The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027027	Shigella dysenteriae strain E670/74 chromosome, complete genome	5036586	4685	47785	5036586	tRNA,protease,transposase,integrase	Paenibacillus_phage(50.0%)	40	9907:9923	38459:38475
WP_171765174.1|4685_6032_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_001112301.1|6456_7851_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_000858396.1|7927_8425_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|8519_9227_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_004972872.1|9306_10038_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
9907:9923	attL	GCAGATGAAATTGCCAT	NA	NA	NA	NA
WP_000593273.1|10050_11001_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|11109_11673_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|11672_12089_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001055629.1|12264_13245_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|13262_13967_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|13984_14551_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|14547_14838_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174743.1|14845_15439_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239925.1|15431_16568_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000577039.1|17907_18411_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_105241767.1|18410_19703_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_001121440.1|19708_20740_-|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
WP_000745260.1|20910_21918_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_105241768.1|22034_23081_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|23256_23976_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|24159_24486_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|24485_25205_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_024258932.1|25365_26418_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|26445_26721_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|26785_27865_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001360964.1|28066_29323_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_005010928.1|29370_31506_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234512.1|31903_32611_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218864.1|32989_34252_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	3.5e-77
WP_005001163.1|35269_36769_-	amino acid permease	NA	NA	NA	NA	NA
WP_000671171.1|36843_39213_-	arginine decarboxylase	NA	NA	NA	NA	NA
38459:38475	attR	ATGGCAATTTCATCTGC	NA	NA	NA	NA
WP_005010922.1|39317_40787_-	amino acid permease	NA	NA	NA	NA	NA
WP_094110432.1|41791_42635_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	49.1	3.7e-22
WP_000477077.1|43268_43616_+	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_000747051.1|43685_44036_+|transposase	transposase	transposase	Q716C1	Shigella_phage	98.9	1.8e-39
WP_005010759.1|44076_45108_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_052991763.1|45204_46161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165850882.1|46162_46534_-	molecular chaperone	NA	NA	NA	NA	NA
WP_001344973.1|46533_46911_-	molecular chaperone	NA	NA	NA	NA	NA
WP_086021050.1|46940_47785_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	4.4e-23
>prophage 2
NZ_CP027027	Shigella dysenteriae strain E670/74 chromosome, complete genome	5036586	108266	156629	5036586	tRNA,transposase,head,integrase,capsid	Moraxella_phage(25.0%)	43	118188:118204	168304:168320
WP_001121440.1|108266_109298_-|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
WP_001077147.1|109381_110284_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_005001201.1|112372_113515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005036606.1|113639_114419_-	transcriptional regulator GlcC	NA	NA	NA	NA	NA
WP_000853256.1|116695_117100_+	protein GlcG	NA	NA	NA	NA	NA
118188:118204	attL	GAAATCCCGGAAGGCAT	NA	NA	NA	NA
WP_005010759.1|119526_120558_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_000350095.1|120735_120936_-	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
WP_001047862.1|121204_121834_+	DUF1449 family protein	NA	NA	NA	NA	NA
WP_000341055.1|121860_123522_+	flotillin family protein	NA	NA	NA	NA	NA
WP_001387081.1|123760_123820_+	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_001387082.1|124136_124196_+	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_000869197.1|124315_125749_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.3	1.4e-40
WP_005010914.1|125796_128637_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_000046257.1|128659_129961_-	inorganic triphosphatase	NA	NA	NA	NA	NA
WP_001125337.1|130202_130823_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_000708515.1|130886_132125_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.3	5.0e-92
WP_001305111.1|132287_133109_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_001295541.1|133199_133568_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_001272796.1|133672_134290_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_000935226.1|134302_135235_-	DNA-binding transcriptional activator TtdR	NA	NA	NA	NA	NA
WP_000986806.1|135441_136353_+	L(+)-tartrate dehydratase subunit alpha	NA	NA	NA	NA	NA
WP_000722957.1|136349_136955_+	L(+)-tartrate dehydratase subunit beta	NA	NA	NA	NA	NA
WP_039071980.1|137003_138467_+	L-tartrate/succinate antiporter	NA	NA	NA	NA	NA
WP_001264365.1|138509_139523_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
WP_001144069.1|139760_139976_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918808.1|140086_141832_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	6.4e-77
WP_000437371.1|142026_143868_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_171765175.1|144005_145352_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000228937.1|145385_145892_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_089636741.1|146413_146698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089565840.1|146980_147421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097727718.1|147631_148057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105241774.1|148071_148401_-|head	head decoration protein	head	NA	NA	NA	NA
WP_105241775.1|148411_149467_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	45.4	2.6e-73
WP_089565838.1|149466_149673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105241776.1|149930_150353_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_105241777.1|150349_150601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105241779.1|150802_152218_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	57.9	1.5e-113
WP_105241780.1|152214_152514_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_165487781.1|152519_152729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077630326.1|154241_154415_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_105241781.1|154587_155208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105241782.1|155204_156629_-|integrase	integrase family protein	integrase	A0A0R6PGY7	Moraxella_phage	30.5	6.4e-43
168304:168320	attR	GAAATCCCGGAAGGCAT	NA	NA	NA	NA
>prophage 3
NZ_CP027027	Shigella dysenteriae strain E670/74 chromosome, complete genome	5036586	187728	232790	5036586	transposase,holin	Paenibacillus_phage(60.0%)	44	NA	NA
WP_171765176.1|187728_188957_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	3.2e-176
WP_105241784.1|189032_190127_-	pilus assembly protein CblD	NA	NA	NA	NA	NA
WP_094110432.1|192015_192860_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	49.1	3.7e-22
WP_000755097.1|193817_194318_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000225868.1|194347_195064_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000406488.1|195359_196136_+	transcriptional regulator ExuR	NA	NA	NA	NA	NA
WP_000422149.1|196480_197143_+	DedA family protein	NA	NA	NA	NA	NA
WP_001297156.1|197675_198044_+	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_000031415.1|198081_198387_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000785722.1|198389_198794_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_000096086.1|198783_199083_+	YqjK-like family protein	NA	NA	NA	NA	NA
WP_000603618.1|199178_199661_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000531219.1|199730_200717_+	glutathionyl-hydroquinone reductase YqjG	NA	NA	NA	NA	NA
WP_001314179.1|201009_201378_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000633568.1|202585_203287_+	pirin family protein	NA	NA	NA	NA	NA
WP_001345966.1|203309_203474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460502.1|203607_204918_-	serine dehydratase subunit alpha family protein	NA	NA	NA	NA	NA
WP_094110432.1|204982_205826_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	49.1	3.7e-22
WP_000107723.1|206673_208005_-	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_000548347.1|208026_209016_-	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_000104191.1|209114_210053_-	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_000145832.1|210241_210586_+	DNA-binding transcriptional activator TdcR	NA	NA	NA	NA	NA
WP_000675746.1|210841_211381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012792.1|211527_212559_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_004971349.1|213739_214885_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	3.7e-49
WP_005089576.1|214981_215872_-	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_105241785.1|215901_216672_-	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_000599636.1|216687_218022_-	galactarate/glucarate/glycerate transporter GarP	NA	NA	NA	NA	NA
WP_105241786.1|218396_219968_+	galactarate dehydratase	NA	NA	NA	NA	NA
WP_001307405.1|220116_220452_+	type II toxin-antitoxin system antitoxin PrlF	NA	NA	NA	NA	NA
WP_000347255.1|220451_220916_+	type II toxin-antitoxin system ribonuclease toxin YhaV	NA	NA	NA	NA	NA
WP_000072187.1|220970_221780_-	aga operon transcriptional regulator AgaR	NA	NA	NA	NA	NA
WP_000681932.1|222028_223309_+	tagatose-bisphosphate aldolase subunit KbaZ	NA	NA	NA	NA	NA
WP_001295547.1|223331_223805_+	PTS N-acetylgalactosamine transporter subunit IIB	NA	NA	NA	NA	NA
WP_000406227.1|223815_224595_+	PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC	NA	NA	NA	NA	NA
WP_001295548.1|224584_225463_+	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_000948814.1|225480_225915_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_001114849.1|227395_228550_+	AgaS family sugar isomerase	NA	NA	NA	NA	NA
WP_000022766.1|228562_229423_+	tagatose-bisphosphate aldolase subunit KbaY	NA	NA	NA	NA	NA
WP_000098008.1|229588_230065_+	PTS N-acetylgalactosamine transporter subunit IIB	NA	NA	NA	NA	NA
WP_000544484.1|230103_230907_+	PTS N-acetylgalactosamine transporter subunit IIC	NA	NA	NA	NA	NA
WP_000534351.1|230896_231688_+	PTS N-acetylgalactosamine transporter subunit IID	NA	NA	NA	NA	NA
WP_000439448.1|231688_231901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094110432.1|231946_232790_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	49.1	3.7e-22
>prophage 4
NZ_CP027027	Shigella dysenteriae strain E670/74 chromosome, complete genome	5036586	565465	621898	5036586	tRNA,transposase	uncultured_Caudovirales_phage(27.27%)	49	NA	NA
WP_004998488.1|565465_566497_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_000384048.1|566477_566774_+	membrane protein	NA	NA	NA	NA	NA
WP_001168544.1|566868_567780_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_001291766.1|567789_569859_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_094192380.1|570158_571527_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	6.3e-112
WP_001135738.1|571629_571782_+	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_000014594.1|571969_572182_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
WP_000455798.1|572462_572753_-	HTH-type transcriptional regulator	NA	NA	NA	NA	NA
WP_000190518.1|573186_573897_+	DUF3053 domain-containing protein	NA	NA	NA	NA	NA
WP_000805019.1|573946_574921_-	glyoxylate/hydroxypyruvate reductase GhrB	NA	NA	NA	NA	NA
WP_000747641.1|575024_575684_-	OmpA family lipoprotein	NA	NA	NA	NA	NA
WP_000959820.1|577199_579479_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.6	3.6e-72
WP_000617472.1|579447_579888_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000438967.1|579884_580448_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_000584472.1|580605_581304_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000189037.1|581532_582741_+	MFS transporter	NA	NA	NA	NA	NA
WP_001269234.1|583064_584756_+	kdo(2)-lipid A phosphoethanolamine 7''-transferase	NA	NA	NA	NA	NA
WP_000938855.1|587615_588635_+	dipeptide ABC transporter permease DppB	NA	NA	NA	NA	NA
WP_000084677.1|588644_589547_+	dipeptide ABC transporter permease DppC	NA	NA	NA	NA	NA
WP_001196482.1|589557_590541_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.4	3.3e-14
WP_000107031.1|590537_591542_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G9BWD6	Planktothrix_phage	33.7	1.1e-20
WP_001295225.1|591571_592843_-	transporter	NA	NA	NA	NA	NA
WP_001295224.1|593318_593426_+	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_001295224.1|593801_593909_+	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_001295224.1|594284_594392_+	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_001295224.1|594767_594875_+	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_005010277.1|596306_597653_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_005010191.1|597851_598883_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_086021050.1|599006_599850_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	4.4e-23
WP_000439190.1|600653_601856_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000902786.1|602087_603587_+	inorganic phosphate transporter PitA	NA	NA	NA	NA	NA
WP_000626187.1|603657_603993_-	universal stress protein UspB	NA	NA	NA	NA	NA
WP_000323571.1|604383_604818_+	universal stress protein UspA	NA	NA	NA	NA	NA
WP_001098647.1|605134_606604_+	dipeptide/tripeptide permease DtpB	NA	NA	NA	NA	NA
WP_000686620.1|606652_607405_-	16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ	NA	NA	NA	NA	NA
WP_024261626.1|607412_609455_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	1.7e-44
WP_000954225.1|609657_610500_+	23S rRNA (adenine(2030)-N(6))-methyltransferase	NA	NA	NA	NA	NA
WP_000160824.1|610574_611927_+	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_001295215.1|611980_612064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000008955.1|612806_613160_+	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	5.7e-25
WP_005010403.1|613214_614504_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.3	1.0e-172
WP_000065764.1|614516_614942_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	1.6e-50
WP_001057453.1|617039_617606_+	outer membrane lipoprotein Slp	NA	NA	NA	NA	NA
WP_000478623.1|617761_618292_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001296814.1|618333_618981_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
WP_001298717.1|619044_619371_-	acid-activated periplasmic chaperone HdeB	NA	NA	NA	NA	NA
WP_000756550.1|619486_619819_-	acid-activated periplasmic chaperone HdeA	NA	NA	NA	NA	NA
WP_000965672.1|620073_620646_+	acid-resistance protein HdeD	NA	NA	NA	NA	NA
WP_004998488.1|620866_621898_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP027027	Shigella dysenteriae strain E670/74 chromosome, complete genome	5036586	635549	724135	5036586	protease,transposase	Stx2-converting_phage(27.78%)	48	NA	NA
WP_005010290.1|635549_636896_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_001167676.1|636964_637567_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_171765177.1|638014_638986_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000191266.1|639034_640048_+	inner membrane protein YhjD	NA	NA	NA	NA	NA
WP_001149009.1|640458_641781_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_024258924.1|644143_644911_-	cyclic-guanylate-specific phosphodiesterase	NA	NA	NA	NA	NA
WP_000476973.1|644923_646072_+	2-dehydro-3-deoxygluconokinase	NA	NA	NA	NA	NA
WP_001163137.1|646167_647664_-	insulinase family protein	NA	NA	NA	NA	NA
WP_000858214.1|647884_649171_-	C4-dicarboxylate transporter DctC	NA	NA	NA	NA	NA
WP_001266306.1|649353_651342_-	biofilm formation regulator HmsP	NA	NA	NA	NA	NA
WP_004967149.1|653524_655126_-|transposase	IS66-like element ISSfl3 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.5	4.9e-148
WP_000631725.1|655145_655493_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_004998909.1|655489_656164_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	30.8	1.5e-10
WP_000923158.1|659251_659590_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	56.1	2.1e-29
WP_000187617.1|659656_660025_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	98.4	4.2e-63
WP_000612593.1|660021_660369_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	8.2e-61
WP_001254932.1|661049_662201_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001254932.1|666622_667774_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_088895429.1|669474_670257_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.7e-138
WP_001254932.1|674450_675602_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_088895413.1|677567_678795_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	8.5e-177
WP_072038484.1|679033_679243_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_086021050.1|679587_680431_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	4.4e-23
WP_004971737.1|682142_682262_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000555342.1|682788_683046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000991372.1|684877_685492_+	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_001254932.1|688411_689563_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001034079.1|690561_694449_-|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	38.9	2.2e-226
WP_005038950.1|694699_694843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105241806.1|696072_697300_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001254932.1|698386_699538_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001387241.1|700156_702352_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000750132.1|702357_703695_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001015713.1|703691_705434_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_001287501.1|705433_706381_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_005011344.1|706381_708106_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000074473.1|708241_709435_+	MFS transporter	NA	NA	NA	NA	NA
WP_158250164.1|710514_711033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088895413.1|711822_713051_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	8.5e-177
WP_001173343.1|713902_714076_-	type V toxin-antitoxin system toxin GhoT	NA	NA	NA	NA	NA
WP_000398619.1|714102_714399_-	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_000371704.1|714909_715140_-	(4Fe-4S)-binding protein	NA	NA	NA	NA	NA
WP_001216476.1|715320_716952_+	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_000611297.1|716948_717668_+	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_000899522.1|718238_719579_+	anaerobic C4-dicarboxylate transporter DcuB	NA	NA	NA	NA	NA
WP_000066686.1|719656_721303_+	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_000198748.1|721425_722055_+	DUF2238 domain-containing protein	NA	NA	NA	NA	NA
WP_105242100.1|722906_724135_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
>prophage 6
NZ_CP027027	Shigella dysenteriae strain E670/74 chromosome, complete genome	5036586	952828	1019368	5036586	tRNA,protease,transposase	Paenibacillus_phage(20.0%)	60	NA	NA
WP_000420783.1|952828_953965_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000644419.1|954688_954925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001143967.1|955558_956752_+|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	62.0	5.8e-138
WP_105241820.1|956773_960421_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	28.6	1.8e-12
WP_000710769.1|960580_960793_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_005002270.1|960995_963194_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_000644892.1|963349_964375_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_000068834.1|964466_965426_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000208242.1|965518_966049_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293341.1|966058_967390_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|967456_968383_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|968475_968961_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|969045_969291_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084278.1|969716_970562_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	3.4e-15
WP_105241821.1|970584_972093_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250613.1|972227_973238_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796337.1|973334_974081_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323555.1|974085_974514_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655986.1|974540_974840_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155257.1|975050_975491_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802226.1|975591_976191_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216325.1|976298_977066_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000708998.1|977120_977876_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045689.1|977982_978972_-	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_000591795.1|979290_980253_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076737.1|980433_981336_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_005002255.1|981483_981984_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_001033722.1|982133_982832_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580413.1|982828_984202_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270260.1|984307_984982_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001297064.1|986372_986993_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_000063486.1|987277_988312_+	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001297062.1|988308_989247_-	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000217155.1|989230_990067_-	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000144083.1|990354_991824_+	rhamnulokinase	NA	NA	NA	NA	NA
