The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	0	16733	4784656	tRNA	Mycobacterium_phage(20.0%)	15	NA	NA
WP_008784117.1|609_2250_-	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_048214679.1|2274_2817_-	replication initiation negative regulator SeqA	NA	NA	NA	NA	NA
WP_048216341.1|3011_3785_+	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	33.0	6.4e-05
WP_003831362.1|3913_4201_+	LexA regulated protein	NA	NA	NA	NA	NA
WP_003022839.1|4356_4887_+	flavodoxin FldA	NA	NA	NA	NA	NA
WP_100247215.1|5097_5184_+	ryhB-regulated fur leader peptide	NA	NA	NA	NA	NA
WP_003022836.1|5176_5623_+	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_100272765.1|5750_6677_+	tricarballylate utilization LysR family transcriptional regulator TcuR	NA	NA	NA	NA	NA
WP_100272766.1|6774_8178_+	FAD-dependent tricarballylate dehydrogenase TcuA	NA	A0A2P0ZL82	Lactobacillus_phage	26.1	1.3e-08
WP_100272767.1|8164_9304_+	tricarballylate utilization 4Fe-4S protein TcuB	NA	NA	NA	NA	NA
WP_100272768.1|9357_10653_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.9	6.9e-60
WP_008784106.1|10703_11036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048235880.1|11085_12492_-	chitoporin	NA	NA	NA	NA	NA
WP_100272769.1|12928_14596_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	94.6	0.0e+00
WP_048235881.1|14783_16733_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	1.4e-08
>prophage 2
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	21485	23150	4784656		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_008784099.1|21485_23150_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.3	4.7e-85
>prophage 3
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	27159	28206	4784656		Pseudomonas_phage(100.0%)	1	NA	NA
WP_003022776.1|27159_28206_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	3.2e-47
>prophage 4
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	34136	39321	4784656	tRNA	Planktothrix_phage(50.0%)	4	NA	NA
WP_003022754.1|34136_34862_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.1	1.1e-30
WP_100272772.1|34978_35914_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_003022748.1|36020_36503_-	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_100272773.1|36738_39321_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.6	9.5e-186
>prophage 5
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	47486	49951	4784656		Synechococcus_phage(50.0%)	2	NA	NA
WP_032942683.1|47486_48596_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	8.1e-09
WP_003022711.1|48739_49951_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.9	9.8e-101
>prophage 6
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	53558	54203	4784656		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_003831281.1|53558_53942_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.6	3.4e-23
WP_000034825.1|53993_54203_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 7
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	68038	76168	4784656		Escherichia_phage(50.0%)	8	NA	NA
WP_048235896.1|68038_68869_-	alpha/beta hydrolase	NA	W8EHU1	Mycobacterium_phage	31.2	6.0e-17
WP_003831264.1|69144_69555_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_003022101.1|69738_70167_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	1.1e-17
WP_100272780.1|70236_71004_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_008784074.1|71003_71561_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.7	6.2e-26
WP_048235898.1|71557_73828_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	25.0	2.6e-46
WP_008784072.1|73824_74379_-	molecular chaperone TorD family protein	NA	A0A077SLS7	Escherichia_phage	29.0	7.6e-08
WP_020996553.1|74602_76168_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.0	1.1e-43
>prophage 8
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	79278	81104	4784656		Streptococcus_phage(50.0%)	2	NA	NA
WP_032942667.1|79278_80502_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	34.1	1.7e-60
WP_032942666.1|80486_81104_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.8	3.9e-53
>prophage 9
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	86462	90800	4784656		Escherichia_phage(100.0%)	1	NA	NA
WP_100272783.1|86462_90800_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	27.1	2.7e-31
>prophage 10
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	98249	106330	4784656		uncultured_Caudovirales_phage(33.33%)	5	NA	NA
WP_100272787.1|98249_99257_+	Fe(3+)-siderophore ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	25.7	6.4e-13
WP_008784056.1|99253_100246_+	iron-enterobactin ABC transporter permease	NA	NA	NA	NA	NA
WP_100272788.1|100242_101040_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.5	2.4e-07
WP_100272789.1|101086_102220_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_100272790.1|102439_106330_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	30.1	5.3e-63
>prophage 11
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	117674	119219	4784656		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_100272794.1|117674_119219_+	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.3	5.2e-14
>prophage 12
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	129019	130000	4784656		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003831159.1|129019_130000_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	31.2	2.4e-25
>prophage 13
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	139186	148531	4784656		Escherichia_phage(100.0%)	1	NA	NA
WP_100272803.1|139186_148531_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	24.4	2.7e-12
>prophage 14
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	152387	158001	4784656		Erysipelothrix_phage(50.0%)	3	NA	NA
WP_008784027.1|152387_153713_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.3	2.9e-106
WP_048214745.1|153950_154805_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_100272804.1|154857_158001_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.1	1.2e-57
>prophage 15
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	161339	163464	4784656		Bacillus_phage(50.0%)	2	NA	NA
WP_003831137.1|161339_162023_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.6	1.0e-30
WP_063941362.1|162012_163464_+	Cu(+)/Ag(+) sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.8	1.9e-10
>prophage 16
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	169834	179314	4784656		Morganella_phage(25.0%)	7	NA	NA
WP_003831130.1|169834_170263_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	50.0	4.3e-27
WP_100272810.1|170318_170933_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_048235936.1|170929_173470_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	31.2	2.8e-73
WP_003831126.1|173459_174638_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_020996565.1|174769_175462_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	29.3	5.7e-21
WP_100272811.1|175434_176466_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_100272812.1|176548_179314_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.6	3.1e-33
>prophage 17
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	189297	192491	4784656	tRNA	Enterococcus_phage(50.0%)	4	NA	NA
WP_003831112.1|189297_190164_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.5	9.4e-29
WP_003831111.1|190165_190378_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_100272816.1|190503_191028_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_003831109.1|191105_192491_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	1.6e-46
>prophage 18
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	197530	198547	4784656		Planktothrix_phage(100.0%)	1	NA	NA
WP_100272821.1|197530_198547_-	virulence-associated ABC transporter ATP-binding protein SfbB	NA	G9BWD6	Planktothrix_phage	38.6	3.9e-34
>prophage 19
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	203433	204120	4784656		Planktothrix_phage(100.0%)	1	NA	NA
WP_008783992.1|203433_204120_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	1.0e-30
>prophage 20
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	207423	208101	4784656		Bacillus_virus(100.0%)	1	NA	NA
WP_100272824.1|207423_208101_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	35.7	6.2e-28
>prophage 21
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	219652	223072	4784656		Pithovirus(50.0%)	2	NA	NA
WP_048235959.1|219652_220423_+	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	27.9	6.8e-15
WP_060682640.1|220570_223072_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.3	3.8e-115
>prophage 22
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	231337	239963	4784656		Acanthamoeba_polyphaga_mimivirus(25.0%)	8	NA	NA
WP_003831053.1|231337_232297_+	acetyl esterase	NA	A0A0G2Y6Q1	Acanthamoeba_polyphaga_mimivirus	28.3	5.9e-16
WP_003831052.1|232293_233256_-	ferrochelatase	NA	NA	NA	NA	NA
WP_003021773.1|233419_234064_-	adenylate kinase	NA	NA	NA	NA	NA
WP_032942554.1|234295_236170_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.5	7.0e-114
WP_003831050.1|236280_236886_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_003021764.1|236885_237215_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_100272830.1|237272_239201_-	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	41.9	1.3e-43
WP_003021759.1|239411_239963_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.6	7.0e-30
>prophage 23
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	247847	250997	4784656		Leptospira_phage(100.0%)	1	NA	NA
WP_008783964.1|247847_250997_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.5	1.8e-53
>prophage 24
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	263187	266731	4784656		Bacillus_phage(100.0%)	2	NA	NA
WP_008783952.1|263187_264966_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	6.4e-40
WP_100272833.1|264958_266731_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	4.9e-48
>prophage 25
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	271185	271881	4784656		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003021638.1|271185_271881_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	4.2e-88
>prophage 26
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	275155	280200	4784656	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_003021629.1|275155_275428_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.5e-20
WP_003831014.1|275636_277991_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.5	1.2e-224
WP_003831013.1|278175_279450_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	1.9e-131
WP_003021624.1|279576_280200_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 27
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	302997	312607	4784656	tRNA	uncultured_Mediterranean_phage(50.0%)	11	NA	NA
WP_003021575.1|302997_303468_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	7.8e-30
WP_008783929.1|303558_304662_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	5.9e-52
WP_003021571.1|304665_305115_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_020996578.1|305268_305808_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_003021561.1|306106_306970_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_032942528.1|307015_307708_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	30.1	5.9e-18
WP_003021554.1|307731_308097_-	VOC family protein	NA	NA	NA	NA	NA
WP_003021550.1|308267_309239_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.8	1.4e-44
WP_003021547.1|309249_311097_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_003021544.1|311124_311457_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_003021535.1|311479_312607_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.3	1.6e-89
>prophage 28
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	324799	331368	4784656		Bacillus_phage(75.0%)	4	NA	NA
WP_003830971.1|324799_326095_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.3	1.1e-28
WP_003830970.1|326145_326835_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.9	1.1e-37
WP_100272845.1|327025_328228_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	39.8	4.3e-08
WP_100272846.1|328224_331368_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.4	1.7e-11
>prophage 29
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	339148	340060	4784656		Salmonella_phage(100.0%)	1	NA	NA
WP_003021479.1|339148_340060_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	64.3	2.7e-103
>prophage 30
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	343896	345012	4784656		Bacillus_phage(100.0%)	1	NA	NA
WP_095533161.1|343896_345012_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.6	5.3e-16
>prophage 31
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	361683	362451	4784656		Planktothrix_phage(100.0%)	1	NA	NA
WP_048235995.1|361683_362451_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	38.6	5.6e-25
>prophage 32
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	370501	371548	4784656		Bacillus_virus(100.0%)	1	NA	NA
WP_000192349.1|370501_371548_+	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
>prophage 33
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	375533	377494	4784656		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
WP_032942491.1|375533_376547_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	5.4e-44
WP_057067127.1|376543_377494_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.7	8.1e-34
>prophage 34
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	387951	395525	4784656		Enterobacteria_phage(33.33%)	4	NA	NA
WP_100271435.1|387951_389034_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	81.7	2.7e-158
WP_100271436.1|389155_392239_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	82.0	0.0e+00
WP_032942480.1|392290_393544_+	MFS transporter	NA	NA	NA	NA	NA
WP_100271437.1|393638_395525_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.6	1.4e-53
>prophage 35
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	409272	410178	4784656		Burkholderia_virus(100.0%)	1	NA	NA
WP_020996593.1|409272_410178_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	25.1	4.0e-14
>prophage 36
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	418278	419391	4784656		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_100271446.1|418278_419391_+	agmatine deiminase family protein	NA	M1HH76	Paramecium_bursaria_Chlorella_virus	35.7	4.4e-55
>prophage 37
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	441697	442702	4784656		Enterobacteria_phage(100.0%)	1	NA	NA
WP_008783828.1|441697_442702_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	1.1e-23
>prophage 38
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	450270	451452	4784656	integrase	Enterobacteria_phage(100.0%)	1	443137:443151	451610:451624
443137:443151	attL	CGGCACCATCCCTTA	NA	NA	NA	NA
WP_100271457.1|450270_451452_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.4	4.0e-123
WP_100271457.1|450270_451452_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.4	4.0e-123
451610:451624	attR	TAAGGGATGGTGCCG	NA	NA	NA	NA
>prophage 39
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	462332	466043	4784656		Streptococcus_phage(66.67%)	3	NA	NA
WP_100271465.1|462332_463583_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	1.6e-98
WP_100271466.1|463594_464698_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.6	1.2e-60
WP_003830831.1|464987_466043_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	59.5	5.5e-116
>prophage 40
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	473334	473916	4784656		Caulobacter_phage(100.0%)	1	NA	NA
WP_003031390.1|473334_473916_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.8	5.7e-14
>prophage 41
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	490228	494427	4784656		Bradyrhizobium_phage(33.33%)	5	NA	NA
WP_100272859.1|490228_490957_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.8	6.9e-41
WP_003838896.1|491021_491489_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	60.1	6.5e-53
WP_048214878.1|491485_492208_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_057068753.1|492241_492997_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_032942416.1|493068_494427_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	35.1	9.9e-09
>prophage 42
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	498471	499275	4784656		Indivirus(100.0%)	1	NA	NA
WP_100271474.1|498471_499275_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	34.6	1.0e-37
>prophage 43
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	505740	506772	4784656		Planktothrix_phage(100.0%)	1	NA	NA
WP_003829140.1|505740_506772_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
>prophage 44
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	518774	522878	4784656		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_008786271.1|518774_522257_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.0	5.9e-207
WP_003018518.1|522281_522878_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.8	1.3e-26
>prophage 45
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	531685	532444	4784656		Flavobacterium_phage(100.0%)	1	NA	NA
WP_008786266.1|531685_532444_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	41.5	5.5e-25
>prophage 46
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	544075	545509	4784656	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003829191.1|544075_545509_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	2.1e-25
>prophage 47
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	549511	549856	4784656		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_032942401.1|549511_549856_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	52.3	1.2e-27
>prophage 48
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	555865	556663	4784656		Planktothrix_phage(100.0%)	1	NA	NA
WP_100271484.1|555865_556663_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.8	1.2e-14
>prophage 49
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	567153	573976	4784656	tRNA	Niemeyer_virus(50.0%)	6	NA	NA
WP_191553951.1|567153_569583_-	ATP-dependent helicase HrpB	NA	A0A0U2UIE6	Niemeyer_virus	28.9	6.9e-37
WP_100271490.1|569656_570187_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_008786246.1|570202_570907_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_003829221.1|571084_571540_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_032942389.1|571610_572507_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_071845213.1|572557_573976_+	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	35.9	5.5e-26
>prophage 50
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	587020	589325	4784656		Anomala_cuprea_entomopoxvirus(50.0%)	3	NA	NA
WP_008786228.1|587020_587947_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.7	4.1e-22
WP_008786227.1|588055_588718_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_003018658.1|588788_589325_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	3.9e-17
>prophage 51
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	592597	595513	4784656		Mamastrovirus(50.0%)	3	NA	NA
WP_048214925.1|592597_594214_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.3	3.3e-19
WP_032941691.1|594367_594715_+	YacC family pilotin-like protein	NA	NA	NA	NA	NA
WP_008786221.1|594745_595513_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	35.3	5.7e-30
>prophage 52
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	604992	606417	4784656		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_003829486.1|604992_606417_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	4.6e-41
>prophage 53
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	617496	618060	4784656		Thiobacimonas_phage(100.0%)	1	NA	NA
WP_008786207.1|617496_618060_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1B0T6G1	Thiobacimonas_phage	33.1	2.7e-13
>prophage 54
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	622366	623410	4784656		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_003829510.1|622366_623410_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.0	3.4e-102
>prophage 55
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	649598	651323	4784656		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_020996230.1|649598_651323_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	25.7	1.7e-34
>prophage 56
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	667617	668316	4784656		Bacillus_virus(100.0%)	1	NA	NA
WP_032942352.1|667617_668316_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	37.4	1.8e-22
>prophage 57
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	675507	680943	4784656		Lymphocystis_disease_virus(50.0%)	2	NA	NA
WP_048236148.1|675507_677859_+	DNA polymerase II	NA	A0A1B2RW58	Lymphocystis_disease_virus	25.4	6.5e-16
WP_048236149.1|678036_680943_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	2.2e-21
>prophage 58
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	688801	690220	4784656		Salmonella_phage(50.0%)	2	NA	NA
WP_100271517.1|688801_689650_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH	NA	S4TT53	Salmonella_phage	28.8	8.3e-06
