTCATTTGATTCAAACATGTATCCACAGAACTGACATTTATGCATATCTCACCCCTCATACAGTAGCTTACTGCCTAATTTCATTTTCTGGCGACCAACACAAGTCACACCCATTTCACTGCGTGGCTTGCTGTACCATGTGCGCTGATTCTTGCGCTCAATACGTTGCAGGTTGCTTTCAATCTGTTCGTGGTATTCAGCCAGTACCGTAAGGTCTATCGGATTCAGTGCGCTTTCTACTCGTGATTTCGGTTTGCGATTCAGCGAGAGAATAGGGCGGTTAACTGGTTTTGCGCTTACCCCAACCAACAGGGGATTTGCTGCTTTCCATTGAGCCTGTTTCTCTGCGCGACGTTCGCGGCGGCGTGTTTGTGCATCCATCTGGATTCTCCTGTCAGTTAGCTTTGGTGGTGTGGTGGCTGGTAGTCTAGCTCCAGCTTGTTGAGTCTCATTCGGAGGGGTATAACCGGCACCCCAGTGATTTTTCCATGCGACAACGTGCGCGTTATGGCGGCCTTATCGCCCGCGGCTCCCCATCTCGTCCACGCTATTGCTAGCGTTGGGAGCGCTTCACCGCTCAACAGTAGGTAAGCACTTGCCAGTGACTAGCTGGCTTCACCACACCCCAAAGCCTTCTGCTTTGAATGCTGCCCTTCTTCAGGGCTTAATTTTTAAGAGCCTCACCTTCATGGTGGTTAGTGCGTCCTGCTGATGGCTTAAAATATACCTACAGGTAAAACTGTTGTCTATACCTGCAGGTAAATAAAATTGGTGTGAGAGTTTACCTGTTTGAATTTTCAGGTAATTAATTTTTTGGATTGATATAAAAAAGCCCGCTTTGCGGGCTGAAAGGAGATGTCAGAAGCT	NA	NA	NA	NA
WP_024186732.1|5273169_5273856_-	helix-turn-helix transcriptional regulator	NA	K7PK07	Enterobacteria_phage	98.2	4.1e-128
WP_000391959.1|5273964_5274195_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	100.0	1.1e-37
WP_104457595.1|5274314_5274593_+	hypothetical protein	NA	Q8VNP9	Enterobacteria_phage	98.9	1.1e-42
WP_000166205.1|5274627_5274774_+	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	97.9	2.8e-18
WP_016063113.1|5274766_5275666_+	DNA replication protein O	NA	K7PH26	Enterobacteria_phage	100.0	1.2e-164
WP_158649915.1|5275655_5277092_+	AAA family ATPase	NA	K7PGR8	Enterobacteria_phage	99.8	8.8e-274
WP_000736886.1|5277168_5277609_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	99.3	3.5e-80
>prophage 1
NZ_CP026400	Escherichia coli strain ECONIH4 plasmid pECO-5e72, complete sequence	60248	0	1995	60248		Hokovirus(100.0%)	1	NA	NA
WP_048235105.1|579_1995_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	3.1e-53
>prophage 2
NZ_CP026400	Escherichia coli strain ECONIH4 plasmid pECO-5e72, complete sequence	60248	6123	11032	60248		Streptococcus_phage(50.0%)	5	NA	NA
WP_044715191.1|6123_8445_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	26.6	4.1e-39
WP_050886235.1|8446_9103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044715189.1|9105_9762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044715185.1|9773_10547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044715183.1|10561_11032_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	40.0	1.6e-19
>prophage 3
NZ_CP026400	Escherichia coli strain ECONIH4 plasmid pECO-5e72, complete sequence	60248	15091	22480	60248	transposase	uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_011787801.1|15091_16582_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	82.2	8.6e-224
WP_055329964.1|16616_17474_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	48.4	6.6e-67
WP_011787803.1|17564_17897_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
WP_011787804.1|18014_18635_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	37.1	1.1e-26
WP_011787805.1|18804_19065_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_011918375.1|19064_19376_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011787830.1|19399_22480_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	30.6	8.2e-51
>prophage 4
NZ_CP026400	Escherichia coli strain ECONIH4 plasmid pECO-5e72, complete sequence	60248	42563	44210	60248		Burkholderia_phage(50.0%)	2	NA	NA
WP_044715119.1|42563_43226_-	P-loop NTPase	NA	E5FFJ3	Burkholderia_phage	25.1	6.5e-06
WP_024262784.1|43562_44210_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	29.1	6.1e-09
>prophage 5
NZ_CP026400	Escherichia coli strain ECONIH4 plasmid pECO-5e72, complete sequence	60248	52340	58632	60248		uncultured_virus(50.0%)	3	NA	NA
WP_063078336.1|52340_55982_-	glycosyltransferase	NA	A0A218MKE2	uncultured_virus	29.6	1.5e-22
