The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	0	35453	5883411		Amsacta_moorei_entomopoxvirus(100.0%)	40	NA	NA
WP_085520431.1|1079_2159_+	threonine-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_085520432.1|2905_3772_-	L-threonine kinase	NA	NA	NA	NA	NA
WP_004853834.1|3936_5151_-	acetate/propionate family kinase	NA	NA	NA	NA	NA
WP_004853831.1|5135_5588_-	propanediol utilization protein PduV	NA	NA	NA	NA	NA
WP_000441103.1|5592_5943_-	propanediol utilization microcompartment protein PduU	NA	NA	NA	NA	NA
WP_004124543.1|5942_6497_-	propanediol utilization microcompartment protein PduT	NA	NA	NA	NA	NA
WP_085520433.1|6499_7855_-	cobalamin reductase PduS	NA	NA	NA	NA	NA
WP_032694693.1|7851_8964_-	1-propanol dehydrogenase PduQ	NA	NA	NA	NA	NA
WP_085520434.1|8975_10367_-	CoA-acylating propionaldehyde dehydrogenase PduP	NA	NA	NA	NA	NA
WP_032694691.1|10363_11374_-	two-domain cob(I)yrinic acid a,c-diamide adenosyltransferase PduO	NA	NA	NA	NA	NA
WP_004133641.1|11383_11659_-	propanediol utilization microcompartment protein PduN	NA	NA	NA	NA	NA
WP_042946001.1|11662_12154_-	microcompartment protein PduM	NA	NA	NA	NA	NA
WP_014226641.1|12150_12783_-	phosphate propanoyltransferase	NA	NA	NA	NA	NA
WP_088167888.1|12782_13265_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_004853788.1|13268_13544_-	propanediol utilization microcompartment protein PduJ	NA	NA	NA	NA	NA
WP_014839408.1|13536_13914_-	propanediol dehydratase reactivase beta subunit PduH	NA	NA	NA	NA	NA
WP_014226638.1|13903_15736_-	propanediol dehydratase reactivase alpha subunit PduG	NA	NA	NA	NA	NA
WP_004133648.1|15872_16394_-	propanediol dehydratase small subunit PduE	NA	NA	NA	NA	NA
WP_004853784.1|16408_17083_-	propanediol dehydratase medium subunit PduD	NA	NA	NA	NA	NA
WP_104876650.1|17093_18758_-	propanediol dehydratase large subunit PduC	NA	NA	NA	NA	NA
WP_004205485.1|18776_19589_-	propanediol utilization microcompartment protein PduB	NA	NA	NA	NA	NA
WP_001183618.1|19585_19870_-	propanediol utilization microcompartment protein PduA	NA	NA	NA	NA	NA
WP_004105118.1|20394_21195_+	propanediol diffusion facilitator PduF	NA	NA	NA	NA	NA
WP_025107430.1|21383_22295_+	regulatory protein PocR	NA	NA	NA	NA	NA
WP_104876651.1|22851_24231_+	cobyrinate a,c-diamide synthase	NA	NA	NA	NA	NA
WP_064358538.1|24227_25187_+	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
WP_004133657.1|25197_25830_+	cobalt-precorrin-8 methylmutase	NA	NA	NA	NA	NA
WP_104876652.1|25826_26966_+	cobalt-precorrin-5B (C(1))-methyltransferase	NA	NA	NA	NA	NA
WP_104876653.1|26959_27565_+	cobalt-precorrin-7 (C(5))-methyltransferase	NA	NA	NA	NA	NA
WP_014839401.1|27554_28124_+	decarboxylating cobalt-precorrin-6B (C(15))-methyltransferase	NA	NA	NA	NA	NA
WP_014226631.1|28116_28890_+	cobalt-precorrin-4 methyltransferase	NA	NA	NA	NA	NA
WP_014226630.1|28870_29926_+	cobalt-precorrin 5A hydrolase	NA	NA	NA	NA	NA
WP_004105101.1|29925_30651_+	precorrin-3B C(17)-methyltransferase	NA	NA	NA	NA	NA
WP_032694683.1|30647_31433_+	cobalt-precorrin-6A reductase	NA	NA	NA	NA	NA
WP_014226628.1|31443_32238_+	sirohydrochlorin cobaltochelatase	NA	NA	NA	NA	NA
WP_014226627.1|32234_32948_+	cobalt-factor II C(20)-methyltransferase	NA	NA	NA	NA	NA
WP_014839397.1|32944_33682_+	cobalt ECF transporter S component CbiM	NA	NA	NA	NA	NA
WP_004133685.1|33683_33965_+	energy-coupling factor ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014839396.1|33951_34629_+	energy-coupling factor ABC transporter transmembrane protein	NA	NA	NA	NA	NA
WP_085520439.1|34637_35453_+	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	23.6	2.5e-07
>prophage 2
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	40486	43061	5883411	tRNA	Pandoravirus(50.0%)	3	NA	NA
WP_009651598.1|40486_41296_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.3	2.5e-15
WP_014226622.1|41418_41856_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_014226621.1|41855_43061_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.0	4.4e-69
>prophage 3
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	53594	54350	5883411		Bacillus_phage(100.0%)	1	NA	NA
WP_014226613.1|53594_54350_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	31.1	4.2e-09
>prophage 4
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	66749	67595	5883411		Vibrio_phage(100.0%)	1	NA	NA
WP_004853651.1|66749_67595_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	4.7e-41
>prophage 5
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	75036	80445	5883411		Streptococcus_phage(33.33%)	3	NA	NA
WP_014226599.1|75036_76176_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.0	7.2e-45
WP_014226598.1|76225_78979_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.6	2.0e-48
WP_014226597.1|79101_80445_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	26.6	1.4e-34
>prophage 6
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	83867	89192	5883411		Only_Syngen_Nebraska_virus(33.33%)	4	NA	NA
WP_004105009.1|83867_85505_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.3	1.1e-155
WP_004105008.1|85585_86884_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.6	3.7e-130
WP_032720184.1|86950_88060_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_004124321.1|88520_89192_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.6	3.5e-15
>prophage 7
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	107694	109727	5883411		Hokovirus(50.0%)	2	NA	NA
WP_014226587.1|107694_109122_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.3	3.9e-32
WP_004853621.1|109121_109727_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	36.5	6.1e-27
>prophage 8
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	112800	116575	5883411		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_004124266.1|112800_113562_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	47.6	2.9e-58
WP_009651549.1|113555_114182_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	2.4e-34
WP_085520458.1|114304_115423_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	34.6	6.5e-06
WP_104876659.1|115582_116575_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
>prophage 9
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	122684	125246	5883411		Catovirus(100.0%)	1	NA	NA
WP_085520465.1|122684_125246_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	21.7	4.0e-27
>prophage 10
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	135414	140626	5883411		Planktothrix_phage(66.67%)	3	NA	NA
WP_014226570.1|135414_137526_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.2	6.9e-17
WP_042945951.1|137522_138683_+	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_014226568.1|138682_140626_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.9	1.7e-30
>prophage 11
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	153457	156788	5883411		Chrysochromulina_ericina_virus(33.33%)	3	NA	NA
WP_014226555.1|153457_154225_-	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	27.9	1.1e-20
WP_014839337.1|154563_155817_+	2-dehydro-3-deoxy-6-phosphogalactonate aldolase	NA	Q6A202	Oenococcus_phage	30.9	1.0e-44
WP_014839336.1|156008_156788_-	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	27.8	1.3e-10
>prophage 12
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	164757	165579	5883411		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_014226545.1|164757_165579_-	manganese/iron ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.4	2.6e-12
>prophage 13
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	205632	206598	5883411		Tetraselmis_virus(100.0%)	1	NA	NA
WP_014226519.1|205632_206598_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	32.9	4.0e-36
>prophage 14
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	212207	220491	5883411	tRNA	Staphylococcus_phage(20.0%)	9	NA	NA
WP_032694770.1|212207_212885_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	3.5e-07
WP_014226515.1|212881_213745_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_085520507.1|213753_214632_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014226513.1|214668_214896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014226512.1|215100_215598_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	47.8	1.3e-27
WP_004104808.1|215678_216737_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.1	5.2e-114
WP_104876665.1|216808_217309_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_032720437.1|217439_220067_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	39.0	9.9e-82
WP_000906486.1|220305_220491_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 15
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	235420	240711	5883411		Bacillus_virus(25.0%)	5	NA	NA
WP_104876666.1|235420_236623_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.2	2.9e-28
WP_014226498.1|236968_237931_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.5	2.5e-131
WP_014839292.1|237941_240086_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.0	2.0e-189
WP_004104769.1|240058_240469_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_004853449.1|240465_240711_-	glutaredoxin-like protein NrdH	NA	A0A0E3T8B5	Gordonia_phage	37.3	6.1e-10
>prophage 16
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	256014	259500	5883411		Paramecium_bursaria_Chlorella_virus(50.0%)	4	NA	NA
WP_085520523.1|256014_256809_+	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	29.3	3.5e-06
WP_004853415.1|256844_257618_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014839277.1|257657_258578_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025107304.1|258723_259500_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.2	4.2e-12
>prophage 17
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	262564	263206	5883411		Bacillus_virus(100.0%)	1	NA	NA
WP_085520555.1|262564_263206_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	26.8	5.9e-12
>prophage 18
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	270578	272099	5883411		Pithovirus(100.0%)	1	NA	NA
WP_085520540.1|270578_272099_-	amino acid ABC transporter permease/ATP-binding protein	NA	W5SAS9	Pithovirus	26.5	3.9e-14
>prophage 19
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	285560	286154	5883411		Escherichia_phage(100.0%)	1	NA	NA
WP_014226456.1|285560_286154_-	hypothetical protein	NA	O21975	Escherichia_phage	55.2	5.9e-59
>prophage 20
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	304868	307305	5883411	integrase	Escherichia_phage(50.0%)	2	304527:304540	310227:310240
304527:304540	attL	GGAAGCCGACATGG	NA	NA	NA	NA
WP_014226446.1|304868_306110_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.3	1.1e-99
WP_004104655.1|306822_307305_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	1.8e-29
310227:310240	attR	CCATGTCGGCTTCC	NA	NA	NA	NA
>prophage 21
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	322568	323639	5883411		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_014226435.1|322568_323639_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	4.8e-91
>prophage 22
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	330442	333016	5883411		Enterobacteria_phage(100.0%)	1	NA	NA
WP_049070042.1|330442_333016_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	1.2e-127
>prophage 23
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	338845	340873	5883411		Synechococcus_phage(50.0%)	2	NA	NA
WP_032721134.1|338845_339301_+	DUF4385 domain-containing protein	NA	A0A222YVL1	Synechococcus_phage	47.0	2.8e-32
WP_032721132.1|339574_340873_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	2.4e-44
>prophage 24
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	346172	350693	5883411	tRNA	Streptomyces_phage(25.0%)	5	NA	NA
WP_004104599.1|346172_346598_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	4.6e-13
WP_004123719.1|346801_347875_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_014230405.1|347930_348620_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	51.2	4.6e-55