WP_100271518.1|689740_690220_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	47.1	3.0e-29
>prophage 59
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	698550	704201	4784656		Vibrio_phage(50.0%)	4	NA	NA
WP_003829695.1|698550_700068_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	22.4	2.5e-08
WP_003018898.1|700102_701245_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_100271522.1|701368_702586_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_100271523.1|702647_704201_+	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	24.6	5.2e-30
>prophage 60
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	709684	710833	4784656		Halovirus(100.0%)	1	NA	NA
WP_048214966.1|709684_710833_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.4	2.2e-49
>prophage 61
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	717008	719825	4784656	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_003829724.1|717008_719825_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	25.6	1.0e-76
>prophage 62
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	726292	730807	4784656		uncultured_Caudovirales_phage(33.33%)	3	NA	NA
WP_008786152.1|726292_727459_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.2	5.7e-90
WP_003829737.1|727665_728799_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	5.5e-29
WP_003829739.1|728884_730807_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.1	5.5e-146
>prophage 63
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	734691	735645	4784656		Synechococcus_phage(100.0%)	1	NA	NA
WP_003829752.1|734691_735645_-	transaldolase	NA	A0A0E3G6C9	Synechococcus_phage	35.2	9.7e-11
>prophage 64
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	746841	748266	4784656		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_048214983.1|746841_748266_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.0	1.0e-08
>prophage 65
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	752224	757544	4784656		Bacillus_phage(33.33%)	3	NA	NA
WP_057067007.1|752224_754162_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	36.2	1.6e-12
WP_032942320.1|754493_756161_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.6	1.4e-41
WP_170974255.1|756260_757544_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.0	4.7e-85
>prophage 66
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	764173	765496	4784656		Geobacillus_virus(100.0%)	1	NA	NA
WP_100271539.1|764173_765496_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.3	2.0e-78
>prophage 67
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	771322	774127	4784656		Salmonella_phage(50.0%)	3	NA	NA
WP_003019081.1|771322_771484_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	66.0	2.8e-11
WP_071446017.1|771611_772229_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_100271543.1|772537_774127_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.1	9.1e-30
>prophage 68
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	777950	779027	4784656		Bacillus_phage(100.0%)	1	NA	NA
WP_003829994.1|777950_779027_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.2	1.5e-20
>prophage 69
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	785368	786648	4784656		Salmonella_phage(50.0%)	2	NA	NA
WP_100271547.1|785368_785908_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
WP_003019133.1|785910_786648_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.2	2.9e-63
>prophage 70
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	789837	792319	4784656		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_100271550.1|789837_791283_-	tagaturonate reductase	NA	G8DCZ3	Micromonas_pusilla_virus	26.0	9.5e-18
WP_100271551.1|791296_792319_-	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.0	3.9e-10
>prophage 71
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	795891	797553	4784656		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_008786110.1|795891_797553_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	72.3	6.0e-08
>prophage 72
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	819929	824399	4784656		Enterobacteria_phage(50.0%)	3	NA	NA
WP_032942285.1|819929_820937_-	porin	NA	Q1MVN1	Enterobacteria_phage	50.3	1.8e-84
WP_048227162.1|821974_822748_-	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_100271555.1|822923_824399_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.1	1.2e-47
>prophage 73
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	850045	850993	4784656		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_100271564.1|850045_850993_+	site-specific DNA-methyltransferase	NA	A0A1B1IW70	uncultured_Mediterranean_phage	31.0	9.3e-14
>prophage 74
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	854488	854683	4784656		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001561320.1|854488_854683_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	44.8	5.0e-07
>prophage 75
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	857933	862838	4784656		Yersinia_virus(50.0%)	5	NA	NA
WP_100271567.1|857933_860114_+	AAA family ATPase	NA	Q858T2	Yersinia_virus	24.1	6.2e-13
WP_100271568.1|860113_860977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100271569.1|861921_862152_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_100271570.1|862191_862455_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_100271571.1|862562_862838_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	65.3	2.1e-19
>prophage 76
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	872500	886690	4784656	integrase,tRNA	Pseudomonas_phage(16.67%)	10	865479:865492	880039:880052
865479:865492	attL	CTGCTGACGATGGC	NA	NA	NA	NA
WP_100271578.1|872500_873535_-	macro domain-containing protein	NA	B3FJ30	Pseudomonas_phage	33.8	2.9e-16
WP_100271579.1|873547_874192_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_100271580.1|874331_876011_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.2	1.7e-79
WP_100271581.1|876538_877558_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	31.7	3.5e-43
WP_100272870.1|877705_879208_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	3.0e-83
WP_008786067.1|879311_880394_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
880039:880052	attR	GCCATCGTCAGCAG	NA	NA	NA	NA
WP_032942200.1|880393_881494_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_003025870.1|881760_883272_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	7.1e-48
WP_003830256.1|883391_883835_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_100271582.1|883834_886690_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.8	4.2e-142
>prophage 77
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	891762	892698	4784656		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003025818.1|891762_892698_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.2	1.4e-51
>prophage 78
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	898555	902601	4784656		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_164079418.1|898555_901252_-	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	25.7	1.3e-44
WP_032942194.1|901653_902601_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.5	7.9e-13
>prophage 79
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	906288	909052	4784656		Vibrio_phage(100.0%)	2	NA	NA
WP_048215057.1|906288_908427_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.4	2.6e-266
WP_048227187.1|908587_909052_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	A0A2D0YLR2	Vibrio_phage	57.1	9.4e-52
>prophage 80
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	921001	922000	4784656		Klosneuvirus(100.0%)	1	NA	NA
WP_003830390.1|921001_922000_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.1	1.1e-68
>prophage 81
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	925316	928716	4784656		Organic_Lake_phycodnavirus(50.0%)	3	NA	NA
WP_048215067.1|925316_926819_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.4	4.7e-12
WP_003025728.1|926922_927879_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_003025726.1|928188_928716_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	9.3e-56
>prophage 82
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	932735	934745	4784656		Acinetobacter_phage(100.0%)	1	NA	NA
WP_100271596.1|932735_934745_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	28.7	8.6e-09
>prophage 83
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	950524	952096	4784656		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_100271601.1|950524_952096_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.6	1.0e-09
>prophage 84
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	971576	976018	4784656		Lactococcus_phage(50.0%)	3	NA	NA
WP_063941659.1|971576_974039_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.3	3.6e-65
WP_003830485.1|974077_974503_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_003025606.1|974719_976018_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.6	2.9e-66
>prophage 85
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	981541	984754	4784656		Wolbachia_phage(50.0%)	2	NA	NA
WP_100271607.1|981541_983416_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	42.1	2.6e-60
WP_048215090.1|983425_984754_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	1.1e-17
>prophage 86
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	988656	989202	4784656		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_020996267.1|988656_989202_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.0	1.7e-28
>prophage 87
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	996651	997629	4784656		Tupanvirus(100.0%)	1	NA	NA
WP_100271613.1|996651_997629_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.8	1.1e-28
>prophage 88
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1003531	1004065	4784656		Morganella_phage(100.0%)	1	NA	NA
WP_001221666.1|1003531_1004065_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	6.1e-47
>prophage 89
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1009095	1011076	4784656		Vibrio_phage(50.0%)	2	NA	NA
WP_079934483.1|1009095_1010739_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.1	1.7e-188
WP_000027827.1|1010782_1011076_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	1.2e-12
>prophage 90
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1019788	1021450	4784656		Hepacivirus(100.0%)	1	NA	NA
WP_100271619.1|1019788_1021450_+	fatty acid--CoA ligase	NA	Q75ZG1	Hepacivirus	24.4	3.0e-31
>prophage 91
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1048282	1051100	4784656		Bacillus_phage(50.0%)	3	NA	NA
WP_100271626.1|1048282_1049365_+	two-component system sensor histidine kinase PmrB	NA	W8CYF6	Bacillus_phage	27.2	4.5e-12
WP_003826741.1|1049358_1049448_-	LpxT activity modulator PmrR	NA	NA	NA	NA	NA
WP_003826737.1|1049597_1051100_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.5	4.1e-56
>prophage 92
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1057674	1058463	4784656		Pithovirus(100.0%)	1	NA	NA
WP_100271628.1|1057674_1058463_+	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.1	7.2e-12
>prophage 93
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1064109	1068948	4784656		Bacillus_virus(33.33%)	7	NA	NA
WP_003844769.1|1064109_1064868_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	1.8e-15
WP_003826708.1|1064989_1065676_+	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-08
WP_100271632.1|1065672_1066809_+	alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_100271633.1|1066811_1067366_+	ribose 1,5-bisphosphokinase	NA	NA	NA	NA	NA
WP_048215113.1|1067352_1067787_+	aminoalkylphosphonate N-acetyltransferase	NA	NA	NA	NA	NA
WP_100271634.1|1067795_1068554_+	phosphonate metabolism protein PhnP	NA	NA	NA	NA	NA
WP_008786950.1|1068606_1068948_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	81.8	1.8e-44
>prophage 94
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1072206	1073730	4784656		Pithovirus(100.0%)	1	NA	NA
WP_003844755.1|1072206_1073730_+	sugar ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	22.9	3.6e-07
>prophage 95
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1091174	1093133	4784656		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003826645.1|1091174_1093133_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.5	4.6e-92
>prophage 96
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1099573	1100923	4784656		Moraxella_phage(100.0%)	1	NA	NA
WP_003826632.1|1099573_1100923_-	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	70.9	2.6e-158
>prophage 97
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1104888	1109814	4784656	transposase	Enterobacteria_phage(33.33%)	3	NA	NA
WP_003826621.1|1104888_1105413_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	94.5	1.1e-53
WP_061547501.1|1105664_1108487_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.5	5.2e-312
WP_100271643.1|1108833_1109814_-|transposase	transposase	transposase	A0A1S7J231	Thermus_phage	32.8	1.0e-23
>prophage 98
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1112850	1115362	4784656		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
WP_100271646.1|1112850_1113930_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.2	1.1e-29
WP_003826610.1|1113946_1115362_-	replicative DNA helicase	NA	O80281	Escherichia_phage	77.9	1.8e-199
>prophage 99
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1121040	1121649	4784656		Lactococcus_phage(100.0%)	1	NA	NA
WP_003826596.1|1121040_1121649_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 100
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1128824	1129934	4784656		Mycoplasma_phage(100.0%)	1	NA	NA
WP_048215134.1|1128824_1129934_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
>prophage 101
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1160007	1167018	4784656		Brucella_phage(66.67%)	5	NA	NA
WP_032942059.1|1160007_1160325_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	57.3	5.1e-25
WP_032942057.1|1160317_1160596_+	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	48.8	1.3e-11
WP_032942056.1|1160706_1161396_+	dipeptidase PepE	NA	NA	NA	NA	NA
WP_048213962.1|1161482_1163114_-	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_100271657.1|1163334_1167018_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	4.9e-26
>prophage 102
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1180793	1182383	4784656		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_100271658.1|1180793_1182383_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.4	3.2e-67
>prophage 103
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1187874	1189638	4784656		Bacillus_phage(50.0%)	3	NA	NA
WP_001044509.1|1187874_1188147_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	57.8	5.5e-20
WP_003842015.1|1188333_1188924_-	YjaG family protein	NA	NA	NA	NA	NA
WP_048237131.1|1188957_1189638_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	29.6	7.4e-21
>prophage 104
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1194903	1215429	4784656		Indivirus(14.29%)	17	NA	NA
WP_100271662.1|1194903_1195662_+	HesA/MoeB/ThiF family protein	NA	A0A1V0SCZ9	Indivirus	32.7	1.6e-11
WP_016155307.1|1195642_1195843_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_032945651.1|1195844_1196615_+	thiazole synthase	NA	NA	NA	NA	NA
WP_100271663.1|1196611_1197745_+	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_003033098.1|1197864_1198077_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	78.6	2.2e-24
WP_100271664.1|1199169_1199475_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003033104.1|1199479_1199797_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003826919.1|1199899_1204123_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.4	1.3e-67
WP_003033111.1|1204199_1208228_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.4	1.6e-22
WP_003033114.1|1208548_1208914_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_100271665.1|1208980_1209478_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_003033119.1|1209892_1210600_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_003033122.1|1210603_1211032_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_003033125.1|1211186_1211732_-	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	29.6	1.1e-14
WP_003033128.1|1211733_1212117_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_003031109.1|1212347_1213532_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	7.5e-13
WP_003031107.1|1214478_1215429_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 105
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1224086	1225943	4784656		Acinetobacter_phage(100.0%)	1	NA	NA
WP_032945649.1|1224086_1225943_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	27.5	1.5e-07
>prophage 106
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1242969	1250339	4784656		Serratia_phage(33.33%)	5	NA	NA
WP_008787050.1|1242969_1245267_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	46.2	1.3e-05
WP_003825151.1|1245436_1245757_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_003825153.1|1245771_1246851_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_048227754.1|1247159_1249661_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	27.8	4.6e-12
WP_020996106.1|1249676_1250339_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	33.2	1.9e-29
>prophage 107
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1271559	1276207	4784656		Erwinia_phage(50.0%)	5	NA	NA
WP_003028803.1|1271559_1272891_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.2	2.6e-46
WP_003825185.1|1272958_1273888_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_008787034.1|1273980_1274466_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_095533156.1|1274687_1274933_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_008787032.1|1275361_1276207_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	29.5	4.0e-16
>prophage 108
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1289814	1291883	4784656		Feldmannia_irregularis_virus(50.0%)	2	NA	NA
WP_003028763.1|1289814_1290513_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	29.5	1.5e-05
WP_003028758.1|1290509_1291883_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	1.1e-15
>prophage 109
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1298177	1298798	4784656		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_003825239.1|1298177_1298798_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.9	3.5e-62
>prophage 110
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1311681	1314732	4784656		Escherichia_phage(100.0%)	1	NA	NA
WP_100247862.1|1311681_1314732_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.7	6.5e-08
>prophage 111
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1318070	1319000	4784656		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_100271690.1|1318070_1319000_+	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	32.0	2.3e-25
>prophage 112
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1326686	1331429	4784656		Acanthamoeba_polyphaga_moumouvirus(33.33%)	5	NA	NA
WP_008786993.1|1326686_1327697_-	alcohol dehydrogenase catalytic domain-containing protein	NA	L7RC95	Acanthamoeba_polyphaga_moumouvirus	25.1	2.2e-05
WP_008786992.1|1327728_1328616_-	aldolase	NA	NA	NA	NA	NA
WP_008786991.1|1328641_1329532_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	76.7	8.4e-49
WP_008786990.1|1329704_1330601_+	sugar kinase	NA	NA	NA	NA	NA
WP_008786989.1|1330640_1331429_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.5	2.0e-22
>prophage 113
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1335391	1337861	4784656		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_008786986.1|1335391_1336441_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	3.4e-09
WP_003825317.1|1336451_1337861_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	9.0e-05
>prophage 114
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1341773	1344560	4784656		Enterococcus_phage(100.0%)	1	NA	NA
WP_048237100.1|1341773_1344560_-	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	30.3	6.5e-47
>prophage 115
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1356787	1357402	4784656		Streptococcus_phage(100.0%)	1	NA	NA
WP_100271699.1|1356787_1357402_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	45.7	2.8e-19
>prophage 116
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1368387	1371707	4784656		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_003828911.1|1368387_1369179_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.0	3.0e-26
WP_008787098.1|1369181_1369730_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_003017888.1|1369733_1369988_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_003828916.1|1370066_1371707_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.5	1.3e-42
>prophage 117
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1383716	1387153	4784656	transposase	Sodalis_phage(50.0%)	3	NA	NA