WP_064179390.1|55984_57418_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000120464.1|57417_58632_-	O8 family O-antigen ABC transporter ATP-binding protein Wzt	NA	A0A2H4PQG7	Staphylococcus_phage	26.5	2.4e-14
>prophage 1
NZ_CP026404	Escherichia coli strain ECONIH4 plasmid pECO-6357, complete sequence	127217	0	67354	127217	transposase,protease	Escherichia_phage(44.0%)	59	NA	NA
WP_001324682.1|839_2462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001446199.1|3054_3318_-|transposase	transposase	transposase	A0A218MNG9	uncultured_virus	41.7	6.3e-05
WP_001446200.1|3332_3596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000127020.1|3823_4105_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350432.1|4140_4710_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_000101609.1|4807_7657_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.3	1.2e-128
WP_023205563.1|7673_9104_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_021567664.1|9131_10961_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	C7U047	Ostreococcus_tauri_virus	41.5	5.3e-106
WP_023205562.1|11039_11498_+	small heat shock protein sHSP20-GI	NA	NA	NA	NA	NA
WP_021567662.1|11519_12428_+	heat resistance protein YfdX1	NA	NA	NA	NA	NA
WP_016239829.1|12530_13418_+	heat resistance protein YfdX2	NA	NA	NA	NA	NA
WP_001090783.1|13514_14126_+	heat resistance membrane protein HdeD-GI	NA	NA	NA	NA	NA
WP_001723515.1|14205_15351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786816.1|15340_15781_+	heat resistance system thioredoxin Trx-GI	NA	A0A023NHA9	Dinoroseobacter_phage	34.7	2.6e-11
WP_001325264.1|15784_17500_+	heat resistance system K+/H+ antiporter KefB-GI	NA	NA	NA	NA	NA
WP_016239752.1|17496_17994_+	heat resistance protein PsiE-GI	NA	NA	NA	NA	NA
WP_001721693.1|17971_18937_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_016156528.1|18961_20113_+|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	9.9e-26
WP_000484498.1|20957_21953_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.6	2.4e-20
WP_001067855.1|22059_22764_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|23385_24090_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000558568.1|27305_27617_+	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_000990392.1|27613_28033_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	31.4	1.8e-06
WP_020806042.1|28069_28279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061872725.1|29018_29723_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	2.6e-138
WP_001039462.1|31618_31954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000861578.1|31962_32154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001101446.1|32229_33255_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_104457629.1|33594_34518_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.7	8.7e-174
WP_001181218.1|34563_35241_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_000058769.1|35472_36297_-	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_001515701.1|36293_37556_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_001294851.1|37709_38510_-	histidine utilization repressor	NA	NA	NA	NA	NA
WP_001112072.1|38751_40125_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_000148344.1|40121_40718_+	HutD family protein	NA	NA	NA	NA	NA
WP_000069054.1|40956_41943_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_104457630.1|41954_42836_+	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	29.7	6.4e-25
WP_000121312.1|42835_43621_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.9	3.2e-36
WP_000741484.1|43735_45286_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.1	1.9e-80
WP_000993475.1|45329_47012_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_000135555.1|47070_48237_+	histidinol-phosphate transaminase	NA	A0A1X7QHI1	Faustovirus	27.4	1.5e-18
