The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026580	Escherichia coli strain WCHEC005237 chromosome, complete genome	4833062	1117626	1130809	4833062		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1117626_1118388_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1118381_1119008_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1119147_1120287_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1120349_1121342_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|1121435_1122800_-	permease	NA	NA	NA	NA	NA
WP_001136934.1|1122888_1123665_-	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_001278994.1|1123669_1124308_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|1124304_1125567_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847984.1|1125563_1126472_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	5.1e-118
WP_001300386.1|1126667_1127435_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|1127485_1128142_-	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_039023140.1|1128247_1130809_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
NZ_CP026580	Escherichia coli strain WCHEC005237 chromosome, complete genome	4833062	1733692	1743135	4833062		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569343.1|1733692_1734619_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
WP_000783134.1|1734623_1735355_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001216963.1|1735335_1735443_-	membrane protein	NA	NA	NA	NA	NA
WP_001240398.1|1735502_1736234_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001295431.1|1736455_1738141_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001308766.1|1738137_1738857_+	two-component system response regulator YehT	NA	NA	NA	NA	NA
WP_001551352.1|1738903_1739374_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
WP_001295429.1|1739415_1739877_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001551351.1|1740001_1742002_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001551350.1|1741998_1743135_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	5.0e-163
>prophage 3
NZ_CP026580	Escherichia coli strain WCHEC005237 chromosome, complete genome	4833062	1809275	1872622	4833062	transposase	Stx2-converting_phage(26.67%)	54	NA	NA
WP_039023277.1|1809275_1810472_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001295424.1|1811233_1811875_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234767.1|1811966_1812548_+	deoxycytidine triphosphate deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001252306.1|1812569_1814423_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001178345.1|1814874_1817565_-	CBS domain-containing protein	NA	A0A0R6PEZ3	Moraxella_phage	43.5	5.5e-35
WP_024189503.1|1818317_1819208_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.3	9.6e-45
WP_062914723.1|1820386_1821538_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	1.5e-42
WP_033873442.1|1821494_1821863_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_062914722.1|1823299_1824733_+	capsule assembly Wzi family protein	NA	NA	NA	NA	NA
WP_020801619.1|1824878_1826012_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_020801645.1|1826018_1826450_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_062914721.1|1826468_1828640_+	tyrosine protein kinase	NA	NA	NA	NA	NA
WP_062914720.1|1829499_1830450_+	polysaccharide pyruvyl transferase	NA	NA	NA	NA	NA
WP_020801659.1|1830453_1831620_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_062914719.1|1831630_1832785_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_062914718.1|1832741_1834034_+	O-antigen ligase	NA	NA	NA	NA	NA
WP_062914717.1|1834033_1835122_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_020801633.1|1835133_1836303_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_062914716.1|1836312_1837080_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_062914715.1|1837100_1838849_+	pectate lyase superfamily protein	NA	A0A0A8J9B0	Klebsiella_phage	33.0	7.6e-54
WP_062914714.1|1838856_1839810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062914713.1|1840028_1841426_+	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_062914712.1|1841592_1842999_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	8.0e-38
WP_062914711.1|1843226_1844642_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.6	5.8e-52
WP_049284001.1|1844664_1846035_+	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	25.6	9.3e-31
WP_000704906.1|1846198_1847365_+	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	53.7	1.8e-112
WP_000954831.1|1849154_1849763_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_000880176.1|1849756_1850533_-	imidazole glycerol phosphate synthase cyclase subunit	NA	NA	NA	NA	NA
WP_000586445.1|1850514_1851252_-	1-(5-phosphoribosyl)-5-((5- phosphoribosylamino)methylideneamino)imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_001103561.1|1851251_1851842_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_046464156.1|1851841_1852909_-	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_000108945.1|1852908_1853979_-	histidinol-phosphate aminotransferase	NA	NA	NA	NA	NA
WP_001446927.1|1853975_1855280_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_032329340.1|1855285_1856185_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
WP_001364200.1|1856330_1856381_-	his operon leader peptide	NA	NA	NA	NA	NA
WP_001259255.1|1856664_1856916_+	antitoxin YefM	NA	NA	NA	NA	NA
WP_000767829.1|1856912_1857167_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_000754749.1|1857249_1858074_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000803351.1|1858119_1859049_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010723108.1|1859263_1859326_+	membrane protein YoeI	NA	NA	NA	NA	NA
WP_000019197.1|1859315_1860674_+	low-affinity putrescine importer PlaP	NA	NA	NA	NA	NA