WP_100271705.1|1383716_1384601_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.4	5.7e-66
WP_003828942.1|1384639_1385260_-	threonine export protein RhtC	NA	NA	NA	NA	NA
WP_008787089.1|1385323_1387153_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	38.5	1.9e-84
>prophage 118
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1391171	1395041	4784656		Bacillus_phage(100.0%)	3	NA	NA
WP_003828957.1|1391171_1393334_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.7	3.5e-117
WP_032945701.1|1393422_1394139_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_100271706.1|1394138_1395041_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.9	1.1e-24
>prophage 119
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1411451	1417613	4784656		uncultured_marine_virus(20.0%)	6	NA	NA
WP_100271712.1|1411451_1412582_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	5.1e-19
WP_048227518.1|1412586_1413264_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_032945685.1|1413241_1414123_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	66.7	1.8e-107
WP_032945684.1|1414156_1415224_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.8	5.6e-100
WP_008787073.1|1415223_1416486_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HFY9	Paramecium_bursaria_Chlorella_virus	27.5	4.5e-24
WP_032934208.1|1416482_1417613_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	26.8	1.1e-26
>prophage 120
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1421666	1427095	4784656		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|1421666_1421996_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_003829013.1|1422139_1423408_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	8.3e-42
WP_003829016.1|1423544_1425026_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_003829018.1|1425073_1427095_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.8	2.2e-113
>prophage 121
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1436299	1437946	4784656		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_100271714.1|1436299_1437946_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.6	1.0e-63
>prophage 122
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1453309	1457303	4784656		Tupanvirus(50.0%)	3	NA	NA
WP_100271717.1|1453309_1454815_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	21.9	2.9e-17
WP_003827001.1|1454822_1455242_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_003827003.1|1455434_1457303_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.5	3.2e-66
>prophage 123
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1460577	1461570	4784656		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_100271719.1|1460577_1461570_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	3.8e-50
>prophage 124
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1473880	1484653	4784656		Chrysochromulina_ericina_virus(20.0%)	9	NA	NA
WP_008786550.1|1473880_1475251_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	38.0	2.5e-36
WP_003827031.1|1475603_1477433_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	41.2	4.0e-122
WP_003827033.1|1477767_1478808_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	35.8	2.7e-46
WP_008786549.1|1478951_1479911_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_003827037.1|1479910_1480801_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_003023821.1|1480847_1481621_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	30.6	3.4e-14
WP_003023824.1|1481635_1482361_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003827040.1|1482482_1483148_-	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_003827042.1|1483315_1484653_+	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	38.0	1.6e-64
>prophage 125
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1491630	1499138	4784656		Staphylococcus_phage(33.33%)	7	NA	NA
WP_003023846.1|1491630_1491888_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_100271722.1|1491851_1492211_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_003023858.1|1492228_1492369_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_003023861.1|1492975_1494379_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_003023863.1|1494383_1495484_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	1.1e-53
WP_069323651.1|1495621_1496695_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_008786542.1|1496723_1499138_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.1	4.1e-114
>prophage 126
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1506692	1507106	4784656		Synechococcus_phage(100.0%)	1	NA	NA
WP_003023882.1|1506692_1507106_+	heat shock chaperone IbpA	NA	A0A1D8KSJ6	Synechococcus_phage	35.2	4.6e-18
>prophage 127
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1515756	1520596	4784656		Salmonella_phage(50.0%)	5	NA	NA
WP_032934162.1|1515756_1516941_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	24.5	3.3e-16
WP_100271729.1|1517132_1517966_-	EamA family transporter	NA	NA	NA	NA	NA
WP_003023909.1|1518089_1518179_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_003827118.1|1518701_1518800_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_048215245.1|1518907_1520596_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	30.4	2.2e-58
>prophage 128
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1535840	1537223	4784656		Pandoravirus(100.0%)	1	NA	NA
WP_100271735.1|1535840_1537223_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	28.0	1.7e-40
>prophage 129
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1541245	1545938	4784656	transposase	Sodalis_phage(33.33%)	5	NA	NA
WP_100271738.1|1541245_1542172_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.0	2.2e-68
WP_008786507.1|1542295_1543114_+	lipoprotein NlpA	NA	NA	NA	NA	NA
WP_100271739.1|1543142_1544045_-	DMT family transporter	NA	NA	NA	NA	NA
WP_071444579.1|1544070_1545015_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	25.4	2.2e-15
WP_100271740.1|1545161_1545938_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	27.2	6.4e-13
>prophage 130
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1552679	1555484	4784656		Escherichia_phage(100.0%)	1	NA	NA
WP_100271745.1|1552679_1555484_+	intestinal colonization autotransporter adhesin MisL	NA	A0A2L1IV18	Escherichia_phage	47.8	1.3e-100
>prophage 131
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1572001	1573393	4784656		environmental_Halophage(100.0%)	1	NA	NA
WP_003024026.1|1572001_1573393_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	95.9	2.5e-68
>prophage 132
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1577647	1582675	4784656		Bordetella_phage(33.33%)	4	NA	NA
WP_003024038.1|1577647_1579762_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|1579780_1580056_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_003024042.1|1580110_1580734_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.6	2.2e-19
WP_100271758.1|1580995_1582675_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	23.0	2.9e-26
>prophage 133
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1586739	1591360	4784656		Xanthomonas_phage(25.0%)	7	NA	NA
WP_003827259.1|1586739_1587198_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.1	1.6e-48
WP_100272877.1|1587175_1588396_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.7	1.2e-42
WP_048227329.1|1588567_1589233_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_003024071.1|1589509_1589746_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_003024094.1|1589766_1589934_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_048237016.1|1590032_1590842_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.2	2.6e-25
WP_003024099.1|1590880_1591360_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.2	6.3e-27
>prophage 134
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1601830	1612230	4784656		Prochlorococcus_phage(16.67%)	10	NA	NA
WP_003827312.1|1601830_1602763_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.1	1.0e-36
WP_003827313.1|1602977_1604174_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.1	9.2e-35
WP_032945365.1|1604183_1605209_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.4	3.9e-18
WP_100271764.1|1605261_1605948_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_032945363.1|1606433_1607468_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	29.4	1.7e-08
WP_048215307.1|1607468_1608404_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_008786464.1|1608407_1609691_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.8e-07
WP_057066896.1|1609700_1611245_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003024148.1|1611494_1611926_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_003024152.1|1611978_1612230_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	53.4	2.2e-15
>prophage 135
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1633615	1635460	4784656		Tupanvirus(100.0%)	1	NA	NA
WP_100271770.1|1633615_1635460_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	25.1	6.9e-13
>prophage 136
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1656732	1657728	4784656		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_071446723.1|1656732_1657728_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.5	1.0e-10
>prophage 137
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1662135	1662348	4784656		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|1662135_1662348_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 138
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1670143	1672477	4784656		Escherichia_phage(100.0%)	1	NA	NA
WP_100271780.1|1670143_1672477_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	30.3	2.2e-72
>prophage 139
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1682365	1684350	4784656		Planktothrix_phage(50.0%)	2	NA	NA
WP_100271784.1|1682365_1683349_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.2	2.5e-14
WP_003827418.1|1683345_1684350_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.9e-17
>prophage 140
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1712834	1714877	4784656		Indivirus(100.0%)	1	NA	NA
WP_057068836.1|1712834_1714877_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.3	2.0e-45
>prophage 141
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1724681	1728489	4784656		Ostreococcus_tauri_virus(50.0%)	3	NA	NA
WP_100271794.1|1724681_1726154_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.6	5.4e-45
WP_100271795.1|1726261_1727443_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_003827481.1|1727463_1728489_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L7I1	Tupanvirus	23.6	2.3e-10
>prophage 142
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1740077	1742825	4784656		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_100271803.1|1740077_1742825_+	ribosome-associated ATPase/putative transporter RbbA	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.6	8.7e-20
>prophage 143
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1765145	1769223	4784656		Dickeya_phage(50.0%)	4	NA	NA
WP_003827549.1|1765145_1765811_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	54.9	2.5e-58
WP_003827551.1|1765979_1766225_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	4.7e-10
WP_060682898.1|1766323_1768522_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	37.7	1.2e-117
WP_003827558.1|1768596_1769223_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	60.2	2.3e-29
>prophage 144
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1772475	1775320	4784656		Staphylococcus_phage(50.0%)	3	NA	NA
WP_003023420.1|1772475_1773144_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.5e-13
WP_003837835.1|1773136_1774195_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_003023425.1|1774465_1775320_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	7.0e-45
>prophage 145
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1781114	1782613	4784656		Anomala_cuprea_entomopoxvirus(100.0%)	2	NA	NA
WP_003023438.1|1781114_1781882_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.1	3.7e-13
WP_003827581.1|1781899_1782613_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.2	1.9e-11
>prophage 146
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1786402	1788213	4784656		Planktothrix_phage(50.0%)	2	NA	NA
WP_100271813.1|1786402_1787473_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.0	2.6e-20
WP_003827589.1|1787469_1788213_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.3	4.9e-10
>prophage 147
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1809315	1811763	4784656		Dickeya_phage(100.0%)	1	NA	NA
WP_003827624.1|1809315_1811763_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	82.1	3.6e-33
>prophage 148
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1818965	1821359	4784656		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_100271821.1|1818965_1821359_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	2.1e-14
>prophage 149
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1834537	1838303	4784656		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|1834537_1835257_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_003827658.1|1835253_1836606_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.6	1.9e-12
WP_100271827.1|1836680_1838303_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.9	1.6e-143
>prophage 150
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1855254	1856091	4784656		Vibrio_phage(100.0%)	1	NA	NA
WP_048215408.1|1855254_1856091_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	8.4e-67
>prophage 151
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1873816	1877861	4784656		Acinetobacter_phage(33.33%)	3	NA	NA
WP_048236932.1|1873816_1874380_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.5	2.7e-61
WP_032945195.1|1874465_1875683_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.7	8.0e-34
WP_008786302.1|1875773_1877861_-	FUSC family protein	NA	H9YQA8	environmental_Halophage	87.7	2.1e-66
>prophage 152
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1881596	1886827	4784656		Bacillus_virus(25.0%)	4	NA	NA
WP_008786298.1|1881596_1882316_-	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	28.4	8.6e-20
WP_100271842.1|1882507_1883368_+	ribose-phosphate pyrophosphokinase	NA	G0X553	Salmonella_phage	41.3	1.5e-50
WP_100271843.1|1883382_1884873_+	nicotinate phosphoribosyltransferase	NA	A0A218KC49	Bacillus_phage	52.2	1.3e-142
WP_003827754.1|1884925_1886827_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.9	1.5e-74
>prophage 153
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1892504	1898076	4784656		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_008786293.1|1892504_1892891_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	40.6	3.9e-19
WP_003827771.1|1892890_1893250_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_008786292.1|1893257_1893545_+	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	39.2	3.1e-05
WP_003023654.1|1893670_1894045_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_003023657.1|1894140_1894611_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_003023659.1|1894707_1896822_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.1	6.2e-58
WP_003031109.1|1896891_1898076_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	7.5e-13
>prophage 154
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1917975	1919447	4784656	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_100271849.1|1917975_1918923_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	36.9	2.2e-07
WP_003828283.1|1918937_1919447_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	6.7e-19
>prophage 155
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1929900	1934056	4784656		Bacillus_virus(50.0%)	4	NA	NA
WP_003025300.1|1929900_1930659_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	3.1e-20
WP_048215432.1|1930666_1931770_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_008785977.1|1931779_1932961_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_008785976.1|1933030_1934056_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.5	6.9e-71
>prophage 156
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1940658	1941543	4784656		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_100271852.1|1940658_1941543_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	32.2	2.1e-28
>prophage 157
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1954200	1955244	4784656		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|1954200_1955244_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 158
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1972948	1974316	4784656	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_008785951.1|1972948_1974316_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	2.5e-20
>prophage 159
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1978218	1978722	4784656	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_032945142.1|1978218_1978722_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	7.3e-26
>prophage 160
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1982558	1984049	4784656		Burkholderia_virus(100.0%)	1	NA	NA
WP_048215451.1|1982558_1984049_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.9	4.1e-08
>prophage 161
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1994888	2008963	4784656		Staphylococcus_phage(25.0%)	16	NA	NA
WP_100271860.1|1994888_1995818_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	4.0e-17
WP_003828775.1|1996013_1998350_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.1	9.9e-41
WP_003828774.1|1998579_1999233_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_100271861.1|1999229_1999949_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_003828770.1|2000015_2000288_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_003025085.1|2000284_2001139_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_032945121.1|2001184_2001676_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_003025078.1|2001759_2002047_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	43.2	4.2e-10
WP_032945120.1|2002069_2003503_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_003828761.1|2003549_2004275_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_032945118.1|2004281_2004830_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_008785932.1|2004798_2005374_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_100271862.1|2005370_2005937_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	74.8	1.8e-52
WP_020996354.1|2005957_2006944_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_008785929.1|2006957_2007935_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_003828749.1|2008150_2008963_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	30.6	9.7e-20
>prophage 162
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2013055	2014532	4784656		Vibrio_phage(50.0%)	2	NA	NA
WP_003025035.1|2013055_2013340_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	65.7	6.0e-17
WP_003839953.1|2013560_2014532_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	26.2	1.6e-08
>prophage 163
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2021220	2024102	4784656	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_003025013.1|2021220_2023155_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	4.1e-117
WP_020996352.1|2023253_2024102_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	28.9	1.7e-19
>prophage 164
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2029922	2036567	4784656		Dickeya_phage(50.0%)	4	NA	NA
WP_005131837.1|2029922_2031266_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	93.7	4.8e-64
WP_003024996.1|2031883_2032336_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003024992.1|2032364_2033852_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003828710.1|2033876_2036567_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.4	8.8e-25
>prophage 165
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2042160	2044089	4784656		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_057067629.1|2042160_2044089_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	4.6e-52
>prophage 166
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2049877	2055947	4784656		Invertebrate_iridovirus(33.33%)	8	NA	NA
WP_032945094.1|2049877_2050168_-	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	53.2	4.1e-13
WP_003828634.1|2050220_2050649_+	YhbP family protein	NA	NA	NA	NA	NA
WP_003828632.1|2050685_2051321_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_008785904.1|2051405_2051981_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_003024948.1|2051990_2052581_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	3.2e-12
WP_003828625.1|2052615_2053011_-	YraN family protein	NA	NA	NA	NA	NA
WP_100271868.1|2052968_2055020_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_003024942.1|2055083_2055947_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	5.6e-50
>prophage 167