WP_000211492.1|991820_993080_+	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_001179780.1|993321_994146_+	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000619515.1|994155_994470_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_000729598.1|994770_995217_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000446001.1|995227_996679_+	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001019509.1|996668_997577_+	peptidase	NA	NA	NA	NA	NA
WP_000931321.1|997576_999319_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_001121440.1|999613_1000645_-|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
WP_005002230.1|1000728_1001637_-	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_000753580.1|1001789_1002623_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_094192385.1|1002816_1005867_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.6	7.2e-07
WP_000331371.1|1005879_1006782_+	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_000829013.1|1006778_1007414_+	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000027708.1|1007410_1008340_+	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_001086388.1|1008669_1008912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295676.1|1009130_1009349_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_000226342.1|1010024_1011839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086021050.1|1012213_1013058_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	4.4e-23
WP_005012255.1|1013167_1014106_-	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_000560983.1|1014150_1014588_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_000920762.1|1014584_1015457_-	virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_004968947.1|1015450_1016050_-	glucose-1-phosphatase	NA	NA	NA	NA	NA
WP_001127584.1|1016190_1016694_-	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_105241823.1|1016733_1018416_-	MFS transporter	NA	NA	NA	NA	NA
WP_094110432.1|1018523_1019368_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	49.1	3.7e-22
>prophage 7
NZ_CP027027	Shigella dysenteriae strain E670/74 chromosome, complete genome	5036586	1040765	1046979	5036586	tail,plate	Shigella_phage(42.86%)	7	NA	NA
WP_000514034.1|1040765_1041461_-	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	95.2	2.4e-128
WP_032157564.1|1041411_1041597_-	Com family DNA-binding transcriptional regulator	NA	A0A0C4UQS3	Shigella_phage	71.0	1.1e-19
WP_024259023.1|1041721_1042348_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	72.3	2.2e-72
WP_077901256.1|1043687_1044218_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	67.6	6.9e-67
WP_000500228.1|1044232_1045330_-	hypothetical protein	NA	A0A0C4UQS2	Shigella_phage	42.7	2.1e-62
WP_000951401.1|1045333_1045918_-	DUF2313 domain-containing protein	NA	M4M9M8	Vibrio_phage	45.1	2.8e-45
WP_001146187.1|1045902_1046979_-|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	49.9	6.9e-90
>prophage 8
NZ_CP027027	Shigella dysenteriae strain E670/74 chromosome, complete genome	5036586	1152379	1196269	5036586	tRNA,transposase	Paramecium_bursaria_Chlorella_virus(25.0%)	36	NA	NA
WP_000140459.1|1152379_1153576_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001131164.1|1153708_1154401_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001280869.1|1154423_1155689_+	MFS transporter	NA	NA	NA	NA	NA
WP_000224470.1|1155654_1156647_-	ribose operon transcriptional repressor RbsR	NA	NA	NA	NA	NA
WP_005010171.1|1156650_1157580_-	ribokinase	NA	NA	NA	NA	NA
WP_000957853.1|1159409_1159598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000947186.1|1159607_1160807_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_005010277.1|1161354_1162701_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_105241826.1|1162803_1164633_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	4.3e-132
WP_000933736.1|1164794_1166165_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
WP_000957853.1|1166555_1166744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000947186.1|1166753_1167953_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001251965.1|1168204_1168624_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_000190506.1|1168644_1170027_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_000896498.1|1170053_1170917_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_001176745.1|1170967_1172509_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_001288587.1|1172521_1173055_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_001052219.1|1173069_1173540_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_000429386.1|1173601_1173841_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_000135625.1|1173887_1174703_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_000116695.1|1174711_1175092_-	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_000932844.1|1175708_1176332_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_000499759.1|1176395_1178285_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_000763742.1|1178663_1179107_-	FMN-binding protein MioC	NA	NA	NA	NA	NA
WP_000432970.1|1179196_1179655_-	transcriptional regulator AsnC	NA	NA	NA	NA	NA
WP_105241827.1|1179806_1180799_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.9e-50
WP_000947186.1|1181289_1182489_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000957853.1|1182498_1182687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001225165.1|1183138_1183285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295222.1|1183266_1184373_-	cellulase	NA	NA	NA	NA	NA
WP_024259202.1|1184379_1186719_-	cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB	NA	NA	NA	NA	NA
WP_000025902.1|1186729_1189348_-	UDP-forming cellulose synthase catalytic subunit	NA	NA	NA	NA	NA
WP_024258914.1|1189344_1190094_-	cellulose biosynthesis protein BcsQ	NA	NA	NA	NA	NA
WP_001149588.1|1192287_1193610_-	xylose isomerase	NA	NA	NA	NA	NA
WP_001300957.1|1193975_1194968_+	D-xylose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001143981.1|1195075_1196269_+|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	62.2	9.9e-138
>prophage 9
NZ_CP027027	Shigella dysenteriae strain E670/74 chromosome, complete genome	5036586	1408159	1468810	5036586	tRNA,transposase,protease	Vibrio_phage(12.5%)	58	NA	NA
WP_001294218.1|1408159_1409299_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_005002499.1|1409297_1410845_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|1410816_1411278_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_000990264.1|1411296_1412631_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.9	6.7e-18
WP_001122456.1|1412640_1414488_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_001280345.1|1414480_1415431_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|1415516_1415825_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_044067435.1|1415901_1417182_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|1417267_1418527_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|1418529_1419534_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|1419615_1419813_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|1419916_1421215_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|1421419_1421845_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076316.1|1421883_1424325_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001293282.1|1424504_1425236_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220139.1|1425362_1425764_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511952.1|1425782_1426442_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_001254932.1|1427254_1428406_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000547748.1|1429684_1430083_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101686.1|1430092_1430731_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943983.1|1430733_1431897_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	8.3e-81
WP_005002546.1|1431980_1433606_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|1433722_1433998_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|1434146_1434476_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569701.1|1434657_1435407_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|1435403_1436159_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|1436266_1437331_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_005013554.1|1437685_1439083_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218362.1|1439098_1439404_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776523.1|1439413_1439878_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|1439891_1440542_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949539.1|1440551_1441406_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170803.1|1441405_1442092_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000492921.1|1442812_1443088_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|1443414_1443810_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_024258241.1|1443816_1444131_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|1444135_1444363_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|1444404_1444854_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005002567.1|1444924_1445719_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_005002568.1|1446376_1447015_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211237.1|1447233_1447854_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|1448161_1449574_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331445.1|1449618_1450281_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_105241839.1|1450388_1451354_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560550.1|1451462_1452323_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005002580.1|1452411_1452792_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589464.1|1452909_1454853_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886892.1|1455042_1455783_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_086021050.1|1455842_1456686_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	4.4e-23
WP_000937640.1|1456912_1457824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175287.1|1457913_1458468_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_005002644.1|1458792_1458999_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935042.1|1459060_1460404_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001295196.1|1460726_1461365_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269339.1|1461570_1463304_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060954.1|1463300_1467080_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|1467082_1467424_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_004994989.1|1467463_1468810_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP027027	Shigella dysenteriae strain E670/74 chromosome, complete genome	5036586	1677794	1754385	5036586	transposase	Paenibacillus_phage(36.36%)	60	NA	NA
WP_001121440.1|1677794_1678826_-|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
WP_000425668.1|1679892_1681617_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.9e-36
WP_001252744.1|1681619_1682111_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_032333899.1|1682122_1682209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000762401.1|1682290_1683295_+	catabolite repressor/activator	NA	NA	NA	NA	NA
WP_001295770.1|1683896_1684355_+	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_000970485.1|1684356_1685298_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_000625658.1|1685294_1685660_+	cell division protein FtsL	NA	NA	NA	NA	NA
WP_000642196.1|1685675_1687442_+	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_000775106.1|1687428_1688916_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000626687.1|1688912_1690271_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_000964124.1|1690264_1691347_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_000796466.1|1691349_1692666_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_005013454.1|1692665_1693910_+	cell division protein FtsW	NA	NA	NA	NA	NA
WP_000016548.1|1693906_1694974_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_001096048.1|1695027_1696503_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_000130073.1|1696495_1697416_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_000075744.1|1697417_1698248_+	cell division protein FtsQ	NA	NA	NA	NA	NA
WP_000588471.1|1698244_1699507_+	cell division protein FtsA	NA	NA	NA	NA	NA
WP_000462776.1|1699567_1700719_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_000595482.1|1700819_1701737_+	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_000014320.1|1701966_1702479_+	secA regulator SecM	NA	NA	NA	NA	NA
WP_000905809.1|1702540_1705246_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_000736004.1|1705305_1705695_+	8-oxo-dGTP diphosphatase MutT	NA	NA	NA	NA	NA
WP_000005036.1|1705793_1705991_-	DNA gyrase inhibitor YacG	NA	NA	NA	NA	NA
WP_001194721.1|1706000_1706744_-	cell division protein ZapD	NA	NA	NA	NA	NA
WP_001269528.1|1706743_1707364_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_001217337.1|1707588_1708632_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
WP_086021050.1|1708892_1709737_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	4.4e-23
WP_105241849.1|1710776_1712162_-	type II secretion system protein GspE	NA	NA	NA	NA	NA
WP_000360900.1|1712171_1712612_-	prepilin peptidase-dependent pilin	NA	NA	NA	NA	NA
WP_001135185.1|1712814_1713708_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_000923721.1|1713795_1714347_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
WP_000172022.1|1714343_1715213_+	beta-lactamase regulator AmpE	NA	NA	NA	NA	NA
WP_000969916.1|1715255_1716629_-	aromatic amino acid transporter AroP	NA	NA	NA	NA	NA
WP_000331776.1|1717169_1717934_+	pyruvate dehydrogenase complex transcriptional repressor PdhR	NA	NA	NA	NA	NA
WP_000003820.1|1718094_1720758_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_000963529.1|1720772_1722665_+	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_000102485.1|1722989_1724414_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
WP_086021050.1|1724849_1725693_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	4.4e-23
WP_032335988.1|1727607_1730205_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_000384306.1|1730379_1730742_+	YacL family protein	NA	NA	NA	NA	NA
WP_000734287.1|1730779_1731574_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_000818429.1|1731589_1732456_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_001295568.1|1732561_1732909_-	YacC family pilotin-like protein	NA	NA	NA	NA	NA
WP_001189617.1|1733074_1734625_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
WP_004989580.1|1734826_1737217_-	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|1737422_1737959_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651593.1|1737999_1738662_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|1738770_1739697_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000972197.1|1739693_1740464_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000901989.1|1740568_1741009_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000277902.1|1741072_1742302_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000621515.1|1742305_1742686_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_000905383.1|1745372_1746224_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_000805451.1|1746235_1747030_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_000713138.1|1747142_1748417_-	fimbrial-like adhesin	NA	NA	NA	NA	NA
WP_105241851.1|1749611_1750455_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	49.1	2.8e-22
WP_004996846.1|1750970_1752002_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_086021050.1|1753540_1754385_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	4.4e-23
>prophage 11
NZ_CP027027	Shigella dysenteriae strain E670/74 chromosome, complete genome	5036586	1759654	1900016	5036586	tRNA,transposase,protease	Stx2-converting_phage(20.69%)	115	NA	NA
WP_000937420.1|1759654_1760581_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|1760617_1761073_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396056.1|1761250_1761955_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294700.1|1761969_1762500_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_024259111.1|1762573_1765003_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	29.3	2.7e-41
WP_000918137.1|1765135_1767670_+	bifunctional glycosyl transferase/transpeptidase	NA	NA	NA	NA	NA
WP_005033089.1|1770128_1770926_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	6.0e-14
WP_004975547.1|1770925_1771816_+	Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD	NA	NA	NA	NA	NA
WP_000044045.1|1771812_1773795_+	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
WP_000045299.1|1773829_1775110_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_000845403.1|1775334_1776756_+	H(+)/Cl(-) exchange transporter ClcA	NA	NA	NA	NA	NA
WP_120795373.1|1776779_1776845_+	protein YadW	NA	NA	NA	NA	NA
WP_001295564.1|1776837_1777182_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
WP_000964221.1|1777228_1777852_-	TRIC cation channel family protein	NA	NA	NA	NA	NA
WP_005012419.1|1777889_1778690_-	vitamin B12 ABC transporter substrate-binding protein BtuF	NA	NA	NA	NA	NA
WP_000689844.1|1778682_1779381_-	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_000057094.1|1779464_1780982_+	dGTPase	NA	NA	NA	NA	NA
WP_000753946.1|1781111_1782536_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
WP_001254932.1|1783623_1784775_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000046052.1|1785203_1786334_+	DNA-binding transcriptional regulator CdaR	NA	NA	NA	NA	NA
WP_000272188.1|1786422_1786809_-	DUF3461 family protein	NA	NA	NA	NA	NA
WP_105241854.1|1786970_1787783_-	phosphodiesterase YaeI	NA	NA	NA	NA	NA
WP_001186650.1|1787837_1788662_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_001094579.1|1788692_1791365_-	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_001018194.1|1791426_1792221_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_000246882.1|1792588_1793314_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_000818114.1|1793571_1794423_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_000224573.1|1794569_1795295_+	UMP kinase	NA	NA	NA	NA	NA
WP_000622418.1|1795586_1796144_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_000811936.1|1796235_1797432_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_001088287.1|1799019_1799694_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.1	5.8e-10
WP_000631709.1|1799690_1800038_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	73.8	4.1e-44
WP_105241855.1|1801657_1801858_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_105241856.1|1801861_1803394_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.7	3.7e-44
WP_000775238.1|1803846_1804008_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000622995.1|1805488_1805836_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	3.4e-46
WP_171765179.1|1806279_1807290_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_004996908.1|1807480_1808239_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
WP_000922455.1|1808251_1809109_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_004973152.1|1809120_1810473_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240881.1|1810502_1812935_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|1813056_1813542_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139296.1|1813545_1814571_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|1814675_1815131_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565968.1|1815134_1815923_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139679.1|1815922_1817071_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569419.1|1817067_1817664_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	3.9e-26
WP_001294806.1|1817700_1821183_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	1.1e-208
WP_000055741.1|1821195_1822155_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020968.1|1822253_1824395_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|1824451_1824841_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176558.1|1824905_1826204_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062307.1|1826252_1826513_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|1826499_1826700_-	YaeP family protein	NA	NA	NA	NA	NA
WP_000635545.1|1827406_1827829_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239197.1|1827842_1828553_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_105241859.1|1828707_1829532_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260708.1|1829585_1831304_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|1831414_1832122_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|1832118_1832523_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874226.1|1832640_1833456_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294597.1|1833495_1834149_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|1834141_1835173_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140181.1|1835360_1835921_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997036.1|1841693_1842497_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	7.1e-39
WP_000648555.1|1842493_1843408_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230981.1|1843648_1844449_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211706.1|1844526_1845297_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|1845344_1846703_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052720.1|1846774_1847530_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001307587.1|1847563_1848286_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|1848282_1848750_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|1848814_1849546_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001053629.1|1850084_1850870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236634.1|1851006_1851486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072038402.1|1851495_1852332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001121440.1|1852417_1853449_+|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