WP_004104596.1|348932_349316_+	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	69.9	3.1e-32
WP_004853282.1|349361_350693_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	1.1e-44
>prophage 25
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	356470	360167	5883411		Streptococcus_phage(50.0%)	3	NA	NA
WP_004853275.1|356470_358270_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.3	6.5e-24
WP_014230401.1|358285_359260_+	signal peptidase I	NA	NA	NA	NA	NA
WP_004104573.1|359486_360167_+	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.5	2.8e-20
>prophage 26
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	363174	378807	5883411	tRNA	Bacillus_phage(33.33%)	12	NA	NA
WP_004114478.1|363174_363435_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	3.2e-17
WP_014230398.1|363601_364450_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004853258.1|364658_365294_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_071846082.1|365313_365859_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.8	4.5e-05
WP_104876670.1|365855_367472_-	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_104876992.1|367646_371534_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.0	1.7e-130
WP_025106584.1|372096_373533_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.6	1.3e-11
WP_104876671.1|373546_374251_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_014230390.1|374237_375575_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	33.1	3.0e-10
WP_002914032.1|375640_375979_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_032693157.1|376037_377228_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_004104543.1|377553_378807_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	2.5e-99
>prophage 27
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	393130	399489	5883411		Faustovirus(20.0%)	8	NA	NA
WP_004134936.1|393130_394345_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.6e-34
WP_002913991.1|394371_394758_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
WP_004104506.1|394777_395101_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.6e-21
WP_004104505.1|395174_395690_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_104876672.1|395705_397556_+	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.8	2.5e-103
WP_004104503.1|397557_397893_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_004104502.1|397894_398095_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_014230371.1|398202_399489_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	38.6	3.4e-35
>prophage 28
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	411660	412092	5883411		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_004114414.1|411660_412092_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	38.6	1.7e-18
>prophage 29
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	423641	426643	5883411		Bodo_saltans_virus(50.0%)	2	NA	NA
WP_085520604.1|423641_425018_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	3.8e-40
WP_014230355.1|425176_426643_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.3	9.8e-87
>prophage 30
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	430623	430833	5883411		Escherichia_phage(100.0%)	1	NA	NA
WP_014230352.1|430623_430833_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	73.9	2.5e-20
>prophage 31
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	443255	444931	5883411		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_014230347.1|443255_443897_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.2	1.2e-28
WP_004853107.1|443893_444931_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	1.4e-71
>prophage 32
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	448434	449724	5883411		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004123491.1|448434_449724_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	7.1e-65
>prophage 33
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	456990	458691	5883411		Cyanophage(50.0%)	2	NA	NA
WP_004104417.1|456990_457704_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	2.4e-38
WP_014839185.1|457824_458691_+	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	34.5	9.7e-34
>prophage 34
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	492420	501013	5883411		Paenibacillus_phage(25.0%)	10	NA	NA
WP_004870750.1|492420_493296_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	32.4	7.5e-18
WP_004853033.1|493507_493933_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_104876677.1|493919_494369_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_085520627.1|494432_495008_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_014839168.1|495101_496001_+	Dyp-type peroxidase	NA	S4VVJ7	Pandoravirus	32.6	1.9e-24
WP_014230322.1|496226_497243_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004123378.1|497242_498076_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_085520629.1|498075_498951_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_014230320.1|498940_500035_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	38.5	1.4e-29
WP_032751912.1|500101_501013_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	42.1	1.7e-57
>prophage 35
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	505261	515196	5883411		Hokovirus(25.0%)	9	NA	NA
WP_032693091.1|505261_506989_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	32.0	3.3e-17
WP_002913505.1|507033_507291_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_046878226.1|507672_508644_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.5e-75
WP_009654873.1|508803_509565_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_104876995.1|509798_510794_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_085520634.1|510868_512893_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.4	1.2e-146
WP_004123346.1|512885_513104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004852990.1|513100_514099_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_104876678.1|514188_515196_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	26.3	9.6e-09
>prophage 36
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	533037	533781	5883411		Clostridioides_phage(100.0%)	1	NA	NA
WP_049069336.1|533037_533781_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.6	1.6e-13
>prophage 37
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	538942	543899	5883411		Lactobacillus_phage(33.33%)	5	NA	NA
WP_085520642.1|538942_539875_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	8.0e-10
WP_032694846.1|540055_540919_-	hypothetical protein	NA	A0A1W6JPD1	Morganella_phage	25.2	4.5e-07
WP_004852922.1|541514_541769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014230292.1|542439_542775_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_032694845.1|543002_543899_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	78.2	8.5e-126
>prophage 38
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	553018	554107	5883411		Pandoravirus(100.0%)	1	NA	NA
WP_014230282.1|553018_554107_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
>prophage 39
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	562519	563656	5883411		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_009654654.1|562519_563656_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	1.5e-21
>prophage 40
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	570078	571596	5883411		Mollivirus(100.0%)	1	NA	NA
WP_004123211.1|570078_571596_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.4e-88
>prophage 41
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	575889	578094	5883411		Salmonella_phage(66.67%)	4	NA	NA
WP_004852881.1|575889_576663_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.7	3.9e-10
WP_085521363.1|576704_577202_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014230267.1|577269_577836_-	hypothetical protein	NA	J9Q7G7	Salmonella_phage	58.3	7.2e-46
WP_085520656.1|577839_578094_-	hypothetical protein	NA	J9Q735	Salmonella_phage	43.4	4.1e-09
>prophage 42
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	582359	583379	5883411		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004852866.1|582359_583379_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	7.9e-19
>prophage 43
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	595195	595795	5883411		Salmonella_phage(100.0%)	1	NA	NA
WP_004852850.1|595195_595795_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 44
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	614934	615486	5883411	integrase	Escherichia_phage(100.0%)	1	608558:608571	616237:616250
608558:608571	attL	AACGTCAGGATCTG	NA	NA	NA	NA
WP_014839116.1|614934_615486_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.6	2.1e-50
WP_014839116.1|614934_615486_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.6	2.1e-50
616237:616250	attR	CAGATCCTGACGTT	NA	NA	NA	NA
>prophage 45
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	637063	639541	5883411	transposase	Sodalis_phage(50.0%)	2	NA	NA
WP_085520674.1|637063_638044_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	56.3	5.4e-73
WP_014230229.1|638092_639541_-	catalase	NA	A0A2K9L0T1	Tupanvirus	46.7	6.9e-101
>prophage 46
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	642646	643852	5883411		Oenococcus_phage(100.0%)	1	NA	NA
WP_014839100.1|642646_643852_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.8e-25
>prophage 47
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	651708	663493	5883411		Pseudomonas_phage(33.33%)	7	NA	NA
WP_085520685.1|651708_652779_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	42.9	3.9e-08
WP_004104002.1|652850_653105_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	64.0	8.2e-26
WP_004852757.1|653104_654235_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	7.3e-175
WP_014839096.1|654338_656624_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.9	3.5e-285
WP_014230217.1|656968_657697_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_004852752.1|657882_660516_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.8	1.6e-92
WP_085520687.1|660646_663493_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.3	1.9e-41
>prophage 48
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	667637	676215	5883411		Enterobacteria_phage(25.0%)	7	NA	NA
WP_025106708.1|667637_668738_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.3	1.2e-118
WP_104876682.1|668840_669893_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_085520691.1|669965_671030_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	L7Y5F8	Megavirus	47.2	1.4e-18
WP_085520693.1|671029_671680_+	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
WP_025106712.1|671756_673400_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.3	3.2e-09
WP_014230209.1|673568_675005_+	magnesium transporter	NA	NA	NA	NA	NA
WP_014230208.1|674967_676215_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	44.3	9.5e-67
>prophage 49
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	687262	689773	5883411		Ralstonia_phage(100.0%)	1	NA	NA
WP_104876683.1|687262_689773_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	23.0	7.9e-20
>prophage 50
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	703371	712431	5883411		Vibrio_phage(50.0%)	9	NA	NA
WP_004122954.1|703371_704379_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	49.5	3.1e-84
WP_014230181.1|704428_705187_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_032693687.1|705267_705861_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_004114143.1|705922_706207_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_085520729.1|706344_708102_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.2	2.2e-101
WP_049071441.1|708250_708970_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_014230177.1|708966_710163_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	24.8	2.8e-23