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2068661	2069807	4784656		Streptococcus_phage(100.0%)	1	NA	NA
WP_032934186.1|2068661_2069807_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	40.2	4.1e-48
>prophage 168
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2075831	2078126	4784656		Tetraselmis_virus(100.0%)	1	NA	NA
WP_003828587.1|2075831_2078126_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	40.4	5.3e-156
>prophage 169
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2098127	2099096	4784656		Enterobacteria_phage(100.0%)	1	NA	NA
WP_048216385.1|2098127_2099096_-	TerC family protein	NA	I7HPH5	Enterobacteria_phage	31.8	4.5e-32
>prophage 170
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2109916	2121967	4784656	tRNA	Herpes_simplex_virus(25.0%)	9	NA	NA
WP_100271882.1|2109916_2113009_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	33.9	1.9e-156
WP_032945068.1|2113216_2114200_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_016157522.1|2114409_2114742_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_167371260.1|2114819_2116199_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.7	3.4e-33
WP_100271883.1|2116629_2118150_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	49.3	1.1e-32
WP_167820709.1|2118203_2118887_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_100271884.1|2119122_2119896_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_100272879.1|2119896_2120745_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_048225647.1|2120812_2121967_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.8	2.1e-84
>prophage 171
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2136345	2141806	4784656	tRNA	Vibrio_phage(33.33%)	4	NA	NA
WP_003024699.1|2136345_2138193_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_003828467.1|2138357_2140103_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.8	8.4e-77
WP_001144069.1|2140340_2140556_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_048236797.1|2140792_2141806_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.8	7.4e-110
>prophage 172
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2153263	2154499	4784656		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_032945041.1|2153263_2154499_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	48.3	3.4e-93
>prophage 173
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2159750	2163131	4784656		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_003828429.1|2159750_2161184_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.0	7.4e-39
WP_008785836.1|2161552_2161759_+	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
WP_048215526.1|2161792_2162089_-	ubiquinone biosynthesis accessory factor UbiK	NA	NA	NA	NA	NA
WP_003828424.1|2162477_2163131_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	8.3e-46
>prophage 174
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2168832	2176907	4784656		Ralstonia_phage(25.0%)	8	NA	NA
WP_100271899.1|2168832_2169993_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.9	8.5e-86
WP_100271900.1|2169998_2170676_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	45.0	2.6e-34
WP_100247260.1|2170823_2172302_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_032945031.1|2172501_2173134_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	34.2	7.6e-20
WP_003024582.1|2173130_2173553_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_008785825.1|2173577_2174405_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_100271901.1|2174404_2174986_+	esterase YqiA	NA	NA	NA	NA	NA
WP_003024571.1|2175014_2176907_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.8	2.0e-92
>prophage 175
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2180205	2180604	4784656		Stx_converting_phage(100.0%)	1	NA	NA
WP_003024544.1|2180205_2180604_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	43.9	9.9e-18
>prophage 176
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2184281	2186540	4784656		Bacillus_virus(100.0%)	1	NA	NA
WP_100271905.1|2184281_2186540_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.3	9.8e-86
>prophage 177
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2190648	2195893	4784656		Pseudomonas_phage(33.33%)	4	NA	NA
WP_100271906.1|2190648_2192820_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	1.3e-103
WP_008785817.1|2192923_2193379_-	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	36.1	5.4e-20
WP_003828381.1|2193423_2194878_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_008785816.1|2195065_2195893_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.6	1.9e-63
>prophage 178
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2205707	2207348	4784656		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_100271909.1|2205707_2207348_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	53.4	8.3e-10
>prophage 179
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2226159	2227926	4784656		Ralstonia_phage(100.0%)	1	NA	NA
WP_100271916.1|2226159_2227926_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.5	2.6e-25
>prophage 180
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2241179	2242290	4784656	transposase	Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_100271926.1|2241179_2242290_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	24.5	1.1e-05
>prophage 181
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2247814	2248900	4784656		Geobacillus_virus(100.0%)	1	NA	NA
WP_008785777.1|2247814_2248900_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	4.5e-12
>prophage 182
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2262266	2265214	4784656		Aichi_virus(50.0%)	2	NA	NA
WP_008785766.1|2262266_2263661_-	galactose/proton symporter	NA	O13311	Aichi_virus	25.5	8.3e-27
WP_020996311.1|2264059_2265214_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.4	6.2e-129
>prophage 183
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2287631	2288864	4784656		Catovirus(100.0%)	1	NA	NA
WP_003825480.1|2287631_2288864_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.6	3.1e-102
>prophage 184
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2296834	2302056	4784656		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_100271937.1|2296834_2299708_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	50.8	1.0e-260
WP_003825501.1|2299785_2300529_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_100271938.1|2300622_2302056_-	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	25.9	8.2e-30
>prophage 185
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2306858	2314505	4784656	tRNA	Brevibacillus_phage(20.0%)	7	NA	NA
WP_003825519.1|2306858_2307755_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	27.9	2.5e-29
WP_003825520.1|2307778_2308492_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_100271940.1|2308497_2310231_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.3	4.1e-60
WP_100194817.1|2310322_2311420_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_003026911.1|2311430_2312948_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	1.3e-86
WP_048215592.1|2313025_2313580_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_100272884.1|2313746_2314505_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A7K9	Microcystis_virus	37.3	2.5e-09
>prophage 186
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2324332	2324938	4784656		Canarypox_virus(100.0%)	1	NA	NA
WP_100271942.1|2324332_2324938_+	ankyrin repeat domain-containing protein	NA	Q6VZ28	Canarypox_virus	27.4	3.2e-07
>prophage 187
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2340606	2343101	4784656		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_003033923.1|2340606_2341368_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	2.6e-19
WP_003033926.1|2341682_2343101_+	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.7	5.1e-24
>prophage 188
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2346743	2347754	4784656		Enterobacteria_phage(100.0%)	1	NA	NA
WP_100271948.1|2346743_2347754_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	30.3	3.3e-33
>prophage 189
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2354349	2361175	4784656		Moraxella_phage(33.33%)	6	NA	NA
WP_003033961.1|2354349_2355063_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	5.3e-46
WP_003033965.1|2355138_2355834_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_003825602.1|2356518_2357049_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_003825604.1|2357061_2359308_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	24.6	5.1e-10
WP_100271949.1|2359498_2360374_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_003033990.1|2360380_2361175_+	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	62.0	1.9e-116
>prophage 190
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2366655	2382262	4784656	tRNA	Klosneuvirus(16.67%)	9	NA	NA
WP_100271953.1|2366655_2369544_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	24.9	2.6e-67
WP_100271954.1|2369536_2373082_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.4	5.2e-09
WP_100271955.1|2373078_2374908_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	40.8	3.8e-03
WP_003034012.1|2375005_2376337_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_003034016.1|2376572_2377826_+	N-acetylmuramoyl-L-alanine amidase AmiC	NA	E5DV68	Deep-sea_thermophilic_phage	28.4	2.7e-13
WP_008785702.1|2378520_2379618_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_003825630.1|2379726_2380533_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.8	5.0e-16
WP_079934183.1|2380610_2381057_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_079934184.1|2381056_2382262_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.3	1.6e-71
>prophage 191
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2393808	2394564	4784656		Bacillus_phage(100.0%)	1	NA	NA
WP_008785695.1|2393808_2394564_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	28.7	2.0e-06
>prophage 192
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2399482	2400331	4784656		Vibrio_phage(100.0%)	1	NA	NA
WP_003825665.1|2399482_2400331_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.6	3.6e-41
>prophage 193
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2404856	2413193	4784656		Oenococcus_phage(25.0%)	5	NA	NA
WP_100271958.1|2404856_2406197_+	glucarate dehydratase	NA	Q6A202	Oenococcus_phage	24.3	2.0e-06
WP_008785687.1|2406217_2407558_+	glucarate dehydratase	NA	NA	NA	NA	NA
WP_100271959.1|2407640_2408783_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.0	1.7e-49
WP_048215651.1|2409080_2411837_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.7	7.8e-53
WP_008785684.1|2411894_2413193_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	2.6e-35
>prophage 194
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2416800	2419824	4784656		Only_Syngen_Nebraska_virus(50.0%)	2	NA	NA
WP_008785683.1|2416800_2418438_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.6	6.7e-153
WP_003034129.1|2418525_2419824_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	57.9	1.4e-129
>prophage 195
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2425007	2425679	4784656		Vibrio_phage(100.0%)	1	NA	NA
WP_003034139.1|2425007_2425679_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.6	3.9e-14
>prophage 196
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2433154	2435187	4784656		Hokovirus(50.0%)	2	NA	NA
WP_008785677.1|2433154_2434582_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	25.6	5.1e-32
WP_060683317.1|2434581_2435187_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	37.9	4.7e-27
>prophage 197
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2438359	2441008	4784656		uncultured_Mediterranean_phage(66.67%)	3	NA	NA
WP_003825728.1|2438359_2439121_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	46.7	2.5e-57
WP_003034172.1|2439114_2439741_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	50.6	4.4e-36
WP_032944817.1|2439880_2441008_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	34.6	5.0e-06
>prophage 198
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2445129	2447697	4784656		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_100271964.1|2445129_2447697_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.9	1.9e-32
>prophage 199
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2451664	2453869	4784656		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_082193810.1|2451664_2453869_-	type I secretion system permease/ATPase	NA	F2Y1V6	Organic_Lake_phycodnavirus	32.8	1.3e-21
>prophage 200
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2471572	2491480	4784656		Bacillus_phage(33.33%)	15	NA	NA
WP_003825843.1|2471572_2473765_-	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	31.5	9.1e-12
WP_008785653.1|2474375_2476586_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_008785652.1|2476631_2478722_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.0	3.0e-12
WP_100271968.1|2478718_2479786_+	response regulator	NA	NA	NA	NA	NA
WP_100271969.1|2479782_2481195_+	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_100271970.1|2481206_2483339_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	37.1	5.7e-11
WP_100271971.1|2483361_2483721_+	response regulator	NA	NA	NA	NA	NA
WP_100271972.1|2483738_2485415_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.0	2.5e-17
WP_008785646.1|2485426_2485951_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_003825861.1|2485934_2486294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048236645.1|2486353_2487976_-	serine hydrolase	NA	G1BNF7	Mycobacterium_phage	24.8	1.4e-06
WP_100271973.1|2488070_2488793_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_071445692.1|2488956_2489808_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_100271974.1|2489804_2490662_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_003825870.1|2490664_2491480_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	W5SAS9	Pithovirus	28.1	1.2e-12
>prophage 201
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2519807	2520773	4784656		Tetraselmis_virus(100.0%)	1	NA	NA
WP_003825938.1|2519807_2520773_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.6	8.8e-36
>prophage 202
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2526264	2531686	4784656	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_048225249.1|2526264_2526762_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	51.0	2.6e-31
WP_057068120.1|2526854_2527919_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.8	4.0e-114
WP_008785618.1|2528005_2528506_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_008785617.1|2528634_2531262_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.8	1.1e-80
WP_000906486.1|2531500_2531686_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 203
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2546359	2551656	4784656		Bacillus_virus(20.0%)	5	NA	NA
WP_003825980.1|2546359_2547562_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.1	1.9e-27
WP_100271984.1|2547916_2548876_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.5	2.9e-132
WP_100271985.1|2548886_2551031_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.4	2.2e-196
WP_003825987.1|2551003_2551414_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	41.0	1.1e-16
WP_048236625.1|2551410_2551656_-	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	42.5	3.8e-12
>prophage 204
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2557292	2561318	4784656		Clostridioides_phage(50.0%)	4	NA	NA
WP_003037241.1|2557292_2557742_+	peptidoglycan-binding protein LysM	NA	A0A1V0DZX0	Clostridioides_phage	38.2	3.7e-05
WP_032944692.1|2557754_2558441_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_032944690.1|2558486_2559887_-	GABA permease	NA	NA	NA	NA	NA
WP_100271988.1|2560034_2561318_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.6	1.6e-29
>prophage 205
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2581615	2586837	4784656		Tetraselmis_virus(50.0%)	5	NA	NA
WP_100271993.1|2581615_2582827_+	glycosyltransferase family 4 protein	NA	A0A2P0VNG4	Tetraselmis_virus	32.3	8.5e-12
WP_048215718.1|2582828_2583941_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003826052.1|2583943_2584351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100271994.1|2584382_2585774_+	DUF4832 domain-containing protein	NA	NA	NA	NA	NA
WP_100271995.1|2585820_2586837_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	46.1	1.0e-79
>prophage 206
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2605535	2608778	4784656		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_100272005.1|2605535_2608778_+	transporter substrate-binding domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	30.4	5.6e-34
>prophage 207
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2618972	2624797	4784656		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_100272007.1|2618972_2620898_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	E5EQ70	Micromonas_sp._RCC1109_virus	23.0	4.3e-26
WP_100272009.1|2621241_2622228_+	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_003839787.1|2622266_2623196_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_100272010.1|2623249_2624797_+	sugar ABC transporter ATP-binding protein	NA	M1HXU1	Acanthocystis_turfacea_Chlorella_virus	22.1	7.3e-08
>prophage 208
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2636408	2638595	4784656		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_100272015.1|2636408_2638595_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	29.8	5.5e-17
>prophage 209
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2651895	2652378	4784656		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003031211.1|2651895_2652378_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	1.2e-28
>prophage 210
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2663708	2667265	4784656		Pseudomonas_phage(50.0%)	4	NA	NA
WP_003826449.1|2663708_2664935_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	37.0	3.8e-07
WP_003826451.1|2664927_2665446_-	YfiR family protein	NA	NA	NA	NA	NA
WP_008785516.1|2665604_2665979_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_003031241.1|2666194_2667265_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	50.9	4.5e-89
>prophage 211
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2673218	2675792	4784656		Enterobacteria_phage(100.0%)	1	NA	NA
WP_020996274.1|2673218_2675792_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	1.5e-127
>prophage 212
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2682034	2683333	4784656		Burkholderia_virus(100.0%)	1	NA	NA
WP_048225111.1|2682034_2683333_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.8	6.9e-44
>prophage 213
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2688632	2694775	4784656	tRNA	Achromobacter_phage(25.0%)	7	NA	NA
WP_008785506.1|2688632_2689052_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	36.5	6.3e-15
WP_020996710.1|2689259_2690339_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_008785504.1|2690372_2691062_-	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	49.3	6.0e-55
WP_003037563.1|2691379_2691763_+	autonomous glycyl radical cofactor GrcA	NA	A0A1W5N098	Cronobacter_phage	70.9	3.6e-33
WP_048225104.1|2691842_2692430_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_100272886.1|2692532_2693429_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003835340.1|2693446_2694775_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	29.1	2.5e-41
>prophage 214
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2700620	2707601	4784656		Streptococcus_phage(33.33%)	8	NA	NA
WP_003037577.1|2700620_2702420_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	3.8e-24
WP_003835329.1|2702435_2703410_+	signal peptidase I	NA	NA	NA	NA	NA
WP_100272019.1|2703679_2704360_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	1.6e-20
WP_032937937.1|2704356_2705262_+	GTPase Era	NA	NA	NA	NA	NA
WP_008785495.1|2705396_2706107_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_008785494.1|2706122_2706854_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_003037588.1|2706853_2707234_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_003037590.1|2707340_2707601_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	54.7	1.7e-18
>prophage 215
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2713942	2725281	4784656		Bacillus_phage(50.0%)	7	NA	NA
WP_100272020.1|2713942_2717830_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.0	2.5e-129
WP_103286014.1|2718479_2719910_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	25.6	1.2e-12
WP_003835304.1|2719932_2720676_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_003835302.1|2720672_2722010_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	34.1	1.4e-10
WP_002914032.1|2722070_2722409_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_003037624.1|2722510_2723701_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_003835277.1|2724027_2725281_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.4	3.0e-100