WP_000217345.1|48233_49391_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_001148851.1|49424_50510_+	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_024191312.1|50599_50911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032216024.1|50964_51945_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	3.0e-185
WP_032160673.1|52092_53049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|53571_54552_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_000780222.1|54829_55111_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_000493286.1|55091_55421_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_000426307.1|56117_57500_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.5	9.4e-15
WP_001067855.1|58223_58928_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_011787805.1|59155_59416_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_011918375.1|59415_59727_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011787830.1|59750_62831_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	30.6	8.2e-51
WP_000557619.1|63004_63262_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|63194_63596_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001067855.1|64918_65623_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|66042_66747_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_158649920.1|66793_67354_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.7e-108
>prophage 1
NZ_CP026403	Escherichia coli strain ECONIH4 plasmid pECO-816c, complete sequence	103161	18666	26451	103161	integrase	Escherichia_phage(28.57%)	9	10252:10266	32414:32428
10252:10266	attL	CTGGTCCGGTATCTG	NA	NA	NA	NA
WP_000016494.1|18666_19458_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	9.4e-52
WP_000239529.1|19595_19871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633913.1|19864_20509_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
WP_001103690.1|20737_21709_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	7.4e-67
WP_000340829.1|21713_22106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000457518.1|22110_23382_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.5	1.9e-142
WP_089588324.1|23381_23819_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.2	1.9e-25
WP_000618105.1|23815_24064_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	3.2e-14
WP_089588325.1|25767_26451_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.9e-29
32414:32428	attR	CTGGTCCGGTATCTG	NA	NA	NA	NA
>prophage 1
NZ_CP026405	Escherichia coli strain ECONIH4 plasmid pECO-c85f, complete sequence	186884	34417	82646	186884	transposase,integrase	Escherichia_phage(38.89%)	47	41348:41407	85050:85063
WP_011787830.1|34417_37498_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	30.6	8.2e-51
WP_011918375.1|37521_37833_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011787805.1|37832_38093_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_158649921.1|38308_38524_-	hypothetical protein	NA	A0A077SL39	Escherichia_phage	100.0	5.5e-23
WP_001067855.1|38529_39234_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000946487.1|39762_40614_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.1e-11
WP_000376623.1|40741_41242_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
41348:41407	attL	CCGACATTCCGCAGCTAATTTAGGAATAAACTACCTCATAGAATCTACCGAGTAATTTGA	NA	NA	NA	NA
WP_011787758.1|41366_42977_-|transposase	IS1634-like element ISSpu7 family transposase	transposase	NA	NA	NA	NA
41348:41407	attL	CCGACATTCCGCAGCTAATTTAGGAATAAACTACCTCATAGAATCTACCGAGTAATTTGA	NA	NA	NA	NA