WP_004122937.1|710493_710838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085520731.1|710841_712431_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	31.1	4.0e-17
>prophage 51
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	718190	722498	5883411		Clostridioides_phage(50.0%)	4	NA	NA
WP_004122922.1|718190_718760_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	5.2e-12
WP_004852707.1|719186_719894_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_014230172.1|719935_720913_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_085520736.1|721031_722498_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.1	1.7e-43
>prophage 52
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	733723	734581	5883411		Catovirus(100.0%)	1	NA	NA
WP_104876687.1|733723_734581_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	30.5	9.0e-24
>prophage 53
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	738699	742666	5883411		Acinetobacter_phage(50.0%)	3	NA	NA
WP_032693692.1|738699_740673_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	35.8	8.1e-12
WP_042945714.1|740792_741629_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_004103895.1|741997_742666_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.8	6.9e-56
>prophage 54
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	746424	747945	5883411		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_014230153.1|746424_747945_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.0	3.1e-11
>prophage 55
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	763854	764589	5883411		Streptococcus_phage(100.0%)	1	NA	NA
WP_014230141.1|763854_764589_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	41.6	1.3e-50
>prophage 56
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	768784	769339	5883411		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_014839047.1|768784_769339_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.2	5.1e-20
>prophage 57
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	775912	784863	5883411	tRNA	Enterobacteria_phage(60.0%)	10	NA	NA
WP_014230133.1|775912_776860_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	6.2e-10
WP_104876696.1|776843_777581_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004103838.1|777555_777669_-	protein YohO	NA	NA	NA	NA	NA
WP_158660689.1|777717_778110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014230131.1|778167_778926_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	69.3	3.1e-76
WP_004852614.1|779136_780825_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	84.5	1.9e-259
WP_014230130.1|780818_781538_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_004852612.1|781591_782059_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	79.9	5.1e-66
WP_014230129.1|782162_782630_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_014230128.1|782829_784863_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.5	1.4e-54
>prophage 58
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	793202	795179	5883411		Tetraselmis_virus(100.0%)	1	NA	NA
WP_104876700.1|793202_795179_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	45.5	6.8e-160
>prophage 59
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	803218	804586	5883411		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_104876703.1|803218_804586_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	28.5	5.6e-44
>prophage 60
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	813219	821614	5883411	tRNA	Bacillus_phage(33.33%)	8	NA	NA
WP_104876996.1|813219_814083_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.4	1.1e-08
WP_104876707.1|814093_814867_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.1	2.7e-27
WP_032693715.1|815283_816084_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014230103.1|816070_816541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009654032.1|816541_817435_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.9	8.8e-14
WP_014230102.1|817679_819041_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	91.8	4.7e-200
WP_014230101.1|819359_820082_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	2.4e-30
WP_014838977.1|820078_821614_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	27.6	6.3e-28
>prophage 61
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	840115	841090	5883411		Bacillus_virus(100.0%)	1	NA	NA
WP_104876712.1|840115_841090_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.4	1.6e-08
>prophage 62
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	853981	860869	5883411		Catovirus(25.0%)	5	NA	NA
WP_004122537.1|853981_854623_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.3	1.7e-35
WP_004852489.1|854713_855295_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.6	1.3e-31
WP_101869465.1|855322_857170_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_014230075.1|857409_858996_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.5	2.9e-36
WP_014230073.1|859978_860869_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	41.0	7.3e-45
>prophage 63
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	876073	897818	5883411		Tupanvirus(20.0%)	17	NA	NA
WP_042945671.1|876073_877492_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.5	5.4e-50
WP_042945670.1|877508_878885_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.4	4.0e-34
WP_070596194.1|878962_880105_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_042945666.1|880213_881257_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_104876719.1|881367_882774_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.9	4.3e-39
WP_042946238.1|883144_884146_+	NAD-dependent epimerase	NA	A0A2K9L4U8	Tupanvirus	31.9	1.7e-34
WP_104876720.1|884416_885583_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.2	3.1e-112
WP_004138729.1|886156_886279_-	small membrane protein	NA	NA	NA	NA	NA
WP_042945661.1|886751_887756_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	2.3e-31
WP_004138730.1|889061_889829_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014230053.1|889828_890569_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	24.8	1.5e-06
WP_014230052.1|890582_892475_+	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_004852435.1|892493_893648_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	40.9	3.0e-75
WP_032693856.1|893644_894538_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_032693855.1|894550_895684_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_104876721.1|895815_897135_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	36.0	9.6e-09
WP_004122447.1|897218_897818_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A1V0SIZ6	Klosneuvirus	34.2	1.5e-17
>prophage 64
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	903362	904262	5883411		Cellulophaga_phage(100.0%)	1	NA	NA
WP_014230042.1|903362_904262_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	89.5	5.4e-11
>prophage 65
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	916785	918843	5883411		Faustovirus(50.0%)	2	NA	NA
WP_104876726.1|916785_917988_-	cysteine desulfurase NifS	NA	A0A1X7C038	Faustovirus	27.5	4.5e-29
WP_014230029.1|918018_918843_-	Fe-S cluster assembly protein NifU	NA	A0A218MKD1	uncultured_virus	45.1	9.5e-23
>prophage 66
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	932021	937001	5883411		Streptococcus_phage(50.0%)	3	NA	NA
WP_104876728.1|932021_934124_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	6.3e-63
WP_014230018.1|934229_935654_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_104876729.1|935828_937001_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	81.0	1.4e-184
>prophage 67
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	971160	976696	5883411		Caulobacter_phage(50.0%)	3	NA	NA
WP_104876732.1|971160_972105_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	38.4	8.0e-50
WP_104876733.1|972408_973188_+	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_104876734.1|973171_976696_+	DEAD/DEAH box helicase	NA	M1IHE6	Paramecium_bursaria_Chlorella_virus	25.2	2.0e-16
>prophage 68
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	987114	987309	5883411		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_020078417.1|987114_987309_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	49.0	7.7e-08
>prophage 69
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	999628	1005880	5883411	integrase	Leptospira_phage(50.0%)	3	996816:996828	1007122:1007134
996816:996828	attL	GACGGCGGCTATT	NA	NA	NA	NA
WP_104876747.1|999628_1002820_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.5	1.5e-63
WP_104876748.1|1002816_1003986_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_044173424.1|1004629_1005880_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.8	3.3e-75
1007122:1007134	attR	GACGGCGGCTATT	NA	NA	NA	NA
>prophage 70
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1012411	1013326	5883411		Lactobacillus_phage(100.0%)	1	NA	NA
WP_032720305.1|1012411_1013326_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	30.2	1.5e-08
>prophage 71
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1016845	1019966	5883411		Vibrio_virus(50.0%)	3	NA	NA
WP_085520821.1|1016845_1018252_+	DUF1738 domain-containing protein	NA	A2I2Y7	Vibrio_virus	67.5	3.8e-64
WP_032738874.1|1018488_1019061_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042934119.1|1019255_1019966_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	29.1	2.0e-08
>prophage 72
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1032432	1033182	5883411	integrase	Pseudomonas_phage(100.0%)	1	1020419:1020432	1034455:1034468
1020419:1020432	attL	GCGCAGCGCCGGGT	NA	NA	NA	NA
WP_085520836.1|1032432_1033182_-|integrase	site-specific integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.5	6.4e-34
WP_085520836.1|1032432_1033182_-|integrase	site-specific integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.5	6.4e-34
1034455:1034468	attR	ACCCGGCGCTGCGC	NA	NA	NA	NA
>prophage 73
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1042437	1050288	5883411		Leptospira_phage(33.33%)	4	NA	NA
WP_085520841.1|1042437_1045500_-	efflux RND transporter permease subunit	NA	S5VL66	Leptospira_phage	22.3	4.0e-26
WP_032750435.1|1045499_1046585_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_014229901.1|1047118_1047550_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	42.8	5.0e-23
WP_085520843.1|1047600_1050288_+	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.7	6.2e-71
>prophage 74
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1057664	1058426	5883411		Planktothrix_phage(100.0%)	1	NA	NA
WP_025106087.1|1057664_1058426_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.4	1.5e-30
>prophage 75
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1069002	1081179	5883411		Burkholderia_phage(28.57%)	12	NA	NA
WP_085520854.1|1069002_1070460_-	glucosyl transferase GtrII family protein	NA	E5AGC8	Erwinia_phage	40.7	4.5e-100
WP_085520856.1|1070456_1071449_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	39.2	2.2e-50
WP_046878072.1|1071445_1071835_-	GtrA family protein	NA	NA	NA	NA	NA
WP_014229889.1|1072486_1073557_-	porin	NA	Q1MVN1	Enterobacteria_phage	51.1	5.3e-90
WP_004852229.1|1074183_1074465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014229888.1|1074507_1075203_+	phosphohydrolase	NA	S4W232	Pandoravirus	26.5	2.3e-06
WP_042934379.1|1075259_1076693_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.5	1.7e-96
WP_014229886.1|1076673_1077168_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.0	1.4e-32
WP_014229885.1|1077142_1078054_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_004852222.1|1078237_1079149_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_025106102.1|1079224_1079404_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_085521375.1|1079511_1081179_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	36.7	9.3e-17
>prophage 76