>prophage 216
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2743321	2744830	4784656		Bacillus_virus(100.0%)	1	NA	NA
WP_008785466.1|2743321_2744830_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.5	3.5e-15
>prophage 217
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2750547	2756902	4784656		Faustovirus(20.0%)	8	NA	NA
WP_003835233.1|2750547_2751762_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.6e-34
WP_002913991.1|2751787_2752174_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
WP_003835203.1|2752194_2752518_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.2e-21
WP_003835201.1|2752626_2753142_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_003838439.1|2753157_2755008_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.9	1.4e-103
WP_003037690.1|2755009_2755345_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_003037694.1|2755356_2755557_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_008785461.1|2755618_2756902_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	35.7	1.3e-34
>prophage 218
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2766240	2766672	4784656		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_003037710.1|2766240_2766672_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.1	5.3e-17
>prophage 219
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2775616	2781569	4784656		Acinetobacter_phage(33.33%)	5	NA	NA
WP_003835166.1|2775616_2777158_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.6	1.1e-160
WP_032944203.1|2777221_2778304_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_100272033.1|2778356_2778572_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_032944201.1|2778568_2779942_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.0	4.4e-41
WP_003037756.1|2780102_2781569_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.5	5.7e-87
>prophage 220
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2784575	2784779	4784656		Escherichia_phage(100.0%)	1	NA	NA
WP_008785446.1|2784575_2784779_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	82.9	5.4e-12
>prophage 221
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2791207	2796805	4784656		Prochlorococcus_phage(33.33%)	5	NA	NA
WP_008785442.1|2791207_2791849_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.5e-28
WP_100272035.1|2791845_2792883_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	42.1	3.1e-71
WP_100272036.1|2793178_2794609_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_003835110.1|2794792_2795419_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003835107.1|2795515_2796805_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.4	2.3e-63
>prophage 222
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2806622	2807336	4784656		Cyanophage(100.0%)	1	NA	NA
WP_003835086.1|2806622_2807336_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	2.0e-37
>prophage 223
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2843170	2852707	4784656		Paenibacillus_phage(20.0%)	11	NA	NA
WP_003038046.1|2843170_2844040_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	33.3	1.5e-18
WP_003038048.1|2844252_2844678_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_100272045.1|2844664_2845114_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_100272046.1|2845173_2845749_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_100272047.1|2845842_2846742_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.4	1.5e-24
WP_003835020.1|2846914_2847706_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.8	1.2e-17
WP_003835019.1|2847863_2848880_+	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_003038061.1|2848880_2849714_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_003038064.1|2849713_2850589_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_100272048.1|2850578_2851676_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	38.9	8.2e-30
WP_100272049.1|2851795_2852707_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	42.1	3.5e-58
>prophage 224
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2856765	2866638	4784656		Hokovirus(25.0%)	9	NA	NA
WP_008785405.1|2856765_2858493_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	7.4e-17
WP_002913505.1|2858538_2858796_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_003038091.1|2859179_2860151_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	3.3e-75
WP_057066948.1|2860314_2861076_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_100272053.1|2861306_2862320_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_060683464.1|2862391_2864407_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.1	2.1e-148
WP_003038102.1|2864408_2864627_+	DUF3820 family protein	NA	NA	NA	NA	NA
WP_100272054.1|2864623_2865622_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_003834913.1|2865711_2866638_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.2	2.2e-07
>prophage 225
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2885965	2886700	4784656		Clostridioides_phage(100.0%)	1	NA	NA
WP_003834866.1|2885965_2886700_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.8	1.2e-13
>prophage 226
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2891177	2892098	4784656		Morganella_phage(100.0%)	1	NA	NA
WP_020996694.1|2891177_2892098_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.5	1.2e-74
>prophage 227
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2900157	2902056	4784656		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_020996691.1|2900157_2902056_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.5	1.9e-13
>prophage 228
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2905207	2906754	4784656		Enterobacteria_phage(66.67%)	4	NA	NA
WP_023294204.1|2905207_2905408_-	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	84.8	5.3e-28
WP_100272069.1|2905542_2905815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100272070.1|2905855_2906197_-	hypothetical protein	NA	I3PV00	Vibrio_phage	53.3	5.1e-23
WP_100272071.1|2906406_2906754_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	61.9	2.7e-35
>prophage 229
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2910292	2914829	4784656		Salmonella_virus(50.0%)	2	NA	NA
WP_100272073.1|2910292_2912236_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	32.7	2.9e-62
WP_048224768.1|2913887_2914829_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	89.6	1.3e-148
>prophage 230
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2923968	2925054	4784656		Pandoravirus(100.0%)	1	NA	NA
WP_003834825.1|2923968_2925054_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.3	9.1e-90
>prophage 231
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2933557	2934694	4784656		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_032944094.1|2933557_2934694_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	26.6	4.0e-19
>prophage 232
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2941184	2942702	4784656		Mollivirus(100.0%)	1	NA	NA
WP_003028127.1|2941184_2942702_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	1.4e-88
>prophage 233
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2947058	2947832	4784656		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_071445282.1|2947058_2947832_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	27.7	3.6e-08
>prophage 234
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2961628	2962228	4784656		Salmonella_phage(100.0%)	1	NA	NA
WP_003028083.1|2961628_2962228_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	39.8	3.1e-07
>prophage 235
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2981213	2982218	4784656		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_032944079.1|2981213_2982218_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.0	1.1e-28
>prophage 236
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2994902	3002845	4784656	transposase	Tupanvirus(50.0%)	7	NA	NA
WP_100272086.1|2994902_2996885_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.4	3.7e-20
WP_042307134.1|2996881_2997865_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	32.2	2.9e-34
WP_104856826.1|2997867_2999007_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	28.5	1.0e-30
WP_100272088.1|2999291_2999717_-	nucleoside triphosphatase NudI	NA	NA	NA	NA	NA
WP_008785326.1|3000034_3000577_+	membrane protein	NA	NA	NA	NA	NA
WP_008785325.1|3000656_3001853_+	nicotinamide mononucleotide deamidase-related protein YfaY	NA	NA	NA	NA	NA
WP_100272089.1|3001891_3002845_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.6	5.6e-67
>prophage 237
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3008725	3022782	4784656		Pseudomonas_phage(33.33%)	9	NA	NA
WP_100272092.1|3008725_3009793_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	50.9	1.7e-08
WP_079934561.1|3009854_3010733_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100272093.1|3010893_3012084_+	MFS transporter	NA	NA	NA	NA	NA
WP_003027609.1|3012087_3012342_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	76.1	2.4e-25
WP_003834668.1|3012341_3013472_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	2.8e-174
WP_003834667.1|3013582_3015868_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.9	7.1e-286
WP_008785314.1|3016287_3017016_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_003834662.1|3017174_3019814_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.1	1.6e-92
WP_100272094.1|3019935_3022782_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	25.5	1.9e-41
>prophage 238
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3026973	3035506	4784656		Enterobacteria_phage(20.0%)	7	NA	NA
WP_057066398.1|3026973_3028074_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.7	3.4e-116
WP_100272096.1|3028188_3029241_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_100272097.1|3029320_3030385_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A2P1EL10	Moumouvirus	52.9	2.4e-18
WP_100272098.1|3030384_3031035_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	34.7	3.7e-06
WP_100272099.1|3031110_3032754_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.2	6.3e-10
WP_008785304.1|3032859_3034296_+	magnesium transporter	NA	NA	NA	NA	NA
WP_100272890.1|3034258_3035506_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	49.3	3.1e-81
>prophage 239
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3044310	3044931	4784656		Bacillus_virus(100.0%)	1	NA	NA
WP_008785298.1|3044310_3044931_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.0	2.8e-11
>prophage 240
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3053895	3062164	4784656		Vibrio_phage(50.0%)	8	NA	NA
WP_100272106.1|3053895_3054903_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.6	1.0e-82
WP_100272107.1|3054930_3055551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003027502.1|3055658_3055943_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_100272892.1|3056067_3057828_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.4	6.0e-99
WP_008785291.1|3057979_3058687_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_003834584.1|3058702_3059893_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.4	1.4e-19
WP_085951589.1|3060226_3060571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100272108.1|3060574_3062164_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.4	2.1e-18
>prophage 241
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3067927	3072230	4784656		Bacillus_phage(50.0%)	4	NA	NA
WP_003834567.1|3067927_3068497_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	S5MM68	Bacillus_phage	37.6	2.3e-12
WP_008785286.1|3068910_3069624_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_100272109.1|3069657_3070644_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_100272110.1|3070763_3072230_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	9.0e-40
>prophage 242
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3090088	3090946	4784656		Catovirus(100.0%)	1	NA	NA
WP_100272118.1|3090088_3090946_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	32.8	1.3e-22
>prophage 243
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3094994	3099087	4784656		Acinetobacter_phage(50.0%)	3	NA	NA
WP_003834514.1|3094994_3096980_-	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	32.6	4.5e-10
WP_008785267.1|3097259_3098096_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_003027410.1|3098418_3099087_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.8	4.1e-56
>prophage 244
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3102792	3104313	4784656		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_003027396.1|3102792_3104313_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.8	3.4e-10
>prophage 245
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3116060	3116795	4784656		Streptococcus_phage(100.0%)	1	NA	NA
WP_048215920.1|3116060_3116795_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	43.6	1.1e-51
>prophage 246
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3127633	3136197	4784656	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_032943978.1|3127633_3128581_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	25.3	1.7e-07
WP_048234924.1|3128564_3129296_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003027354.1|3129276_3129384_-	protein YohO	NA	NA	NA	NA	NA
WP_003027351.1|3129583_3130315_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.5	1.0e-105
WP_100272128.1|3130540_3132226_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	7.4e-280
WP_003840155.1|3132222_3132942_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_003834454.1|3132988_3133459_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	77.4	1.8e-63
WP_100272129.1|3133499_3133958_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	69.3	7.1e-52
WP_032943974.1|3134163_3136197_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	8.9e-54
>prophage 247
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3147198	3151702	4784656		Serratia_phage(50.0%)	4	NA	NA
WP_100272136.1|3147198_3148203_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	28.1	1.4e-12
WP_100272137.1|3148199_3149477_-	MFS transporter	NA	NA	NA	NA	NA
WP_003834421.1|3149729_3150782_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_048224539.1|3150802_3151702_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	27.8	1.2e-10
>prophage 248
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3154965	3157168	4784656		Planktothrix_phage(50.0%)	3	NA	NA
WP_003027295.1|3154965_3155694_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.0	1.1e-27
WP_003834409.1|3155919_3156435_-	lipoprotein	NA	NA	NA	NA	NA
WP_100272138.1|3156955_3157168_+	cold shock domain-containing protein	NA	A0A1W6JNX5	Morganella_phage	74.3	2.7e-22
>prophage 249
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3162519	3164238	4784656		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_100272140.1|3162519_3164238_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	23.8	1.5e-30
>prophage 250
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3175592	3180789	4784656	protease	Planktothrix_phage(25.0%)	4	NA	NA
WP_048215946.1|3175592_3177539_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.8	1.4e-40
WP_003036813.1|3177613_3177838_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
WP_003036810.1|3178161_3178482_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_003036804.1|3178512_3180789_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
>prophage 251
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3184822	3193416	4784656	tRNA	Bacillus_phage(50.0%)	6	NA	NA
WP_100272145.1|3184822_3186184_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	92.6	5.3e-204
WP_048224506.1|3186343_3186676_-	YegP family protein	NA	NA	NA	NA	NA
WP_100272146.1|3186804_3187527_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
WP_003834277.1|3187523_3188927_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.2	2.3e-32
WP_003834276.1|3188926_3190339_-	MFS transporter	NA	NA	NA	NA	NA
WP_100272147.1|3190335_3193416_-	multidrug efflux RND transporter permease subunit MdtC	NA	S5VTK5	Leptospira_phage	22.6	1.7e-64
>prophage 252
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3204195	3214833	4784656		Catovirus(20.0%)	9	NA	NA
WP_003036776.1|3204195_3204837_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.3	2.2e-35
WP_003834269.1|3204928_3205510_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	43.2	4.2e-33
WP_100272151.1|3205536_3207390_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_032943936.1|3207434_3209018_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.9	1.2e-37
WP_003834266.1|3209673_3210813_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_032949610.1|3210818_3211268_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_100272152.1|3211264_3213427_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.8	3.7e-18
WP_000206145.1|3213499_3214342_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	NA	NA	NA	NA
WP_003834262.1|3214344_3214833_+	colanic acid biosynthesis acetyltransferase WcaB	NA	A0A191KBJ5	Streptococcus_virus	41.0	9.3e-10
>prophage 253
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3218579	3225315	4784656		Synechococcus_phage(25.0%)	6	NA	NA
WP_100272155.1|3218579_3219701_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	2.0e-132
WP_100272156.1|3219703_3220669_+	GDP-L-fucose synthase	NA	M1I5W5	Acanthocystis_turfacea_Chlorella_virus	50.3	1.7e-87
WP_100272157.1|3220671_3221151_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_100272158.1|3221147_3222374_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_008785192.1|3222373_3223810_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	31.9	4.1e-53
WP_100272159.1|3223944_3225315_+	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	26.6	9.3e-31
>prophage 254
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3230776	3238970	4784656		Enterobacteria_phage(42.86%)	8	NA	NA
WP_100272163.1|3230776_3232171_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	35.0	5.5e-23
WP_060854693.1|3232336_3233230_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	39.7	1.6e-44
WP_100272164.1|3233599_3234685_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	4.4e-100
WP_100272165.1|3234684_3235584_+	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	35.3	1.0e-30
WP_100272166.1|3235635_3236514_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.4	1.6e-105
WP_100272167.1|3236518_3237067_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	55.6	1.2e-50
WP_100272168.1|3237109_3238255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100272169.1|3238187_3238970_+	glycosyltransferase	NA	A0A0F7L2F7	uncultured_marine_virus	32.4	8.2e-08
>prophage 255
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3242364	3245174	4784656		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_100272173.1|3242364_3243771_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	1.8e-37
WP_032943916.1|3244007_3245174_+	UDP-glucose 6-dehydrogenase	NA	O41091	Paramecium_bursaria_Chlorella_virus	54.0	2.8e-113
>prophage 256
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3252988	3253888	4784656		Cellulophaga_phage(100.0%)	1	NA	NA
WP_003834191.1|3252988_3253888_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	97.4	4.8e-12
>prophage 257
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3261851	3264506	4784656		Escherichia_phage(50.0%)	3	NA	NA
WP_003834185.1|3261851_3262430_+	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	38.0	1.6e-21
WP_032943904.1|3262426_3263194_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_032941959.1|3263333_3264506_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	86.7	1.1e-197
>prophage 258
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3284163	3284973	4784656		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003030258.1|3284163_3284973_+	propanediol diffusion facilitator PduF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	27.8	1.7e-11
>prophage 259
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3298467	3299283	4784656		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_003839037.1|3298467_3299283_+	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	24.2	2.5e-07
>prophage 260
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3304252	3304936	4784656		Bacillus_virus(100.0%)	1	NA	NA
WP_020996647.1|3304252_3304936_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	3.1e-27
>prophage 261
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3309139	3321456	4784656	integrase	Salmonella_phage(27.27%)	16	3308768:3308781	3331477:3331490
3308768:3308781	attL	GGCGATAAGCCTGG	NA	NA	NA	NA
WP_100272200.1|3309139_3310183_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	55.5	1.8e-98
WP_071667664.1|3310157_3310400_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_072213458.1|3311643_3312315_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	77.5	3.9e-67