WP_001163403.1|43184_43967_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_001324342.1|43956_45480_-|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_000344784.1|47197_48058_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000935451.1|48060_49776_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000204520.1|49814_50522_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|50518_50755_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|50751_51114_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_015063453.1|51131_52826_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_000522996.1|52864_53290_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|53317_53593_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294656.1|53608_53974_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|54045_54501_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000787563.1|55847_56120_+	MafI family immunity protein	NA	NA	NA	NA	NA
WP_000750746.1|56124_56367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000243483.1|56378_56714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000791469.1|56880_57333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000278322.1|57348_57951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000243801.1|58173_58494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000949433.1|58792_59329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000543934.1|59331_60342_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_000997323.1|60346_61216_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	35.1	3.5e-23
WP_000139717.1|61212_61704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001097010.1|62030_62906_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_001067855.1|63252_63957_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_011787758.1|64067_65678_-|transposase	IS1634-like element ISSpu7 family transposase	transposase	NA	NA	NA	NA
WP_104457635.1|65774_66692_-	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
64049:65809	attR	CCGACATTCCGCAGCTAATTTAGGAATAAACTACCTCATAGAATCTACCGAGTAATTTGAGTAGTTGTGTTTGGTGATCTTGAAGTCCAGTGATGAACCTTTGGCCGTTAATCTCTAGCGTATCTATGCCTTCGAATTGCAAGAAGACCCAACGTGCCGTCGGTCTGGAGGTCGTCTTGTTCTTTACCATACTTGGGAAGAACGCTTCGGTTTGTGCGAGTTGTTCTCTGATTTTGTGTTCTAAACTAGCGTAAACAAGCAAGCTCAACGTCATTATCATTAGCAACGCTTCAATGCGCTCAGGCTTTTTCAAGAAGATGGAAGAGGTTAAAAACTCAGGGCTTTTTAGAAAACGGAAGCCGCGCTCGACTTTTTGTTGCGATTTGTAATGTGCTAGAAGAGCCGCCATGGTGAGTGCTTCATTGTCGGTGTCATTCGTCGCGAGGATAAACATGCCTACTTTGAGCTTAGCCAGTTTTACTTTTTCTAGGTCGGTGAAGGGGGCGGCTTCGATAAAGTATTGGTATCCTGTCGGTGCTTCATCTGTCTTTGGGCGGCCCGAATGAGAGTAAGTCGGCTGTTTGATGAGAGTGCCTTGTTCAAACCCAAGTAAGTCACATTGTTTCTTGAAATCGTTAAACGCTAATTCTGCGTCAACTTCACAAGCGAATGGTTTTTTACTTAGCTTTTCCAACGCTTTGATTTCTTTTGCTATGTTTTTCTCTAAGTTCTTGAAGAAAGTGATTTCTTCCCGCTTGGTGGCCTGTTCACTGTGAACGAGCAACCAACGTTGATTGACCTTTCCGTAATCCGAGTCTATCCAACATCCTGAGTAGCCATGACCGATAGTGCTTAATTGCTCTGGCTCTAGCGCAAGTAGTGCTTGTTTTGCGAGCTTGATGGTCATGGGGACACGGGTAATGAATTTTTGATTTTGCTCATCTAGCGAGGAGATGCTTTCTTCGGTGTACAAAGCGGCATCAGCGATAAAGTAACGACTATTTTGCGCGGCTTTTAGGCAATGTATGTGTCTTTTAGTGACTTCAGCGAATGCCTTGGCATCATTGGTGTTACCACTCAGTGCTTGCATGTAAACAGGAATACCTGCTTGGTTTTCACAGATGAGTTCAAGCACGACTTGGTTAAGCTCTGGCCTATGATCCCGACTATAACCTCTTACAAGCTTAATCACGTTGGTGTTTTCATCTTGTGCATACTCACCATCAACGTGGAAGCTAGTGATATCAAGATGAACAGAATCGGTCGTCAAGCCCAGTTTATCAACAACACGCTCAGCAATAACCTGATAGAGCGCTGAGACATCGGCTTCGTATAGAGCATCTAATGTGCGGCCTAGTACATCATCAGTCAGGTGGTGTGCTTCAATGTCTTTGGCGAGTAGCTTAGATACAGGCTTGGTCTTAAAAAAGTCCGAGAACATGTGCAGTGTTCTGCTATGAAAGCCAAGTCCATTTAGGAGCATGGCCAATACCGCGTCACCATGAGAAACATTGTGGTCAGAATATTTTGGGATAACGGCATCTATCATCCGTGGCAGGCCAATTTCGTGACAAAAGGCGGCAATGAGACCAAGGTGATCTAAGCGTTTAATAACAGGATGGGTAGACATATTTTGAGACCGTCAAATAGCAGTAATAGATCAAAACTGTCGATCGCGGTCAAGATGGTGTCGTAGTTTTTATGAAAAGCTGATCGCCAGATCACACTATTTAAATTCTGGAATTAGCTGCGGAATGACGG	NA	NA	NA	NA
WP_000052512.1|66747_68223_-	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