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1087884	1088637	5883411		Bacillus_virus(100.0%)	1	NA	NA
WP_004852203.1|1087884_1088637_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.4e-27
>prophage 77
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1105914	1107429	5883411		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_014229863.1|1105914_1107429_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	27.6	1.5e-10
>prophage 78
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1114452	1121098	5883411	tRNA	Tupanvirus(33.33%)	7	NA	NA
WP_009652018.1|1114452_1116186_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.4	4.1e-84
WP_032720340.1|1116415_1116985_+	VOC family protein	NA	NA	NA	NA	NA
WP_049069085.1|1117061_1117805_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_004852151.1|1118028_1119051_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_009652021.1|1119047_1119791_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	29.1	1.5e-22
WP_004122068.1|1119830_1120226_-	membrane protein	NA	NA	NA	NA	NA
WP_085520869.1|1120279_1121098_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	81.1	1.5e-57
>prophage 79
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1124970	1131311	5883411		Bacillus_virus(25.0%)	7	NA	NA
WP_085520871.1|1124970_1125492_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
WP_004103390.1|1125573_1126185_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_004852130.1|1126193_1127204_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.6	8.1e-08
WP_014229854.1|1127412_1128198_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_014229853.1|1128197_1128950_-	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.0	3.0e-15
WP_014229852.1|1129028_1129973_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_004113780.1|1129988_1131311_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	36.8	1.5e-14
>prophage 80
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1136334	1142008	5883411		Dickeya_phage(50.0%)	4	NA	NA
WP_014229846.1|1136334_1137669_+	2-hydroxycarboxylate transporter family protein	NA	A0A140XAH4	Dickeya_phage	62.9	1.2e-22
WP_014229845.1|1137733_1139176_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_004852107.1|1139301_1140171_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004122041.1|1140532_1142008_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	3.7e-78
>prophage 81
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1149462	1150431	5883411		Pseudoalteromonas_phage(50.0%)	2	NA	NA
WP_014229839.1|1149462_1150122_-	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	32.8	2.6e-15
WP_004103351.1|1150200_1150431_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	58.8	1.3e-14
>prophage 82
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1159680	1160334	5883411		Escherichia_phage(100.0%)	1	NA	NA
WP_014229829.1|1159680_1160334_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	52.1	1.7e-59
>prophage 83
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1167802	1169851	5883411		Moraxella_phage(100.0%)	1	NA	NA
WP_032694908.1|1167802_1169851_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.4	2.6e-85
>prophage 84
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1175104	1175314	5883411		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|1175104_1175314_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 85
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1182750	1184310	5883411		Moraxella_phage(100.0%)	1	NA	NA
WP_004852040.1|1182750_1184310_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.0	6.6e-41
>prophage 86
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1188154	1189510	5883411		Pandoravirus(100.0%)	1	NA	NA
WP_085520891.1|1188154_1189510_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	34.5	2.5e-44
>prophage 87
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1196672	1204757	5883411	tRNA	Bacillus_phage(66.67%)	7	NA	NA
WP_085520900.1|1196672_1197767_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	W8CYL7	Bacillus_phage	28.5	1.7e-14
WP_014229808.1|1197774_1198914_+	alginate lyase family protein	NA	NA	NA	NA	NA
WP_004113724.1|1199084_1199429_-	RidA family protein	NA	NA	NA	NA	NA
WP_014229807.1|1199561_1201472_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.9	4.2e-90
WP_032721102.1|1201539_1202235_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_085520902.1|1202278_1202863_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_014229806.1|1203071_1204757_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	4.2e-33
>prophage 88
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1220354	1220966	5883411		Geobacillus_virus(100.0%)	1	NA	NA
WP_009651970.1|1220354_1220966_+	membrane-bound lytic murein transglycosylase EmtA	NA	A0A0H3V0Q1	Geobacillus_virus	40.7	3.0e-05
>prophage 89
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1242098	1248295	5883411		Planktothrix_phage(25.0%)	6	NA	NA
WP_025108425.1|1242098_1243187_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	6.7e-24
WP_014229781.1|1243365_1244052_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	30.1	3.0e-06
WP_004851947.1|1244111_1245005_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032718840.1|1245320_1246961_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.2	1.0e-132
WP_014229779.1|1247194_1247689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014229778.1|1247767_1248295_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	58.2	8.4e-49
>prophage 90
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1255112	1255571	5883411		Acinetobacter_phage(100.0%)	1	NA	NA
WP_009651983.1|1255112_1255571_+	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	35.9	2.1e-19
>prophage 91
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1258593	1260066	5883411		Enterobacteria_phage(100.0%)	1	NA	NA
WP_032718844.1|1258593_1260066_-	purine permease	NA	Q9KX94	Enterobacteria_phage	27.7	2.8e-25
>prophage 92
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1278646	1279654	5883411	integrase	uncultured_Caudovirales_phage(100.0%)	1	1264840:1264859	1289093:1289112
1264840:1264859	attL	GCTGGCTTCCTGCTCGACAA	NA	NA	NA	NA
WP_074193846.1|1278646_1279654_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J5F8	uncultured_Caudovirales_phage	33.4	2.1e-48
WP_074193846.1|1278646_1279654_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J5F8	uncultured_Caudovirales_phage	33.4	2.1e-48
1289093:1289112	attR	TTGTCGAGCAGGAAGCCAGC	NA	NA	NA	NA
>prophage 93
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1283330	1286207	5883411		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_025108450.1|1283330_1285010_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	8.7e-23
WP_004103157.1|1285259_1286207_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	3.0e-44
>prophage 94
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1289420	1295126	5883411		Pseudomonas_phage(33.33%)	7	NA	NA
WP_004851884.1|1289420_1290503_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	40.0	1.1e-07
WP_014229755.1|1290502_1291342_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_004851880.1|1291338_1291731_+	SirB family protein	NA	NA	NA	NA	NA
WP_004851879.1|1291734_1292547_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004103146.1|1292586_1293441_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.8	8.9e-48
WP_004121802.1|1293529_1294630_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_009651994.1|1294895_1295126_+	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	46.7	9.1e-08
>prophage 95
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1300487	1301276	5883411		Bacillus_virus(100.0%)	1	NA	NA
WP_014838761.1|1300487_1301276_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.4	1.0e-29
>prophage 96
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1317710	1327785	5883411		Escherichia_phage(20.0%)	10	NA	NA
WP_014838755.1|1317710_1319246_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	3.7e-20
WP_014229743.1|1319242_1319953_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_004103123.1|1319952_1320630_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_004121732.1|1321511_1322354_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	46.3	1.6e-12
WP_014229741.1|1322396_1322855_-	YchJ family protein	NA	NA	NA	NA	NA
WP_014229740.1|1322967_1323876_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_004851838.1|1323956_1324970_+	two-component system response regulator RssB	NA	Q6XM27	Feldmannia_irregularis_virus	27.7	3.4e-06
WP_104876758.1|1325167_1326070_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.2	1.7e-57
WP_004121719.1|1326204_1326612_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_032720584.1|1327167_1327785_+	thymidine kinase	NA	A0A191ZC13	Erwinia_phage	52.6	3.3e-52
>prophage 97
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1336086	1338983	5883411		Bacillus_virus(66.67%)	3	NA	NA
WP_004851823.1|1336086_1337100_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.2	6.4e-13
WP_004851821.1|1337096_1338101_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	28.6	6.8e-15
WP_014229737.1|1338146_1338983_+	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	41.2	3.9e-08
>prophage 98
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1348345	1366332	5883411	tRNA	Tupanvirus(25.0%)	18	NA	NA
WP_004102966.1|1348345_1350274_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	6.7e-128
WP_052746887.1|1350277_1350820_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.3	5.3e-14
WP_001124225.1|1350916_1351114_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004102963.1|1351164_1351521_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|1351644_1351689_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_004851795.1|1351918_1352902_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	2.9e-34
WP_104876759.1|1352917_1355305_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_004851790.1|1355309_1355609_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	9.4e-13
WP_009653750.1|1355709_1356696_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_014229729.1|1356722_1357523_-	MetQ/NlpA family lipoprotein	NA	NA	NA	NA	NA
WP_104876760.1|1357747_1358299_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_038424643.1|1358298_1359048_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.9	4.2e-09
WP_038424642.1|1359129_1359594_+	endopeptidase	NA	NA	NA	NA	NA
WP_104876761.1|1359755_1361198_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	34.7	2.6e-55
WP_014229724.1|1361232_1361460_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_014229723.1|1361577_1362624_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	A0A0B5IW14	Pandoravirus	47.4	2.3e-82
WP_004851771.1|1362777_1363611_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_014229722.1|1363953_1366332_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.0	2.9e-173
>prophage 99
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1384038	1385259	5883411		environmental_halophage(100.0%)	1	NA	NA
WP_104876764.1|1384038_1385259_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	42.6	5.8e-93
>prophage 100
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1403407	1405371	5883411		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
WP_025108198.1|1403407_1404358_+	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.9	4.8e-34
WP_085520946.1|1404354_1405371_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.4	3.0e-42
>prophage 101
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1418404	1422732	5883411		Bacillus_virus(50.0%)	3	NA	NA
WP_049076253.1|1418404_1419193_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.8	8.5e-29
WP_100248307.1|1419331_1421404_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_014229681.1|1421910_1422732_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	3.3e-15
>prophage 102