WP_001059850.1|1853501_1853951_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_171765180.1|1853947_1855000_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_105241860.1|1855061_1855919_+	recombinase family protein	NA	NA	NA	NA	NA
WP_001088287.1|1855972_1856647_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.1	5.8e-10
WP_000631709.1|1856643_1856991_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	73.8	4.1e-44
WP_105241861.1|1857010_1858612_+|transposase	IS66-like element ISSfl3 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	52.9	2.2e-148
WP_075330163.1|1859380_1859938_-	recombinase family protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	35.5	4.6e-13
WP_088895413.1|1861124_1862353_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	8.5e-177
WP_001121440.1|1862390_1863422_-|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
WP_001118004.1|1864498_1865269_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532694.1|1865422_1865896_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973104.1|1865938_1868383_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|1868622_1869201_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_001225684.1|1870143_1870884_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000615975.1|1871039_1871318_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729704.1|1871320_1871581_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000543886.1|1871766_1872540_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000207556.1|1874277_1875063_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_000640586.1|1875214_1875985_-	hypothetical protein	NA	A0A0F6TIY9	Escherichia_coli_O157_typing_phage	74.0	1.3e-85
WP_000881576.1|1876142_1876805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086021050.1|1876878_1877723_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	4.4e-23
WP_004996944.1|1877768_1877963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005011356.1|1877943_1878975_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_004975014.1|1879254_1879464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001344294.1|1879578_1879890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105241862.1|1879993_1881130_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_105241864.1|1883624_1886597_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224611.1|1886597_1887488_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177464.1|1887670_1888432_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
WP_000805428.1|1888796_1889429_+	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_167551154.1|1889798_1891026_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.6	1.5e-173
WP_000691066.1|1891291_1892299_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_105241865.1|1892311_1894921_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000988388.1|1894951_1895644_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000729161.1|1896885_1897752_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|1897753_1897966_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143536.1|1898073_1898595_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|1898630_1900016_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 13
NZ_CP027027	Shigella dysenteriae strain E670/74 chromosome, complete genome	5036586	2038228	2157592	5036586	tRNA,transposase,integrase	Bacillus_phage(13.51%)	104	2091860:2091919	2155563:2156721
WP_000667319.1|2038228_2039356_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_001266491.1|2039410_2040481_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_001009879.1|2040573_2041155_+	ACP phosphodiesterase	NA	NA	NA	NA	NA
WP_005011693.1|2041159_2042977_-	maltodextrin glucosidase	NA	NA	NA	NA	NA
WP_001295329.1|2043132_2044506_-	proline-specific permease ProY	NA	NA	NA	NA	NA
WP_000149643.1|2044581_2045901_-	branched-chain amino acid transporter carrier protein BrnQ	NA	NA	NA	NA	NA
WP_000893603.1|2046306_2047602_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
WP_000113933.1|2047659_2048349_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_001221343.1|2048538_2049741_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000698845.1|2049737_2052881_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001306939.1|2053006_2054191_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001219296.1|2054338_2055241_-	fructokinase	NA	NA	NA	NA	NA
WP_001298537.1|2055365_2056277_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_000194199.1|2056354_2056810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000941942.1|2057295_2057580_-	pyrimidine/purine nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_001276420.1|2057651_2058329_-	AroM family protein	NA	NA	NA	NA	NA
WP_001142439.1|2058586_2058778_-	protein YaiA	NA	NA	NA	NA	NA
WP_000193393.1|2058827_2059352_-	shikimate kinase AroL	NA	NA	NA	NA	NA
WP_000158111.1|2059534_2059993_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_005011778.1|2060112_2060922_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_000484048.1|2060938_2062054_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
WP_005011795.1|2062594_2064010_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_000792970.1|2064110_2064371_-	anti-adapter protein IraP	NA	NA	NA	NA	NA
WP_039072083.1|2064832_2065927_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_001295334.1|2065950_2066163_-	DUF2754 domain-containing protein	NA	NA	NA	NA	NA
WP_000763148.1|2066422_2066731_+	DUF2755 family protein	NA	NA	NA	NA	NA
WP_000092043.1|2066789_2067884_-	surface-exposed outer membrane lipoprotein YaiW	NA	NA	NA	NA	NA
WP_001297134.1|2067896_2069117_-	peptide antibiotic transporter SbmA	NA	NA	NA	NA	NA
WP_000830756.1|2069468_2070626_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.5	1.0e-06
WP_088895425.1|2072616_2073844_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_086021050.1|2074525_2075369_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	4.4e-23
WP_005011749.1|2075358_2076102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295337.1|2076624_2077599_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_004997068.1|2077655_2078549_-	taurine dioxygenase	NA	NA	NA	NA	NA
WP_000114617.1|2078545_2079373_-	taurine ABC transporter permease TauC	NA	NA	NA	NA	NA
WP_000939361.1|2079369_2080137_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	5.0e-26
WP_001317652.1|2080149_2081112_-	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000362029.1|2081727_2082399_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_005011738.1|2082408_2083605_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_024183734.1|2083582_2084164_+	acetyltransferase	NA	NA	NA	NA	NA
WP_000596097.1|2084165_2084306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086021050.1|2084302_2085147_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	4.4e-23
WP_005038971.1|2086134_2087331_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001141271.1|2087492_2087768_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_000842090.1|2087802_2088912_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	5.2e-32
WP_105241875.1|2089003_2089837_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_072971588.1|2089962_2090502_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_086021023.1|2090955_2091800_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	4.4e-23
2091860:2091919	attL	CTAAATAGCTGCGCGGAATAGTAGATCACTTTGAGGGAACTTAGCCCGGATTGTGCGATC	NA	NA	NA	NA
WP_001121440.1|2091963_2092995_+|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
WP_158250166.1|2092975_2093116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001254932.1|2094918_2096070_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000747051.1|2095989_2096340_-|transposase	transposase	transposase	Q716C1	Shigella_phage	98.9	1.8e-39
WP_000662258.1|2097439_2097541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001254932.1|2098383_2099535_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001350215.1|2101357_2101717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000284450.1|2101709_2102252_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_000617443.1|2102855_2103137_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000378127.1|2103558_2103885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236873.1|2103811_2103997_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000560496.1|2104991_2105381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105241876.1|2105399_2107481_-	injection protein	NA	A0A2I7QQN9	Vibrio_phage	37.0	2.1e-90
WP_086021023.1|2107560_2108404_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	4.4e-23
WP_001121440.1|2109526_2110558_-|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
WP_000909175.1|2110998_2111676_-	hypothetical protein	NA	Q2A0B2	Sodalis_phage	71.6	9.2e-56
WP_000420674.1|2111669_2112131_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	72.2	2.9e-61
WP_001018524.1|2112147_2112309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001585368.1|2112893_2115650_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.3	1.8e-299
WP_001208878.1|2115636_2116008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000628967.1|2116000_2116342_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	61.5	2.5e-33
WP_001058748.1|2116352_2116955_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.3	2.6e-25
WP_000181940.1|2116947_2117169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024675.1|2117165_2117429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065741.1|2117425_2117620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000958750.1|2117612_2118680_-	ash family protein	NA	NA	NA	NA	NA
WP_000476150.1|2118673_2118856_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001019376.1|2118848_2119682_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_001035842.1|2119694_2120126_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	5.1e-28
WP_000083330.1|2120125_2120323_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	48.1	1.7e-07
WP_000251023.1|2120520_2121402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000772642.1|2121544_2122759_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.5e-133
WP_000893316.1|2123114_2124368_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_001285288.1|2124379_2125483_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749871.1|2125770_2126826_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	2.9e-117
WP_000174677.1|2126864_2127266_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189556.1|2127323_2128568_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|2128659_2129118_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|2129378_2130836_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_000602104.1|2130892_2131507_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_000528865.1|2131503_2132643_-	RNA ligase RtcB family protein	NA	A0A222ZKP1	Mycobacterium_phage	31.1	4.5e-31
WP_105241877.1|2133996_2138736_-	PAAR domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.5	4.4e-19
WP_001160804.1|2138755_2139217_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_000253844.1|2140771_2142229_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	3.9e-11
WP_000770953.1|2142218_2142902_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000074197.1|2143058_2144441_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000709882.1|2144464_2144797_+	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000717143.1|2144812_2146036_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_105241878.1|2146047_2149191_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	3.7e-59
WP_000786320.1|2149292_2150669_+	phenylalanine transporter	NA	NA	NA	NA	NA
WP_001153148.1|2150736_2151984_-	mechanosensitive ion channel YbdG	NA	NA	NA	NA	NA
WP_000351480.1|2152091_2152745_-	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_000360937.1|2152838_2153207_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000682523.1|2153271_2153520_-	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_001121440.1|2154486_2155518_-|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
WP_087522250.1|2156222_2157592_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	6.3e-112
2155563:2156721	attR	GATCGCACAATCCGGGCTAAGTTCCCTCAAAGTGATCTACTATTCCGCGCAGCTATTTAGTTGATATCACGGCAAACATCCGTCGCCAGCTCCAGCATACTTTCGGTGATATCGTGCTTTACCTCTCCGGCCGTGATCTTATTTTTAACCGCGTCAATCAGCATTGAAGAGTCCTGGCTTAAGTCATAGCCCGGCGGATTAACCACCTGCATTTCTAGTTCAATACCGAGGGTAAAAGGTTCAGAAACATGAAAATCGGGTAATGGCATAGGTTTCTCTTATGTTGCGTTTTCTATTCAGTATAGAAGTGGGAGCGGCTGGGCGAGATGCGGAAGTTCTGGAATGTTTCTTTTTTTTGGTGATGGTGAATTGATTGTGACTGAAGCAATTTGGCTACTTTTGCAATGTGACAAGTTATGGCACGGCTGGCTGGTGGCGAAGAATTTTGACGATTGAGGCATGCAGAAAAAACGGGCTCAGCTTCAGTTGATCAAATGGAGAGTGAGAAGTCCGAAACAGGACTTACTGTATAAATAAACAGCTATTTTGCTAAGCAAGGGTAAGATAACTGCGGGTGCCTGAGGCTTTCCGGTTTCAGGTTTACTCTGAGGTCTGGAAAGATGAAGCCCCAGGATGTACTGACCCCAAAAAGTTGGACAGTTAAACACGAGGCATATAGGTCTGATTCCGATATTCAATTGGAGTCAGACCTTTTAATTTCAGGCTAATTCTTCTGCTGTTGTAGTATTCAATATATTCCGTAACAGCATCCTTCAGTTCGCTTATATTACTGAACTCATCAAGATAAAAACACTCCGATTTTAAGGTTCCAAAGAAACACTCCACCACAGCATTATCCAGACAATTGCCTTTTCTGGACATGCTTTGTTTAATACCATGTTCTTTAAGGATATTTTGATATCTTCTCATACGATACTGCCATCCCTGGTCAGAGTGCAGAACAGGATGCTCGTGAGGATTAAGCTTTTTGAATGCCTGATCGAGCATATTCTCGACCATGTTCATCACTGGTCTTTCCGAAAGGCTGTAAGAAATAACTTCGTTGTTGAAGAGATCTATTACTGGAGACAAATACAGCTTGCGCCCATTGACTGCAAATTCAGTAACATCGGTAACCCACTTCTCGTTTGGCCGCGTA	NA	NA	NA	NA
>prophage 14
NZ_CP027027	Shigella dysenteriae strain E670/74 chromosome, complete genome	5036586	2209697	2277673	5036586	tRNA,transposase	Paenibacillus_phage(13.33%)	50	NA	NA
WP_001157901.1|2209697_2212280_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.1	7.5e-183
WP_001044880.1|2212514_2212997_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_000367027.1|2214208_2214916_+	DUF1266 domain-containing protein	NA	NA	NA	NA	NA
WP_086021050.1|2216127_2216971_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	4.4e-23
WP_105241882.1|2217005_2218037_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_001035673.1|2218422_2218977_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_001030920.1|2219078_2219786_+	DUF1266 domain-containing protein	NA	NA	NA	NA	NA
WP_005013481.1|2219782_2221234_+	co-chaperone DjlC	NA	NA	NA	NA	NA
WP_000367883.1|2221293_2222964_-	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.6	3.0e-76
WP_001207527.1|2223047_2223983_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|2224100_2224826_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_000272818.1|2224825_2225500_-	glutamate/aspartate ABC transporter permease GltK	NA	NA	NA	NA	NA
WP_000853064.1|2229674_2231213_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_001278607.1|2231237_2232116_-	CNNM family magnesium/cobalt transport protein CorC	NA	NA	NA	NA	NA
WP_000084472.1|2232205_2232673_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_001018040.1|2232669_2233710_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.1e-47
WP_000162740.1|2233862_2235287_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_000184562.1|2235432_2236608_+	2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase	NA	NA	NA	NA	NA
WP_000337061.1|2237909_2239574_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	38.8	6.7e-84
WP_000187601.1|2240769_2241990_-	DNA-binding transcriptional regulator NagC	NA	NA	NA	NA	NA
WP_000271195.1|2241998_2243147_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_001237072.1|2243206_2244007_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_001023135.1|2244338_2246285_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	9.2e-08
WP_001287165.1|2246543_2248208_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.6	0.0e+00
WP_000649027.1|2248370_2248538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089590740.1|2248795_2250202_+	chitoporin	NA	NA	NA	NA	NA
WP_000733592.1|2250251_2250578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000131702.1|2250661_2251108_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_001406816.1|2251100_2251187_-	fur leader peptide	NA	NA	NA	NA	NA
WP_001018618.1|2251396_2251927_-	flavodoxin FldA	NA	NA	NA	NA	NA
WP_001300829.1|2252066_2252360_-	LexA regulated protein	NA	NA	NA	NA	NA
WP_000773301.1|2252499_2253264_-	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	35.4	4.4e-06
WP_001424151.1|2253448_2253994_+	replication initiation negative regulator SeqA	NA	NA	NA	NA	NA
WP_001297249.1|2254019_2255660_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_005012122.1|2256797_2257994_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000040198.1|2258481_2260680_-	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_001171592.1|2260802_2261060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000186087.1|2261275_2261953_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
WP_004997582.1|2261949_2264634_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
WP_004997579.1|2264626_2265199_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_105241884.1|2265207_2267256_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.1	8.4e-28
WP_000730080.1|2267278_2268952_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_032336058.1|2268951_2269041_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424925.1|2269353_2269560_+	YbfA family protein	NA	NA	NA	NA	NA
WP_105241885.1|2269800_2273448_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	41.2	2.2e-10
WP_001143980.1|2273526_2274720_+|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	62.5	1.2e-138
WP_094110437.1|2275091_2275936_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	2.6e-23
WP_138974787.1|2276015_2276180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105241886.1|2276176_2276626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105241887.1|2276641_2277673_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP027027	Shigella dysenteriae strain E670/74 chromosome, complete genome	5036586	2335724	2364851	5036586	transposase,integrase,lysis,terminase,capsid,holin	Escherichia_phage(34.48%)	36	2337003:2337017	2345194:2345208
WP_000891698.1|2335724_2336783_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	2.6e-20
WP_000213425.1|2336783_2337602_-	bifunctional pyridoxal phosphate/fructose-1,6-bisphosphate phosphatase	NA	NA	NA	NA	NA
2337003:2337017	attL	TTTGCTGTTGCCGCC	NA	NA	NA	NA
WP_005033876.1|2337837_2338884_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	K7PHK0	Enterobacteria_phage	44.5	9.4e-76
WP_000276807.1|2339177_2339366_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	93.5	8.8e-17
WP_001173292.1|2339416_2340514_-	AAA family ATPase	NA	I6PCV5	Cronobacter_phage	84.7	2.9e-184
WP_001277359.1|2340519_2340816_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	83.5	6.2e-41
WP_001068999.1|2343199_2343481_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	55.8	2.0e-09
WP_000935589.1|2343497_2344346_-	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	57.5	6.7e-56
WP_001121440.1|2344863_2345895_-|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
2345194:2345208	attR	TTTGCTGTTGCCGCC	NA	NA	NA	NA
WP_001005969.1|2346181_2346385_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	6.6e-10
WP_001091983.1|2346386_2346542_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.8e-07
WP_000787424.1|2346744_2347152_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	1.7e-28
WP_000912291.1|2347228_2347456_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000702036.1|2347439_2347862_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	3.8e-68
WP_105241894.1|2347939_2348722_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	66.0	3.2e-44
WP_000789009.1|2348728_2349475_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.7	2.0e-112
WP_001118167.1|2349489_2349912_+	DUF977 family protein	NA	A0A2I6TCA7	Escherichia_phage	76.6	5.9e-53
WP_024259128.1|2349969_2350326_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	96.6	2.5e-57
WP_012421537.1|2350494_2351160_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000882657.1|2351330_2351543_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	90.0	4.0e-26
WP_000687440.1|2351792_2352080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000940326.1|2352118_2352718_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	6.5e-106
WP_000228005.1|2352717_2353008_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	9.6e-47
WP_000640122.1|2353004_2353559_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	6.5e-68
WP_000284485.1|2354738_2354954_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	91.5	4.2e-31
WP_000075178.1|2354953_2355451_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	98.2	2.9e-91
WP_000092288.1|2355447_2355918_+|lysis	lysis protein	lysis	Q9AZ06	Salmonella_phage	93.5	1.4e-71
WP_011069285.1|2356006_2356519_-	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_001118113.1|2356713_2357478_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	53.8	5.9e-11
WP_001300443.1|2357428_2358832_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	1.2e-187
WP_000113499.1|2358831_2360298_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.2	3.3e-260
WP_000184977.1|2360188_2360932_+|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	84.4	5.3e-89
WP_105241895.1|2360935_2362156_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	91.0	4.2e-208
WP_001066726.1|2362159_2362492_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	89.2	6.9e-49
WP_001121440.1|2362507_2363539_-|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
WP_105241896.1|2364719_2364851_+	DNA invertase	NA	A0A0C4UR34	Shigella_phage	81.2	2.0e-07
>prophage 16
NZ_CP027027	Shigella dysenteriae strain E670/74 chromosome, complete genome	5036586	2498457	2560704	5036586	tRNA,protease,transposase	uncultured_Mediterranean_phage(10.53%)	44	NA	NA
WP_000520781.1|2498457_2498778_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_105241902.1|2498808_2501085_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	3.7e-165
WP_001040187.1|2501770_2501989_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|2502273_2502978_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202162.1|2503019_2504741_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	4.9e-21