WP_000492321.1|1860852_1861911_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_000985273.1|1861924_1862152_+	membrane protein	NA	NA	NA	NA	NA
WP_000980567.1|1862194_1863622_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_001310935.1|1863830_1864997_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.0	1.5e-226
WP_000343760.1|1865123_1866344_-|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_001105393.1|1866439_1866913_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_057109539.1|1867110_1868169_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|1868340_1868670_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016348.1|1868770_1868953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001445118.1|1869406_1869796_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000839179.1|1870289_1870694_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|1870690_1871038_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001333339.1|1871086_1872622_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
>prophage 4
NZ_CP026580	Escherichia coli strain WCHEC005237 chromosome, complete genome	4833062	2710430	2766472	4833062	portal,terminase,holin,tail,integrase,tRNA,head,capsid	Escherichia_phage(43.48%)	68	2718622:2718636	2766574:2766588
WP_001297484.1|2710430_2711537_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|2711572_2712214_+	lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423742.1|2712217_2713588_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001265471.1|2713756_2714428_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|2714427_2715888_+	sensor protein PhoQ	NA	NA	NA	NA	NA
WP_000456506.1|2715963_2717085_+	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
WP_000359434.1|2717133_2718360_-	peptidase T	NA	NA	NA	NA	NA
WP_001299275.1|2718415_2718631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000531594.1|2718609_2719746_+	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
2718622:2718636	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799406.1|2719729_2720593_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_041983107.1|2721189_2721816_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001309429.1|2721760_2721898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042047081.1|2722053_2722584_-	chaperone of endosialidase	NA	A0A2D1UII2	Escherichia_phage	85.2	2.5e-69
WP_032143699.1|2723317_2723689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000587127.1|2723982_2725506_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
WP_001233546.1|2729459_2730059_-	hypothetical protein	NA	H6WZM8	Escherichia_phage	95.0	1.6e-107
WP_000515345.1|2730126_2733606_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_072199988.1|2733666_2734314_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.4	2.6e-108
WP_001333568.1|2734211_2734955_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	4.5e-149
WP_001152457.1|2734960_2735659_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	3.4e-130
WP_001330090.1|2735658_2736015_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_000224003.1|2735992_2739220_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
WP_077253127.1|2739266_2739527_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	95.3	2.3e-39
WP_001324129.1|2739568_2739955_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_000097535.1|2739954_2740659_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	92.7	1.4e-112
WP_001206700.1|2740719_2741064_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	5.1e-55
WP_000968644.1|2741060_2741510_-	hypothetical protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001147814.1|2741506_2741845_-|head,tail	head-tail adaptor protein	head,tail	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719064.1|2741853_2742171_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	5.3e-22
WP_000766109.1|2742247_2743465_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000923134.1|2744070_2745297_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
WP_001140892.1|2745444_2747202_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_001333563.1|2747201_2747684_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001135104.1|2747831_2748182_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	8.0e-64
WP_071586179.1|2748474_2748615_-	Rz1 lytic protein	NA	U5P461	Shigella_phage	84.6	1.0e-09
WP_000738421.1|2748707_2749001_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_075202333.1|2749091_2749274_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_075202332.1|2749326_2749554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000992097.1|2749490_2750024_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
WP_000193264.1|2750087_2750438_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000372595.1|2750442_2750658_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_001333561.1|2750807_2750969_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	87.0	5.9e-14
WP_000874243.1|2750965_2751154_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001333560.1|2751414_2751750_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
WP_001333559.1|2751820_2752033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106104550.1|2752521_2752608_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_000762879.1|2753002_2753824_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
WP_000139999.1|2753820_2754201_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
WP_001221526.1|2754201_2755260_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
