The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026649	Bacillus coagulans strain R11 chromosome, complete genome	3602752	271013	339096	3602752	transposase	Bacillus_phage(30.0%)	55	NA	NA
WP_017551449.1|271013_272189_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	42.6	3.6e-84
WP_158657222.1|273076_273295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014096391.1|273245_275480_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0Y0AS84	Bacillus_phage	61.0	1.0e-260
WP_014096390.1|275464_275947_+	flavodoxin	NA	A0A060AL80	Listeria_phage	36.9	6.2e-14
WP_035182730.1|275891_276935_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A059T7I4	Listeria_phage	56.9	5.8e-110
WP_014096388.1|277257_277872_-	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_014096387.1|277868_278954_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_048339797.1|279222_280152_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014096385.1|280153_280390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014096384.1|280386_280650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014096383.1|280782_281280_+	thioesterase	NA	NA	NA	NA	NA
WP_017550731.1|281336_282353_+	EamA family transporter	NA	NA	NA	NA	NA
WP_014096381.1|282366_282681_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_014096380.1|282680_283022_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_013858187.1|283115_283898_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_014096379.1|284037_285063_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_014096378.1|285062_286109_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_014096377.1|286265_287228_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014096376.1|287556_288372_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.2	1.2e-17
WP_104851101.1|288409_289441_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	26.6	2.9e-21
WP_017550727.1|289580_290219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104851701.1|290647_291268_+	membrane-spanning protein	NA	NA	NA	NA	NA
WP_014096372.1|291260_291848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014096371.1|292232_292952_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_071452296.1|293150_294170_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017550723.1|294357_295602_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_104851102.1|295579_296353_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_017550721.1|298121_298685_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017550720.1|298950_299163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017550719.1|299411_299816_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017550718.1|299858_300917_+	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_017550717.1|301300_302719_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017550714.1|305762_307166_-	peptidase G2	NA	D6R401	Bacillus_phage	47.8	1.3e-99
WP_017550713.1|307335_307641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035182691.1|308162_308888_+	phosphoadenylyl-sulfate reductase	NA	M4W6M9	Bacillus_phage	24.5	5.3e-09
WP_017550710.1|309287_310046_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_035182689.1|310052_310793_+	sirohydrochlorin chelatase	NA	NA	NA	NA	NA
WP_035182685.1|311079_311706_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_035182683.1|311838_312369_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_017550705.1|313977_315081_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_026685144.1|315313_316906_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.5	1.3e-44
WP_026685145.1|317553_318594_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_014096346.1|318885_319110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017550701.1|319232_320162_-	EamA family transporter	NA	NA	NA	NA	NA
WP_035182679.1|320383_321277_+	NERD nuclease	NA	NA	NA	NA	NA
WP_017550699.1|321994_322936_-	cation transporter	NA	NA	NA	NA	NA
WP_017550698.1|323232_325068_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	38.1	4.9e-104
WP_026684855.1|326812_327754_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_035182673.1|328096_329077_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_017550692.1|330669_331314_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_104851104.1|331675_333070_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_061577833.1|333241_334270_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_061577834.1|334326_334896_+	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_104851105.1|335486_336797_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_104851106.1|337758_339096_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP026649	Bacillus coagulans strain R11 chromosome, complete genome	3602752	974650	980835	3602752		Streptococcus_phage(33.33%)	7	NA	NA
WP_014095825.1|974650_975598_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	52.8	7.0e-86
WP_014095823.1|976387_976846_+	8-oxo-dGTP diphosphatase	NA	K4F7D9	Cronobacter_phage	33.3	6.9e-07
WP_104851291.1|976882_977773_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.8	4.3e-05
WP_061086719.1|977769_978750_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	44.6	1.2e-67
WP_013858691.1|978830_979784_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.1	9.2e-54