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1439459	1443430	5883411		Staphylococcus_virus(50.0%)	3	NA	NA
WP_154971653.1|1439459_1442360_+	hypothetical protein	NA	Q4ZC50	Staphylococcus_virus	39.2	1.3e-34
WP_085520970.1|1442362_1443139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061772558.1|1443166_1443430_+	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	52.0	4.0e-07
>prophage 103
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1456047	1457118	5883411		Bacillus_virus(100.0%)	1	NA	NA
WP_032692928.1|1456047_1457118_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	9.8e-28
>prophage 104
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1460544	1461417	5883411		Lactobacillus_phage(100.0%)	1	NA	NA
WP_014229640.1|1460544_1461417_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.3e-05
>prophage 105
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1465177	1465729	5883411	integrase	Escherichia_phage(100.0%)	1	1458239:1458253	1468473:1468487
1458239:1458253	attL	GATATGCAGGACGTT	NA	NA	NA	NA
WP_014838689.1|1465177_1465729_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	55.1	2.6e-53
WP_014838689.1|1465177_1465729_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	55.1	2.6e-53
1468473:1468487	attR	AACGTCCTGCATATC	NA	NA	NA	NA
>prophage 106
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1471751	1477148	5883411	integrase	Escherichia_phage(33.33%)	4	1468189:1468202	1476104:1476117
1468189:1468202	attL	AACAGCCCATCGCG	NA	NA	NA	NA
WP_014229630.1|1471751_1472300_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.9	7.2e-51
WP_014229629.1|1472725_1475131_+	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
WP_014229628.1|1475205_1476171_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SJ29	Klosneuvirus	26.9	1.8e-09
1476104:1476117	attR	AACAGCCCATCGCG	NA	NA	NA	NA
WP_032692922.1|1476167_1477148_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.1	4.2e-09
>prophage 107
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1482213	1486307	5883411		Escherichia_phage(50.0%)	5	NA	NA
WP_085521003.1|1482213_1482984_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.1	5.6e-17
WP_032692917.1|1482997_1483627_-	LysE family transporter	NA	NA	NA	NA	NA
WP_004119381.1|1483851_1484487_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_085521005.1|1484593_1485400_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_014229621.1|1485422_1486307_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	55.8	2.8e-81
>prophage 108
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1500812	1509512	5883411		Orpheovirus(20.0%)	9	NA	NA
WP_004851490.1|1500812_1501448_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.3	1.6e-22
WP_014838673.1|1501478_1502627_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	5.0e-86
WP_085521015.1|1502925_1504110_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_014229606.1|1504222_1505134_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004851481.1|1505152_1506178_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	1.8e-31
WP_049082851.1|1506474_1506564_+	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_004851479.1|1506728_1507895_+	MFS transporter	NA	NA	NA	NA	NA
WP_004851476.1|1507951_1508533_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	45.3	9.0e-44
WP_014229604.1|1508657_1509512_-	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	38.7	4.7e-17
>prophage 109
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1513670	1515148	5883411		Indivirus(50.0%)	2	NA	NA
WP_042945298.1|1513670_1514567_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	29.7	2.7e-07
WP_004119475.1|1514626_1515148_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	56.3	2.1e-47
>prophage 110
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1523788	1525063	5883411	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_085521025.1|1523788_1525063_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.8	7.2e-86
>prophage 111
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1536244	1537615	5883411		Pandoravirus(100.0%)	1	NA	NA
WP_014229586.1|1536244_1537615_-	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	33.7	8.0e-67
>prophage 112
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1542972	1543176	5883411		Salmonella_phage(100.0%)	1	NA	NA
WP_004851411.1|1542972_1543176_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	67.2	3.5e-19
>prophage 113
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1547104	1547719	5883411		Clostridium_phage(100.0%)	1	NA	NA
WP_032442199.1|1547104_1547719_-	recombinase family protein	NA	A0A0A8WJD4	Clostridium_phage	28.1	2.5e-07
>prophage 114
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1551156	1552926	5883411		Burkholderia_virus(100.0%)	1	NA	NA
WP_032442195.1|1551156_1552926_-	recombinase family protein	NA	Q6V7T7	Burkholderia_virus	28.3	6.4e-32
>prophage 115
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1562592	1565561	5883411		Bacillus_phage(50.0%)	3	NA	NA
WP_014229576.1|1562592_1563894_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.0	2.5e-17
WP_009654787.1|1564212_1564902_+	VIT family protein	NA	NA	NA	NA	NA
WP_032719220.1|1565078_1565561_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	38.5	3.9e-16
>prophage 116
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1579727	1580243	5883411		Streptococcus_phage(100.0%)	1	NA	NA
WP_014229564.1|1579727_1580243_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.8	4.1e-24
>prophage 117
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1596766	1599544	5883411		Lactobacillus_phage(100.0%)	1	NA	NA
WP_025105802.1|1596766_1599544_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	30.8	4.7e-66
>prophage 118
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1610469	1611429	5883411		Salmonella_phage(100.0%)	1	NA	NA
WP_004851304.1|1610469_1611429_-	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	1.3e-52
>prophage 119
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1618778	1620935	5883411		Bacillus_virus(100.0%)	1	NA	NA
WP_085521056.1|1618778_1620935_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	34.4	1.6e-16
>prophage 120
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1631308	1662486	5883411	holin,terminase,integrase	Klebsiella_phage(23.53%)	29	1641347:1641361	1659964:1659978
WP_085521065.1|1631308_1631917_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	38.3	9.8e-25
WP_085521067.1|1631957_1632815_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_014229529.1|1632816_1633434_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.6	4.4e-73
WP_104876782.1|1633444_1635868_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.4	9.7e-217
WP_014838619.1|1636016_1636268_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_014229527.1|1636370_1637081_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_004102449.1|1637074_1637635_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_004851259.1|1637697_1638039_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_004851258.1|1638175_1638502_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	53.9	7.6e-24
WP_085521071.1|1638708_1639923_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.7	9.7e-48
WP_085521073.1|1639937_1640957_+	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_029946863.1|1641000_1642377_+	MHS family MFS transporter	NA	NA	NA	NA	NA
1641347:1641361	attL	TAGCGCCGGTGTTGC	NA	NA	NA	NA
WP_004851251.1|1642610_1644074_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	31.2	3.2e-45
WP_004851249.1|1644351_1644783_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	39.3	1.5e-19
WP_004851246.1|1644834_1645521_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004851244.1|1645611_1646361_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_104876783.1|1646532_1648575_+	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	19.8	1.8e-14
WP_104876784.1|1648726_1649866_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	48.2	2.1e-92
WP_012541846.1|1649846_1650104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048262120.1|1650163_1650403_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	70.1	9.4e-24
WP_104877003.1|1650443_1651553_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	86.1	2.1e-182
WP_158660700.1|1653810_1654110_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	98.0	1.9e-45
WP_104876785.1|1654106_1654649_+	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	77.0	1.2e-77
WP_104876786.1|1655257_1655626_+	TonB family protein	NA	NA	NA	NA	NA
WP_046876635.1|1656082_1656328_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	56.8	1.4e-17
WP_104876787.1|1656677_1657682_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	43.8	1.2e-35
WP_104876788.1|1658876_1660883_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	65.8	1.7e-44
1659964:1659978	attR	GCAACACCGGCGCTA	NA	NA	NA	NA
WP_158660691.1|1660879_1661050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104876789.1|1661052_1662486_+	hypothetical protein	NA	A0A1D8KLY0	Synechococcus_phage	30.7	6.5e-19
>prophage 121
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1679119	1686339	5883411		Escherichia_phage(50.0%)	5	NA	NA
WP_004851229.1|1679119_1679383_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	82.4	3.8e-34
WP_014838607.1|1679485_1680574_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	82.5	3.7e-176
WP_104876796.1|1680647_1681898_-	MFS transporter	NA	NA	NA	NA	NA
WP_085521080.1|1681953_1685061_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	60.0	0.0e+00
WP_049104095.1|1685268_1686339_+	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	44.6	1.3e-64
>prophage 122
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1694214	1695318	5883411		uncultured_virus(100.0%)	1	NA	NA
WP_014229500.1|1694214_1695318_+	cobalamin-independent methionine synthase II family protein	NA	A0A218MNE0	uncultured_virus	48.9	1.1e-101
>prophage 123
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1699498	1701004	5883411		Cedratvirus(50.0%)	2	NA	NA
WP_014229496.1|1699498_1700296_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A1M7XV31	Cedratvirus	26.9	1.2e-11
WP_014229495.1|1700305_1701004_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.3	6.2e-15
>prophage 124
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1705027	1705408	5883411		Streptococcus_phage(100.0%)	1	NA	NA
WP_004102351.1|1705027_1705408_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	1.4e-08
>prophage 125
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1715539	1716901	5883411		Bacillus_phage(100.0%)	1	NA	NA
WP_009654684.1|1715539_1716901_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.4	3.4e-17
>prophage 126
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1736596	1737388	5883411		Bacillus_virus(100.0%)	1	NA	NA
WP_014229467.1|1736596_1737388_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	29.5	1.6e-19
>prophage 127
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1740890	1741631	5883411		Indivirus(100.0%)	1	NA	NA
WP_004102264.1|1740890_1741631_+	amino acid ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.1	7.3e-14
>prophage 128
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1748692	1750150	5883411		Mycoplasma_phage(100.0%)	1	NA	NA
WP_085521109.1|1748692_1750150_-	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.6	2.0e-39
>prophage 129
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1754136	1754946	5883411		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
WP_085521113.1|1754136_1754946_+	ABC transporter ATP-binding protein	NA	R4TX06	Phaeocystis_globosa_virus	29.4	7.4e-12
>prophage 130
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1759372	1762936	5883411		Enterobacteria_phage(50.0%)	3	NA	NA
WP_025106268.1|1759372_1760458_+	porin	NA	Q1MVN1	Enterobacteria_phage	67.1	6.0e-142