WP_032155008.1|2755261_2755540_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001013636.1|2755707_2755920_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_000786213.1|2756122_2756302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001224662.1|2756954_2757137_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000403785.1|2757230_2757587_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001151150.1|2757644_2758067_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_001262390.1|2758107_2759178_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_000693850.1|2759249_2759675_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|2759658_2759901_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_014639888.1|2760106_2760631_+	LexA family transcriptional repressor	NA	H9C160	Pectobacterium_phage	28.0	2.2e-12
WP_032159761.1|2760842_2761001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042046576.1|2760984_2761284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|2761355_2761574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014640381.1|2761538_2761793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|2762142_2762331_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070255.1|2762327_2762519_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102136.1|2762612_2765054_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
WP_000003742.1|2765115_2765385_+	excisionase	NA	NA	NA	NA	NA
WP_000074971.1|2765353_2766472_+|integrase	integrase	integrase	Q77Z04	Phage_21	44.4	1.6e-84
2766574:2766588	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 5
NZ_CP026580	Escherichia coli strain WCHEC005237 chromosome, complete genome	4833062	3704564	3759038	4833062	portal,terminase,tail,integrase,lysis,transposase	Enterobacteria_phage(39.62%)	68	3699733:3699781	3744502:3744550
3699733:3699781	attL	AAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_072240810.1|3704564_3704693_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.6	1.7e-11
WP_086708942.1|3704747_3708506_-	peptidase S74	NA	A0A2D1UII2	Escherichia_phage	93.4	0.0e+00
WP_001230375.1|3708570_3709170_-	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	5.7e-110
WP_039023163.1|3709239_3712737_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.0	0.0e+00
WP_032158484.1|3712797_3713445_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.3	6.2e-110
WP_032151194.1|3713342_3714086_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	2.3e-148
WP_001152385.1|3714091_3714790_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_039023164.1|3714799_3715129_-|tail	tail protein	tail	A5LH39	Enterobacteria_phage	99.1	1.7e-60
WP_039023165.1|3715128_3718194_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.2	0.0e+00
WP_001161009.1|3718165_3718495_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3718503_3718890_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_021560209.1|3718950_3719694_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	99.2	2.3e-132
WP_001079419.1|3719704_3720106_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_023140704.1|3720102_3720681_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
WP_001283153.1|3720692_3720968_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_075209601.1|3720960_3721329_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	99.1	9.7e-52
WP_072240803.1|3721370_3723494_-	peptidase S14	NA	A0A291AWT6	Escherichia_phage	99.4	0.0e+00
WP_052249886.1|3723381_3724851_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	3.1e-282
WP_001072975.1|3724850_3725063_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_025670557.1|3725059_3727162_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.1	0.0e+00
WP_000349509.1|3727161_3727653_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_021512737.1|3728328_3728481_-	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	98.0	4.7e-21
WP_001341210.1|3728468_3728936_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
WP_001135250.1|3728932_3729430_-	lysozyme	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_000839596.1|3729429_3729645_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799656.1|3729712_3730765_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000917724.1|3730915_3731119_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_001446998.1|3731387_3732329_+	hypothetical protein	NA	A5LH79	Enterobacteria_phage	44.2	5.0e-68
WP_001208502.1|3732350_3732800_+	hypothetical protein	NA	A5LH78	Enterobacteria_phage	43.8	8.0e-24
WP_085949407.1|3732835_3733204_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	87.5	9.4e-55
WP_039023166.1|3733218_3734208_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	7.5e-192
WP_024227971.1|3734215_3735025_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	98.1	1.4e-148
WP_000767113.1|3735044_3735434_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210170.1|3735430_3735757_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_001377816.1|3735753_3736407_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	8.1e-126
WP_001393497.1|3736406_3736901_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_039023167.1|3736897_3737884_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	87.8	1.4e-134
WP_001250272.1|3737873_3738053_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_032198019.1|3738228_3738780_-	hypothetical protein	NA	U5P4K1	Shigella_phage	98.9	3.8e-100
WP_032198020.1|3738772_3739033_-	XRE family transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	98.8	7.1e-41
WP_001347307.1|3739004_3739157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001020632.1|3739130_3739823_+	XRE family transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	6.4e-121
WP_001323606.1|3739878_3740157_+	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	97.4	3.0e-13
WP_032142136.1|3740258_3740453_-	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	98.4	2.5e-30
WP_000135680.1|3740525_3740888_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081287.1|3740953_3741778_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008200.1|3741905_3742442_+	HD family hydrolase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_001242749.1|3742432_3742795_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206737.1|3742794_3743100_+	hypothetical protein	NA	U5P0J0	Shigella_phage	98.0	5.8e-50