WP_014095819.1|979894_980164_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_035182139.1|980250_980835_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.0	1.3e-53
>prophage 3
NZ_CP026649	Bacillus coagulans strain R11 chromosome, complete genome	3602752	1583529	1591960	3602752	transposase	Ostreococcus_lucimarinus_virus(16.67%)	9	NA	NA
WP_014098396.1|1583529_1585200_-	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRP3	Ostreococcus_lucimarinus_virus	34.5	9.2e-49
WP_014098395.1|1585265_1585562_-	ATP synthase subunit B	NA	NA	NA	NA	NA
WP_017550823.1|1585658_1586189_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_046721160.1|1586436_1586688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013859272.1|1586836_1587040_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	5.9e-19
WP_104851393.1|1587212_1588262_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	27.8	2.0e-25
WP_046721159.1|1588577_1589225_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	53.0	8.5e-59
WP_013858393.1|1589387_1590611_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	46.5	3.7e-79
WP_046721158.1|1591021_1591960_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	34.3	1.4e-30
>prophage 4
NZ_CP026649	Bacillus coagulans strain R11 chromosome, complete genome	3602752	1770313	1844370	3602752	tail,capsid,head,terminase,portal,tRNA,protease,holin,integrase	Bacillus_phage(27.27%)	78	1772306:1772365	1808184:1808282
WP_014098215.1|1770313_1770967_-	recombinase family protein	NA	D7RWL2	Brochothrix_phage	25.3	3.2e-05
WP_014098214.1|1770963_1771302_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014098213.1|1771508_1772129_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.3	2.5e-15
1772306:1772365	attL	ACAAAAACCCCTCAAAGCCTTACGCTTCAAGGGGTTTCTTGCTTAATACATTTCGATATA	NA	NA	NA	NA
WP_104851413.1|1772578_1773295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052042174.1|1773399_1774239_-	LysM peptidoglycan-binding domain-containing protein	NA	Q5ILA1	Bacillus_phage	29.8	4.8e-14
WP_035184862.1|1774293_1774527_-|holin	phage holin	holin	M4ZR48	Bacillus_phage	67.5	3.9e-22
WP_035184860.1|1774544_1774802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035184794.1|1774935_1775190_-	hypothetical protein	NA	A0A2H4J8H2	uncultured_Caudovirales_phage	41.5	5.5e-06
WP_035184791.1|1775430_1775721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035184789.1|1775736_1776465_-	hypothetical protein	NA	A0A2P0ZL22	Lactobacillus_phage	38.2	4.8e-34
WP_052042170.1|1776474_1777944_-	metallophosphoesterase	NA	A0A0U4JVA9	Exiguobacterium_phage	43.4	4.5e-15
WP_104851414.1|1777943_1779350_-	hypothetical protein	NA	Q9T1A5	Listeria_phage	41.1	2.9e-72
WP_104851415.1|1779358_1780183_-|tail	phage tail family protein	tail	A8ATA8	Listeria_phage	34.3	4.7e-30
WP_104851416.1|1780191_1784385_-|tail	phage tail tape measure protein	tail	A0A059T5F4	Listeria_phage	33.0	1.2e-89
WP_061574459.1|1784666_1784993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061574460.1|1785046_1785655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104851417.1|1785667_1786054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158657231.1|1786050_1786482_-|head,tail	head-tail adaptor protein	head,tail	A0A1B1P9Z7	Enterococcus_phage	33.3	4.8e-10
WP_104851419.1|1786481_1786814_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_061574463.1|1786816_1787098_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A6M953	Geobacillus_virus	60.9	5.9e-25
WP_061574464.1|1787111_1788260_-|capsid	phage major capsid protein	capsid	A0A0A7S154	Clostridium_phage	43.4	5.0e-78
WP_061574465.1|1788274_1788994_-|protease	Clp protease ClpP	protease	A0A2I7SCY8	Paenibacillus_phage	53.6	2.8e-55
WP_081105576.1|1788980_1790267_-|portal	phage portal protein	portal	Q0SPK2	Clostridium_phage	54.3	5.7e-131
WP_104851420.1|1790285_1791854_-|terminase	terminase large subunit	terminase	A0A2I7SBY8	Paenibacillus_phage	74.7	7.6e-247
WP_104851421.1|1791843_1792380_-	hypothetical protein	NA	A0A2I7SBY3	Paenibacillus_phage	34.3	1.9e-16
WP_104851422.1|1792487_1792859_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	52.3	1.9e-31
WP_035184766.1|1792864_1793083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035184764.1|1793406_1793706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035184762.1|1793867_1794410_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	60.6	8.7e-57
WP_035184760.1|1794406_1794862_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	54.9	1.5e-38
WP_035184757.1|1794964_1795651_-	hypothetical protein	NA	A0A2P1JTZ2	Anoxybacillus_phage	39.1	4.8e-36
WP_035184755.1|1795713_1795953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035184750.1|1796176_1796479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035184748.1|1796493_1796676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035184746.1|1796944_1797133_-	BH0509 family protein	NA	NA	NA	NA	NA
WP_035184744.1|1797265_1797475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104851423.1|1797736_1798732_-	DnaD domain protein	NA	A0A0U4JX08	Bacillus_phage	59.8	1.3e-37
WP_035184741.1|1799272_1799464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043052499.1|1799550_1799832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035184739.1|1799844_1800114_-	group-specific protein	NA	A0A1B1P7U4	Bacillus_phage	62.8	3.5e-27