WP_004851075.1|1760588_1761851_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_014838545.1|1761940_1762936_-	2-hydroxyacid dehydrogenase	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	30.5	4.4e-22
>prophage 131
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1770708	1772241	5883411		Staphylococcus_phage(100.0%)	1	NA	NA
WP_014838539.1|1770708_1772241_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	5.0e-17
>prophage 132
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1781503	1782340	5883411		Mycobacterium_phage(100.0%)	1	NA	NA
WP_014838530.1|1781503_1782340_+	alpha/beta hydrolase	NA	A0A1I9SAY0	Mycobacterium_phage	37.7	2.4e-13
>prophage 133
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1802397	1803126	5883411		Escherichia_phage(100.0%)	1	NA	NA
WP_032694970.1|1802397_1803126_-	tetrathionate reductase subunit TtrB	NA	A0A077SL61	Escherichia_phage	38.4	8.4e-23
>prophage 134
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1806876	1808874	5883411		Acinetobacter_phage(100.0%)	1	NA	NA
WP_086073937.1|1806876_1808874_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	27.3	4.2e-08
>prophage 135
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1813481	1814264	5883411		Staphylococcus_phage(100.0%)	1	NA	NA
WP_014229398.1|1813481_1814264_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	1.8e-15
>prophage 136
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1826466	1847029	5883411		Bacillus_phage(50.0%)	5	NA	NA
WP_104876808.1|1826466_1835943_-	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	8.1e-49
WP_085521159.1|1836029_1842128_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	26.7	6.8e-33
WP_014229382.1|1842311_1843271_-	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_071998074.1|1843437_1845240_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.6	1.4e-31
WP_032719113.1|1845226_1847029_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	23.5	4.4e-20
>prophage 137
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1855211	1858532	5883411		Autographa_californica_nuclear_polyhedrosis_virus(50.0%)	4	NA	NA
WP_085521167.1|1855211_1856027_-	APH(3')-I family aminoglycoside O-phosphotransferase	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	96.3	9.4e-156
WP_085521169.1|1856394_1857513_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_085521171.1|1857546_1857786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085521173.1|1857785_1858532_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.7	5.4e-25
>prophage 138
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1880739	1882137	5883411		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_085521192.1|1880739_1882137_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.7	9.1e-42
>prophage 139
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1889372	1890257	5883411		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_004850866.1|1889372_1890257_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	56.7	3.7e-81
>prophage 140
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1903829	1907948	5883411		Pithovirus(50.0%)	4	NA	NA
WP_032719075.1|1903829_1904558_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.0	2.8e-18
WP_004850829.1|1904554_1905295_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_085521209.1|1905319_1906255_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_009652210.1|1906562_1907948_+	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.8	3.3e-28
>prophage 141
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1921136	1922725	5883411		Dickeya_phage(50.0%)	2	NA	NA
WP_009652163.1|1921136_1921913_-	ABC transporter ATP-binding protein	NA	A0A140XAK6	Dickeya_phage	48.4	1.5e-17
WP_038424494.1|1921909_1922725_-	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	21.3	5.6e-07
>prophage 142
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1930998	1934582	5883411		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_049080919.1|1930998_1933731_-	magnesium-translocating P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	25.6	1.9e-35
WP_025108277.1|1933886_1934582_-	MgtC family protein	NA	G3MA03	Bacillus_virus	43.1	6.2e-15
>prophage 143
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1953143	1958095	5883411		Streptococcus_phage(33.33%)	4	NA	NA
WP_047684837.1|1953143_1954856_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	25.4	1.6e-32
WP_104876813.1|1954893_1955421_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014229291.1|1956228_1956828_-	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	40.6	5.3e-23
WP_004120604.1|1957084_1958095_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.6	2.5e-25
>prophage 144
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1962336	1963941	5883411		Planktothrix_phage(100.0%)	1	NA	NA
WP_014838430.1|1962336_1963941_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.3	2.9e-15
>prophage 145
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1973921	1975412	5883411		Mycobacterium_phage(100.0%)	1	NA	NA
WP_004850706.1|1973921_1975412_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	29.3	1.1e-32
>prophage 146
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1981515	1983060	5883411		Escherichia_phage(100.0%)	1	NA	NA
WP_004101903.1|1981515_1983060_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	44.6	1.9e-19
>prophage 147
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	1988531	1989233	5883411		Bacillus_virus(100.0%)	1	NA	NA
WP_085521247.1|1988531_1989233_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.2	5.2e-30
>prophage 148
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2003037	2003817	5883411		Bacillus_virus(100.0%)	1	NA	NA
WP_014229256.1|2003037_2003817_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.5	1.4e-20
>prophage 149
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2014365	2016462	5883411		Salmonella_phage(100.0%)	1	NA	NA
WP_104877006.1|2014365_2016462_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	68.2	4.1e-139
>prophage 150
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2033476	2034487	5883411		Mycoplasma_phage(100.0%)	1	NA	NA
WP_104876816.1|2033476_2034487_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	35.8	4.7e-24
>prophage 151
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2041236	2043201	5883411		Phage_TP(100.0%)	1	NA	NA
WP_032693487.1|2041236_2043201_-	U32 family peptidase	NA	Q6DW11	Phage_TP	28.0	3.0e-22
>prophage 152
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2056546	2058055	5883411		Moumouvirus(100.0%)	1	NA	NA
WP_085521278.1|2056546_2058055_-	carboxylesterase/lipase family protein	NA	M1PNU1	Moumouvirus	35.1	3.0e-30
>prophage 153
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2065291	2069909	5883411		Prochlorococcus_phage(20.0%)	7	NA	NA
WP_014229209.1|2065291_2066410_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	29.5	4.7e-33
WP_004101746.1|2066432_2066708_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_014229207.1|2066877_2067405_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	47.7	6.3e-20
WP_004101739.1|2067630_2067873_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	82.3	1.6e-31
WP_014838364.1|2068179_2068377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004850536.1|2068668_2068872_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	53.7	6.0e-11
WP_014229205.1|2068937_2069909_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.7	2.1e-13
>prophage 154
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2081919	2086530	5883411		Bacillus_phage(50.0%)	2	NA	NA
WP_014229195.1|2081919_2082579_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	50.4	1.4e-29
WP_085521289.1|2082627_2086530_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.7	7.6e-54
>prophage 155
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2096172	2097243	5883411		Synechococcus_phage(100.0%)	1	NA	NA
WP_014838352.1|2096172_2097243_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	V5UTY8	Synechococcus_phage	39.3	2.4e-10
>prophage 156
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2140589	2142110	5883411		Indivirus(100.0%)	1	NA	NA
WP_014838321.1|2140589_2142110_+	amino acid ABC transporter permease/ATP-binding protein	NA	A0A1V0SE00	Indivirus	26.3	6.9e-11
>prophage 157
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2151398	2156784	5883411	holin	Enterobacterial_phage(33.33%)	9	NA	NA
WP_004112629.1|2151398_2152388_+	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.7	1.9e-70
WP_014229134.1|2152513_2152954_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_004101621.1|2152950_2153223_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_032693413.1|2153550_2153916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085521341.1|2154142_2154685_-	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	66.9	3.1e-70
WP_032749344.1|2154692_2154965_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	55.4	2.2e-16
WP_009653048.1|2154954_2155347_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	66.2	1.3e-38
WP_032720808.1|2155423_2155786_-	hypothetical protein	NA	C6ZR44	Salmonella_phage	58.3	7.1e-31
WP_009653037.1|2156247_2156784_-	helix-turn-helix transcriptional regulator	NA	K7PKK1	Enterobacteria_phage	49.7	5.2e-30
>prophage 158
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2161303	2168253	5883411	protease,tRNA	Enterobacteria_phage(40.0%)	7	NA	NA
WP_085521345.1|2161303_2162410_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.4	8.4e-107
WP_004850325.1|2162563_2162776_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_025107975.1|2162858_2163293_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	51.4	7.2e-30
WP_014229121.1|2163481_2163772_+	hypothetical protein	NA	C6ZCX3	Enterobacteria_phage	66.0	9.7e-31
WP_042934342.1|2164150_2165089_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_014838310.1|2165899_2166835_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.4	7.0e-139
WP_032749350.1|2166879_2168253_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	6.8e-50
>prophage 159
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2171300	2174888	5883411		Escherichia_phage(33.33%)	4	NA	NA
WP_014229116.1|2171300_2172044_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.6	1.1e-14
WP_085521389.1|2172060_2173128_+	oxidoreductase	NA	NA	NA	NA	NA
WP_014229114.1|2173200_2174466_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	66.4	1.0e-156
WP_104876821.1|2174465_2174888_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.2	4.4e-32
>prophage 160
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2188055	2188781	5883411		Enterobacteria_phage(100.0%)	1	NA	NA
WP_032693666.1|2188055_2188781_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	46.4	3.5e-45
>prophage 161
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2211002	2215718	5883411		Ralstonia_phage(50.0%)	2	NA	NA
WP_029946967.1|2211002_2212970_-	membrane protein	NA	A0A077K801	Ralstonia_phage	32.2	1.1e-61
WP_032720905.1|2213222_2215718_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.0	1.8e-19
>prophage 162
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2223371	2224148	5883411		Bacillus_virus(100.0%)	1	NA	NA
WP_014229066.1|2223371_2224148_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.4	3.9e-34
>prophage 163
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2230224	2237390	5883411		Bacillus_virus(25.0%)	8	NA	NA
WP_014838260.1|2230224_2231067_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	41.1	7.2e-34
WP_014229058.1|2231038_2231905_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014229057.1|2232094_2233573_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.3	2.1e-89
WP_014229056.1|2233559_2234504_-	membrane protein	NA	NA	NA	NA	NA
WP_085521506.1|2234541_2235717_-	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A291ATS8	Pandoravirus	33.6	2.3e-09