WP_044700602.1|3312438_3312792_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	51.9	4.8e-24
WP_000855179.1|3312839_3313202_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_100272201.1|3313219_3314971_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_100272202.1|3315018_3316308_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.7	2.7e-173
WP_100272203.1|3316320_3316746_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	3.3e-51
WP_065554936.1|3316812_3317109_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_100272204.1|3317209_3318301_+	permease	NA	NA	NA	NA	NA
WP_065554934.1|3318583_3318817_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	83.1	2.7e-31
WP_100272205.1|3318862_3319108_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	62.2	1.3e-20
WP_065554933.1|3319237_3319438_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	61.5	1.9e-17
WP_048221174.1|3319440_3319800_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	64.4	4.0e-42
WP_100272206.1|3319796_3320837_+	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	50.4	2.1e-96
WP_060683642.1|3320850_3321456_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	72.1	5.6e-81
3331477:3331490	attR	CCAGGCTTATCGCC	NA	NA	NA	NA
>prophage 262
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3324640	3332060	4784656	tail	Burkholderia_phage(40.0%)	6	NA	NA
WP_191553932.1|3324640_3325069_+|tail	tail fiber domain-containing protein	tail	A0A291LC16	Salmonella_phage	70.4	2.0e-48
WP_100272208.1|3325610_3327170_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_100272209.1|3327771_3328971_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.7	3.6e-111
WP_057069503.1|3329412_3330105_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.5	2.1e-07
WP_100272210.1|3330181_3331612_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.2	2.5e-103
WP_100272211.1|3331592_3332060_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.3e-32
>prophage 263
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3360103	3360856	4784656		Bacillus_virus(100.0%)	1	NA	NA
WP_003030477.1|3360103_3360856_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	6.4e-26
>prophage 264
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3366226	3404155	4784656	tail,head,portal,holin,protease,terminase,integrase,capsid	Salmonella_phage(28.57%)	55	3366045:3366104	3404342:3404465
3366045:3366104	attL	GATTTAAAATCCCTCGGCGTTCGCGCTGTGTGGGTTCAAGTCCCACTCCGGGTACCATGG	NA	NA	NA	NA
WP_100272223.1|3366226_3367237_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PLZ2	Enterobacterial_phage	87.5	9.5e-174
WP_065944714.1|3367236_3367464_-	DUF4224 domain-containing protein	NA	K7PHA0	Enterobacterial_phage	88.0	4.6e-36
WP_100272225.1|3367849_3368065_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	51.7	1.7e-08
WP_100272226.1|3368061_3368466_-	DUF551 domain-containing protein	NA	G5DA83	Enterobacteria_phage	37.0	7.2e-08
WP_100272896.1|3368967_3369276_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	73.9	3.8e-33
WP_100272227.1|3369280_3369694_-	hypothetical protein	NA	I6RSM9	Salmonella_phage	76.6	3.8e-20
WP_100272228.1|3369677_3370718_-	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	87.8	7.7e-163
WP_100272229.1|3370717_3371131_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	72.1	6.8e-46
WP_100272230.1|3371178_3371616_-	hypothetical protein	NA	K7P7N6	Enterobacteria_phage	42.8	6.2e-29
WP_100272231.1|3372503_3372710_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	69.1	1.6e-16
WP_100272232.1|3372748_3373099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100272233.1|3373098_3373533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165919942.1|3373549_3374257_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	55.8	2.4e-75
WP_047715881.1|3374336_3374588_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	52.2	2.7e-13
WP_100272234.1|3374616_3375171_+	hypothetical protein	NA	U5P4K1	Shigella_phage	51.9	2.9e-47
WP_100272235.1|3375334_3375541_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.9	1.2e-14
WP_100272236.1|3375503_3376424_+	conserved phage C-terminal domain-containing protein	NA	K7PLZ7	Enterobacterial_phage	84.1	4.7e-63
WP_100272237.1|3376426_3376870_+	hypothetical protein	NA	U5P0U0	Shigella_phage	30.4	1.4e-12
WP_100272238.1|3377211_3377601_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	66.7	2.7e-44
WP_100272239.1|3377617_3378343_+	phage antirepressor KilAC domain-containing protein	NA	G0ZND1	Cronobacter_phage	53.5	1.5e-56
WP_100272240.1|3378339_3379329_+	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	70.8	1.9e-142
WP_100272241.1|3379343_3379922_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	54.4	3.3e-46
WP_100272242.1|3380180_3380477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100272243.1|3380488_3380992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008784467.1|3381091_3381478_+|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	92.2	1.0e-56
WP_072161075.1|3381464_3381746_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	47.1	7.0e-18
WP_100272244.1|3381745_3382360_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	81.9	8.5e-93
WP_100272245.1|3382367_3382637_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	69.0	1.7e-21
WP_100272247.1|3382876_3383233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100272248.1|3383423_3383774_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	77.2	3.3e-49
WP_100272249.1|3383930_3384404_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	88.5	3.9e-77
WP_100272250.1|3384403_3386161_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	90.3	0.0e+00
WP_163208360.1|3386169_3386319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038642109.1|3386308_3387535_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	86.5	9.0e-211
WP_058806104.1|3387527_3388127_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	83.0	7.8e-91
WP_048997965.1|3388136_3389354_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	75.8	1.2e-170
WP_038642103.1|3389431_3389752_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	53.9	2.8e-23
WP_100272251.1|3389761_3390100_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	69.6	1.7e-39
WP_100272252.1|3390096_3390546_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	85.9	1.4e-65
WP_058806107.1|3390542_3390890_+	DUF3168 domain-containing protein	NA	A0A220NRP0	Escherichia_phage	74.8	7.0e-44
WP_038642094.1|3390947_3391652_+|tail	tail protein	tail	K7PHL2	Enterobacterial_phage	74.4	5.7e-93
WP_100272253.1|3391679_3392051_+|tail	phage tail protein	tail	S4TSQ0	Salmonella_phage	86.8	1.9e-55
WP_100272254.1|3392062_3392353_+	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	90.6	1.8e-40
WP_038642089.1|3392411_3392591_+	hypothetical protein	NA	K7PH36	Enterobacterial_phage	84.7	6.2e-20
WP_100272255.1|3392636_3395921_+|tail	phage tail tape measure protein	tail	K7PKG1	Enterobacteria_phage	70.5	0.0e+00
WP_100272256.1|3396073_3396289_-	hypothetical protein	NA	H6WRW0	Salmonella_phage	57.6	2.2e-11
WP_100272257.1|3396459_3397053_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	97.0	6.3e-109
WP_049001813.1|3397052_3397637_+	DUF2163 domain-containing protein	NA	S4TND4	Salmonella_phage	95.4	2.3e-103
WP_100272258.1|3397643_3398042_+	hypothetical protein	NA	S4TR39	Salmonella_phage	93.9	2.5e-69
WP_100272259.1|3398041_3400756_+	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	90.7	0.0e+00
WP_100272260.1|3400755_3401700_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	67.1	1.6e-119
WP_100272261.1|3401709_3403068_+|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	50.5	4.3e-113
WP_003841691.1|3403202_3403445_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	79.2	1.2e-29
WP_000982849.1|3403520_3403763_+	hypothetical protein	NA	I6PD82	Cronobacter_phage	54.4	3.8e-20
WP_047357985.1|3403765_3404155_+	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	72.1	7.8e-52
3404342:3404465	attR	GATTTAAAATCCCTCGGCGTTCGCGCTGTGTGGGTTCAAGTCCCACTCCGGGTACCATGGGAAAGAACAGAATAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTACGGGTGGTTTTTTTGT	NA	NA	NA	NA
>prophage 265
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3417827	3419342	4784656		Cedratvirus(100.0%)	1	NA	NA
WP_100272265.1|3417827_3419342_+	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.2	1.3e-12
>prophage 266
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3431125	3436771	4784656		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_003833879.1|3431125_3432781_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.8	1.6e-08
WP_008785067.1|3432824_3434426_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.1	1.1e-11
WP_032943796.1|3434445_3435318_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_003833872.1|3435314_3436364_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.0	1.8e-05
WP_003034656.1|3436381_3436771_+	chemotaxis response regulator CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	31.3	1.3e-06
>prophage 267
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3444783	3451443	4784656	tRNA	Tupanvirus(33.33%)	7	NA	NA
WP_048235196.1|3444783_3446517_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.6	2.2e-85
WP_003833855.1|3446755_3447322_+	VOC family protein	NA	NA	NA	NA	NA
WP_048235198.1|3447324_3448071_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_100272269.1|3448305_3449274_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_043016732.1|3449270_3450014_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	31.3	2.4e-25
WP_003833847.1|3450054_3450450_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_100272270.1|3450624_3451443_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	80.3	4.5e-57
>prophage 268
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3455317	3461524	4784656		Bacillus_virus(50.0%)	7	NA	NA
WP_003034867.1|3455317_3455839_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
WP_003034869.1|3455919_3456531_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003034872.1|3456539_3457550_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.4	1.6e-08
WP_057066827.1|3457628_3458414_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_003034877.1|3458410_3459166_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	6.5e-18
WP_003844151.1|3459244_3460189_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_003833825.1|3460204_3461524_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	36.8	1.5e-14
>prophage 269
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3465457	3466933	4784656		Cyanophage(100.0%)	1	NA	NA
WP_048216177.1|3465457_3466933_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	1.9e-77
>prophage 270
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3472638	3479170	4784656		Organic_Lake_phycodnavirus(25.0%)	8	NA	NA
WP_191553933.1|3472638_3474693_+	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	36.3	6.2e-31
WP_003833802.1|3474683_3475346_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	31.1	9.1e-08
WP_008785043.1|3475369_3476026_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_003034925.1|3476132_3476363_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	1.0e-14
WP_100272275.1|3476506_3476881_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_100272276.1|3476884_3477757_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_048235206.1|3477777_3478116_+	YebY family protein	NA	NA	NA	NA	NA
WP_048216182.1|3478528_3479170_+	protein-serine/threonine phosphatase	NA	Q71TJ1	Escherichia_phage	50.2	7.8e-57
>prophage 271
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3486616	3488665	4784656		Moraxella_phage(100.0%)	1	NA	NA
WP_048235216.1|3486616_3488665_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	6.1e-87
>prophage 272
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3493939	3494149	4784656		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|3493939_3494149_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 273
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3501647	3503207	4784656		Moraxella_phage(100.0%)	1	NA	NA
WP_008785026.1|3501647_3503207_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	5.1e-41
>prophage 274
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3507075	3514426	4784656	tRNA	Pandoravirus(25.0%)	7	NA	NA
WP_191553934.1|3507075_3508437_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	32.5	4.0e-42
WP_003020986.1|3508520_3508700_+	YoaH family protein	NA	NA	NA	NA	NA
WP_003020984.1|3508706_3509051_-	RidA family protein	NA	NA	NA	NA	NA
WP_003020980.1|3509192_3511103_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.1	9.1e-93
WP_100272289.1|3511161_3511857_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	A0A0R6PI74	Moraxella_phage	35.4	5.8e-05
WP_003020975.1|3511951_3512536_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_122973804.1|3512740_3514426_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.3	2.6e-35
>prophage 275
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3542623	3543385	4784656		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_100272300.1|3542623_3543385_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.1	4.4e-14
>prophage 276
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3557457	3558189	4784656		Enterobacteria_phage(100.0%)	1	NA	NA
WP_100272306.1|3557457_3558189_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.3	3.2e-54
>prophage 277
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3571109	3576826	4784656		Klosneuvirus(33.33%)	4	NA	NA
WP_008784983.1|3571109_3572495_+	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.2	1.3e-27
WP_191553935.1|3572501_3573974_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_008784981.1|3574071_3575754_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	22.7	8.2e-21
WP_001518537.1|3575878_3576826_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	8.6e-44
>prophage 278
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3580076	3584083	4784656		Pseudomonas_phage(50.0%)	5	NA	NA
WP_003020786.1|3580076_3581159_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	38.8	4.3e-07
WP_071446250.1|3581158_3581992_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_071446252.1|3581988_3582381_+	SirB family protein	NA	NA	NA	NA	NA
WP_003020775.1|3582383_3583193_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_003020772.1|3583228_3584083_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	38.8	2.4e-45
>prophage 279
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3587503	3587734	4784656		Mythimna_unipuncta_granulovirus(100.0%)	1	NA	NA
WP_008784971.1|3587503_3587734_+	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	46.1	9.1e-08
>prophage 280
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3593165	3593954	4784656		Bacillus_virus(100.0%)	1	NA	NA
WP_003833396.1|3593165_3593954_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.6	2.6e-30
>prophage 281
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3610442	3620522	4784656		Escherichia_phage(25.0%)	10	NA	NA
WP_003833388.1|3610442_3611981_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.5	1.8e-19
WP_100272323.1|3611977_3612688_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_003833386.1|3612687_3613365_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_003020737.1|3614149_3614992_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	48.8	9.8e-15
WP_008784957.1|3615047_3615503_-	YchJ family protein	NA	NA	NA	NA	NA
WP_008784956.1|3615614_3616526_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_032943688.1|3616616_3617630_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_003020727.1|3617834_3618743_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	3.7e-60
WP_003020723.1|3618880_3619294_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_008784954.1|3619904_3620522_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	54.3	1.1e-52
>prophage 282
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3629062	3684002	4784656	tail,head,coat,holin,terminase,integrase	Enterobacteria_phage(34.62%)	74	3617147:3617161	3660006:3660020
3617147:3617161	attL	ATTGGTGGCAGCCGA	NA	NA	NA	NA
WP_100272325.1|3629062_3630076_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	29.4	4.5e-14
WP_008784949.1|3630072_3631077_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.2	6.8e-15
WP_100272326.1|3631122_3631959_+	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	40.0	1.4e-08
WP_003020691.1|3631996_3632326_-	YciU family protein	NA	NA	NA	NA	NA
WP_003020687.1|3632360_3633821_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_094301000.1|3633963_3634137_+	YciY family protein	NA	NA	NA	NA	NA
WP_100272327.1|3634391_3635585_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	84.1	2.6e-202
WP_008322518.1|3635577_3635778_-	hypothetical protein	NA	K7PM28	Enterobacteria_phage	82.5	1.9e-25
WP_008322517.1|3635823_3636066_-	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	82.3	2.6e-29
WP_100272328.1|3636105_3637146_-	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	75.9	2.0e-155
WP_100272329.1|3637160_3640010_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	K7P6V4	Enterobacteria_phage	60.9	4.4e-293
WP_170975043.1|3640149_3640308_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	92.3	1.3e-21
WP_100272330.1|3640318_3640516_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_097728169.1|3640515_3640716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_191553936.1|3640712_3640871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049041823.1|3640991_3641285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_191553937.1|3641265_3641535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040230817.1|3641754_3641979_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	63.2	5.7e-15
WP_019076926.1|3642010_3642391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040230821.1|3642480_3643389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008322488.1|3643584_3644283_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	79.3	1.0e-102
WP_100272333.1|3644393_3644615_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	67.6	8.2e-22
WP_100272334.1|3644640_3645180_+	toxin YdaT domain-containing protein	NA	K7PJT7	Enterobacteria_phage	86.0	8.5e-81
WP_100272335.1|3645347_3646295_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	33.0	1.8e-25
WP_100272336.1|3646297_3647047_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	87.1	5.3e-121
WP_100272337.1|3647065_3647377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100272338.1|3647373_3647859_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.1	8.8e-69
WP_100272339.1|3648391_3649159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100272340.1|3649155_3649554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100272341.1|3650258_3650516_+	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	77.3	4.6e-24
WP_100272342.1|3650515_3650770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064545070.1|3650871_3651471_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	97.0	2.9e-106
WP_100272343.1|3651470_3651677_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	72.1	1.8e-23
WP_100272344.1|3651679_3652288_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	61.8	7.0e-47
WP_100272345.1|3652284_3652422_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	88.4	1.2e-15
WP_100272346.1|3652418_3653108_+	antiterminator	NA	I6PDF8	Cronobacter_phage	52.2	3.3e-61
WP_100272347.1|3654100_3654289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003826170.1|3654635_3654914_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	97.8	3.3e-44
WP_100272348.1|3654885_3655434_+	lysozyme	NA	K7PM52	Enterobacteria_phage	94.5	3.2e-99
WP_100272349.1|3655430_3655964_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	50.0	3.0e-09
WP_071891841.1|3655967_3656183_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_191238446.1|3656161_3656332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100272350.1|3656422_3656809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172960224.1|3656885_3657527_+	hypothetical protein	NA	I6S676	Salmonella_phage	89.5	2.1e-110
WP_100272351.1|3657558_3658047_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	75.6	2.5e-47
WP_100272352.1|3658043_3659591_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	86.9	2.5e-282
WP_100272353.1|3659602_3661054_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	67.0	2.6e-177
3660006:3660020	attR	ATTGGTGGCAGCCGA	NA	NA	NA	NA
WP_191553938.1|3661001_3661988_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	66.1	5.7e-107
WP_100272355.1|3662005_3663394_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	69.4	2.6e-166
WP_100272356.1|3663397_3663838_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	65.1	2.0e-43
WP_100272357.1|3663848_3664925_+|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	75.1	3.4e-153