WP_035184735.1|1800138_1800660_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_035184732.1|1800948_1801176_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_035184731.1|1801321_1801741_+	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	51.7	3.0e-09
WP_035184729.1|1801869_1802787_+	NAD-dependent DNA ligase	NA	NA	NA	NA	NA
WP_052042163.1|1802816_1803779_+	hypothetical protein	NA	A0A0A8WJ41	Clostridium_phage	39.2	1.9e-30
WP_104851425.1|1803924_1805439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104851426.1|1805469_1806333_+	DNA adenine methylase	NA	M4SNK2	Cyanophage	24.5	1.0e-06
WP_035184723.1|1806431_1806941_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_035184722.1|1806977_1808117_+|integrase	site-specific integrase	integrase	A0A0S2SXP1	Bacillus_phage	71.9	2.0e-71
WP_014098212.1|1808225_1809563_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
1808184:1808282	attR	ACAAAAACCCCTCAAAGCCTTACGCTTCAAGGGGTTTCTTGCTTAATACATTTCGATATACTGGTCGCGTTCCCATTGGTGGACTTGTGTGCGGAACAT	NA	NA	NA	NA
WP_014098211.1|1809632_1810022_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017550446.1|1810114_1813714_-	dynamin	NA	NA	NA	NA	NA
WP_014098209.1|1813879_1814083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014098207.1|1815092_1816406_-	purine permease	NA	NA	NA	NA	NA
WP_014098206.1|1816402_1816990_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_014098205.1|1817536_1819057_-	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_104851427.1|1819138_1820284_-	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_013859462.1|1821013_1821316_-	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_014098203.1|1821396_1821948_-	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_014098202.1|1822017_1822269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014098201.1|1822607_1823906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035184719.1|1823886_1826187_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	32.5	1.5e-09
WP_014098199.1|1826336_1826780_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_014098197.1|1827410_1827773_-	YppE family protein	NA	NA	NA	NA	NA
WP_014098196.1|1827840_1828080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014098194.1|1828636_1829242_+	Holliday junction resolvase RecU	NA	NA	NA	NA	NA
WP_046720849.1|1829334_1832070_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_014098191.1|1832157_1832817_-	endonuclease III	NA	NA	NA	NA	NA
WP_026683353.1|1832864_1833560_-	DnaD domain-containing protein	NA	A0A0N7AE27	Bacillus_phage	48.7	2.3e-25
WP_035184709.1|1833671_1834964_-|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	30.8	2.7e-56
WP_017550453.1|1835059_1836247_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_014098186.1|1836269_1836722_-	DUF5590 domain-containg protein	NA	NA	NA	NA	NA
WP_104851428.1|1836914_1839707_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	28.5	1.0e-60
WP_014098184.1|1839842_1840226_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_104851429.1|1840252_1841116_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_014098182.1|1841112_1841952_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	38.4	1.0e-48
WP_014098181.1|1842217_1843195_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_046720857.1|1843167_1844370_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	46.6	1.7e-41
>prophage 5
NZ_CP026649	Bacillus coagulans strain R11 chromosome, complete genome	3602752	2137443	2198257	3602752	transposase,protease,coat,tRNA	Moraxella_phage(22.22%)	57	NA	NA
WP_014097883.1|2137443_2138583_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.5	6.6e-83
WP_014097882.1|2138600_2139629_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_014097881.1|2139664_2139871_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_014097880.1|2139867_2140866_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.6	2.1e-08
WP_014097879.1|2140882_2141485_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_014097878.1|2141983_2142703_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_014097877.1|2142815_2143784_-	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_104851463.1|2143783_2145055_-|coat	SafA/ExsA family spore coat assembly protein	coat	S6BFI4	Thermus_phage	55.6	6.2e-05
WP_104851464.1|2145241_2145799_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_014097874.1|2145925_2146771_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_014097873.1|2146796_2147249_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_104851465.1|2147297_2148590_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_104851466.1|2148624_2149161_-	sporulation protein	NA	NA	NA	NA	NA
WP_013859801.1|2149366_2149657_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_026683599.1|2149669_2149999_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_013859803.1|2150011_2150320_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_026683600.1|2150462_2151941_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_014097868.1|2151992_2152859_-	stage IV sporulation protein FB	NA	NA	NA	NA	NA
WP_013859806.1|2152851_2153604_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_013859807.1|2153730_2154540_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_014097867.1|2154532_2155225_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_014097866.1|2155449_2155968_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_014097865.1|2155967_2156834_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_017551063.1|2156940_2157957_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_104851467.1|2158130_2158814_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_014095555.1|2159225_2160449_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	46.2	1.1e-78