WP_000433939.1|3743099_3743450_+	DNA-binding protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
WP_077783063.1|3743551_3744490_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	98.7	3.3e-181
WP_000893278.1|3744694_3745948_-	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
3744502:3744550	attR	AAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|3745959_3747063_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_039023169.1|3747350_3748406_+	outer membrane pore protein E	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
WP_000174677.1|3748444_3748846_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189532.1|3748903_3750148_-	esterase	NA	NA	NA	NA	NA
WP_001291990.1|3750239_3750698_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001292994.1|3750958_3752416_+	aminoacyl-histidine dipeptidase	NA	NA	NA	NA	NA
WP_001326471.1|3752472_3753009_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001295202.1|3752941_3753208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077248235.1|3753194_3753392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001059892.1|3753513_3753966_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263489.1|3753975_3754374_-	mRNA interferase YafO	NA	NA	NA	NA	NA
WP_000554758.1|3754376_3754670_-	antitoxin YafN	NA	NA	NA	NA	NA
WP_001226164.1|3754721_3755777_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001333407.1|3755847_3756618_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001334802.1|3756577_3758317_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_000006255.1|3758540_3759038_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP026580	Escherichia coli strain WCHEC005237 chromosome, complete genome	4833062	4570713	4610823	4833062	portal,terminase,holin,tail,plate,capsid,integrase,head,lysis,transposase	Escherichia_phage(53.19%)	49	4567589:4567603	4610905:4610919
4567589:4567603	attL	TGTAGGCCTGATAAG	NA	NA	NA	NA
WP_085947770.1|4570713_4572083_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_000035493.1|4572155_4572410_-	DNA-binding transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
WP_000882940.1|4572455_4573619_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.8e-206
WP_000978889.1|4573618_4574098_-|tail	tail assembly protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000069960.1|4574112_4576560_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.2	0.0e+00
WP_000785970.1|4576552_4576672_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031307.1|4576704_4576980_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251408.1|4577036_4577555_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_094885522.1|4577567_4578758_-|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.4e-224
WP_062914736.1|4578817_4579420_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	95.3	3.5e-99
WP_001333339.1|4579427_4580963_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
WP_000612626.1|4581011_4581359_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|4581355_4581760_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001333405.1|4581901_4582417_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	56.8	5.0e-46
WP_024176421.1|4582431_4583034_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	75.5	2.5e-81
WP_001032315.1|4583005_4583422_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	46.0	3.4e-21
WP_001285346.1|4584716_4585328_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	1.4e-116
WP_001121501.1|4585320_4586229_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	3.7e-161
WP_000127167.1|4586233_4586581_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	3.8e-58
WP_001093698.1|4586577_4587213_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.5e-111
WP_001001770.1|4587279_4587732_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	97.3	4.5e-75
WP_000917160.1|4587724_4588192_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	3.3e-81
WP_001440152.1|4588154_4588328_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000040631.1|4588299_4588725_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	94.3	1.3e-63
WP_000736582.1|4588712_4589138_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	92.9	3.7e-55
WP_001144097.1|4589152_4589650_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.5e-92
WP_000123123.1|4589649_4589931_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846414.1|4589934_4590138_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	2.6e-30
WP_000988633.1|4590137_4590647_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_024176422.1|4590746_4591490_-|terminase	terminase	terminase	Q94MJ2	Enterobacteria_phage	96.4	4.6e-125
WP_001248567.1|4591493_4592567_-|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	98.9	2.2e-200
WP_001085956.1|4592625_4593480_-|capsid	capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.6	1.7e-136
WP_000156872.1|4593653_4595426_+|terminase	terminase	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_000038166.1|4595425_4596460_+|portal	phage portal protein	portal	U5N087	Enterobacteria_phage	99.1	1.6e-200
WP_001333402.1|4596498_4596708_-	hypothetical protein	NA	M1TAP7	Escherichia_phage	83.0	2.7e-14
WP_000012516.1|4596831_4599315_+	helicase	NA	NA	NA	NA	NA
WP_001016257.1|4600632_4601379_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_002431311.1|4601393_4602935_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
WP_000027659.1|4604409_4604685_-	hypothetical protein	NA	A0A0F7LCM4	Escherichia_phage	100.0	2.3e-45
WP_001113270.1|4604681_4604906_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_001277952.1|4604905_4605208_-	hypothetical protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	2.5e-45