WP_001043612.1|2504741_2506508_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_000537416.1|2506630_2507596_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	6.5e-63
WP_000228473.1|2508139_2508634_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077004.1|2508768_2513040_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.3e-86
WP_005035852.1|2513198_2513810_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067767.1|2513820_2515164_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886681.1|2515254_2516547_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.1e-94
WP_105241903.1|2519241_2519859_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.1	4.3e-76
WP_000534690.1|2519860_2520724_+	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_004967157.1|2521090_2521765_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
WP_000631725.1|2521761_2522109_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_005010168.1|2523810_2525157_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_072038244.1|2525233_2526547_+	amino acid permease	NA	NA	NA	NA	NA
WP_001242665.1|2527708_2528617_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001190384.1|2528716_2529307_+	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_000111043.1|2529388_2530129_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292794.1|2530320_2532603_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	4.9e-162
WP_000642553.1|2532657_2533515_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_105242096.1|2533920_2535681_-	YcaO-like family protein	NA	NA	NA	NA	NA
WP_000642852.1|2535810_2536503_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057149.1|2536701_2537790_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_000445231.1|2537860_2539144_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000483770.1|2539269_2540616_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000926028.1|2540823_2542671_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001605195.1|2542851_2543400_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109488.1|2543426_2544074_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462666.1|2544295_2545486_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000483769.1|2545702_2547049_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000977920.1|2547106_2548195_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000117880.1|2548796_2550197_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	6.9e-82
WP_005013395.1|2550365_2551568_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193831.1|2551833_2554446_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	5.3e-19
WP_001090522.1|2554652_2555420_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
WP_000235203.1|2555416_2556208_-	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_000055968.1|2556219_2557110_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001244331.1|2557106_2558066_-	aliphatic sulfonate ABC transporter substrate-binding protein SsuA	NA	NA	NA	NA	NA
WP_001263932.1|2558058_2558634_-	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_000750284.1|2558989_2559532_+	fimbrial protein	NA	NA	NA	NA	NA
WP_005010759.1|2559672_2560704_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP027027	Shigella dysenteriae strain E670/74 chromosome, complete genome	5036586	2578816	2701895	5036586	protease,transposase,integrase	Escherichia_phage(26.83%)	105	2624040:2624099	2659142:2660362
WP_000156472.1|2578816_2580577_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|2580762_2581215_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_004991512.1|2581290_2582346_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288718.1|2582702_2583212_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839153.1|2583430_2584060_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875029.1|2584022_2586185_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261233.1|2586194_2586641_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_005011496.1|2586763_2588818_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.3	6.5e-20
WP_000424181.1|2588849_2589308_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847784.1|2589403_2590066_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|2590238_2590652_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|2590696_2591014_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116305.1|2591071_2592262_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048239.1|2592356_2592635_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|2592631_2592961_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375136.1|2593051_2593711_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
WP_004999783.1|2594431_2595550_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107371.1|2595546_2597340_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186413.1|2597358_2598066_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003674.1|2598062_2598650_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000069878.1|2598646_2599045_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000263585.1|2600031_2601576_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000460803.1|2601587_2602724_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270305.1|2602736_2602829_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_024258952.1|2602904_2604203_+	bifunctional acid phosphatase/4-phytase	NA	NA	NA	NA	NA
WP_000208624.1|2604322_2606503_-	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_000057871.1|2606522_2606969_-	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_004991465.1|2606956_2608096_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_060634440.1|2608141_2610238_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001038078.1|2610237_2610984_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_001247610.1|2610980_2611625_-	lipoprotein GfcB	NA	NA	NA	NA	NA
WP_004999748.1|2611731_2612037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000087763.1|2612478_2612691_-	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_000066490.1|2612976_2613189_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_072038325.1|2613199_2613388_+	cold-shock protein	NA	NA	NA	NA	NA
WP_032336090.1|2613362_2613593_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|2613582_2613756_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_072038322.1|2614947_2617692_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.2	7.0e-38
WP_001121440.1|2617764_2618796_-|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
WP_000420625.1|2619119_2620040_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
WP_000024560.1|2620039_2620345_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209856.1|2620437_2621037_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_105241904.1|2621033_2623580_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	31.0	1.5e-71
2624040:2624099	attL	TGTAGATTCAATTGGTCAACGCAACAGTTATGTGAAAACATGGGGTTGCGGAGGTTTTTT	NA	NA	NA	NA
WP_001254932.1|2624101_2625253_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001120112.1|2627345_2628038_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_005010277.1|2628305_2629652_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_001121440.1|2630611_2631643_+|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
WP_105241905.1|2631702_2632953_+	YccE family protein	NA	NA	NA	NA	NA
WP_001143120.1|2634523_2634751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000111568.1|2634771_2635377_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_105241906.1|2635430_2636789_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000631709.1|2637840_2638188_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	73.8	4.1e-44
WP_005002356.1|2638207_2639809_+|transposase	IS66-like element ISSfl3 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	1.4e-147
WP_004967157.1|2639952_2640627_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
WP_000631725.1|2640623_2640971_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001254932.1|2642581_2643733_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000930140.1|2646009_2646633_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	75.9	8.4e-80
WP_001039888.1|2646632_2646812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105241907.1|2646812_2648576_-	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
WP_000533659.1|2649138_2650212_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	96.4	1.0e-194
WP_001303849.1|2650189_2650408_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_105242100.1|2650506_2651734_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000235316.1|2651828_2652485_-	ORF6N domain-containing protein	NA	A0A088CD42	Shigella_phage	70.3	1.6e-76
WP_001095964.1|2652810_2653593_-	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	67.6	2.4e-44
WP_000457738.1|2653735_2653978_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	80.0	3.4e-29
WP_105241908.1|2654062_2654458_-	hypothetical protein	NA	A0A193GYM6	Enterobacter_phage	60.5	1.2e-36
WP_032336156.1|2657087_2657663_-	DUF551 domain-containing protein	NA	A0A088CPS0	Enterobacteria_phage	68.4	2.9e-58
WP_000747051.1|2657717_2658068_+|transposase	transposase	transposase	Q716C1	Shigella_phage	98.9	1.8e-39
WP_001254932.1|2657987_2659139_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000459725.1|2661406_2661757_-	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	99.1	1.0e-58
2659142:2660362	attR	AAAAAACCTCCGCAACCCCATGTTTTCACATAACTGTTGCGTTGACCAATTGAATCTACAACCGCGCTCTTGATGTCAGACTCCCTGAACAGTTCTCGATAATCGGGAAACTCAGAGCGCATTATCCTGTGGTCACACTCTGCCAAGTGTTCGGGGTTCATCGCAGCAGCTACAGATACTGGAAAAACCGTCCTGAAAAACCAGACGGCAGACGGGCTGTATTACGCAGTCAGGTACTTGAGCTACATGGCATCAGCCATGGTTCGGCCGGAGCAAGAAGCATCGCCACAATGGCAACCCGGAGAGGCTACCAGATGGGACGCTGGCTTGCTGGCAGGCTCATGAAAGAGCTGGGGCTGGTTAGCTGTCAGCAGCCGACTCACCGGTATAAACGTGGTGGTCATGAACATGTTGCTATCCCTAACTACCTTGAAAGGCAGTTCGCCGTGACCGAGCCAAATCAGGTGTGGTGCGGTGATGTGACCTATATCTGGACGGGTAAGCGCTGGGCGTACCTCGCCGTTGTTCTCGACCTGTTCGCAAGAAAACCAGTGGGCTGGGCCATGTCGTTCTCGCCGGACAGCAGGCTCACCATGAAAGCGCTGGAAATGGCATGGGAAACCCGTGGTAAGCCCGGCGGGGTGATGTTCCACAGCGATCAGGGCAGTCATTATACGAGCAGGCAGTTCCGGCAGTTATTGTGGCGATACCAGATCAGACAGAGTATGAGCCGGCGCGGAAACTGCTGGGATAACAGCCCAATGGAACGCTTCTTCAGGAGTCTGAAGAACGAATGGATGCTGGTGGTGGGTTACGTAAGCTTCAGCGAGGCAGCTCACGCCATAACGGACTATATCGTTGGATATTACAGCGCACTAAGACCGCACGAATATAACGGTGGGTTACCCCCAAACGAATCGGAAAATCGATACTGGAAAAACTCTAACTCGGTGGCCAGTTTTTGTTGACCACTTCACTCAGTAAATCAGGCTCTTACCGACAAATTCCTGAGTTTACCGTCAGAACTCAGAAAATCACTGACATGGGACAGAGGAATGGAACTGGCCAGACATCTAGAATTTACTGTCAGCACCGGCGTTAAAGTTTACTTCTGCGATCCTCAGAGTCCTTGGCAGCGGGGAACAAATGAGAACACAAATGGGCTAATTCGGCAGTACTTTCCTAAAAAGACATGTCTTGCCCAATATACTCAACATGAAC	NA	NA	NA	NA
WP_000995347.1|2661774_2662056_-	host nuclease inhibitor GamL	NA	A0A2R2Z319	Escherichia_phage	98.9	6.5e-48
WP_000934194.1|2662076_2662358_-	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	94.6	3.1e-42
WP_000917251.1|2662369_2662582_-	hypothetical protein	NA	A0A0P0ZGD1	Escherichia_phage	98.6	2.2e-32
WP_075329961.1|2662652_2663543_-	Rha family phage regulatory protein	NA	A0A0H4IQ68	Shigella_phage	71.1	4.7e-92
WP_000513533.1|2664198_2664447_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_001016018.1|2664443_2664788_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_164834428.1|2664902_2665073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000162429.1|2665194_2665914_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	69.9	1.3e-87
WP_000171144.1|2666019_2666259_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005011604.1|2666421_2666607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000470023.1|2666784_2667171_+	hypothetical protein	NA	A0A286S263	Klebsiella_phage	44.8	2.6e-23
WP_000912605.1|2667164_2668670_+	DEAD/DEAH box helicase	NA	A0A2R2Z335	Escherichia_phage	98.8	2.6e-292
WP_001254932.1|2669569_2670721_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000187062.1|2671712_2672402_+	YqaJ viral recombinase family protein	NA	A0A2R2Z325	Escherichia_phage	99.1	1.3e-134
WP_001254932.1|2674016_2675168_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001121440.1|2676379_2677411_-|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
WP_000268371.1|2678260_2678809_-	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	36.1	2.7e-21
WP_001273658.1|2679755_2679929_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_004999727.1|2680186_2681515_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	5.3e-233
WP_001028095.1|2681535_2682030_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001001110.1|2682040_2682631_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001400595.1|2682640_2683441_-	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001126789.1|2683448_2683835_-	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_024258950.1|2683846_2684539_-	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_004999719.1|2684538_2685630_-	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_000191700.1|2685917_2686556_+	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_005011657.1|2686595_2690558_-	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000979516.1|2690612_2690822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018490.1|2690980_2692489_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000154398.1|2693986_2695114_+	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_105241910.1|2695119_2696352_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_171765191.1|2696972_2697761_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	6.0e-91
WP_000225124.1|2698569_2699025_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000140459.1|2699155_2700352_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001143980.1|2700701_2701895_-|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	62.5	1.2e-138
>prophage 18
NZ_CP027027	Shigella dysenteriae strain E670/74 chromosome, complete genome	5036586	2802535	2888879	5036586	tRNA,transposase,head,terminase,portal,lysis,capsid,protease,tail	Escherichia_phage(28.89%)	83	NA	NA
WP_004976564.1|2802535_2803642_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|2803695_2804157_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|2804166_2804820_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|2804991_2806242_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_024258980.1|2806344_2806668_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	64.5	2.6e-40
WP_000140459.1|2806976_2808173_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_032143442.1|2808655_2808766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001121440.1|2809041_2810073_+|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
WP_000813256.1|2810787_2810943_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	98.0	5.0e-18
WP_001429486.1|2811400_2811679_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	4.3e-12
WP_001265033.1|2811680_2812730_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	2.2e-109
WP_000904114.1|2812742_2813117_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_000762890.1|2813113_2813935_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	6.1e-78
WP_000562553.1|2814789_2814921_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000506936.1|2815287_2815716_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|2815887_2816262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839561.1|2816513_2816729_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	95.8	5.9e-33
WP_000192455.1|2816733_2817048_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	96.2	4.5e-50
WP_001274718.1|2817103_2817637_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	98.3	9.6e-101
WP_000091905.1|2817633_2818098_+|lysis	lysis protein	lysis	A0A1B5FPA1	Escherichia_phage	85.8	3.1e-63
WP_105241914.1|2818140_2818491_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	97.4	1.4e-63
WP_024258328.1|2818637_2819120_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	1.1e-84
WP_000811487.1|2820873_2821035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059242548.1|2821024_2822251_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.8	5.3e-203
WP_000999828.1|2822243_2822843_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000766109.1|2822857_2824075_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000719066.1|2824151_2824469_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
WP_105241915.1|2824477_2824816_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	93.8	1.2e-51
WP_032333424.1|2824812_2825262_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.9	6.1e-64
WP_001206304.1|2825258_2825603_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	98.2	4.6e-56
WP_000097532.1|2825662_2826367_+	immunoglobulin domain-containing protein	NA	A0A1B5FP82	Escherichia_phage	96.6	1.8e-118
WP_000164661.1|2826381_2826753_+|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
WP_171765184.1|2826776_2827055_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	96.7	1.1e-42
WP_001254932.1|2830796_2831948_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_105241917.1|2833136_2833835_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	9.9e-130
WP_141095323.1|2834519_2835128_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.5	1.7e-101
WP_001230479.1|2840109_2840709_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	5.2e-111
WP_105241919.1|2840767_2841466_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	K7PGT9	Enterobacteria_phage	96.7	1.4e-59
WP_088895413.1|2841507_2842735_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	8.5e-177
WP_164837515.1|2845123_2845543_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.9	4.0e-70
WP_000358619.1|2846026_2846740_+	cytolethal distending toxin type I subunit CdtA	NA	A5LH52	Enterobacteria_phage	100.0	2.9e-137
WP_000734593.1|2846736_2847558_+	cytolethal distending toxin type I nuclease subunit CdtB	NA	A5LH53	Enterobacteria_phage	100.0	1.5e-153
WP_000859545.1|2847554_2848127_+	cytolethal distending toxin type I subunit CdtC	NA	A5LH54	Enterobacteria_phage	98.9	5.3e-105
WP_048816332.1|2849096_2849627_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	99.1	1.2e-55
WP_001254932.1|2850513_2851665_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001007788.1|2852459_2853110_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_000384037.1|2854146_2854287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001121440.1|2854267_2855299_-|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
WP_005012432.1|2855382_2856453_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	1.0e-37
WP_001240091.1|2857011_2857647_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_000740078.1|2857647_2858652_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_000920127.1|2858760_2859174_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_001339045.1|2859306_2859978_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826730.1|2859977_2861336_+	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	19.8	3.9e-05
WP_000218200.1|2861443_2862295_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_094110432.1|2862855_2863700_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	49.1	3.7e-22
WP_000824397.1|2863803_2864991_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	52.7	2.9e-105
WP_001313057.1|2865557_2865923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365562.1|2865962_2866658_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_001157213.1|2866724_2868143_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_000786004.1|2868123_2868594_+	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001212238.1|2868582_2869503_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922690.1|2869675_2870593_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009307.1|2870671_2870854_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_077901286.1|2871024_2872719_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000844800.1|2873827_2874055_-	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000867217.1|2874217_2874406_+	protein DsrB	NA	NA	NA	NA	NA
WP_000384045.1|2874449_2875073_-	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_005010759.1|2875053_2876085_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_000983980.1|2876512_2877298_-	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000187358.1|2877306_2877576_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_001253456.1|2877585_2878323_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_004966878.1|2878322_2878688_-	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001282098.1|2878690_2879104_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_005013919.1|2879100_2880105_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_000133117.1|2880109_2880574_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000620067.1|2880678_2881806_-	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000807593.1|2881802_2882246_-	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_039072038.1|2882264_2883638_-	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_001282702.1|2883637_2884324_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000067950.1|2884316_2885312_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001274300.1|2887170_2887485_+	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_005010759.1|2887847_2888879_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP027027	Shigella dysenteriae strain E670/74 chromosome, complete genome	5036586	2912700	3075304	5036586	tRNA,transposase,lysis,terminase,portal,holin,protease,tail	Enterobacteria_phage(31.82%)	155	NA	NA
WP_000140459.1|2912700_2913897_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001295647.1|2914162_2914513_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_001291596.1|2914515_2915130_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_000906336.1|2915220_2916108_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_000795637.1|2916104_2917031_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_078126482.1|2917035_2918868_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_171765185.1|2918864_2920211_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000147302.1|2920459_2920963_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_000610396.1|2921106_2921571_+	Tar ligand binding domain-containing protein	NA	NA	NA	NA	NA