WP_104851469.1|2160791_2161775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104851470.1|2161893_2162655_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_104851471.1|2162760_2163465_-	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_104851472.1|2163461_2164340_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_104851473.1|2164340_2165339_-	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_104851474.1|2165441_2165876_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_104851475.1|2165958_2167164_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_104851476.1|2167150_2168203_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_104851477.1|2168212_2169874_-	Flp pilus assembly complex ATPase component	NA	NA	NA	NA	NA
WP_035184493.1|2169919_2171374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104851478.1|2171390_2172119_-	photosystem reaction center subunit H	NA	NA	NA	NA	NA
WP_014097852.1|2172145_2173918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035184521.1|2174045_2175707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013859826.1|2175706_2176216_-	pilin	NA	NA	NA	NA	NA
WP_013859827.1|2176212_2176632_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_014097850.1|2176750_2178073_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017551078.1|2178135_2180781_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	43.7	3.4e-162
WP_014097848.1|2181207_2181399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014097847.1|2181415_2182600_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_104851479.1|2182630_2184448_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_104851480.1|2184833_2186123_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	27.6	4.4e-06
WP_014097844.1|2186138_2187116_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_017551081.1|2187352_2188141_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_014097842.1|2188137_2189070_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_014097841.1|2189082_2189907_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_014097840.1|2189922_2191254_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_014097839.1|2191439_2191934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014097838.1|2192110_2192695_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_014097837.1|2192691_2195016_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.5	4.8e-181
WP_014097836.1|2195059_2196697_-|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	36.4	2.9e-15
WP_014097835.1|2196988_2198257_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	67.4	5.4e-150
>prophage 6
NZ_CP026649	Bacillus coagulans strain R11 chromosome, complete genome	3602752	2400737	2472934	3602752	transposase,bacteriocin	Staphylococcus_phage(23.08%)	55	NA	NA
WP_014095994.1|2400737_2402153_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_014097647.1|2404141_2404912_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.4	1.3e-37
WP_017551856.1|2404898_2405705_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_104851499.1|2406236_2406701_-	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	37.7	4.4e-25
WP_013860030.1|2406869_2407118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017551858.1|2407190_2407640_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	52.4	1.5e-38
WP_013860032.1|2407756_2407993_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	63.8	1.1e-19
WP_100183710.1|2408084_2408213_+	DUF4021 domain-containing protein	NA	NA	NA	NA	NA
WP_017551860.1|2408332_2409223_+	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
WP_014097641.1|2409285_2409444_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_104851500.1|2409814_2410918_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_026684902.1|2412945_2413764_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_061577841.1|2413804_2414608_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_035183995.1|2414604_2416350_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_061565856.1|2416351_2417686_-	isochorismate synthase	NA	NA	NA	NA	NA
WP_035183998.1|2417951_2418875_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_035191286.1|2427234_2428398_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_046721937.1|2428725_2429376_-|bacteriocin	putative bacteriocin export ABC transporter	bacteriocin	G9BWD6	Planktothrix_phage	30.7	1.6e-20
WP_104851501.1|2429377_2431567_-	DUF1430 domain-containing protein	NA	NA	NA	NA	NA
WP_035191149.1|2431864_2432044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061577719.1|2432344_2433250_-	DMT family transporter	NA	NA	NA	NA	NA
WP_013860047.1|2433340_2434030_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	35.7	3.0e-14
WP_081106251.1|2434165_2435290_-	DUF1646 family protein	NA	NA	NA	NA	NA
WP_061565795.1|2435799_2436186_-	MFS transporter	NA	NA	NA	NA	NA
WP_104851503.1|2436489_2438901_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.0	4.8e-115