64049:65809	attR	CCGACATTCCGCAGCTAATTTAGGAATAAACTACCTCATAGAATCTACCGAGTAATTTGAGTAGTTGTGTTTGGTGATCTTGAAGTCCAGTGATGAACCTTTGGCCGTTAATCTCTAGCGTATCTATGCCTTCGAATTGCAAGAAGACCCAACGTGCCGTCGGTCTGGAGGTCGTCTTGTTCTTTACCATACTTGGGAAGAACGCTTCGGTTTGTGCGAGTTGTTCTCTGATTTTGTGTTCTAAACTAGCGTAAACAAGCAAGCTCAACGTCATTATCATTAGCAACGCTTCAATGCGCTCAGGCTTTTTCAAGAAGATGGAAGAGGTTAAAAACTCAGGGCTTTTTAGAAAACGGAAGCCGCGCTCGACTTTTTGTTGCGATTTGTAATGTGCTAGAAGAGCCGCCATGGTGAGTGCTTCATTGTCGGTGTCATTCGTCGCGAGGATAAACATGCCTACTTTGAGCTTAGCCAGTTTTACTTTTTCTAGGTCGGTGAAGGGGGCGGCTTCGATAAAGTATTGGTATCCTGTCGGTGCTTCATCTGTCTTTGGGCGGCCCGAATGAGAGTAAGTCGGCTGTTTGATGAGAGTGCCTTGTTCAAACCCAAGTAAGTCACATTGTTTCTTGAAATCGTTAAACGCTAATTCTGCGTCAACTTCACAAGCGAATGGTTTTTTACTTAGCTTTTCCAACGCTTTGATTTCTTTTGCTATGTTTTTCTCTAAGTTCTTGAAGAAAGTGATTTCTTCCCGCTTGGTGGCCTGTTCACTGTGAACGAGCAACCAACGTTGATTGACCTTTCCGTAATCCGAGTCTATCCAACATCCTGAGTAGCCATGACCGATAGTGCTTAATTGCTCTGGCTCTAGCGCAAGTAGTGCTTGTTTTGCGAGCTTGATGGTCATGGGGACACGGGTAATGAATTTTTGATTTTGCTCATCTAGCGAGGAGATGCTTTCTTCGGTGTACAAAGCGGCATCAGCGATAAAGTAACGACTATTTTGCGCGGCTTTTAGGCAATGTATGTGTCTTTTAGTGACTTCAGCGAATGCCTTGGCATCATTGGTGTTACCACTCAGTGCTTGCATGTAAACAGGAATACCTGCTTGGTTTTCACAGATGAGTTCAAGCACGACTTGGTTAAGCTCTGGCCTATGATCCCGACTATAACCTCTTACAAGCTTAATCACGTTGGTGTTTTCATCTTGTGCATACTCACCATCAACGTGGAAGCTAGTGATATCAAGATGAACAGAATCGGTCGTCAAGCCCAGTTTATCAACAACACGCTCAGCAATAACCTGATAGAGCGCTGAGACATCGGCTTCGTATAGAGCATCTAATGTGCGGCCTAGTACATCATCAGTCAGGTGGTGTGCTTCAATGTCTTTGGCGAGTAGCTTAGATACAGGCTTGGTCTTAAAAAAGTCCGAGAACATGTGCAGTGTTCTGCTATGAAAGCCAAGTCCATTTAGGAGCATGGCCAATACCGCGTCACCATGAGAAACATTGTGGTCAGAATATTTTGGGATAACGGCATCTATCATCCGTGGCAGGCCAATTTCGTGACAAAAGGCGGCAATGAGACCAAGGTGATCTAAGCGTTTAATAACAGGATGGGTAGACATATTTTGAGACCGTCAAATAGCAGTAATAGATCAAAACTGTCGATCGCGGTCAAGATGGTGTCGTAGTTTTTATGAAAAGCTGATCGCCAGATCACACTATTTAAATTCTGGAATTAGCTGCGGAATGACGG	NA	NA	NA	NA
WP_001067855.1|68636_69341_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001389365.1|69517_70282_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000259032.1|70456_71296_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_012579084.1|71495_72152_-	quinolone resistance pentapeptide repeat protein QnrA1	NA	NA	NA	NA	NA
WP_000050481.1|72484_74026_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259032.1|74430_75270_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|75263_75611_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|75774_76566_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000845039.1|76711_77725_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001162012.1|78030_78588_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_001138073.1|78590_81563_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_000427623.1|81641_82646_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
85050:85063	attR	CAGGGTGATGTGAT	NA	NA	NA	NA
>prophage 2
NZ_CP026405	Escherichia coli strain ECONIH4 plasmid pECO-c85f, complete sequence	186884	156561	165297	186884	transposase	Acidithiobacillus_phage(33.33%)	12	NA	NA
WP_001207227.1|156561_157743_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
WP_001151304.1|157746_158532_-	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
WP_000338945.1|158705_159017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000058870.1|158998_159448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001050849.1|159461_160496_-	site-specific DNA-methyltransferase	NA	H8ZMF1	Synechococcus_phage	20.9	1.0e-05
WP_001274811.1|160740_162282_+|transposase	IS21-like element ISAs29 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.6	4.4e-130
WP_000194038.1|162296_163052_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.0	5.8e-59
WP_000098292.1|163111_163324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001258027.1|163316_163679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001096362.1|163681_163924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000532167.1|164161_164359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268395.1|164358_165297_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	50.2	1.5e-69