WP_000204312.1|2924433_2925294_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_105241923.1|2925296_2926346_+	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	33.6	4.6e-06
WP_000763867.1|2926360_2926750_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000983609.1|2926760_2927405_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_001278928.1|2927606_2928755_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_105241924.1|2928747_2930826_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_004998488.1|2930884_2931916_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_001383257.1|2932040_2932373_+	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_001307852.1|2932494_2932983_-	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001025322.1|2933159_2934893_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
WP_001326063.1|2935108_2935675_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185743.1|2935688_2936435_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214305.1|2936822_2937923_+	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_105241925.1|2937947_2940377_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_000564725.1|2940541_2941513_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|2941509_2942253_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252979.1|2942293_2942689_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_105241926.1|2942741_2943089_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_105241927.1|2943159_2944191_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_001254932.1|2945354_2946506_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000148625.1|2946892_2947234_-	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	74.0	8.2e-37
WP_000141096.1|2947429_2947636_-	hypothetical protein	NA	Q8W651	Enterobacteria_phage	92.6	6.4e-29
WP_000492404.1|2947775_2948036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000608407.1|2948064_2948427_-	helix-turn-helix transcriptional regulator	NA	Q8W649	Enterobacteria_phage	96.7	2.6e-57
WP_000838348.1|2948523_2949180_-	helix-turn-helix domain-containing protein	NA	Q8W648	Enterobacteria_phage	98.2	6.9e-125
WP_000867913.1|2950488_2950782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004998217.1|2950901_2951609_+	Rha family transcriptional regulator	NA	Q8W645	Enterobacteria_phage	77.8	4.2e-96
WP_001197745.1|2951628_2951805_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	85.7	1.5e-23
WP_001300492.1|2951826_2952186_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001141116.1|2952187_2952475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105241928.1|2952439_2953378_+	Rha family phage regulatory protein	NA	S5MQL6	Escherichia_phage	75.7	2.5e-112
WP_000618009.1|2953374_2953608_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	50.0	1.1e-13
WP_001247837.1|2953594_2954503_+	hypothetical protein	NA	Q8W642	Enterobacteria_phage	97.4	2.0e-61
WP_039072146.1|2954513_2955392_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	96.8	7.0e-141
WP_001064800.1|2956776_2957034_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	95.0	4.9e-34
WP_001215511.1|2957033_2957408_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.3	4.9e-35
WP_000762890.1|2957404_2958226_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	6.1e-78
WP_001441762.1|2958820_2959156_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	75.7	1.0e-44
WP_000874243.1|2959416_2959605_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001323614.1|2959601_2959763_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	91.3	5.4e-15
WP_005014140.1|2959912_2960128_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	97.2	7.7e-33
WP_000193253.1|2960132_2960663_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	52.6	3.7e-36
WP_105241929.1|2960984_2961518_+	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.7e-97
WP_024259025.1|2961852_2962290_+|lysis	lysis protein	lysis	A0A088CBQ1	Shigella_phage	89.0	4.2e-62
WP_001028468.1|2962492_2963014_+	KilA-N domain-containing protein	NA	H6WRZ8	Salmonella_phage	99.4	7.2e-101
WP_001205133.1|2963153_2963330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373425.1|2963687_2964182_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_000934088.1|2964181_2966284_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	93.9	0.0e+00
WP_001072972.1|2966280_2966493_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	87.1	1.1e-26
WP_105241930.1|2966492_2967998_+|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	88.0	1.2e-257
WP_077901312.1|2967942_2970003_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	93.8	0.0e+00
WP_001097044.1|2970089_2970413_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	97.2	2.7e-50
WP_001283159.1|2970405_2970681_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	94.5	4.0e-42
WP_000677085.1|2970692_2971277_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	89.2	9.9e-91
WP_004999318.1|2971273_2971675_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	96.2	7.8e-71
WP_000211092.1|2971685_2972369_+|tail	tail protein	tail	K7PGT7	Enterobacteria_phage	87.8	4.8e-113
WP_000478927.1|2972427_2972814_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	92.2	1.4e-61
WP_001161004.1|2972822_2973152_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	99.1	1.3e-55
WP_105241931.1|2973123_2976165_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	86.5	0.0e+00
WP_000447264.1|2976164_2976494_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	97.2	2.4e-57
WP_001152490.1|2976493_2977192_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	89.7	8.4e-121
WP_000194737.1|2977196_2977940_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.8e-145
WP_000090877.1|2977876_2978479_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	8.1e-88
WP_105241932.1|2978539_2982019_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	87.3	0.0e+00
WP_001233100.1|2982086_2982644_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	85.9	1.7e-92
WP_105241933.1|2982707_2984144_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q8W611	Enterobacteria_phage	45.6	1.2e-44
WP_000551128.1|2984094_2984718_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	75.9	1.2e-78
WP_001039888.1|2984717_2984897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217553.1|2987247_2987496_-	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000140459.1|2988224_2989421_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000891604.1|2989612_2989867_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_001258662.1|2990176_2991949_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001308712.1|2992066_2992519_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907250.1|2992547_2993288_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004999301.1|2993322_2993844_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	4.5e-10
WP_001024918.1|2993845_2994448_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001386853.1|2994518_2994584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580331.1|2994722_2995334_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|2995342_2996353_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571460.1|2996402_2997188_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202994.1|2997184_2997940_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	3.8e-18
WP_001300644.1|2998018_2998951_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184048.1|2998966_3000289_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_000448381.1|3000408_3001380_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000091152.1|3001510_3002953_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_001056686.1|3003080_3003938_-	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000301720.1|3004275_3005751_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
WP_078166953.1|3005985_3007797_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000800522.1|3007833_3008475_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_000173505.1|3008530_3009709_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000257738.1|3009842_3010133_+	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_001295500.1|3010199_3010556_+	protein YebF	NA	NA	NA	NA	NA
WP_001254932.1|3011327_3012479_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001144025.1|3013409_3014033_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000936942.1|3014241_3016302_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_000944257.1|3016298_3016961_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011658.1|3016984_3017641_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916767.1|3017742_3017973_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	3.8e-14
WP_000168741.1|3018111_3018486_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000976480.1|3019374_3019716_+	YebY family protein	NA	NA	NA	NA	NA
WP_004998488.1|3021099_3022131_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_077901267.1|3022305_3022587_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	42.4	1.3e-11
WP_000276806.1|3022693_3022882_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	72.6	1.5e-16
WP_001254932.1|3023601_3024753_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001277359.1|3026460_3026757_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	83.5	6.2e-41
WP_077788306.1|3026734_3028675_-	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	57.3	8.1e-190
WP_000022246.1|3028698_3028995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069000.1|3029069_3029351_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	55.8	2.0e-09
WP_000935587.1|3029367_3030210_-	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	58.5	2.7e-57
WP_001005969.1|3030878_3031082_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	6.6e-10
WP_001091983.1|3031083_3031239_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.8e-07
WP_000787424.1|3031441_3031849_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	1.7e-28
WP_000912291.1|3031925_3032153_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000702036.1|3032136_3032559_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	3.8e-68
WP_105241894.1|3032636_3033419_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	66.0	3.2e-44
WP_000789009.1|3033425_3034172_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.7	2.0e-112
WP_001254932.1|3035430_3036582_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000403775.1|3037156_3037513_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_105241936.1|3037677_3038871_+|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	62.0	5.8e-138
WP_001224662.1|3038917_3039100_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000753060.1|3039092_3039269_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	94.8	6.7e-27
WP_005032998.1|3039731_3040763_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_105241937.1|3040743_3040938_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	82.6	2.1e-13
WP_000090004.1|3041047_3041335_-	hypothetical protein	NA	Q3LZN5	Bacteriophage	49.5	3.3e-15
WP_001254932.1|3042414_3043566_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000218022.1|3044149_3044707_+	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	75.0	1.1e-49
WP_000284485.1|3045904_3046120_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	91.5	4.2e-31
WP_105241938.1|3046119_3046617_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	97.6	1.4e-90
WP_004977454.1|3046613_3047078_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	85.5	5.3e-63
WP_004999231.1|3047215_3048673_+	potassium transporter TrkG	NA	NA	NA	NA	NA
WP_000089441.1|3048955_3050047_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	92.2	9.6e-148
WP_000021153.1|3050036_3051365_+	hypothetical protein	NA	A0A0U2JTW9	Escherichia_phage	98.4	9.3e-262
WP_105241939.1|3051382_3052819_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	99.6	1.1e-273
WP_001254932.1|3053642_3054794_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000930140.1|3056867_3057491_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	75.9	8.4e-80
WP_001039888.1|3057490_3057670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128622413.1|3057670_3059386_-	T3SS effector E3 ubiquitin-protein ligase IpaH3	NA	NA	NA	NA	NA
WP_001254932.1|3060656_3061808_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_005035090.1|3064710_3064902_-	YebW family protein	NA	NA	NA	NA	NA
WP_004999202.1|3065336_3066776_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_105241940.1|3066855_3069489_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_005013522.1|3069457_3070741_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001043882.1|3070870_3071368_+	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_000431370.1|3071464_3072163_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001055791.1|3072182_3074231_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000984521.1|3074422_3075304_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 20
NZ_CP027027	Shigella dysenteriae strain E670/74 chromosome, complete genome	5036586	3280918	3410579	5036586	tRNA,transposase	Shigella_phage(12.5%)	87	NA	NA
WP_001367866.1|3280918_3282193_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	6.7e-84
WP_001302086.1|3282254_3283115_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_004994989.1|3283722_3285069_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_001292341.1|3285434_3286202_+	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000969783.1|3286201_3286990_+	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_000018416.1|3288409_3288832_+	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000632294.1|3290050_3291229_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_000039878.1|3291329_3292280_+	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_105241952.1|3292455_3293487_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_000097819.1|3294238_3295099_+	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_005032998.1|3295195_3296227_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_171765186.1|3297815_3299043_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	5.0e-177
WP_000627350.1|3301784_3303101_+	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_000048948.1|3303151_3303757_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000139600.1|3303957_3307860_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	1.9e-52
WP_001254932.1|3309533_3310685_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001098549.1|3313321_3314962_+	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_000414565.1|3314999_3315923_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000013817.1|3316139_3317483_+	VOC family protein	NA	NA	NA	NA	NA
WP_000375956.1|3317707_3319363_+	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_001296778.1|3319502_3319727_+	YdcH family protein	NA	NA	NA	NA	NA
WP_001491065.1|3319789_3320329_+	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_004998587.1|3321419_3322412_+	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_000586711.1|3322408_3323002_+	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001261013.1|3323304_3323973_+	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_075329958.1|3324007_3325219_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000429147.1|3325271_3325808_+	DNA-binding transcriptional regulator SutR	NA	NA	NA	NA	NA
WP_004998589.1|3325880_3327842_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.3	2.7e-23
WP_000494244.1|3327933_3328164_-	YncJ family protein	NA	NA	NA	NA	NA
WP_000813794.1|3328385_3328562_+	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_001270286.1|3328607_3329024_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000760608.1|3329102_3330509_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000047415.1|3330753_3331899_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_105241955.1|3331916_3332930_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.4	4.6e-27
WP_000555447.1|3333837_3334632_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001254932.1|3336490_3337642_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_005010759.1|3338763_3339795_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_105241956.1|3339932_3340742_+	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.0	4.5e-17
WP_001303494.1|3341143_3341239_-	stress response membrane protein YncL	NA	NA	NA	NA	NA
WP_000061178.1|3341433_3341607_+	orphan toxin OrtT	NA	NA	NA	NA	NA
WP_000018633.1|3341692_3341926_+	YdcY family protein	NA	NA	NA	NA	NA
WP_001076548.1|3341926_3342376_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000027563.1|3342372_3342891_-	L-methionine sulfoximine/L-methionine sulfone acetyltransferase	NA	NA	NA	NA	NA
WP_039072206.1|3343071_3344109_+	NADPH-dependent curcumin/dihydrocurcumin reductase	NA	NA	NA	NA	NA
WP_004998616.1|3344306_3344972_+	colanic acid/biofilm transcriptional regulator McbR	NA	NA	NA	NA	NA
WP_005011063.1|3345007_3347026_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.3	1.5e-133
WP_000550677.1|3347350_3348412_+	YncE family protein	NA	NA	NA	NA	NA
WP_005011057.1|3348524_3350024_-	L-asparagine permease	NA	NA	NA	NA	NA
WP_001121440.1|3350360_3351392_+|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
WP_004998646.1|3351951_3352620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001121440.1|3353128_3354160_-|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
WP_000768398.1|3354535_3355636_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	66.2	1.8e-138
WP_011310214.1|3357006_3360054_+	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_001240596.1|3360066_3360951_+	formate dehydrogenase N subunit beta	NA	NA	NA	NA	NA
WP_000045652.1|3360943_3361597_+	formate dehydrogenase-N subunit gamma	NA	NA	NA	NA	NA
WP_004975840.1|3361824_3362109_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.5e-20
WP_000642411.1|3362254_3363265_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	24.8	2.1e-24
WP_000433464.1|3363398_3365096_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_000841554.1|3365251_3365389_-	stationary-phase-induced ribosome-associated protein	NA	NA	NA	NA	NA
WP_000495773.1|3365490_3365706_-	biofilm-dependent modulation protein	NA	NA	NA	NA	NA
WP_001285535.1|3366529_3367456_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	4.1e-14
WP_005011069.1|3368196_3368712_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000830559.1|3369732_3371283_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001285851.1|3371356_3371878_-	D-alanyl-D-alanine dipeptidase	NA	NA	NA	NA	NA
WP_128868448.1|3372135_3374532_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_001121440.1|3376346_3377378_+|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
WP_000350380.1|3377470_3378790_-	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_000246033.1|3378920_3380456_-	acid resistance gamma-aminobutyrate antiporter GadC	NA	NA	NA	NA	NA
WP_000358940.1|3380611_3382012_-	glutamate decarboxylase	NA	NA	NA	NA	NA
WP_005011710.1|3383600_3384632_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_000958175.1|3384728_3385109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001244994.1|3385151_3386312_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.1	2.4e-19
WP_105241958.1|3386368_3388741_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_075329953.1|3388778_3389522_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	26.6	1.8e-12
WP_001121440.1|3389607_3390639_+|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
WP_032336133.1|3390644_3391619_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_120795387.1|3391824_3391947_+	protein YneP	NA	NA	NA	NA	NA
WP_001254932.1|3395358_3396510_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000631725.1|3398001_3398349_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_004967157.1|3398345_3399020_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
WP_105241959.1|3399636_3400830_-|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	62.5	1.2e-138
WP_000060459.1|3401721_3402483_-	acid stress response transcriptional regulator YdeO	NA	NA	NA	NA	NA
WP_000543393.1|3402557_3402755_-	two-component system connector SafA	NA	NA	NA	NA	NA
WP_000726669.1|3403002_3405282_-	acid resistance putative oxidoreductase YdeP	NA	NA	NA	NA	NA
WP_000520692.1|3405615_3406530_-	fimbrial protein	NA	NA	NA	NA	NA
WP_088895425.1|3407589_3408818_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_086021050.1|3409735_3410579_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	4.4e-23
>prophage 21
NZ_CP027027	Shigella dysenteriae strain E670/74 chromosome, complete genome	5036586	3421873	3487721	5036586	protease,transposase	Bacillus_phage(18.18%)	53	NA	NA
WP_086021050.1|3421873_3422717_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	4.4e-23
WP_105241965.1|3424470_3424653_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000257415.1|3425846_3426773_+	glutaminase B	NA	NA	NA	NA	NA
WP_001182685.1|3426772_3427132_+	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000971286.1|3427187_3428312_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.1e-18
WP_000854619.1|3428538_3429990_+	tagaturonate reductase	NA	NA	NA	NA	NA
WP_005011143.1|3430196_3431111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024258939.1|3431114_3431873_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_005010168.1|3431882_3433229_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000558527.1|3433367_3433658_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_000774177.1|3433681_3434557_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_105241967.1|3434583_3435606_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000911174.1|3436616_3437645_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001194853.1|3437638_3439174_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	7.5e-21
WP_000154339.1|3439422_3440376_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_105242100.1|3443713_3444942_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001254932.1|3447441_3448593_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001054189.1|3449756_3450944_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000901367.1|3451070_3451166_+	protein MgtS	NA	NA	NA	NA	NA
WP_000592826.1|3451384_3452275_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.1e-19