WP_104851504.1|2438994_2439201_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_013860052.1|2439215_2439560_-	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_104851505.1|2439839_2441255_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_046722075.1|2442048_2442495_+	helix-turn-helix transcriptional regulator	NA	A0A0A7RUJ5	Clostridium_phage	51.8	3.4e-06
WP_104851506.1|2442770_2444075_+|transposase	IS1380-like element ISBco2 family transposase	transposase	NA	NA	NA	NA
WP_081110520.1|2444229_2444502_+	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_061566880.1|2444602_2445013_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_104851507.1|2445119_2445539_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_104851509.1|2445819_2447007_+	amidohydrolase	NA	NA	NA	NA	NA
WP_013860056.1|2447067_2447262_+	DUF3311 domain-containing protein	NA	NA	NA	NA	NA
WP_046721674.1|2447258_2448728_+	sodium:solute symporter	NA	NA	NA	NA	NA
WP_013860060.1|2449399_2449618_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_013860062.1|2449834_2450272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046721673.1|2450302_2451700_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	34.8	9.8e-36
WP_017554156.1|2451674_2452349_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.6	3.8e-38
WP_013860065.1|2452420_2452975_-	YdhK family protein	NA	NA	NA	NA	NA
WP_080952267.1|2453155_2453767_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_046721671.1|2453780_2454434_-	lipoprotein	NA	NA	NA	NA	NA
WP_026685174.1|2454430_2455366_-	polysaccharide deacetylase	NA	A0A1V0SLN0	Klosneuvirus	25.7	3.7e-07
WP_014097608.1|2458943_2459240_-	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	39.6	4.2e-13
WP_014097607.1|2459321_2459582_-	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_035184240.1|2460163_2460952_+	endonuclease	NA	A0A1P8CWK6	Bacillus_phage	65.2	1.4e-60
WP_017551018.1|2461054_2461564_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_104851510.1|2461921_2463337_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_104851511.1|2463792_2465394_-	FGGY-family carbohydrate kinase	NA	NA	NA	NA	NA
WP_026685165.1|2465411_2466818_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_014097602.1|2467302_2468001_+	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_035184237.1|2468032_2469457_+	L-arabinose isomerase	NA	NA	NA	NA	NA
WP_035184227.1|2469629_2470769_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_104851379.1|2471623_2472934_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP026649	Bacillus coagulans strain R11 chromosome, complete genome	3602752	2957254	3110455	3602752	transposase,integrase	Streptococcus_phage(17.24%)	109	3043523:3043541	3110142:3110160
WP_014095555.1|2957254_2958478_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	46.2	1.1e-78
WP_013860453.1|2958926_2959112_-	type Z 30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_014097151.1|2959402_2959633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035188636.1|2959951_2960515_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_104851595.1|2960685_2961144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104851596.1|2961246_2961693_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_104851597.1|2961841_2963359_-	acyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
WP_104851598.1|2963363_2964143_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_061577170.1|2964737_2965646_-	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	36.3	3.5e-34
WP_017551842.1|2965672_2965882_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_104851599.1|2966176_2967532_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_014097141.1|2967753_2968896_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_104851600.1|2969146_2971102_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	39.4	9.7e-82
WP_104851601.1|2971757_2973308_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	28.5	8.3e-28
WP_104851602.1|2973844_2975212_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_104851603.1|2975930_2977142_-	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.3	2.0e-29
WP_104851604.1|2977304_2978651_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_104851725.1|2978746_2980210_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_017551831.1|2980227_2981658_-	type I restriction-modification system subunit M	NA	A0A220A2U4	Liberibacter_phage	23.4	1.0e-27
WP_017551830.1|2981795_2981975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104851605.1|2982152_2985359_-	type I restriction-modification system endonuclease	NA	Q5YA94	Bacillus_phage	26.7	3.2e-05
WP_104851607.1|2985940_2987422_+	amino acid permease	NA	NA	NA	NA	NA
WP_104851608.1|2988601_2989255_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_104851609.1|2989268_2990492_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_104851610.1|2990791_2991517_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.0	2.3e-28
WP_014097125.1|2991744_2992161_+	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_104851611.1|2992173_2992476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104851612.1|2992493_2992763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104851613.1|2998851_2999745_+	fructose bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	29.0	2.4e-11
WP_061577722.1|3000539_3001847_-|transposase	IS1182-like element ISBco4 family transposase	transposase	NA	NA	NA	NA