WP_000557703.1|4605207_4605432_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217670.1|4605495_4605996_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001308179.1|4606165_4606438_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|4606574_4606868_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985246.1|4606937_4607918_+|integrase	integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_001223800.1|4608104_4608605_-	periplasmic protein CpxP	NA	NA	NA	NA	NA
WP_001033722.1|4608754_4609453_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|4609449_4610823_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
4610905:4610919	attR	CTTATCAGGCCTACA	NA	NA	NA	NA
>prophage 1
NZ_CP026578	Escherichia coli strain WCHEC005237 plasmid pQnrS1_005237, complete sequence	121908	3356	87214	121908	integrase,transposase	Escherichia_phage(39.29%)	57	NA	NA
WP_072178240.1|3356_4433_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	1.8e-42
WP_085948178.1|4504_5717_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_072851607.1|6061_7927_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_104732850.1|8888_9089_-	hypothetical protein	NA	A0A2L1IV26	Escherichia_phage	96.2	2.6e-06
WP_072132356.1|10292_10574_-	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_000777276.1|10801_11905_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_000357807.1|11908_12616_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000880884.1|12622_14275_-	membrane protein	NA	NA	NA	NA	NA
WP_072132360.1|14492_17846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094885491.1|17845_24160_+	DUF1998 domain-containing protein	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	21.5	1.4e-36
WP_072095798.1|24410_27242_+	DEAD/DEAH box helicase	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	25.2	1.4e-41
WP_094885493.1|27244_32155_+	class I SAM-dependent DNA methyltransferase	NA	A0A2R2ZGH5	Clostridioides_phage	34.3	4.0e-07
WP_094885495.1|32154_38496_+	DUF1998 domain-containing protein	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.3	4.9e-58
WP_094885497.1|38492_40607_+	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	23.5	1.2e-05
WP_072851570.1|42826_43855_+|integrase	integrase	integrase	Q5XLQ5	Enterobacteria_phage	42.4	3.8e-61
WP_104732851.1|43826_44009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024166788.1|44092_44473_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	90.3	1.8e-56
WP_033545779.1|44472_44694_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	98.6	1.5e-31
WP_000506718.1|44766_45159_-	hypothetical protein	NA	Q1MVE7	Enterobacteria_phage	76.2	2.1e-52
WP_001286530.1|45270_45519_-	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	85.4	2.8e-31
WP_001408980.1|45521_45722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107524640.1|46144_46285_-	DUF4752 family protein	NA	NA	NA	NA	NA
WP_001067855.1|46275_46980_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001039463.1|49845_50232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000861580.1|50240_50432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072851586.1|50509_53449_+	DUF4145 domain-containing protein	NA	A0A2K9L5A2	Tupanvirus	23.8	9.9e-22
WP_072851583.1|53445_54870_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_001118619.1|55101_56025_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
WP_104732852.1|56296_56554_+	hypothetical protein	NA	A0A222YWE3	Escherichia_phage	100.0	1.8e-41
WP_001351729.1|59024_59417_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|59554_60439_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|60470_61670_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_021536379.1|61748_62426_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000844627.1|62457_62700_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012477564.1|62817_63408_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_001493762.1|63544_64117_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_001493761.1|64153_65545_+|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_001516695.1|66324_66981_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001067855.1|68058_68763_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004201280.1|69976_70450_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001067855.1|70696_71401_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_094885533.1|71595_71979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001143775.1|71980_74986_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.3	0.0e+00
WP_001235713.1|75147_75705_+|transposase	transposase	transposase	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|75887_76748_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001161490.1|77122_77683_+|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_015058874.1|77686_78283_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	85.1	4.7e-64
WP_021536379.1|78314_78992_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000804063.1|79070_80270_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001255015.1|80536_80842_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214121.1|80869_82084_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.3	8.0e-18
WP_001447541.1|82300_83185_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001120888.1|83215_84709_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000743213.1|84919_85144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|85140_85878_-	resolvase	NA	NA	NA	NA	NA
WP_001550559.1|85984_86476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|86509_87214_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP026578	Escherichia coli strain WCHEC005237 plasmid pQnrS1_005237, complete sequence	121908	112854	121168	121908		Macacine_betaherpesvirus(33.33%)	10	NA	NA
WP_072851528.1|112854_113382_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	38.8	1.7e-20
WP_001776120.1|113412_113844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077252056.1|114323_115289_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.7	9.7e-59