WP_014229054.1|2235713_2236004_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_014229053.1|2236063_2236492_-	M67 family metallopeptidase	NA	NA	NA	NA	NA
WP_014229052.1|2236484_2237390_-	PLP-dependent cysteine synthase family protein	NA	A0A1X9I5K7	Streptococcus_phage	38.0	5.2e-46
>prophage 164
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2243443	2244178	5883411		Planktothrix_phage(100.0%)	1	NA	NA
WP_014838252.1|2243443_2244178_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.1	5.3e-33
>prophage 165
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2258937	2259732	5883411		Bacillus_virus(100.0%)	1	NA	NA
WP_025107016.1|2258937_2259732_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.4	1.8e-31
>prophage 166
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2268598	2269618	5883411		Bacillus_phage(100.0%)	1	NA	NA
WP_014229034.1|2268598_2269618_-	methionine ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	34.6	6.9e-15
>prophage 167
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2294880	2300076	5883411		Staphylococcus_phage(50.0%)	4	NA	NA
WP_004850180.1|2294880_2295690_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	26.3	1.6e-14
WP_004121225.1|2295931_2296720_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_014229020.1|2296902_2298060_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_104876826.1|2298141_2300076_+	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	25.1	1.4e-08
>prophage 168
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2305654	2306245	5883411		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004121245.1|2305654_2306245_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	3.5e-43
>prophage 169
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2311089	2313687	5883411		Tupanvirus(100.0%)	1	NA	NA
WP_014229012.1|2311089_2313687_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.0	2.2e-89
>prophage 170
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2326640	2329598	5883411		Acinetobacter_phage(100.0%)	2	NA	NA
WP_004850135.1|2326640_2328236_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	36.7	1.1e-46
WP_025106981.1|2328239_2329598_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.8	4.7e-35
>prophage 171
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2337100	2338417	5883411		Streptococcus_phage(100.0%)	1	NA	NA
WP_085521545.1|2337100_2338417_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	32.8	1.5e-41
>prophage 172
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2342792	2349165	5883411	transposase	Trichoplusia_ni_ascovirus(33.33%)	6	NA	NA
WP_104876828.1|2342792_2343554_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.0	3.0e-15
WP_104876829.1|2343645_2344236_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_014228987.1|2344370_2345762_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_014228411.1|2345943_2346378_+|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	39.2	6.8e-20
WP_072351776.1|2346470_2346818_-	cell division activator CedA	NA	NA	NA	NA	NA
WP_014228985.1|2346906_2349165_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	49.9	2.1e-144
>prophage 173
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2355380	2356208	5883411		Bacillus_virus(100.0%)	1	NA	NA
WP_004850083.1|2355380_2356208_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.1	1.2e-70
>prophage 174
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2365625	2366846	5883411		Klosneuvirus(100.0%)	1	NA	NA
WP_085521552.1|2365625_2366846_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.2e-26
>prophage 175
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2372856	2373489	5883411		Bacillus_phage(100.0%)	1	NA	NA
WP_014838191.1|2372856_2373489_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.4	6.9e-13
>prophage 176
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2377722	2379678	5883411		Streptococcus_phage(100.0%)	1	NA	NA
WP_014228966.1|2377722_2379678_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.9	4.4e-42
>prophage 177
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2385624	2389679	5883411		Tupanvirus(50.0%)	4	NA	NA
WP_046878581.1|2385624_2386266_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	38.6	5.9e-20
WP_085521569.1|2386303_2387662_-	MFS transporter	NA	NA	NA	NA	NA
WP_014228959.1|2387803_2388562_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_032749514.1|2388695_2389679_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	23.9	5.7e-06
>prophage 178
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2395372	2396626	5883411		Tupanvirus(100.0%)	1	NA	NA
WP_064405361.1|2395372_2396626_+	glycoside hydrolase family 18 protein	NA	A0A2K9L3D4	Tupanvirus	28.3	1.5e-24
>prophage 179
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2400254	2401109	5883411		Indivirus(100.0%)	1	NA	NA
WP_085521573.1|2400254_2401109_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	25.3	3.2e-13
>prophage 180
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2404441	2408789	5883411		Bacillus_phage(100.0%)	3	NA	NA
WP_004138302.1|2404441_2405725_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	28.6	2.2e-10
WP_085521575.1|2405773_2406931_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_104876833.1|2407292_2408789_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.6	4.1e-08
>prophage 181
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2416939	2417854	5883411		Morganella_phage(100.0%)	1	NA	NA
WP_009653416.1|2416939_2417854_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	51.2	4.5e-74
>prophage 182
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2424303	2436804	5883411		uncultured_Caudovirales_phage(20.0%)	12	NA	NA
WP_014228931.1|2424303_2425302_+	iron-dicitrate ABC transporter permease FecC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.1	5.4e-12
WP_047684621.1|2425298_2426252_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_042944913.1|2426252_2427020_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	26.2	2.6e-14
WP_009653379.1|2427056_2428100_-	type II asparaginase	NA	NA	NA	NA	NA
WP_014228927.1|2428379_2429570_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_085521598.1|2429646_2431431_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.2	5.6e-20
WP_085521600.1|2431503_2432388_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042944906.1|2432488_2432791_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_042944905.1|2432796_2433186_+	tautomerase family protein	NA	NA	NA	NA	NA
WP_085521603.1|2433529_2433898_-	DUF882 domain-containing protein	NA	I6R9L6	Nonlabens_phage	38.3	2.5e-15
WP_085521605.1|2433926_2434484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032720066.1|2435553_2436804_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	88.9	9.7e-19
>prophage 183
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2440038	2441409	5883411		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_014228873.1|2440038_2441409_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.6e-107
>prophage 184
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2448192	2449329	5883411		Bacillus_virus(100.0%)	1	NA	NA
WP_014228869.1|2448192_2449329_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	34.6	1.3e-30
>prophage 185
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2454682	2455633	5883411		Cyanophage(100.0%)	1	NA	NA
WP_014228865.1|2454682_2455633_-	transaldolase	NA	A0A127KMN5	Cyanophage	35.1	1.6e-13
>prophage 186
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2462737	2466488	5883411		Vibrio_phage(50.0%)	4	NA	NA
WP_032693896.1|2462737_2463568_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	33.5	2.8e-22
WP_014228857.1|2463582_2464494_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_014228856.1|2464542_2465787_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_014228855.1|2465786_2466488_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	41.3	5.4e-35
>prophage 187
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2472778	2473036	5883411		Erwinia_phage(100.0%)	1	NA	NA
WP_004131427.1|2472778_2473036_-	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	38.6	3.6e-05
>prophage 188
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2488807	2489449	5883411		Pseudomonas_phage(100.0%)	1	NA	NA
WP_085521621.1|2488807_2489449_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	38.2	5.9e-28
>prophage 189
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2492749	2493931	5883411		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|2492749_2492986_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_004131399.1|2493196_2493931_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	2.9e-15
>prophage 190
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2515170	2515416	5883411		Salmonella_phage(100.0%)	1	NA	NA
WP_004101040.1|2515170_2515416_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	47.4	7.7e-13
>prophage 191
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2518646	2519567	5883411		Morganella_phage(100.0%)	1	NA	NA
WP_047724098.1|2518646_2519567_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	42.4	1.3e-57
>prophage 192
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2527936	2528491	5883411		Infectious_spleen_and_kidney_necrosis_virus(100.0%)	1	NA	NA
WP_014228822.1|2527936_2528491_-	O-acetyl-ADP-ribose deacetylase	NA	A0A140G0J9	Infectious_spleen_and_kidney_necrosis_virus	45.6	5.1e-28
>prophage 193
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2541774	2544906	5883411		Bacillus_phage(50.0%)	4	NA	NA
WP_049071411.1|2541774_2542470_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.8	1.6e-26
WP_047724107.1|2542592_2543381_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_014838068.1|2543496_2543790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071881726.1|2543841_2544906_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	77.6	2.5e-92
>prophage 194
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2561529	2563777	5883411		Enterobacteria_phage(100.0%)	3	NA	NA
WP_014228795.1|2561529_2562024_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	78.1	3.3e-39
WP_085521638.1|2562045_2563368_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	87.6	2.0e-200
WP_004131287.1|2563603_2563777_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	88.9	3.2e-05
>prophage 195
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2578442	2585020	5883411		Hokovirus(50.0%)	4	NA	NA
WP_104876839.1|2578442_2580944_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	25.9	6.1e-12
WP_004131253.1|2581253_2582330_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_004100938.1|2582350_2582671_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_085521642.1|2582722_2585020_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	44.2	5.0e-05
>prophage 196
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2588665	2589568	5883411		Bacillus_phage(100.0%)	1	NA	NA
WP_085521644.1|2588665_2589568_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.1	4.7e-15
>prophage 197
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2600939	2601680	5883411		Planktothrix_phage(100.0%)	1	NA	NA
WP_025106229.1|2600939_2601680_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	8.8e-36
>prophage 198
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2615170	2616553	5883411		Enterobacteria_phage(100.0%)	1	NA	NA
WP_085521665.1|2615170_2616553_-	purine permease	NA	Q9KX94	Enterobacteria_phage	27.5	4.8e-19
>prophage 199
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2621828	2622857	5883411		Bacillus_phage(100.0%)	1	NA	NA
WP_032693394.1|2621828_2622857_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	36.4	5.2e-18
>prophage 200
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2636876	2643497	5883411		Morganella_phage(50.0%)	5	NA	NA
WP_004131145.1|2636876_2637581_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.4	5.3e-30