WP_104851614.1|3001966_3003382_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_061577388.1|3003891_3005385_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	42.3	6.9e-104
WP_061577387.1|3005493_3006285_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	42.2	3.1e-39
WP_061577389.1|3006304_3007084_-	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	33.1	8.1e-32
WP_104851615.1|3007182_3008457_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_104851727.1|3008475_3010440_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_061577384.1|3010524_3011538_-	ABC transporter substrate-binding protein	NA	G3M9Z0	Bacillus_virus	27.1	5.4e-20
WP_061577383.1|3011570_3012539_-	C-terminal binding protein	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	26.5	1.5e-14
WP_061577382.1|3012570_3012978_-	DUF126 domain-containing protein	NA	NA	NA	NA	NA
WP_061577381.1|3012977_3014180_-	DUF521 domain-containing protein	NA	NA	NA	NA	NA
WP_104851616.1|3014195_3015548_-	amidohydrolase	NA	NA	NA	NA	NA
WP_061577378.1|3016846_3017758_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_061577377.1|3019194_3020139_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_104851379.1|3020680_3021991_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_104851617.1|3022337_3024023_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_104851618.1|3025309_3026380_-	5-methylcytosine-specific restriction endonuclease system specificity protein McrC	NA	NA	NA	NA	NA
WP_104851619.1|3026366_3028781_-	EVE domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	27.6	2.4e-18
WP_104851620.1|3028828_3031912_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	23.3	1.0e-24
WP_104851621.1|3031927_3033187_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_104851622.1|3033186_3035751_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	45.4	2.9e-110
WP_071452125.1|3036075_3036384_-	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_035189966.1|3036693_3036891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017551178.1|3037043_3037688_-	LysE family transporter	NA	NA	NA	NA	NA
WP_104851623.1|3038072_3038546_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_104851624.1|3038713_3039202_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_104851728.1|3039754_3040546_-	maltose-6'-phosphate glucosidase	NA	NA	NA	NA	NA
WP_104851364.1|3040722_3042138_+|transposase	ISLre2-like element ISBco6 family transposase	transposase	NA	NA	NA	NA
WP_104851625.1|3042525_3043830_+|transposase	IS1380-like element ISBco2 family transposase	transposase	NA	NA	NA	NA
3043523:3043541	attL	TGGAAAACTATATCAAAGA	NA	NA	NA	NA
WP_014097072.1|3044052_3045042_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_104851626.1|3045624_3047088_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_104851627.1|3047987_3049244_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_104851628.1|3050399_3050963_-	YqcI/YcgG family protein	NA	NA	NA	NA	NA
WP_013860497.1|3051288_3051864_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0T6D2	Bacillus_phage	39.3	2.9e-26
WP_014097067.1|3052052_3054188_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	84.7	0.0e+00
WP_013860499.1|3054180_3054549_-	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	77.0	2.6e-49
WP_104851629.1|3056045_3057509_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_104851729.1|3058072_3058969_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014097059.1|3059608_3060085_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0A8WJI9	Clostridium_phage	50.3	1.3e-37
WP_026684466.1|3060081_3061953_-	anaerobic ribonucleoside triphosphate reductase	NA	A0A2R2ZH54	Clostridioides_phage	45.7	1.4e-157
WP_013860503.1|3062675_3063755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013860504.1|3063892_3064942_-	2,3-butanediol dehydrogenase	NA	NA	NA	NA	NA
WP_052123359.1|3065390_3066416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035189973.1|3066655_3067801_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.2	9.4e-45
WP_104851630.1|3067813_3069109_-	GntP family permease	NA	NA	NA	NA	NA
WP_035183439.1|3069966_3070887_-	ribose ABC transporter substrate-binding protein RbsB	NA	NA	NA	NA	NA
WP_026684459.1|3070902_3071847_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_014097053.1|3071830_3073330_-	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.8	1.1e-11
WP_014097052.1|3073376_3073772_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_014097051.1|3073768_3074650_-	ribokinase	NA	NA	NA	NA	NA
WP_035183435.1|3074652_3075630_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_104851631.1|3076638_3077532_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014097045.1|3077748_3078237_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_017550090.1|3078435_3078699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104851632.1|3078700_3079654_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014097042.1|3080033_3080648_-	DUF1775 domain-containing protein	NA	NA	NA	NA	NA
WP_104851633.1|3080816_3082463_-	copper resistance protein CopC	NA	NA	NA	NA	NA
WP_014097039.1|3082874_3083798_-	ribokinase	NA	NA	NA	NA	NA
WP_017552347.1|3083851_3084571_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_071452132.1|3084775_3085771_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	33.3	3.3e-30