WP_100272358.1|3664934_3665300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100272359.1|3665302_3665683_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	7.5e-31
WP_100272360.1|3665682_3665853_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_100272361.1|3665856_3666219_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	61.7	5.1e-37
WP_100272362.1|3666208_3666577_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	75.4	1.8e-45
WP_100272363.1|3666573_3666957_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	62.2	7.5e-39
WP_100272364.1|3667019_3667763_+	Ig domain-containing protein	NA	F1C5E5	Cronobacter_phage	82.9	1.2e-72
WP_100272365.1|3667821_3668514_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	60.8	1.9e-72
WP_100272366.1|3668655_3668931_+	cor protein	NA	Q5G8V7	Enterobacteria_phage	67.5	1.2e-22
WP_100272367.1|3669064_3669736_+	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	48.5	1.3e-46
WP_100272368.1|3669801_3673134_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	85.4	0.0e+00
WP_100272369.1|3673136_3673487_+|tail	phage tail protein	tail	I6RSL7	Salmonella_phage	87.1	2.6e-54
WP_080192186.1|3673483_3673771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031608852.1|3673813_3674518_+|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	97.4	6.0e-135
WP_100272370.1|3674517_3675237_+	C40 family peptidase	NA	Q5G8W2	Enterobacteria_phage	83.7	5.8e-125
WP_100272371.1|3675179_3675707_+|tail	tail assembly protein	tail	I6RSM0	Salmonella_phage	78.1	2.4e-56
WP_100272372.1|3675716_3678899_+	host specificity protein J	NA	A0A1V0E5M1	Salmonella_phage	91.7	0.0e+00
WP_100272373.1|3678898_3679843_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	68.0	6.7e-121
WP_100272374.1|3679852_3681217_+|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	50.5	6.7e-114
WP_008322426.1|3681351_3681594_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	76.6	4.4e-29
WP_003826234.1|3681672_3682062_+	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	72.1	1.0e-51
WP_100272375.1|3682755_3683076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100272376.1|3683330_3684002_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.5	1.5e-79
>prophage 283
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3690618	3697091	4784656		Acinetobacter_phage(66.67%)	5	NA	NA
WP_100272380.1|3690618_3692091_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.4	1.1e-16
WP_100272381.1|3692123_3692930_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_100272382.1|3692929_3694123_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_100272899.1|3694133_3695492_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	1.0e-37
WP_057067328.1|3695495_3697091_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.6	3.2e-51
>prophage 284
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3702069	3707455	4784656	protease	Chrysochromulina_ericina_virus(50.0%)	4	NA	NA
WP_079935307.1|3702069_3702831_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.2	5.2e-07
WP_032934465.1|3703052_3704099_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_003020616.1|3704207_3704459_-	YciN family protein	NA	NA	NA	NA	NA
WP_003833325.1|3704857_3707455_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	35.0	1.3e-86
>prophage 285
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3712296	3712887	4784656		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003020601.1|3712296_3712887_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	7.7e-43
>prophage 286
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3720792	3722727	4784656		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_057067367.1|3720792_3722727_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.5	4.5e-07
>prophage 287
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3726138	3727939	4784656		Bacillus_virus(50.0%)	2	NA	NA
WP_003020558.1|3726138_3726945_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	1.3e-13
WP_003020556.1|3726946_3727939_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	24.7	4.7e-08
>prophage 288
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3746368	3749980	4784656		Escherichia_phage(50.0%)	5	NA	NA
WP_100272390.1|3746368_3747139_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.1	2.3e-18
WP_048235289.1|3747259_3747643_+	VOC family protein	NA	NA	NA	NA	NA
WP_100272391.1|3747814_3748444_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_020996378.1|3748476_3748884_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_100272392.1|3748927_3749980_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	46.7	2.0e-86
>prophage 289
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3753653	3766996	4784656	tRNA	Streptococcus_phage(11.11%)	13	NA	NA
WP_057067381.1|3753653_3754169_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.5	7.0e-24
WP_008784894.1|3754394_3754958_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_008784893.1|3754970_3756203_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.0	6.9e-17
WP_100272393.1|3756270_3758385_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	31.5	1.2e-16
WP_100272394.1|3758796_3759906_+	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.9	1.6e-09
WP_032943570.1|3760060_3761044_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_191553967.1|3761319_3761487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008784890.1|3761515_3762889_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	7.3e-52
WP_032943567.1|3762967_3763903_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	94.5	9.8e-141
WP_100272395.1|3764537_3764780_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.9	3.4e-29
WP_003833207.1|3764965_3765400_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	1.2e-29
WP_003833205.1|3765481_3765694_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_100272396.1|3765841_3766996_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.0	7.4e-114
>prophage 290
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3771975	3772965	4784656		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_094169345.1|3771975_3772965_-	2-hydroxyacid dehydrogenase	NA	M1HMI7	Paramecium_bursaria_Chlorella_virus	42.5	2.8e-69
>prophage 291
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3777909	3781812	4784656		Klosneuvirus(100.0%)	1	NA	NA
WP_100272401.1|3777909_3781812_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	7.6e-54
>prophage 292
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3786613	3795425	4784656	integrase	Escherichia_phage(57.14%)	11	3791299:3791311	3793215:3793227
WP_008784870.1|3786613_3787144_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	43.0	4.5e-18
WP_100272404.1|3787182_3788109_-	DMT family transporter	NA	NA	NA	NA	NA
WP_060682160.1|3788369_3788789_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	58.3	1.4e-33
WP_048214134.1|3788791_3790060_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	78.6	4.5e-197
WP_032943541.1|3790209_3791256_+	porin OmpA	NA	NA	NA	NA	NA
3791299:3791311	attL	TTTTTTATTCGCA	NA	NA	NA	NA
WP_100272405.1|3791441_3792230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100272406.1|3792269_3792554_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U2JGI6	Escherichia_phage	57.4	3.0e-24
WP_100272408.1|3793580_3793781_+	hypothetical protein	NA	NA	NA	NA	NA
3793215:3793227	attR	TTTTTTATTCGCA	NA	NA	NA	NA
WP_100272900.1|3793855_3794434_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	48.2	9.3e-49
WP_100272409.1|3794430_3794727_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	71.6	1.9e-37
WP_100272410.1|3794726_3795425_+	antitermination protein	NA	Q7Y3X2	Yersinia_phage	32.1	2.3e-17
>prophage 293
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3798602	3804428	4784656		Escherichia_phage(25.0%)	7	NA	NA
WP_100272415.1|3798602_3799082_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	66.7	2.2e-56
WP_100272417.1|3799390_3799825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100272418.1|3800045_3800498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100272419.1|3800738_3800930_+	ParB N-terminal domain-containing protein	NA	M4SQC2	Psychrobacter_phage	55.4	2.5e-11
WP_003833178.1|3801143_3801419_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_008784862.1|3801451_3802570_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.6	3.6e-33
WP_032943540.1|3802739_3804428_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.3	2.1e-16
>prophage 294
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3819671	3821633	4784656		Phage_TP(100.0%)	1	NA	NA
WP_100272425.1|3819671_3821633_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.4	2.4e-24
>prophage 295
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3828854	3829871	4784656		Mycoplasma_phage(100.0%)	1	NA	NA
WP_048235324.1|3828854_3829871_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	58.9	2.5e-25
>prophage 296
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3847221	3849342	4784656		Salmonella_phage(100.0%)	1	NA	NA
WP_100272437.1|3847221_3849342_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	68.2	2.5e-139
>prophage 297
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3852784	3854326	4784656		Salmonella_phage(100.0%)	1	NA	NA
WP_100272438.1|3852784_3854326_-	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	55.4	8.3e-36
>prophage 298
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3860684	3861458	4784656		Bacillus_virus(100.0%)	1	NA	NA
WP_008784819.1|3860684_3861458_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.5	6.0e-19
>prophage 299
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3868509	3870486	4784656		Tetraselmis_virus(100.0%)	1	NA	NA
WP_008784811.1|3868509_3870486_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	45.8	2.1e-161
>prophage 300
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3874698	3876243	4784656		Escherichia_phage(100.0%)	1	NA	NA
WP_100272450.1|3874698_3876243_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	1.1e-19
>prophage 301
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3884382	3885471	4784656		Enterobacteria_phage(100.0%)	1	NA	NA
WP_057068231.1|3884382_3885471_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	72.9	1.5e-148
>prophage 302
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3891825	3894966	4784656		Escherichia_phage(50.0%)	4	NA	NA
WP_003833020.1|3891825_3892428_+	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.9	1.5e-22
WP_003833018.1|3892467_3892752_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	48.9	4.4e-20
WP_003833016.1|3892751_3893030_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2L1IV28	Escherichia_phage	59.8	3.1e-26
WP_100272453.1|3893250_3894966_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	26.3	3.7e-37
>prophage 303
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3904804	3906719	4784656		Planktothrix_phage(100.0%)	2	NA	NA
WP_100272458.1|3904804_3905740_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	7.0e-14
WP_100272459.1|3905732_3906719_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.5	7.2e-17
>prophage 304
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3912608	3914552	4784656		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_100272461.1|3912608_3914552_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.9	5.0e-06
>prophage 305
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3920009	3921749	4784656		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_057067763.1|3920009_3921749_-	type I secretion system permease/ATPase	NA	F2Y1V6	Organic_Lake_phycodnavirus	29.8	7.7e-14
>prophage 306
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3930527	3932510	4784656		Tetraselmis_virus(100.0%)	1	NA	NA
WP_100272467.1|3930527_3932510_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	45.2	7.6e-159
>prophage 307
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3963884	3964268	4784656		Streptococcus_phage(100.0%)	1	NA	NA
WP_003032424.1|3963884_3964268_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	3.6e-09
>prophage 308
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3967686	3969192	4784656		Staphylococcus_phage(50.0%)	2	NA	NA
WP_100272487.1|3967686_3968385_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	4.4e-13
WP_008784743.1|3968394_3969192_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A285PWH2	Cedratvirus	27.5	2.1e-11
>prophage 309
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3974020	3974947	4784656		Bacillus_phage(100.0%)	1	NA	NA
WP_048235406.1|3974020_3974947_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.3	3.6e-18
>prophage 310
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3979475	3984425	4784656		Salmonella_phage(25.0%)	5	NA	NA
WP_003032393.1|3979475_3979679_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	2.9e-13
WP_100272491.1|3979753_3981220_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.9	1.9e-45
WP_051642672.1|3981381_3982716_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_003832907.1|3982776_3983991_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.2	7.4e-48
WP_008784733.1|3984098_3984425_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.9	9.9e-24
>prophage 311
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3989240	3991371	4784656		Escherichia_phage(100.0%)	3	NA	NA
WP_008784727.1|3989240_3989858_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	8.6e-77
WP_100272492.1|3989859_3990714_+	dimethyl sulfoxide reductase anchor subunit family protein	NA	NA	NA	NA	NA
WP_008784725.1|3990756_3991371_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.5	1.4e-26
>prophage 312
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3998029	4000239	4784656		Bacillus_phage(100.0%)	2	NA	NA
WP_100272496.1|3998029_3999520_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.7	6.3e-25
WP_003028928.1|3999516_4000239_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.6	1.1e-35
>prophage 313
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4007418	4008615	4784656		Salmonella_phage(100.0%)	1	NA	NA
WP_100272500.1|4007418_4008615_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	27.1	8.1e-23
>prophage 314
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4022141	4023443	4784656		Bacillus_phage(100.0%)	1	NA	NA
WP_100272505.1|4022141_4023443_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.6	1.4e-15
>prophage 315
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4034906	4036256	4784656		Bacillus_virus(100.0%)	1	NA	NA
WP_100272509.1|4034906_4036256_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	28.7	3.3e-12
>prophage 316
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4050900	4052175	4784656	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_100272513.1|4050900_4052175_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.8	2.9e-87
>prophage 317
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4059092	4059617	4784656		Salmonella_phage(100.0%)	1	NA	NA
WP_100272515.1|4059092_4059617_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	57.1	1.2e-47
>prophage 318
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4064720	4075761	4784656		Orpheovirus(33.33%)	11	NA	NA
WP_003832759.1|4064720_4065551_+	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	41.6	2.4e-18
WP_003029205.1|4065678_4066260_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	3.4e-43
WP_008784665.1|4066299_4067469_-	MFS transporter	NA	NA	NA	NA	NA
WP_003029209.1|4067645_4067735_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_003832757.1|4068032_4069058_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	4.8e-32
WP_003029215.1|4069054_4069987_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032943314.1|4070099_4071305_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_048214272.1|4071595_4072744_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2I2L5L3	Orpheovirus	44.8	3.3e-82
WP_003832752.1|4072785_4073433_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	37.3	1.2e-23
WP_100272518.1|4073650_4075024_+	multidrug efflux MATE transporter MdtK	NA	NA	NA	NA	NA
WP_100272519.1|4075062_4075761_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.4	1.1e-08
>prophage 319
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4085471	4087256	4784656		Bacillus_phage(100.0%)	1	NA	NA
WP_100272524.1|4085471_4087256_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.4	1.1e-18
>prophage 320
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4097471	4097954	4784656		Turkeypox_virus(100.0%)	1	NA	NA
WP_100272531.1|4097471_4097954_+	glutathione peroxidase	NA	A0A0M5HSM9	Turkeypox_virus	41.0	7.0e-18
>prophage 321
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4107074	4112892	4784656		Tupanvirus(33.33%)	5	NA	NA
WP_100272536.1|4107074_4107827_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.5	5.1e-07
WP_003832715.1|4107823_4108828_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_100272537.1|4108814_4109870_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_100272538.1|4110047_4111310_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.2	3.0e-20
WP_048226664.1|4111416_4112892_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	27.8	3.4e-15
>prophage 322
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4123868	4128415	4784656		Indivirus(33.33%)	6	NA	NA
WP_071446911.1|4123868_4124687_+	amino acid ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.7	9.5e-15
WP_100272546.1|4124686_4125472_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_100272547.1|4125461_4126139_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_100272548.1|4126148_4126961_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	33.3	6.8e-05
WP_048235471.1|4126964_4127750_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_020996435.1|4127746_4128415_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	41.0	1.7e-25
>prophage 323
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4135302	4142748	4784656		Escherichia_phage(66.67%)	6	NA	NA
WP_095533099.1|4135302_4136055_+	tetrathionate reductase subunit TtrB	NA	A0A077SL61	Escherichia_phage	40.0	8.7e-23
WP_100272552.1|4136055_4137078_+	tetrathionate reductase subunit TtrC	NA	NA	NA	NA	NA
WP_100272553.1|4137070_4140136_+	tetrathionate reductase subunit TtrA	NA	A0A077SK27	Escherichia_phage	26.0	3.6e-06
WP_003029358.1|4140230_4141043_-	methionine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_100272554.1|4141064_4141733_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_063941515.1|4141725_4142748_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.4	5.0e-13
>prophage 324
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4146909	4152000	4784656		environmental_halophage(33.33%)	5	NA	NA
WP_100272556.1|4146909_4148130_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	43.4	1.1e-96
WP_032943209.1|4148126_4149398_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003832649.1|4149372_4150119_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	25.0	7.8e-08
WP_020996440.1|4150135_4151623_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_003832645.1|4151631_4152000_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	38.5	9.5e-15
>prophage 325
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4172497	4178916	4784656		Staphylococcus_phage(33.33%)	4	NA	NA
WP_060682297.1|4172497_4174135_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	28.8	1.1e-30
WP_003832604.1|4174202_4176581_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.3	8.8e-170
WP_003832602.1|4176909_4177743_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_003030555.1|4177869_4178916_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	A0A0B5IW14	Pandoravirus	47.1	8.8e-82
>prophage 326
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4184213	4197771	4784656	tRNA	Brazilian_cedratvirus(22.22%)	15	NA	NA
WP_100272565.1|4184213_4184993_+	heme ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.7	1.3e-10
WP_100272566.1|4184989_4186432_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.3	1.3e-51
WP_048214327.1|4186493_4187207_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003836644.1|4187525_4187990_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
WP_008784579.1|4188067_4188817_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	9.3e-09
WP_048226751.1|4188816_4189368_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_048214330.1|4189428_4190409_-	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.2	8.7e-15
WP_003030571.1|4190530_4190830_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_032943162.1|4190834_4193222_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003832580.1|4193237_4194221_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|4194420_4194465_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_003030578.1|4194590_4194947_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_003030583.1|4195002_4195200_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_048997935.1|4195296_4195839_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	8.2e-15