WP_001776124.1|115740_116166_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	50.4	2.9e-31
WP_072851522.1|116165_117437_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.7	7.3e-155
WP_000181753.1|117515_117767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000534920.1|117820_118126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072851519.1|118596_118926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000817037.1|119030_120002_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	89.7	1.7e-156
WP_063501643.1|120001_121168_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	3.4e-223
>prophage 1
NZ_CP026579	Escherichia coli strain WCHEC005237 plasmid pRmtB1_005237, complete sequence	100229	2223	55205	100229	integrase,protease,transposase	Escherichia_phage(20.0%)	52	NA	NA
WP_001067855.1|2223_2928_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_086528360.1|2933_3341_+	resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	1.0e-57
WP_000027057.1|3523_4384_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_012372818.1|4553_5309_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_000050481.1|5901_7443_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|7847_8687_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|8680_9028_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749984.1|9144_9990_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA16	NA	NA	NA	NA	NA
WP_001749985.1|10170_10644_-	trimethoprim-resistant dihydrofolate reductase DfrA27	NA	G3MBI7	Bacillus_virus	29.1	1.4e-15
WP_001749986.1|10776_11229_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_063840321.1|11325_11880_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_000845048.1|12171_13185_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004193519.1|13123_13738_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001161490.1|13913_14474_+|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_041937891.1|15492_15738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021536379.1|15769_16447_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000804064.1|16525_17725_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|17756_18641_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|18778_19171_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_001262767.1|21140_22913_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_012602142.1|23096_23201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012602143.1|23197_23662_-	Plasmid stable inheritance protein	NA	NA	NA	NA	NA
WP_000616807.1|23881_24535_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_071811807.1|24724_25111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077251667.1|25473_26343_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001365705.1|26323_26398_-	positive regulator of RepFIC repA1 expression	NA	NA	NA	NA	NA
WP_072652180.1|26507_26591_+	replication protein RepA	NA	NA	NA	NA	NA
WP_000083830.1|26634_26889_-	replication regulatory protein repA2	NA	NA	NA	NA	NA
WP_063101963.1|27128_27719_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_072652178.1|28011_28473_-	endonuclease	NA	A0A0R6PHV6	Moraxella_phage	37.9	9.4e-20
WP_072652177.1|28714_28927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000139345.1|29057_29618_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_001825166.1|29672_30419_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.6	1.6e-08
WP_072652176.1|30438_35709_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_072652175.1|35708_37880_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_077248519.1|37930_38737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012602147.1|38873_39608_-	conjugal transfer protein TraT	NA	NA	NA	NA	NA
WP_000605868.1|39653_40139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021532658.1|42972_44346_-	conjugal transfer pilus assembly protein TraH	NA	NA	NA	NA	NA
WP_071587080.1|44345_44708_-	conjugal transfer protein TrbJ	NA	NA	NA	NA	NA
WP_044804936.1|44637_45183_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_000549795.1|45169_45451_-	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
WP_077251666.1|45566_46340_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_104732853.1|46302_46563_-	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_072652173.1|46586_48437_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_000777692.1|48433_49072_-	periplasmic protein TrbC	NA	NA	NA	NA	NA
WP_000830839.1|49080_50073_-	conjugal transfer protein TraU	NA	NA	NA	NA	NA
WP_001203720.1|50069_50702_-	protein TraW	NA	NA	NA	NA	NA
WP_000214096.1|50698_51085_-	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
WP_000069764.1|51081_53712_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_077251278.1|53837_54026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001118618.1|54281_55205_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	4.9e-177
>prophage 2
NZ_CP026579	Escherichia coli strain WCHEC005237 plasmid pRmtB1_005237, complete sequence	100229	78284	84872	100229		Escherichia_phage(33.33%)	10	NA	NA
WP_000086160.1|78284_78968_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
WP_032155763.1|79043_79349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077250718.1|79352_80324_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_072652239.1|80292_80562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000618110.1|80672_80921_+	protein ImpC	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_000109071.1|80917_81355_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_064198699.1|81354_82626_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.2	3.2e-142
WP_077248911.1|82630_83059_-	plasmid stability protein	NA	NA	NA	NA	NA
WP_001103697.1|83027_83999_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	1.3e-66
WP_000633913.1|84227_84872_+	chromosome partitioning protein ParA	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