WP_043052546.1|3086270_3087722_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_014097035.1|3087970_3088300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026104690.1|3088754_3090185_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_017552341.1|3090208_3091408_-	beta-ketoacyl synthase	NA	NA	NA	NA	NA
WP_017552339.1|3091743_3091944_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.7	9.0e-20
WP_104851634.1|3092126_3093542_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_104851635.1|3093781_3094615_+	DMT family transporter	NA	NA	NA	NA	NA
WP_104851636.1|3094733_3095993_+	MFS transporter	NA	NA	NA	NA	NA
WP_026684428.1|3096194_3096497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026684429.1|3096479_3097418_-	DMT family transporter	NA	NA	NA	NA	NA
WP_061577684.1|3098037_3099798_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_026684431.1|3099813_3101469_+	serine hydrolase	NA	NA	NA	NA	NA
WP_026684432.1|3101483_3102746_+	DUF1343 domain-containing protein	NA	NA	NA	NA	NA
WP_017552331.1|3102973_3103336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026684433.1|3103325_3103739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104851637.1|3103791_3105654_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	33.1	3.2e-66
WP_104851638.1|3105628_3107383_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.1	7.9e-51
WP_035183416.1|3107424_3107883_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035183414.1|3108271_3108850_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017550355.1|3109141_3110455_+|transposase	IS1380-like element ISBco1 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	48.8	7.1e-113
3110142:3110160	attR	TGGAAAACTATATCAAAGA	NA	NA	NA	NA
>prophage 8
NZ_CP026649	Bacillus coagulans strain R11 chromosome, complete genome	3602752	3166784	3208992	3602752	transposase	Catovirus(25.0%)	31	NA	NA
WP_104851643.1|3166784_3168470_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_061086804.1|3168618_3169239_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_061086805.1|3169509_3170073_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_017552269.1|3170084_3170840_-	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_017552270.1|3170846_3172355_-	terpene cyclase/mutase family protein	NA	NA	NA	NA	NA
WP_104851087.1|3172805_3174116_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_061086802.1|3174436_3176314_+	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	34.9	8.6e-96
WP_061086803.1|3176879_3177290_-	DUF600 family protein	NA	NA	NA	NA	NA
WP_061577649.1|3177781_3178831_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	27.8	1.5e-25
WP_061565433.1|3179159_3179765_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_061565434.1|3179806_3180928_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_061577239.1|3181846_3182869_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	23.9	4.8e-24
WP_104851644.1|3184760_3184970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014096948.1|3188425_3189199_+	acetoin reductase	NA	NA	NA	NA	NA
WP_061086800.1|3189720_3190551_+	DUF1835 domain-containing protein	NA	NA	NA	NA	NA
WP_014096946.1|3190821_3191526_-	DUF2961 domain-containing protein	NA	NA	NA	NA	NA
WP_014096945.1|3191608_3193294_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_014096944.1|3193405_3193804_-	DUF2961 domain-containing protein	NA	NA	NA	NA	NA
WP_104851645.1|3193941_3195546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104851646.1|3195526_3196201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014096940.1|3196223_3197045_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_014096939.1|3197041_3197842_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_014096938.1|3197854_3198346_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_014096937.1|3198357_3198798_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_043052472.1|3201742_3203104_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013860568.1|3203264_3203489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014096932.1|3203744_3203948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017550765.1|3203962_3204499_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_013860569.1|3204683_3205190_+	RNA-binding protein S4	NA	NA	NA	NA	NA
WP_014096929.1|3205411_3206434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013858393.1|3207768_3208992_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	46.5	3.7e-79
>prophage 9
NZ_CP026649	Bacillus coagulans strain R11 chromosome, complete genome	3602752	3236915	3245230	3602752		Synechococcus_phage(33.33%)	8	NA	NA
WP_026684446.1|3236915_3237509_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.3	6.4e-29
WP_071452149.1|3237501_3238545_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.6	2.9e-61
WP_071452150.1|3238564_3239989_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.7	6.0e-49
WP_071452151.1|3239973_3242223_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	44.2	2.7e-168
WP_071452152.1|3242206_3242890_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_013860601.1|3242886_3243141_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_071452153.1|3243133_3243844_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SS43	Cyanophage	42.8	7.4e-48
WP_014096900.1|3243934_3245230_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.5	6.5e-18
>prophage 10