WP_003832572.1|4195842_4197771_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.8	4.4e-127
>prophage 327
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4203036	4204481	4784656		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_100272569.1|4203036_4203798_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	1.8e-20
WP_008784570.1|4203881_4204481_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	34.3	3.5e-06
>prophage 328
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4212626	4213457	4784656		Bacillus_virus(100.0%)	1	NA	NA
WP_100272572.1|4212626_4213457_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	1.2e-73
>prophage 329
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4221002	4222223	4784656		Klosneuvirus(100.0%)	1	NA	NA
WP_100272578.1|4221002_4222223_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.0	3.2e-27
>prophage 330
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4227770	4228403	4784656		Bacillus_phage(100.0%)	1	NA	NA
WP_100272581.1|4227770_4228403_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	33.7	2.4e-13
>prophage 331
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4233482	4235429	4784656		Streptococcus_phage(100.0%)	1	NA	NA
WP_100272585.1|4233482_4235429_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.7	5.3e-40
>prophage 332
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4241542	4243699	4784656		Tupanvirus(100.0%)	2	NA	NA
WP_191553945.1|4241542_4242187_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	36.6	1.4e-16
WP_100272587.1|4242445_4243699_+	glycoside hydrolase family 18 protein	NA	A0A2K9L3D4	Tupanvirus	30.4	5.3e-25
>prophage 333
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4253042	4256846	4784656		Bacillus_phage(100.0%)	3	NA	NA
WP_008784519.1|4253042_4254326_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	27.0	8.5e-10
WP_008784518.1|4254420_4255191_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_008784517.1|4255355_4256846_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.4	6.2e-12
>prophage 334
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4261774	4262800	4784656		Bacillus_virus(100.0%)	1	NA	NA
WP_100272595.1|4261774_4262800_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	26.3	4.7e-11
>prophage 335
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4280821	4282072	4784656		Phage_21(100.0%)	1	NA	NA
WP_088902426.1|4280821_4282072_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-22
>prophage 336
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4286182	4287553	4784656		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_100272603.1|4286182_4287553_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.6	3.6e-107
>prophage 337
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4292676	4300953	4784656		Mycoplasma_phage(50.0%)	9	NA	NA
WP_003832287.1|4292676_4293813_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	40.3	7.2e-29
WP_032943032.1|4293796_4294654_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	25.8	4.3e-10
WP_003030794.1|4294650_4295430_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_100272906.1|4295457_4296504_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_008784438.1|4296641_4297148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003832281.1|4297169_4297991_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	1.9e-23
WP_020996481.1|4298006_4298918_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_003030804.1|4299007_4300252_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_003832278.1|4300251_4300953_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.4e-35
>prophage 338
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4308237	4308495	4784656		Erwinia_phage(100.0%)	1	NA	NA
WP_003030810.1|4308237_4308495_-	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	35.7	2.8e-05
>prophage 339
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4328106	4329177	4784656		Synechococcus_phage(100.0%)	1	NA	NA
WP_100272615.1|4328106_4329177_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	A0A0E3FCK0	Synechococcus_phage	47.8	2.1e-09
>prophage 340
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4346441	4348166	4784656		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_100272627.1|4346441_4347398_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.8	3.7e-18
WP_100272628.1|4347398_4348166_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.2	3.2e-12
>prophage 341
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4352850	4353969	4784656		Streptococcus_phage(100.0%)	1	NA	NA
WP_100272633.1|4352850_4353969_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	22.6	8.1e-09
>prophage 342
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4362475	4368610	4784656		Acinetobacter_phage(33.33%)	5	NA	NA
WP_100272640.1|4362475_4364254_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	34.7	2.0e-81
WP_003836725.1|4364309_4365743_-	PTS glucose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_020996495.1|4366159_4366957_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_100272641.1|4366967_4367972_-	DNA polymerase III subunit delta'	NA	A0A1V0DYC6	Dinoroseobacter_phage	33.3	2.0e-06
WP_048214457.1|4367968_4368610_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	38.2	1.3e-27
>prophage 343
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4371896	4373022	4784656		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|4371896_4372133_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_003036255.1|4372287_4373022_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	7.7e-16
>prophage 344
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4387655	4388606	4784656		Brevibacillus_phage(100.0%)	1	NA	NA
WP_016152632.1|4387655_4388606_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	30.9	1.6e-10
>prophage 345
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4403865	4404111	4784656		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003036157.1|4403865_4404111_+	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	50.0	1.1e-14
>prophage 346
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4408828	4412521	4784656		Morganella_phage(50.0%)	3	NA	NA
WP_003036136.1|4408828_4409749_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.6	1.0e-57
WP_032942948.1|4409904_4411125_+	multidrug efflux MFS transporter MdtG	NA	NA	NA	NA	NA
WP_048236462.1|4411189_4412521_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.1	1.0e-18
>prophage 347
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4420826	4421369	4784656		Scale_drop_disease_virus(100.0%)	1	NA	NA
WP_100272658.1|4420826_4421369_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	47.9	2.5e-27
>prophage 348
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4425557	4430923	4784656		Pelagibacter_phage(33.33%)	6	NA	NA
WP_003036082.1|4425557_4426391_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	39.7	3.0e-40
WP_032934412.1|4426437_4426920_-	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_003832084.1|4427021_4427576_-	molecular chaperone	NA	NA	NA	NA	NA
WP_008784332.1|4427599_4428337_-	phosphatase	NA	NA	NA	NA	NA
WP_032942943.1|4428547_4429486_-	glyoxylate/hydroxypyruvate reductase GhrA	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	30.0	9.9e-08
WP_032942942.1|4430134_4430923_-	phosphate starvation-inducible protein PhoH	NA	A0A1B2ICF6	Erwinia_phage	70.8	2.7e-91
>prophage 349
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4443085	4443259	4784656		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003036022.1|4443085_4443259_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 350
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4452631	4453552	4784656		Klosneuvirus(100.0%)	1	NA	NA
WP_100272669.1|4452631_4453552_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	39.0	3.6e-10
>prophage 351
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4461399	4462215	4784656		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_048235686.1|4461399_4462215_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.7	3.4e-12
>prophage 352
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4465543	4471989	4784656	integrase	Erysipelothrix_phage(66.67%)	3	4458384:4458397	4471344:4471357
4458384:4458397	attL	CAGCAACATCAATA	NA	NA	NA	NA
WP_100272671.1|4465543_4466782_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.4	1.1e-78
WP_100272672.1|4466961_4469019_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	39.4	8.8e-118
WP_100272673.1|4469028_4471989_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	38.2	1.2e-163
4471344:4471357	attR	TATTGATGTTGCTG	NA	NA	NA	NA
>prophage 353
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4477607	4478699	4784656		Clostridium_botulinum_C_phage(100.0%)	1	NA	NA
WP_100272677.1|4477607_4478699_+	MBL fold metallo-hydrolase	NA	Q332C0	Clostridium_botulinum_C_phage	35.6	1.3e-06
>prophage 354
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4482704	4483454	4784656		Cellulophaga_phage(100.0%)	1	NA	NA
WP_100272681.1|4482704_4483454_+	DNA-binding protein	NA	M1Q742	Cellulophaga_phage	46.5	7.6e-27
>prophage 355
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4489417	4489630	4784656		Enterobacteria_phage(100.0%)	1	NA	NA
WP_100272687.1|4489417_4489630_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	40.6	5.8e-09
>prophage 356
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4493108	4493768	4784656	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_008784297.1|4493108_4493768_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	2.6e-47
>prophage 357
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4498024	4500079	4784656		Bacillus_phage(100.0%)	1	NA	NA
WP_100272691.1|4498024_4500079_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.7e-20
>prophage 358
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4512624	4514532	4784656		Tupanvirus(100.0%)	1	NA	NA
WP_008784281.1|4512624_4514532_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	6.0e-52
>prophage 359
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4523299	4534141	4784656	tRNA	Bacillus_virus(20.0%)	8	NA	NA
WP_032942896.1|4523299_4524067_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	2.0e-30
WP_071444989.1|4524163_4526776_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.4	1.8e-19
WP_003836860.1|4527042_4528245_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_020996514.1|4528411_4529812_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.9	5.0e-80
WP_008784270.1|4530412_4531489_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	55.3	2.1e-102
WP_032942893.1|4531672_4532863_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_003831949.1|4532916_4533564_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003831948.1|4533592_4534141_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	32.6	3.5e-05
>prophage 360
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4549598	4554139	4784656		Bacillus_phage(100.0%)	3	NA	NA
WP_003831926.1|4549598_4551347_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	31.1	4.9e-61
WP_100272699.1|4551383_4553648_-	ComEC family protein	NA	NA	NA	NA	NA
WP_003035780.1|4553854_4554139_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	39.1	9.2e-10
>prophage 361
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4558293	4559382	4784656		Streptococcus_phage(100.0%)	1	NA	NA
WP_100272701.1|4558293_4559382_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.0	7.8e-81
>prophage 362
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4563505	4566839	4784656		Tetraselmis_virus(100.0%)	2	NA	NA
WP_003035753.1|4563505_4565788_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.0	3.8e-162
WP_003035751.1|4566098_4566839_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	1.0e-20
>prophage 363
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4572545	4589128	4784656	tRNA	Escherichia_phage(25.0%)	10	NA	NA
WP_003831905.1|4572545_4573163_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	1.2e-75
WP_100272706.1|4573173_4575618_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.7	4.6e-222
WP_048214580.1|4575854_4577147_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.0	4.3e-94
WP_100272707.1|4577239_4578583_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.3	1.6e-80
WP_003831898.1|4578593_4579205_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_100272708.1|4579316_4583381_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.2	2.9e-88
WP_002439523.1|4583515_4584010_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_003831889.1|4584556_4585525_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.3	1.9e-62
WP_003831887.1|4585639_4587406_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.3	3.5e-22
WP_048225901.1|4587406_4589128_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	2.4e-12
>prophage 364
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4593679	4602981	4784656		Streptococcus_phage(25.0%)	11	NA	NA
WP_048214585.1|4593679_4594807_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	28.0	2.5e-29
WP_003035378.1|4594848_4595337_-	YbjO family protein	NA	NA	NA	NA	NA
WP_008784246.1|4595396_4596242_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_043015734.1|4596238_4597192_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_003831665.1|4597201_4598335_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	1.1e-29
WP_043015732.1|4598473_4599586_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_100272709.1|4600019_4600496_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_100272710.1|4600586_4601489_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	33.6	3.3e-37
WP_008784243.1|4601548_4602271_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_100272711.1|4602254_4602545_-	YbjC family protein	NA	NA	NA	NA	NA
WP_003035358.1|4602717_4602981_+	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	67.9	3.8e-26
>prophage 365
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4611884	4613891	4784656		Escherichia_phage(50.0%)	2	NA	NA
WP_032942805.1|4611884_4612643_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	28.3	3.3e-14
WP_032944358.1|4612688_4613891_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.1	2.2e-97
>prophage 366
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4617614	4620065	4784656		Dickeya_phage(100.0%)	1	NA	NA
WP_100272717.1|4617614_4620065_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	74.6	1.3e-22
>prophage 367
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4625381	4627253	4784656		Planktothrix_phage(100.0%)	1	NA	NA
WP_057067350.1|4625381_4627253_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.1	1.4e-13
>prophage 368
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4631430	4639689	4784656		Synechococcus_phage(33.33%)	6	NA	NA
WP_032942786.1|4631430_4632093_-	fructose-6-phosphate aldolase	NA	A0A1D8KKK9	Synechococcus_phage	31.8	2.9e-22
WP_008784219.1|4632225_4633125_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_100272719.1|4633130_4635563_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	50.9	2.3e-08
WP_100272720.1|4635787_4636603_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_100272721.1|4636755_4638018_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_008784214.1|4638096_4639689_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	1.1e-59
>prophage 369
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4644827	4650077	4784656		Enterobacteria_phage(33.33%)	6	NA	NA
WP_003831579.1|4644827_4645343_-	outer membrane protein OmpX	NA	A5LH44	Enterobacteria_phage	33.7	1.2e-15
WP_008784209.1|4645754_4646642_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_003035253.1|4646945_4647449_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	28.1	5.5e-05
WP_003035251.1|4647814_4648561_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_003035248.1|4648698_4649358_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_003035246.1|4649354_4650077_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.1	2.8e-34
>prophage 370
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4656448	4662523	4784656		Synechococcus_phage(33.33%)	6	NA	NA
WP_100272724.1|4656448_4657126_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.6	5.8e-18
WP_100272725.1|4657201_4657468_+	DksA/TraR family C4-type zinc finger protein	NA	A0A2C9CZU7	Yersinia_phage	50.0	1.8e-15
WP_003831561.1|4657768_4658029_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_100272726.1|4658126_4659212_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_100272727.1|4659374_4660343_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_032942770.1|4660372_4662523_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	27.3	8.2e-42
>prophage 371
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4666513	4671480	4784656		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	4	NA	NA
WP_086503862.1|4666513_4667860_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.0	5.0e-53
WP_063940662.1|4668081_4668759_+	transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_048226024.1|4668755_4669751_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_060682507.1|4669743_4671480_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	5.1e-18
>prophage 372
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4681303	4685810	4784656		Streptococcus_phage(50.0%)	3	NA	NA
WP_100272734.1|4681303_4682212_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	30.7	7.8e-26
WP_008784186.1|4682297_4684319_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_008784184.1|4685087_4685810_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	2.4e-09
>prophage 373
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4689476	4692916	4784656		Klosneuvirus(50.0%)	3	NA	NA
WP_020996533.1|4689476_4690766_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.8	1.4e-20
WP_008784178.1|4690823_4691300_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_100272738.1|4691395_4692916_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.9	2.2e-81
>prophage 374
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4701278	4707828	4784656		Planktothrix_phage(33.33%)	7	NA	NA
WP_003831474.1|4701278_4702337_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	33.8	2.6e-20
WP_008784169.1|4702339_4703029_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003831470.1|4703028_4703802_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020996536.1|4703986_4704136_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_003831465.1|4704265_4705054_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_100272742.1|4705121_4706594_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	26.9	3.0e-11
WP_003831462.1|4706811_4707828_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.1	9.8e-78
>prophage 375
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4712163	4715679	4784656		Pandoravirus(33.33%)	4	NA	NA
WP_100272745.1|4712163_4713216_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	S4VUY9	Pandoravirus	47.3	1.3e-80
WP_003022994.1|4713533_4713908_+	YbgS-like family protein	NA	NA	NA	NA	NA
WP_032942740.1|4714021_4714963_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.9	2.9e-23
WP_008784161.1|4714959_4715679_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	33.6	5.8e-24
>prophage 376
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4742817	4747129	4784656		Escherichia_phage(75.0%)	5	NA	NA
WP_100272752.1|4742817_4744074_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	48.6	2.1e-93
WP_008784146.1|4744070_4744715_+	aldolase	NA	A0A077SK32	Escherichia_phage	55.1	1.3e-56
WP_008784145.1|4744721_4745531_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	42.4	3.2e-47
WP_100272753.1|4745511_4746288_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_008784143.1|4746316_4747129_+	3-keto-5-aminohexanoate cleavage protein	NA	A0A1V0SL81	Klosneuvirus	26.6	9.1e-18
>prophage 377
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4765604	4766396	4784656		Kaumoebavirus(100.0%)	1	NA	NA
WP_100272760.1|4765604_4766396_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	30.1	3.7e-08
>prophage 378
NZ_CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4772189	4781225	4784656	transposase	Acinetobacter_phage(25.0%)	8	NA	NA
WP_008784127.1|4772189_4773671_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	27.3	2.3e-43
WP_020996544.1|4773717_4774620_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	44.5	3.4e-66
WP_100272762.1|4774783_4776202_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	33.0	1.4e-61
WP_100247216.1|4776220_4776775_-	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_003022870.1|4776872_4777079_-	YbfA family protein	NA	NA	NA	NA	NA
WP_001670793.1|4777387_4777477_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_060682569.1|4777476_4779156_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_100272763.1|4779176_4781225_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	24.7	3.7e-31