WP_000671986.1|3452529_3452922_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_001024563.1|3453197_3453716_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_004998897.1|3453760_3455806_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636574.1|3455942_3456689_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000215549.1|3456777_3457464_+	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_000214712.1|3457640_3457844_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527808.1|3457879_3459340_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
WP_000598292.1|3460126_3460453_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705197.1|3460587_3460929_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138577.1|3460963_3461524_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_075329984.1|3461526_3462237_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|3462344_3462650_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041529.1|3462848_3463079_+	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
WP_105241968.1|3463079_3465275_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.1	6.1e-202
WP_000526463.1|3468387_3469242_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|3469284_3469899_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_072038334.1|3470056_3471349_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000919231.1|3471301_3471997_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000225276.1|3472121_3473342_-	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_001019535.1|3473476_3474367_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091854.1|3474473_3475727_+	MFS transporter	NA	NA	NA	NA	NA
WP_000743943.1|3476123_3476459_+	acid shock protein	NA	NA	NA	NA	NA
WP_000233090.1|3476551_3476635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260857.1|3476734_3477556_+|protease	serine protease	protease	NA	NA	NA	NA
WP_000046661.1|3477594_3477924_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_000276153.1|3477910_3478276_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_001118229.1|3478687_3479722_+	AI-2 transporter TqsA	NA	NA	NA	NA	NA
WP_000014036.1|3479746_3481135_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_004992068.1|3481145_3482678_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000769313.1|3483201_3484146_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000412388.1|3484331_3485714_+	amino acid permease	NA	NA	NA	NA	NA
WP_000520803.1|3485750_3486473_+	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_001121440.1|3486689_3487721_+|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP027027	Shigella dysenteriae strain E670/74 chromosome, complete genome	5036586	3514480	3629171	5036586	tRNA,transposase,tail,capsid	Edwardsiella_phage(12.82%)	96	NA	NA
WP_000483770.1|3514480_3515827_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000206363.1|3515890_3516619_-	phenylacetic acid degradation protein PaaE	NA	NA	NA	NA	NA
WP_001189195.1|3516626_3517112_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_086021050.1|3517797_3518641_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	4.4e-23
WP_000073393.1|3518799_3519087_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_001070956.1|3519098_3520028_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186461.1|3520312_3522358_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_105241972.1|3522724_3524848_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_105241973.1|3524906_3526406_-	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001067519.1|3526641_3527547_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_024258484.1|3527718_3528048_-	DUF1318 domain-containing protein	NA	NA	NA	NA	NA
WP_000698145.1|3528052_3528238_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900950.1|3528234_3530874_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762229.1|3531081_3532071_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001298828.1|3532181_3532604_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_004992098.1|3532600_3532867_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628204.1|3533140_3536665_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837903.1|3537030_3538164_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_005011161.1|3538304_3538739_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	5.2e-28
WP_000555620.1|3539314_3540229_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_105241974.1|3540228_3541056_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	G9BWD6	Planktothrix_phage	28.5	4.9e-11
WP_001101728.1|3541052_3541910_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968134.1|3541906_3542764_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_105241975.1|3542964_3543588_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	79.1	1.6e-83
WP_105241976.1|3543538_3544807_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q8W611	Enterobacteria_phage	43.1	1.6e-77
WP_000902876.1|3544830_3545376_-|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	73.1	2.5e-72
WP_164834444.1|3545378_3545903_-|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	54.5	9.6e-45
WP_000140459.1|3546844_3548041_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001181759.1|3548216_3548822_-	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	43.2	6.5e-29
WP_005011144.1|3548823_3549606_-	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	43.6	6.4e-53
WP_105241977.1|3549608_3550061_-	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	63.8	1.2e-35
WP_001191864.1|3550057_3550414_-	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	9.5e-20
WP_000068498.1|3550426_3551104_-	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	34.6	5.6e-29
WP_000122177.1|3551084_3551954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105241978.1|3553500_3554568_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	4.0e-37
WP_086021050.1|3554564_3555409_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	4.4e-23
WP_001139094.1|3557808_3558354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001009073.1|3558338_3558704_-	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	39.7	3.0e-21
WP_000247611.1|3558700_3559285_-	hypothetical protein	NA	A0A2I7QJD5	Vibrio_phage	32.0	2.3e-15
WP_105241979.1|3559274_3559733_-	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	43.5	1.3e-16
WP_105241980.1|3559738_3560086_-	hypothetical protein	NA	H9C0V9	Aeromonas_phage	41.2	3.9e-10
WP_105241981.1|3560089_3561118_-	DUF2184 domain-containing protein	NA	Q8HAP7	Burkholderia_phage	49.8	8.1e-80
WP_001091400.1|3561117_3561600_-	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	42.3	2.7e-25
WP_105241982.1|3562958_3563648_-|capsid	minor capsid protein	capsid	H9C0V1	Aeromonas_phage	49.6	4.5e-58
WP_105241983.1|3563688_3565230_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.2	3.2e-104
WP_088895425.1|3567047_3568275_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001254932.1|3568800_3569952_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_105242100.1|3570716_3571945_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_105241984.1|3571982_3573014_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_171764795.1|3573414_3574053_+	hypothetical protein	NA	I6PDJ3	Cronobacter_phage	47.6	1.4e-13
WP_000788996.1|3574059_3574806_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	89.2	2.1e-122
WP_001254932.1|3575845_3576997_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001254932.1|3578249_3579401_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_141095324.1|3579722_3579812_-|transposase	transposase	transposase	Q716C1	Shigella_phage	93.1	2.5e-06
WP_005010759.1|3580034_3581066_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_001157399.1|3581937_3582873_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	7.7e-146
WP_000123752.1|3583001_3584375_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.7	1.7e-53
WP_000387388.1|3584852_3585836_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628062.1|3586090_3587323_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	38.8	2.0e-16
WP_001046829.1|3587343_3587907_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_005032737.1|3588309_3589149_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005010759.1|3589596_3590628_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_000945005.1|3591959_3592475_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
WP_000611911.1|3592669_3593422_+	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_001262123.1|3593573_3594524_+	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000605090.1|3594573_3594831_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004998830.1|3594992_3596339_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000559900.1|3596512_3597544_+	low conductance mechanosensitive channel YnaI	NA	NA	NA	NA	NA
WP_000683014.1|3597594_3599208_-	murein tripeptide ABC transporter substrate-binding protein MppA	NA	NA	NA	NA	NA
WP_000817686.1|3599544_3600444_-	DNA-binding transcriptional regulator PgrR	NA	NA	NA	NA	NA
WP_004998407.1|3600581_3601502_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001344821.1|3602470_3603109_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_105241988.1|3604119_3605085_-	L-Ala-D/L-Glu epimerase	NA	NA	NA	NA	NA
WP_000084387.1|3605203_3605710_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_005012845.1|3605753_3607295_-	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_000138717.1|3607442_3608504_-	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_000825796.1|3608500_3609898_-	YcjX family protein	NA	NA	NA	NA	NA
WP_000075371.1|3610052_3611051_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000735247.1|3611161_3612067_-	monomeric porin OmpG	NA	NA	NA	NA	NA
WP_000057978.1|3612111_3613194_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
WP_000775797.1|3613207_3613867_-	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_105241989.1|3613863_3616131_-	kojibiose phosphorylase	NA	NA	NA	NA	NA
WP_005012860.1|3616127_3617183_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000690251.1|3617192_3617981_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_000737346.1|3617990_3619043_-	zinc-binding alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000224673.1|3619073_3619916_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_001080790.1|3619902_3620784_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_000810483.1|3620804_3623273_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_000473109.1|3623484_3623799_-	thiosulfate sulfurtransferase PspE	NA	NA	NA	NA	NA
WP_001295585.1|3623873_3624095_-	phage shock protein PspD	NA	NA	NA	NA	NA
WP_000907387.1|3624103_3624463_-	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_001274956.1|3624462_3624687_-	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_000511025.1|3624740_3625409_-	phage shock protein PspA	NA	NA	NA	NA	NA
WP_000852835.1|3625575_3626553_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_000336104.1|3626670_3627876_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.5	6.7e-25
WP_001143985.1|3627977_3629171_+|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	62.0	7.6e-138
>prophage 23
NZ_CP027027	Shigella dysenteriae strain E670/74 chromosome, complete genome	5036586	3732550	3828352	5036586	tRNA,transposase,integrase	Stx2-converting_phage(22.73%)	83	3811659:3811718	3820970:3821076
WP_002432222.1|3732550_3733807_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130704.1|3734020_3734644_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260305.1|3734643_3735495_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|3735645_3736593_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033340.1|3736717_3738397_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	3.9e-23
WP_000823885.1|3738451_3738730_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152955.1|3739007_3739592_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3739708_3740800_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_004998308.1|3741644_3744530_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000733749.1|3746776_3747847_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_000059411.1|3747857_3748490_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_004970697.1|3748500_3749919_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_005010759.1|3750186_3751218_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_000841711.1|3751393_3753091_+	alpha,alpha-trehalase	NA	NA	NA	NA	NA
WP_000615059.1|3753169_3753610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000511315.1|3753788_3754043_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000020158.1|3754243_3754978_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_001295616.1|3754979_3755591_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_105241994.1|3755690_3756605_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3756699_3758436_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000197840.1|3758820_3759891_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_005013845.1|3759900_3761205_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3761573_3763106_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_000234823.1|3763157_3763877_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000943459.1|3765784_3766315_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457622.1|3766360_3767629_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.4	1.0e-209
WP_000897378.1|3767628_3768048_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_088895425.1|3768488_3769716_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001121440.1|3769886_3770918_-|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
WP_000807626.1|3772029_3772491_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3772567_3773227_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_004970758.1|3773298_3773592_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000695221.1|3773832_3774225_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_086021050.1|3774262_3775106_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	4.4e-23
WP_001056840.1|3775254_3775623_-	YcgJ family protein	NA	NA	NA	NA	NA
WP_001295613.1|3776142_3776838_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3776861_3777674_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3777677_3777944_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_001131446.1|3781675_3781795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001325743.1|3781755_3781941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122462.1|3782041_3782215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005033203.1|3782276_3782561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000979975.1|3782564_3782900_+	YmgD family protein	NA	NA	NA	NA	NA
WP_001299921.1|3786028_3786247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001246475.1|3786378_3787902_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_001065751.1|3788234_3788483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000888776.1|3788595_3788862_-	biofilm/acid-resistance regulator AriR	NA	NA	NA	NA	NA
WP_000858000.1|3788890_3789163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000554146.1|3789205_3789442_-	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
WP_001254932.1|3790459_3791611_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_005013746.1|3793290_3794637_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000332300.1|3795104_3795836_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	3.5e-53
WP_105241997.1|3796361_3797393_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_105241998.1|3797476_3797803_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|3797799_3798054_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|3798133_3798553_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001088287.1|3799768_3800443_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.1	5.8e-10
WP_000631709.1|3800439_3800787_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	73.8	4.1e-44
WP_005002356.1|3800806_3802408_+|transposase	IS66-like element ISSfl3 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	1.4e-147
WP_000631725.1|3803167_3803515_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_004967157.1|3803511_3804186_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
WP_000379578.1|3804330_3804486_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_001171942.1|3804645_3804864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854564.1|3805432_3805621_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070255.1|3805617_3805809_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_105241999.1|3805902_3808344_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.5	2.5e-111
WP_086021050.1|3808449_3809294_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	4.4e-23
WP_105242000.1|3809335_3809524_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533619.1|3809523_3810549_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
WP_005014722.1|3810784_3811582_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
3811659:3811718	attL	TAATATGCGCCCCGTTCACACGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTT	NA	NA	NA	NA
WP_000055682.1|3811919_3813182_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	38.1	7.9e-69
WP_000957853.1|3813689_3813878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000947192.1|3813887_3815087_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000532914.1|3815592_3816309_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_141095325.1|3816939_3818580_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_094319814.1|3818697_3819648_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011483.1|3819749_3820667_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_000986347.1|3821125_3822061_-	L,D-transpeptidase	NA	NA	NA	NA	NA
3820970:3821076	attR	TAATATGCGCCCCGTTCACACGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTCGAGTCCAGTCAGAGGAGCCAAATTCAA	NA	NA	NA	NA
WP_001166155.1|3822122_3823202_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_105242102.1|3823213_3823957_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_105242002.1|3823989_3824499_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_153643809.1|3825538_3826766_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001373172.1|3827200_3828352_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.4	2.0e-42
>prophage 24
NZ_CP027027	Shigella dysenteriae strain E670/74 chromosome, complete genome	5036586	3909689	4035000	5036586	tRNA,transposase,plate,lysis,portal,capsid,holin,tail	Escherichia_phage(30.0%)	94	NA	NA
WP_170317395.1|3909689_3911630_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005010663.1|3911765_3912530_+	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_000125016.1|3912702_3913386_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140327.1|3913496_3915170_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000167336.1|3915329_3915614_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_004967157.1|3917529_3918204_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
WP_000631725.1|3918200_3918548_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_000551266.1|3920553_3922302_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
WP_000570569.1|3922298_3923285_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000056524.1|3923321_3924554_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350058.1|3924605_3924788_+	protein YcaR	NA	NA	NA	NA	NA
WP_000011602.1|3924784_3925531_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436921.1|3925684_3926578_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000899610.1|3926554_3927334_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_005010831.1|3927469_3928255_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288854.1|3928251_3929574_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001295931.1|3929554_3930259_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572675.1|3930258_3934719_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_171765188.1|3934863_3936210_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000288361.1|3939346_3940204_-	DNA-3-methyladenine glycosylase 2	NA	NA	NA	NA	NA
WP_000469692.1|3940337_3941690_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.6e-06
WP_105242010.1|3941702_3943649_-	protein kinase YegI	NA	NA	NA	NA	NA
WP_000722348.1|3943846_3944308_+	YegJ family protein	NA	NA	NA	NA	NA
WP_000119108.1|3944372_3945134_-	protein-serine/threonine phosphatase PphC	NA	NA	NA	NA	NA
WP_105242011.1|3945403_3946603_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000957853.1|3946612_3946801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000678952.1|3948056_3949304_+	multidrug efflux RND transporter subunit MdtA	NA	NA	NA	NA	NA
WP_001197872.1|3949303_3952426_+	multidrug efflux RND transporter permease subunit MdtB	NA	NA	NA	NA	NA
WP_105242012.1|3952426_3955504_+	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
WP_000130875.1|3955504_3956920_+	MFS transporter	NA	NA	NA	NA	NA
WP_000675144.1|3956916_3958320_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
WP_000137873.1|3958316_3959039_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
WP_005000001.1|3959184_3959517_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|3959664_3961026_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_000468308.1|3961298_3961517_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882962.1|3961598_3962762_-	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	97.4	1.7e-203
WP_000978904.1|3962761_3963241_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	98.1	2.1e-83
WP_105242013.1|3963255_3965637_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	95.5	0.0e+00
WP_000785970.1|3965694_3965814_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|3965846_3966122_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001286721.1|3966708_3967899_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.4e-224
WP_001121440.1|3968296_3969328_+|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
WP_000747051.1|3970068_3970419_+|transposase	transposase	transposase	Q716C1	Shigella_phage	98.9	1.8e-39