NZ_CP026649	Bacillus coagulans strain R11 chromosome, complete genome	3602752	3428015	3490215	3602752	transposase,protease,tRNA,bacteriocin	Bacillus_phage(20.0%)	49	NA	NA
WP_104851087.1|3428015_3429326_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013860747.1|3429553_3430834_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_014096744.1|3431270_3432236_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_014096743.1|3432345_3433632_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_035189474.1|3433811_3434459_-	fructose-6-phosphate aldolase	NA	A0A1D7SX77	Cyanophage	52.6	4.1e-53
WP_014096741.1|3434759_3435617_-	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_013860752.1|3435828_3436194_-	response regulator	NA	W8CYM9	Bacillus_phage	37.1	3.9e-13
WP_014096740.1|3436388_3437534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061577323.1|3437546_3438380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014096738.1|3438376_3439066_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	24.2	4.2e-08
WP_104851687.1|3439058_3439463_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014096736.1|3439733_3441335_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.4	1.0e-150
WP_014096735.1|3441565_3442150_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_104851364.1|3442903_3444319_-|transposase	ISLre2-like element ISBco6 family transposase	transposase	NA	NA	NA	NA
WP_158657238.1|3444361_3444529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014096734.1|3444993_3445674_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	8.1e-28
WP_013858307.1|3449621_3451307_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_017550323.1|3452304_3455559_-	methylmalonyl-CoA mutase	NA	NA	NA	NA	NA
WP_017550324.1|3455644_3456280_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035183210.1|3456299_3457442_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_013860764.1|3457475_3458612_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_035183208.1|3458653_3459832_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_035190064.1|3460559_3462704_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_035190066.1|3462915_3464115_+	phospholipase D	NA	NA	NA	NA	NA
WP_035190068.1|3464393_3466064_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_035190070.1|3466060_3466501_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_017552682.1|3466656_3467529_-	agmatinase	NA	NA	NA	NA	NA
WP_035190088.1|3467709_3469761_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_017550334.1|3469863_3470376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017550335.1|3470406_3471069_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_080746307.1|3471184_3471400_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_035190074.1|3471414_3471933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017550337.1|3471950_3473267_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	27.7	6.6e-26
WP_017550339.1|3473695_3474406_+	RsfA family transcriptional regulator	NA	A0A1D6X8E5	Bacillus_phage	50.0	4.1e-06
WP_035183186.1|3477719_3478691_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_014096713.1|3478860_3479616_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_014096711.1|3480264_3480636_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_014096710.1|3480807_3481065_-	YwdI family protein	NA	NA	NA	NA	NA
WP_014096709.1|3481515_3482202_-	uracil-DNA glycosylase	NA	S4VZ65	Pandoravirus	45.5	5.8e-50
WP_013860790.1|3482349_3482697_+	general stress protein	NA	NA	NA	NA	NA
WP_017550349.1|3482821_3483094_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017550351.1|3483573_3483801_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_013860791.1|3483875_3485501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017550353.1|3485546_3486065_+	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_080738159.1|3486061_3486748_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.8	3.3e-13
WP_013860794.1|3486984_3487224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035190076.1|3487303_3487948_-	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_052123362.1|3487953_3488610_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	3.1e-16
WP_046722045.1|3488694_3490215_+|transposase	IS5-like element ISBco3 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP026649	Bacillus coagulans strain R11 chromosome, complete genome	3602752	3583408	3591471	3602752	protease	Staphylococcus_phage(66.67%)	10	NA	NA
WP_014096622.1|3583408_3583903_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	67.7	2.8e-54
WP_014096621.1|3583964_3584252_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_014096620.1|3584505_3584976_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	55.9	2.2e-40
WP_014096619.1|3584988_3586182_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.1	7.1e-112
WP_014096618.1|3586199_3586847_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.8	8.8e-40
WP_142010213.1|3586827_3587949_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	37.0	2.9e-54
WP_014096616.1|3588270_3589371_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_013860891.1|3589531_3589732_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_014096615.1|3589721_3590633_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_017550665.1|3590847_3591471_+|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	38.5	3.6e-22