WP_001254932.1|3970338_3971490_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_004999989.1|3972808_3973594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001143970.1|3973946_3975140_+|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	62.2	2.6e-138
WP_088895413.1|3976027_3977256_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	8.5e-177
WP_001164153.1|3977837_3978365_-|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	92.6	3.2e-88
WP_105242014.1|3978368_3980474_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	57.5	5.8e-141
WP_001285331.1|3980484_3981015_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	99.4	1.5e-101
WP_001121457.1|3981007_3981916_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	1.7e-161
WP_000127163.1|3981920_3982268_-	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_105242103.1|3982264_3982894_-|plate	phage baseplate assembly protein V	plate	A0A0F7LDY9	Escherichia_phage	96.1	9.6e-108
WP_105242015.1|3984155_3984608_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.0	4.5e-75
WP_000917156.1|3984600_3985068_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	8.7e-82
WP_072133976.1|3985030_3985204_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	93.0	1.2e-23
WP_004999963.1|3985175_3985601_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	94.3	4.4e-64
WP_000736561.1|3985588_3986014_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	96.4	3.6e-58
WP_001144091.1|3986028_3986526_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.5e-92
WP_000123123.1|3986525_3986807_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_094192352.1|3987107_3988145_-|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	99.1	1.1e-193
WP_105242016.1|3988192_3989521_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_105242017.1|3989677_3990532_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.8	2.2e-139
WP_105242019.1|3992476_3993511_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	98.5	2.3e-199
WP_001121440.1|3994109_3995141_-|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
WP_001295425.1|3995655_3995973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807346.1|3996378_3997278_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	9.8e-13
WP_000178554.1|3997359_3998139_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000490687.1|3999326_4000682_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000823272.1|4000685_4000970_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182904.1|4001000_4001453_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000289790.1|4002752_4003607_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129581.1|4003837_4004890_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858527.1|4005146_4006424_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846239.1|4006420_4007425_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.0	1.9e-12
WP_000011966.1|4007421_4008387_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|4008360_4009107_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004979327.1|4009158_4009977_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	36.7	7.2e-23
WP_000822298.1|4010041_4010842_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195643.1|4010838_4011627_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019942.1|4011849_4012122_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_105242020.1|4012241_4013120_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153067.1|4013341_4013680_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_105242021.1|4013761_4014796_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_105242022.1|4014811_4017292_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677390.1|4017307_4017982_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830468.1|4018062_4018605_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001324851.1|4018897_4019179_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|4019440_4020550_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_004999891.1|4020681_4022715_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.8	1.0e-54
WP_000483770.1|4028049_4029396_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_001254932.1|4031081_4032233_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000957853.1|4033602_4033791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105242011.1|4033800_4035000_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP027027	Shigella dysenteriae strain E670/74 chromosome, complete genome	5036586	4039951	4088348	5036586	tRNA,transposase,tail,lysis	Escherichia_phage(42.86%)	42	NA	NA
WP_000937487.1|4039951_4040221_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.7	1.6e-19
WP_000239881.1|4040277_4040946_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_105242024.1|4041261_4042905_+	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
WP_001039888.1|4042905_4043085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000551128.1|4043084_4043708_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	75.9	1.2e-78
WP_105242025.1|4045633_4047760_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q7Y4D4	Escherichia_virus	64.9	1.1e-171
WP_001233125.1|4047824_4048424_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	96.0	2.0e-107
WP_004994989.1|4049395_4050742_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_105242026.1|4050805_4051390_-	host specificity protein	NA	K7PKJ2	Enterobacteria_phage	91.2	4.1e-97
WP_000140459.1|4051625_4052822_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000957853.1|4055652_4055841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000947192.1|4055850_4057050_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000701814.1|4058230_4058455_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	95.9	7.5e-31
WP_000034869.1|4058555_4059185_+	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	92.8	9.6e-108
WP_000457742.1|4059272_4059515_+	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	95.0	1.1e-35
WP_001030142.1|4059518_4059665_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	89.6	2.7e-21
WP_001193441.1|4059672_4059927_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	86.9	3.6e-37
WP_000072658.1|4059960_4061247_+	DUF3596 domain-containing protein	NA	H6WZF6	Escherichia_phage	96.3	2.8e-247
WP_032336184.1|4061267_4061894_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	85.2	1.1e-82
WP_001216963.1|4061953_4062061_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|4062041_4062773_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569361.1|4062777_4063704_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G9BWD6	Planktothrix_phage	34.6	9.7e-24
WP_105242027.1|4063696_4064854_-	glycine betaine ABC transporter permease YehY	NA	NA	NA	NA	NA
WP_001131280.1|4064860_4065778_-	glycine betaine ABC transporter substrate-binding protein OsmF	NA	NA	NA	NA	NA
WP_000871456.1|4066029_4068327_-	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_001121440.1|4068505_4069537_-|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
WP_000097369.1|4069677_4071393_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_001295432.1|4071431_4072364_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_001295454.1|4072537_4073125_-	YIP1 family protein	NA	NA	NA	NA	NA
WP_000365433.1|4073294_4073873_+	DedA family protein	NA	NA	NA	NA	NA
WP_000079558.1|4074002_4074764_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000691708.1|4076475_4076559_+	protein YohP	NA	NA	NA	NA	NA
WP_004977840.1|4076946_4077894_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_001295452.1|4078132_4078531_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_105242028.1|4078527_4079223_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553557.1|4079352_4080237_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920061.1|4080386_4081106_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000354465.1|4081108_4081348_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136334.1|4081666_4082905_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreT	NA	NA	NA	NA	NA
WP_000956069.1|4082898_4084134_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275099.1|4084204_4085215_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_001254932.1|4087196_4088348_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 26
NZ_CP027027	Shigella dysenteriae strain E670/74 chromosome, complete genome	5036586	4241929	4307666	5036586	tRNA,transposase,integrase	Enterobacteria_phage(45.0%)	65	4232364:4232379	4301035:4301050
4232364:4232379	attL	TGAAACCAGTTGCCCG	NA	NA	NA	NA
WP_001121440.1|4241929_4242961_+|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
WP_005012347.1|4242941_4243415_+	peptidase	NA	NA	NA	NA	NA
WP_001244804.1|4243485_4245213_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_105242040.1|4245350_4246322_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_001121440.1|4246501_4247533_-|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
WP_048816310.1|4247618_4248083_+	YfbM family protein	NA	NA	NA	NA	NA
WP_000156701.1|4248149_4249607_-	NADH-quinone oxidoreductase subunit NuoN	NA	NA	NA	NA	NA
WP_000926449.1|4249613_4251143_-	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_001056777.1|4251306_4253148_-	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_000612644.1|4253144_4253447_-	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_000393511.1|4253443_4253998_-	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_000172749.1|4254009_4254552_-	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_000118507.1|4254566_4255544_-	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_004977613.1|4255540_4258267_-	NADH-quinone oxidoreductase subunit NuoG	NA	NA	NA	NA	NA
WP_000789496.1|4258319_4259657_-	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_000545042.1|4259653_4260154_-	NADH-quinone oxidoreductase subunit NuoE	NA	NA	NA	NA	NA
WP_000247878.1|4260156_4261959_-	NADH-quinone oxidoreductase subunit C/D	NA	NA	NA	NA	NA
WP_000386733.1|4262052_4262715_-	NADH-quinone oxidoreductase subunit NuoB	NA	NA	NA	NA	NA
WP_000062997.1|4262730_4263174_-	NADH-quinone oxidoreductase subunit NuoA	NA	NA	NA	NA	NA
WP_000622286.1|4263802_4264741_-	transcriptional regulator LrhA	NA	NA	NA	NA	NA
WP_000074527.1|4265655_4266873_+	alanine transaminase AlaA	NA	NA	NA	NA	NA
WP_000813850.1|4266956_4267556_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	1.5e-06
WP_001012899.1|4267614_4269447_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_000426124.1|4270194_4270689_-	YfbU family protein	NA	NA	NA	NA	NA
WP_000106627.1|4270771_4271227_-	DUF412 domain-containing protein	NA	NA	NA	NA	NA
WP_000095710.1|4271564_4272767_+	acetate kinase	NA	NA	NA	NA	NA
WP_001254932.1|4273354_4274506_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001274492.1|4276398_4277919_+	putative basic amino acid antiporter YfcC	NA	NA	NA	NA	NA
WP_000437935.1|4277951_4278494_-	NUDIX hydrolase YfcD	NA	NA	NA	NA	NA
WP_000772452.1|4278551_4279103_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_000566471.1|4279938_4280586_+	GSH-dependent disulfide bond oxidoreductase	NA	NA	NA	NA	NA
WP_000068457.1|4280642_4281005_+	dihydroneopterin triphosphate 2'-epimerase	NA	NA	NA	NA	NA
WP_001028336.1|4281025_4281919_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_005010759.1|4282282_4283314_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_001293612.1|4284208_4284982_-	histidine ABC transporter ATP-binding protein HisP	NA	G9BWD6	Planktothrix_phage	38.1	2.4e-23
WP_000569959.1|4284989_4285706_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000965518.1|4285702_4286389_-	histidine ABC transporter permease HisQ	NA	NA	NA	NA	NA
WP_000737621.1|4286478_4287261_-	histidine ABC transporter substrate-binding protein HisJ	NA	NA	NA	NA	NA
WP_000748271.1|4287481_4288264_-	lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT	NA	NA	NA	NA	NA
WP_000825707.1|4288529_4289099_-	flavin prenyltransferase UbiX	NA	NA	NA	NA	NA
WP_000334221.1|4289193_4290711_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
WP_000262113.1|4290747_4291236_-	colicin V production protein	NA	NA	NA	NA	NA
WP_000157010.1|4291494_4292157_-	cell division protein DedD	NA	NA	NA	NA	NA
WP_000584572.1|4292146_4293415_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000118404.1|4293484_4294399_-	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_000364335.1|4294554_4295214_-	DedA family protein	NA	NA	NA	NA	NA
WP_001283581.1|4295296_4296109_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289171.1|4296108_4297122_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_105242041.1|4297187_4298345_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	2.1e-23
WP_105242042.1|4298503_4299508_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	55.7	5.8e-99
WP_001088287.1|4299627_4300302_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.1	5.8e-10
WP_000631725.1|4300298_4300646_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_024258962.1|4302304_4302643_-	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	1.5e-14
4301035:4301050	attR	TGAAACCAGTTGCCCG	NA	NA	NA	NA
WP_105242043.1|4302764_4303043_+	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	53.1	3.3e-20
WP_105242044.1|4303049_4303256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171765183.1|4303361_4304589_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	1.5e-176
WP_000813369.1|4304844_4305186_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	90.5	5.6e-54
WP_000158973.1|4305196_4305484_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	75.8	2.3e-32
WP_000514277.1|4305495_4305738_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021652.1|4305734_4305848_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	3.3e-11
WP_000985161.1|4305934_4306138_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	86.6	2.9e-26
WP_000153676.1|4306134_4306380_+	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	100.0	6.7e-41
WP_001274220.1|4306376_4306676_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	90.8	2.8e-41
WP_158250168.1|4306713_4307304_+	ash family protein	NA	S5MQL6	Escherichia_phage	57.7	4.4e-06
WP_000599382.1|4307300_4307666_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
>prophage 27
NZ_CP027027	Shigella dysenteriae strain E670/74 chromosome, complete genome	5036586	4311569	4346868	5036586	tRNA,head,plate,terminase,portal,capsid,holin,tail	Enterobacteria_phage(84.85%)	41	NA	NA
WP_000631725.1|4311569_4311917_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_004967157.1|4311913_4312588_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
WP_105242045.1|4312731_4313064_+	stbA family protein	NA	A0A0A7NPX4	Enterobacteria_phage	100.0	5.9e-48
WP_105242046.1|4313042_4313714_+	stability/partitioning protein	NA	A0A0A7NPX4	Enterobacteria_phage	98.7	1.8e-120
WP_000211256.1|4313718_4314030_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	97.1	5.0e-49
WP_001163785.1|4314093_4314426_+	carboxylate--amine ligase	NA	A0A0A7NV51	Enterobacteria_phage	97.2	2.5e-54
WP_001080499.1|4314422_4314737_+	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	94.2	1.3e-49
WP_001167297.1|4314739_4315231_+	hypothetical protein	NA	G9L661	Escherichia_phage	92.6	7.5e-84
WP_000224225.1|4315232_4315496_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	71.3	3.3e-30
WP_000206724.1|4315506_4315767_+	hypothetical protein	NA	A5LH60	Enterobacteria_phage	82.1	7.6e-35
WP_000087805.1|4316257_4317301_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	1.4e-204
WP_000613792.1|4317300_4319052_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	95.9	0.0e+00
WP_001262688.1|4319206_4320043_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.6	1.5e-119
WP_001055108.1|4320066_4321119_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	96.9	1.4e-191
WP_000632315.1|4321164_4321965_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	92.5	1.6e-131
WP_000063107.1|4322066_4322561_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.6	1.7e-88
WP_000864901.1|4322560_4322761_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_005011921.1|4322763_4323087_+|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	98.1	4.7e-50
WP_000072327.1|4323083_4323476_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780548.1|4323472_4323880_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	5.5e-64
WP_000920589.1|4324017_4324485_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	4.5e-86
WP_000356362.1|4324477_4325113_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	6.9e-114
WP_077826354.1|4325124_4325691_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.9	2.3e-100
WP_001067548.1|4325708_4326038_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_000071739.1|4326853_4327384_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_105242047.1|4327386_4329534_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	97.7	1.7e-111
WP_000631341.1|4329530_4330433_+	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	67.7	1.9e-96
WP_000954202.1|4331062_4331635_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000979955.1|4331791_4332280_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000853430.1|4332292_4335100_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.6	0.0e+00
WP_000333503.1|4335086_4335242_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651574.1|4335250_4335625_-	hypothetical protein	NA	A0A0A7NPZ0	Enterobacteria_phage	72.4	2.0e-36
WP_105242048.1|4336191_4337376_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.5	1.8e-224
WP_000488107.1|4338685_4338946_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|4339137_4339278_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_001173930.1|4339539_4339872_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_000789402.1|4339876_4340770_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_000615813.1|4341037_4342033_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127739.1|4342029_4343208_-	arabinose transporter	NA	NA	NA	NA	NA
WP_000817183.1|4343482_4344703_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683813.1|4344861_4346868_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
>prophage 28
NZ_CP027027	Shigella dysenteriae strain E670/74 chromosome, complete genome	5036586	4365810	4434318	5036586	tRNA,transposase	Paenibacillus_phage(25.0%)	52	NA	NA
WP_105242051.1|4365810_4366655_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	4.4e-23
WP_005032998.1|4367737_4368769_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_005000367.1|4369203_4369416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776759.1|4369597_4370353_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_105242052.1|4370646_4371579_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.0e-165
WP_005011998.1|4371823_4372759_-	DNA-binding transcriptional regulator DsdC	NA	NA	NA	NA	NA
WP_000556037.1|4372976_4374314_+	D-serine transporter DsdX	NA	NA	NA	NA	NA
WP_000426404.1|4374331_4375660_+	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_001018709.1|4375767_4377306_-	multidrug efflux MFS transporter permease subunit EmrY	NA	NA	NA	NA	NA
WP_000435189.1|4377305_4378469_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrK	NA	NA	NA	NA	NA
WP_000991370.1|4378884_4379499_+	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_032333824.1|4379503_4383097_+	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	31.8	3.9e-36
WP_005010759.1|4383610_4384642_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_000955028.1|4385526_4386471_-	transporter YfdV	NA	NA	NA	NA	NA
WP_105242053.1|4386540_4388235_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.8	4.7e-24
WP_000106757.1|4388288_4389539_-	formyl-CoA transferase	NA	NA	NA	NA	NA
WP_000825604.1|4390051_4390684_-	YfdX family protein	NA	NA	NA	NA	NA
WP_000867630.1|4390979_4391255_+	colanic acid biosynthesis lipoprotein YpdI	NA	NA	NA	NA	NA
WP_000639883.1|4391331_4391574_-	YfdY family protein	NA	NA	NA	NA	NA
WP_000484405.1|4391926_4392847_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	6.4e-76
WP_010723117.1|4393202_4393274_+	membrane protein YpdK	NA	NA	NA	NA	NA
WP_000785944.1|4393337_4394576_-	alanine transaminase	NA	NA	NA	NA	NA
WP_105242054.1|4394952_4396650_+	two-component system sensor histidine kinase YpdA	NA	NA	NA	NA	NA
WP_086021050.1|4396732_4397577_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	4.4e-23
WP_005011915.1|4397585_4398317_+	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	26.0	7.4e-11
WP_000646827.1|4398329_4399187_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011995.1|4401283_4401460_-	aminopeptidase Y	NA	NA	NA	NA	NA
WP_001143970.1|4401555_4402749_+|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	62.2	2.6e-138
WP_000985364.1|4404739_4405987_-	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000038456.1|4406008_4406335_-	fructose-like phosphotransferase enzyme IIB component 1	NA	NA	NA	NA	NA
WP_000170342.1|4406553_4407519_-	glucokinase	NA	NA	NA	NA	NA
WP_000903160.1|4407722_4408979_+	ion channel protein	NA	NA	NA	NA	NA
WP_000490072.1|4409093_4409420_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_004998488.1|4409761_4410793_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_000376337.1|4413112_4414315_+	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_001121440.1|4417163_4418195_-|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
WP_086021023.1|4418309_4419154_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	4.4e-23
WP_004993487.1|4419260_4419605_+	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_164837509.1|4419627_4419999_+	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000695653.1|4420048_4421464_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000201414.1|4422117_4422459_+	FlxA-like family protein	NA	NA	NA	NA	NA
WP_005000452.1|4422487_4423384_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000765606.1|4423473_4424472_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_000410199.1|4424468_4424687_-	DUF3820 family protein	NA	NA	NA	NA	NA
WP_000443713.1|4424688_4426704_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	3.8e-150
WP_001297862.1|4426774_4427761_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254840.1|4427990_4428752_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|4428936_4429908_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|4430291_4430549_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623133.1|4430593_4432321_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	30.7	6.2e-16
WP_105242055.1|4432361_4432871_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_005036052.1|4432971_4434318_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP027027	Shigella dysenteriae strain E670/74 chromosome, complete genome	5036586	4665316	4726621	5036586	tRNA,transposase	Mycobacterium_phage(13.33%)	53	NA	NA
WP_004998488.1|4665316_4666348_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_004998488.1|4666840_4667872_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_005012014.1|4668469_4669447_+	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_000069444.1|4672244_4673525_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.1e-33
WP_001295173.1|4673835_4675236_+	GABA permease	NA	NA	NA	NA	NA
WP_000156807.1|4675256_4675919_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522415.1|4675919_4676369_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_005000967.1|4676454_4677651_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001703586.1|4677890_4678049_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000137280.1|4678231_4678531_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001229460.1|4678540_4679065_+	thiosulfate sulfurtransferase YgaP	NA	NA	NA	NA	NA
WP_000115373.1|4679111_4679516_-	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_000492656.1|4680151_4680601_+	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_094110432.1|4680836_4681680_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	49.1	3.7e-22
WP_005000959.1|4682051_4682381_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_001223237.1|4682628_4682874_+	glutaredoxin-like protein NrdH	NA	NA	NA	NA	NA
WP_105242066.1|4682870_4683281_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	6.0e-18
WP_000246538.1|4683253_4685398_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.3	1.4e-195
WP_000777987.1|4685407_4686367_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	4.5e-133
WP_105242067.1|4686722_4687913_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000774974.1|4687916_4688981_+	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_001216536.1|4689037_4690030_+	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000165710.1|4690221_4691406_+	MFS transporter	NA	NA	NA	NA	NA
WP_000445654.1|4691529_4692267_+	L-valine exporter subunit YgaZ	NA	NA	NA	NA	NA
WP_000119748.1|4692256_4692592_+	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_160536923.1|4692610_4692712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000378442.1|4692682_4693213_+	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
WP_024258198.1|4693337_4694510_+	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_005000947.1|4694526_4696065_+	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001130211.1|4696128_4696644_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_000611799.1|4696793_4698350_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001287454.1|4698422_4698851_-	DedA family protein	NA	NA	NA	NA	NA
WP_000273292.1|4698847_4699414_-	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_000906486.1|4700463_4700649_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047198.1|4700883_4703514_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140502.1|4703641_4704142_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|4704369_4705431_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_005000932.1|4705510_4706008_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	7.5e-31
WP_000476837.1|4706152_4707238_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_000573321.1|4707492_4708056_+	PTS glucitol/sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000148863.1|4708052_4709012_+	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000216215.1|4709022_4709394_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_001077351.1|4709397_4710177_+	sorbitol-6-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000252904.1|4710282_4710642_+	transcriptional regulator GutM	NA	NA	NA	NA	NA
WP_000804550.1|4710708_4711482_+	glucitol operon DNA-binding transcriptional repressor SrlR	NA	NA	NA	NA	NA
WP_001287438.1|4711474_4712440_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	6.1e-37
WP_000010745.1|4712436_4713951_-	nitric oxide reductase transcriptional regulator NorR	NA	NA	NA	NA	NA
WP_088895425.1|4715404_4716632_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000064737.1|4718220_4719354_+	NADH:flavorubredoxin reductase NorW	NA	NA	NA	NA	NA
WP_024258199.1|4719481_4721734_-	carbamoyltransferase HypF	NA	NA	NA	NA	NA
WP_001078773.1|4721886_4722414_-	electron transport protein HydN	NA	NA	NA	NA	NA
WP_005012051.1|4722562_4723573_-	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.4	1.2e-27
WP_001254932.1|4725469_4726621_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 30
NZ_CP027027	Shigella dysenteriae strain E670/74 chromosome, complete genome	5036586	4747044	4871243	5036586	tRNA,tail,transposase,plate	Vibrio_phage(23.68%)	94	NA	NA
WP_086021023.1|4747044_4747889_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	4.4e-23
WP_004993790.1|4748103_4749474_-	adenylosuccinate lyase family protein	NA	NA	NA	NA	NA
WP_005010759.1|4750823_4751855_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_000847991.1|4751938_4752475_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	68.5	4.4e-53
WP_005000866.1|4752670_4753438_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	4.8e-69
WP_001139309.1|4753488_4754145_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	1.8e-48
WP_001272912.1|4754250_4756812_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.4	1.9e-29
WP_024258410.1|4757055_4757838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001121440.1|4758055_4759087_+|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
WP_105242070.1|4759286_4760057_+	putative selenium-dependent hydroxylase accessory protein YqeC	NA	NA	NA	NA	NA
WP_001020377.1|4760104_4761730_+	EF2563 family selenium-dependent molybdenum hydroxylase system protein	NA	NA	NA	NA	NA
WP_000037992.1|4761770_4762703_-	carbamate kinase	NA	NA	NA	NA	NA
WP_001264452.1|4762750_4764136_-	dihydropyrimidinase	NA	NA	NA	NA	NA
WP_001107117.1|4764188_4765400_-	YgeY family selenium metabolism-linked hydrolase	NA	NA	NA	NA	NA
WP_000110493.1|4765457_4766654_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000978544.1|4766711_4767902_-	knotted carbamoyltransferase YgeW	NA	NA	NA	NA	NA
WP_000417817.1|4768377_4770156_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_001016602.1|4770195_4770675_-	xanthine dehydrogenase iron sulfur-binding subunit XdhC	NA	NA	NA	NA	NA
WP_000459171.1|4770671_4771550_-	xanthine dehydrogenase FAD-binding subunit XdhB	NA	NA	NA	NA	NA
WP_000388142.1|4771560_4773858_-	xanthine dehydrogenase molybdenum-binding subunit XdhA	NA	NA	NA	NA	NA
WP_001272558.1|4774272_4775028_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
WP_105242071.1|4775978_4777141_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_001389254.1|4777187_4777757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254932.1|4780030_4781182_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000656006.1|4782190_4783372_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_000383234.1|4783657_4784494_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_000603506.1|4784523_4785285_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	4.5e-19
WP_000256438.1|4785569_4786988_+	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000848640.1|4787116_4787809_+	amino acid racemase	NA	NA	NA	NA	NA
WP_000741828.1|4787795_4788731_-	DNA-binding transcriptional regulator LysR	NA	NA	NA	NA	NA
WP_001120738.1|4788852_4790115_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_000201037.1|4790121_4791153_-	HTH-type transcriptional regulator GalR	NA	NA	NA	NA	NA
WP_000899069.1|4791738_4793898_+	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	NA	NA	NA	NA
WP_000004632.1|4793890_4795084_+	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
WP_001199296.1|4795115_4796156_-	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_000758655.1|4796263_4796482_-	lipoprotein YgdR	NA	NA	NA	NA	NA
WP_000895624.1|4796619_4797333_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_000082185.1|4797401_4798091_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564489.1|4798775_4799306_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957911.1|4799318_4801565_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000204658.1|4801715_4802591_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816232.1|4802597_4803392_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_069934407.1|4803576_4804047_+	prepilin peptidase-dependent protein	NA	NA	NA	NA	NA
WP_001144322.1|4804037_4804601_+	prepilin peptidase-dependent protein	NA	NA	NA	NA	NA
WP_001078393.1|4804597_4805005_+	DUF2509 family protein	NA	NA	NA	NA	NA
WP_001276460.1|4804989_4805313_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_000946879.1|4805325_4808694_+	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_001138155.1|4808869_4811758_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	4.0e-68
WP_005013367.1|4811750_4815293_+	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	22.6	1.5e-11
WP_000775959.1|4815292_4817119_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.7	7.8e-25
WP_000237957.1|4817180_4818512_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000016907.1|4818743_4819997_+	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000106969.1|4821557_4821986_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000484011.1|4821989_4822526_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000342480.1|4823548_4825309_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000217701.1|4825548_4826016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000177780.1|4827223_4828147_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_005013338.1|4828298_4831373_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_001202356.1|4831429_4832047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005010277.1|4832150_4833497_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000514034.1|4833600_4834296_-	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	95.2	2.4e-128
WP_038348398.1|4834246_4834432_-	Com family DNA-binding transcriptional regulator	NA	A0A0C4UQS3	Shigella_phage	71.0	2.9e-20
WP_001135846.1|4835132_4836539_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q8W611	Enterobacteria_phage	44.2	9.5e-39
WP_000423347.1|4836525_4837056_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	68.2	8.4e-65
WP_004996298.1|4837070_4837988_-	hypothetical protein	NA	Q71TP5	Escherichia_phage	44.9	3.7e-44
WP_004996284.1|4839253_4839376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105242074.1|4839477_4840452_-|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	50.6	3.8e-79
WP_000206060.1|4840441_4840894_-	phage GP46 family protein	NA	A0A2I7S9F0	Vibrio_phage	42.1	1.7e-21
WP_000523894.1|4840890_4841427_-|plate	phage baseplate assembly protein	plate	M4MCP6	Vibrio_phage	40.7	1.6e-26
WP_000213600.1|4842486_4843761_-	DNA circularization N-terminal domain-containing protein	NA	A0A2I7S9E8	Vibrio_phage	39.9	1.3e-79
WP_000190544.1|4843760_4845605_-	hypothetical protein	NA	M4MHE6	Vibrio_phage	43.1	4.5e-89
WP_000729653.1|4845691_4846087_-|tail	phage tail assembly protein	tail	A0A0C4UR03	Shigella_phage	44.5	1.2e-12
WP_001062747.1|4846088_4846445_-|tail	phage tail tube protein	tail	A0A2P1A4D6	Alteromonadaceae_phage	35.5	2.3e-13
WP_000052047.1|4846454_4847930_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1Q565	Vibrio_phage	55.3	6.0e-153
WP_000435846.1|4847929_4848115_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_000139650.1|4848095_4848707_-	hypothetical protein	NA	M1PJ94	Vibrio_phage	44.9	5.6e-36
WP_000513059.1|4848703_4849246_-	phage virion morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	62.0	8.7e-57
WP_000540585.1|4849245_4849683_-	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	49.0	2.4e-33
WP_000763187.1|4849682_4849907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000631725.1|4851598_4851946_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_004967157.1|4851942_4852617_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
WP_086021050.1|4852913_4853758_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	4.4e-23
WP_005000753.1|4853821_4854163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145238.1|4854181_4854439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105242075.1|4854693_4855608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000063937.1|4855692_4856406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000147335.1|4858919_4861565_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.7e-97
WP_000997071.1|4861755_4862247_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_039072487.1|4862304_4863957_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000712309.1|4863969_4864635_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_105242076.1|4865975_4867514_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004968663.1|4867572_4868073_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000678644.1|4869100_4870198_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000117739.1|4870436_4871243_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.9	7.6e-17
>prophage 31
NZ_CP027027	Shigella dysenteriae strain E670/74 chromosome, complete genome	5036586	4913814	4981479	5036586	tRNA,transposase	uncultured_Mediterranean_phage(15.38%)	57	NA	NA
WP_004998488.1|4913814_4914846_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_000039697.1|4915018_4916497_-	sugar kinase	NA	NA	NA	NA	NA
WP_001164540.1|4916523_4917801_-	MFS transporter	NA	NA	NA	NA	NA
WP_105242078.1|4918119_4918905_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	1.4e-20
WP_000059293.1|4918974_4920429_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_000147674.1|4920450_4921860_+	MFS transporter	NA	NA	NA	NA	NA
WP_005010860.1|4921837_4922617_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_001130266.1|4923621_4924197_-	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_000109520.1|4924213_4924474_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_005000825.1|4924464_4925736_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000108297.1|4925813_4926176_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_000211953.1|4926494_4928294_+	NADPH-dependent assimilatory sulfite reductase flavoprotein subunit	NA	NA	NA	NA	NA
WP_001290727.1|4928293_4930006_+	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_000039835.1|4930079_4930814_+	phosphoadenosine phosphosulfate reductase	NA	NA	NA	NA	NA
WP_000956458.1|4931078_4931231_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000142534.1|4931468_4934126_+	CRISPR-associated helicase/endonuclease Cas3	NA	A0A2R2ZGW0	Clostridioides_phage	24.1	4.0e-06
WP_005000855.1|4934223_4935786_+	type I-E CRISPR-associated protein Cse1/CasA	NA	NA	NA	NA	NA
WP_000029321.1|4935782_4936322_+	type I-E CRISPR-associated protein Cse2/CasB	NA	NA	NA	NA	NA
WP_000206410.1|4936333_4937389_+	type I-E CRISPR-associated protein Cas7/Cse4/CasC	NA	NA	NA	NA	NA
WP_000085076.1|4937399_4938146_+	type I-E CRISPR-associated protein Cas5/CasD	NA	NA	NA	NA	NA
WP_000281426.1|4938127_4938778_+	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
WP_000144880.1|4938774_4939695_+	type I-E CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_000063176.1|4939694_4939988_+	type I-E CRISPR-associated endoribonuclease Cas2	NA	NA	NA	NA	NA
WP_000490393.1|4940439_4941477_-	alkaline phosphatase isozyme conversion aminopeptidase	NA	NA	NA	NA	NA
WP_086021023.1|4941612_4942457_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	4.4e-23
WP_000372390.1|4942646_4943555_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_001090358.1|4943556_4944984_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
WP_001173674.1|4944983_4945589_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	7.2e-28
WP_001246104.1|4945638_4945962_+	DUF3561 family protein	NA	NA	NA	NA	NA
WP_000517474.1|4946155_4946467_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_000246143.1|4946485_4947196_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001254932.1|4947730_4948882_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000568963.1|4948894_4949944_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_001295182.1|4949924_4950686_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254709.1|4950679_4951306_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	7.5e-36
WP_001272570.1|4951445_4952585_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_001208073.1|4953759_4954167_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000767718.1|4954313_4954907_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_000863192.1|4954906_4956334_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_000562982.1|4956344_4956581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000104422.1|4956619_4957984_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136925.1|4958072_4958849_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|4958853_4959492_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590383.1|4959488_4960751_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	6.3e-135
WP_001121440.1|4961159_4962191_-|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
WP_105242100.1|4962383_4963611_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_005000674.1|4964650_4966570_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_000838431.1|4966569_4967058_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000012163.1|4967093_4968461_-	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_001299798.1|4968496_4969813_-	guanine deaminase	NA	NA	NA	NA	NA
WP_105242079.1|4969830_4971231_-	xanthine/proton symporter XanQ	NA	NA	NA	NA	NA
WP_105242080.1|4971395_4974266_-	molybdopterin-dependent oxidoreductase Mo/Fe-S-binding subunit	NA	NA	NA	NA	NA
WP_000572475.1|4974262_4975042_-	molybdopterin-dependent oxidoreductase FAD-binding subunit	NA	NA	NA	NA	NA
WP_105242081.1|4975116_4976421_-	putative aminohydrolase SsnA	NA	NA	NA	NA	NA
WP_105242082.1|4976423_4979522_-	putative selenate reductase subunit YgfK	NA	NA	NA	NA	NA
WP_042769825.1|4979842_4980331_-	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_001121440.1|4980447_4981479_+|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP027028	Shigella dysenteriae strain E670/74 plasmid unnamed, complete sequence	149179	11749	65092	149179	transposase,protease	Staphylococcus_phage(30.0%)	41	NA	NA
WP_001121440.1|11749_12781_-|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
WP_000620627.1|13133_13661_-	type III secretion apparatus protein OrgA/MxiK	NA	NA	NA	NA	NA
WP_000621941.1|13657_14383_-	SctJ family type III secretion inner membrane ring lipoprotein Mxi	NA	NA	NA	NA	NA
WP_001106821.1|14388_14682_-	type III secretion system inner rod protein MxiI	NA	NA	NA	NA	NA
WP_032359554.1|14694_14946_-	type III secretion system needle filament protein MxiH	NA	NA	NA	NA	NA
WP_105242106.1|14953_16069_-	type III secretion system protein MxiG	NA	NA	NA	NA	NA
WP_000086110.1|16077_16536_-	type III secretion system lytic transglycosylase IpgF	NA	NA	NA	NA	NA
WP_000389733.1|16535_16898_-	type III secretion system chaperone IpgE	NA	NA	NA	NA	NA
WP_000548327.1|16907_18524_-	type III secretion system effector inositol phosphate phosphatase	NA	NA	NA	NA	NA
WP_000601047.1|18837_20322_+	type III secretion system effector IcsB	NA	NA	NA	NA	NA
WP_010921664.1|20334_20724_+	type III secretion system chaperone IpgA	NA	NA	NA	NA	NA
WP_001166528.1|20739_21366_+	type III secretion effector IpgB1	NA	NA	NA	NA	NA
WP_000055835.1|21423_21891_+	SycD/LcrH family type III secretion system chaperone IpgC	NA	NA	NA	NA	NA
WP_000552049.1|21896_23639_+	type III secretion system translocon subunit IpaB	NA	NA	NA	NA	NA
WP_000405476.1|23658_24750_+	T3SS translocon subunit IpaC	NA	NA	NA	NA	NA
WP_105242107.1|24800_25799_+	type III secretion system needle tip complex protein IpaD	NA	NA	NA	NA	NA
WP_000588811.1|27711_27948_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_000227976.1|28164_29094_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	42.6	1.4e-51
WP_005059304.1|30039_30819_-|protease	type III secretion system effector cysteine protease IpaJ	protease	NA	NA	NA	NA
WP_001102512.1|31418_31556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000255972.1|32171_33176_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.1	5.3e-185
WP_005012122.1|33366_34563_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001254932.1|35749_36901_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_105242108.1|37508_38963_-	T3SS effector OspC family protein	NA	NA	NA	NA	NA
WP_001088287.1|39330_40005_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.1	5.8e-10
WP_000631725.1|40001_40349_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_032336446.1|42179_42344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011114751.1|43245_43530_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_000501969.1|43517_44003_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001254932.1|44896_46048_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000850660.1|49186_49927_-	PAP2 family phosphatase PhoN2	NA	A0A1B1IUP6	uncultured_Mediterranean_phage	28.9	2.6e-11
WP_001046939.1|50255_51122_-	type 3 secretion system effector OspB	NA	A0A0P0ZCT1	Stx2-converting_phage	32.7	9.4e-29
WP_005000190.1|52668_53616_-|protease	omptin family outer membrane protease IcsP	protease	NA	NA	NA	NA
WP_038341698.1|55204_55861_+	type III secretion system effector cysteine methyltransferase OspZ	NA	NA	NA	NA	NA
WP_000957853.1|57319_57508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105242110.1|57517_58717_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001254932.1|59940_61092_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000405248.1|61429_61912_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_075330081.1|61902_62205_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_000019158.1|62476_62749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088895425.1|63863_65092_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