WP_014838032.1|2637939_2638326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047684564.1|2638644_2641764_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	20.6	8.0e-46
WP_004849645.1|2642401_2642623_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	56.5	6.7e-16
WP_004849644.1|2643284_2643497_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	77.1	8.4e-24
>prophage 201
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2647764	2648544	5883411		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_014228719.1|2647764_2648544_+	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.2	1.9e-17
>prophage 202
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2672610	2673351	5883411		Planktothrix_phage(100.0%)	1	NA	NA
WP_004849580.1|2672610_2673351_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	4.7e-29
>prophage 203
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2691789	2692449	5883411	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004100829.1|2691789_2692449_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	53.9	3.8e-46
>prophage 204
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2703024	2705172	5883411		Bacillus_phage(100.0%)	1	NA	NA
WP_085521713.1|2703024_2705172_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	25.1	2.7e-24
>prophage 205
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2719877	2721932	5883411		Bacillus_phage(100.0%)	1	NA	NA
WP_032695058.1|2719877_2721932_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.2	2.7e-18
>prophage 206
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2734707	2736615	5883411		Tupanvirus(100.0%)	1	NA	NA
WP_004849507.1|2734707_2736615_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	5.6e-50
>prophage 207
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2743327	2751693	5883411	tRNA	Bacillus_virus(20.0%)	5	NA	NA
WP_014837971.1|2743327_2744101_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.0	8.1e-32
WP_014228655.1|2744166_2746782_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_025107499.1|2747109_2748312_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.1	6.4e-44
WP_004849497.1|2748615_2750016_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	37.0	5.0e-80
WP_014228653.1|2750607_2751693_+	porin	NA	Q1MVN1	Enterobacteria_phage	53.0	1.5e-100
>prophage 208
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2769001	2773554	5883411		Bacillus_phage(100.0%)	3	NA	NA
WP_004849478.1|2769001_2770750_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.5	5.1e-58
WP_085521728.1|2770795_2773051_-	ComEC family protein	NA	NA	NA	NA	NA
WP_004100704.1|2773266_2773554_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	5.5e-10
>prophage 209
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2777847	2778936	5883411		Streptococcus_phage(100.0%)	1	NA	NA
WP_004849472.1|2777847_2778936_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	1.0e-80
>prophage 210
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2782984	2786211	5883411		Tetraselmis_virus(100.0%)	2	NA	NA
WP_014228637.1|2782984_2785267_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.9	1.9e-161
WP_004871674.1|2785470_2786211_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	1.8e-20
>prophage 211
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2793343	2898337	5883411	protease,holin,portal,tRNA,terminase,tail	Enterobacteria_phage(16.67%)	110	NA	NA
WP_009653301.1|2793343_2793961_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.6	3.4e-73
WP_032720981.1|2793971_2796410_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	1.0e-218
WP_009653254.1|2796610_2797903_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	3.6e-93
WP_004849446.1|2797994_2799338_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.7	7.8e-83
WP_004130911.1|2799346_2799958_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_085521737.1|2800079_2804138_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.2	4.9e-88
WP_002439523.1|2804273_2804768_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004849433.1|2805299_2806268_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.6e-61
WP_085521739.1|2806382_2808149_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.3	9.2e-23
WP_032694252.1|2808149_2809871_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.4	1.1e-15
WP_009653303.1|2809909_2810614_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002211347.1|2810893_2811112_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_004849425.1|2811249_2813532_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	2.8e-165
WP_004100628.1|2813562_2813880_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.4e-13
WP_004100627.1|2814204_2814435_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.4e-16
WP_104876849.1|2814503_2816450_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	39.2	9.4e-37
WP_014228619.1|2816446_2817562_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_014228618.1|2817737_2819396_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_085522157.1|2819778_2820474_+	aquaporin Z	NA	NA	NA	NA	NA
WP_014837946.1|2820599_2821499_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_014837945.1|2821643_2823296_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_032748889.1|2823306_2824275_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_104876850.1|2824314_2824740_-	DoxX family protein	NA	NA	NA	NA	NA
WP_014228612.1|2824911_2826630_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_032694256.1|2826784_2827786_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_085521744.1|2827796_2829230_+	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_009653274.1|2829326_2830340_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_085521746.1|2830336_2831167_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	29.5	1.6e-06
WP_004100606.1|2831163_2831487_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_038423244.1|2831604_2832120_+	lipoprotein	NA	NA	NA	NA	NA
WP_004111834.1|2832347_2833076_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	2.7e-29
WP_004130868.1|2833095_2833827_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004100599.1|2833833_2834550_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_014228606.1|2834549_2835218_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_014228605.1|2835391_2836123_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_085521748.1|2836836_2838309_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	32.4	2.5e-26
WP_004849381.1|2838305_2839022_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.9	1.1e-35
WP_032694258.1|2839100_2840231_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	25.2	1.7e-25
WP_004100588.1|2840273_2840762_-	YbjO family protein	NA	NA	NA	NA	NA
WP_004130847.1|2840819_2841665_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_014228601.1|2841661_2842615_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_004134592.1|2842625_2843759_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	7.7e-31
WP_014228600.1|2843861_2844974_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_004849367.1|2845322_2845802_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_009653278.1|2845891_2846794_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.5	2.0e-34
WP_025108025.1|2846897_2847620_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_009653259.1|2847603_2847894_-	YbjC family protein	NA	NA	NA	NA	NA
WP_004100567.1|2848098_2848362_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	71.8	1.6e-27
WP_004849358.1|2848368_2848752_-	membrane protein	NA	NA	NA	NA	NA
WP_004849356.1|2849019_2850705_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_014228592.1|2850863_2851406_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042927846.1|2851588_2852791_+	MFS transporter	NA	NA	NA	NA	NA
WP_038424260.1|2852790_2853606_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_042944794.1|2853653_2854889_-	MFS transporter	NA	NA	NA	NA	NA
WP_004849347.1|2855207_2855801_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_085521754.1|2855926_2856685_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	27.2	7.0e-12
WP_038423245.1|2856713_2857916_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	46.7	2.7e-95
WP_004849339.1|2858281_2858608_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	49.0	6.0e-21
WP_004849335.1|2859020_2860274_+	hypothetical protein	NA	A0A1J0MHZ5	Klebsiella_phage	44.2	1.0e-84
WP_104876853.1|2860274_2861489_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_104876854.1|2861853_2863287_-	hypothetical protein	NA	A0A1D8KLY0	Synechococcus_phage	30.1	1.2e-17
WP_004849329.1|2863286_2865281_-	right-handed parallel beta-helix repeat-containing protein	NA	A0A286S1P0	Klebsiella_phage	71.6	3.7e-52
WP_004849327.1|2865358_2868418_-	hypothetical protein	NA	A0A286S259	Klebsiella_phage	86.2	0.0e+00
WP_004849325.1|2868414_2868795_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	92.9	1.0e-67
WP_004849323.1|2868804_2869287_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	91.2	9.3e-79
WP_004849321.1|2869273_2869747_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	58.4	6.2e-51
WP_004849319.1|2869746_2872443_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	56.7	2.6e-202
WP_032721349.1|2872423_2872741_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	49.5	7.9e-18
WP_004849317.1|2872761_2873157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004849315.1|2873199_2873682_-|tail	tail protein	tail	M9NYX0	Enterobacteria_phage	66.9	1.4e-58
WP_004849313.1|2873689_2874088_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	58.6	1.6e-39
WP_032743290.1|2874084_2874636_-|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	66.9	4.1e-54
WP_032721347.1|2874625_2874919_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	2.5e-18
WP_004849307.1|2874911_2875238_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	64.5	2.6e-32
WP_074187855.1|2875319_2877335_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	84.1	0.0e+00
WP_042944766.1|2877279_2878779_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.6	1.1e-247
WP_042944764.1|2878775_2878991_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	78.6	4.5e-25
WP_042944762.1|2878987_2881096_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	82.8	0.0e+00
WP_042944760.1|2881095_2881587_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	85.3	7.6e-68
WP_074187856.1|2881907_2882093_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	61.1	5.4e-11
WP_107334310.1|2882159_2882420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049106544.1|2882645_2882891_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	60.5	4.7e-18
WP_101139615.1|2882956_2883202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049106545.1|2883207_2883597_-	hypothetical protein	NA	Q71TL7	Escherichia_phage	48.4	1.9e-26
WP_049106546.1|2883774_2884164_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	45.2	5.0e-22
WP_049106547.1|2884160_2884655_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	94.5	6.6e-88
WP_019704119.1|2884632_2884857_-|holin	holin	holin	M9NZI9	Enterobacteria_phage	91.9	4.0e-32
WP_048257893.1|2885483_2886062_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	2.4e-52
WP_104876855.1|2886058_2886703_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	72.3	2.3e-88
WP_064374094.1|2886699_2887782_-	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	67.8	8.6e-149
WP_104876856.1|2887795_2888209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004849245.1|2888205_2888415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004849243.1|2888411_2888615_-	hypothetical protein	NA	A0A2P1JU43	Erwinia_phage	50.0	3.6e-08
WP_004849240.1|2888608_2889070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004849238.1|2889066_2889852_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	51.0	7.6e-62
WP_004849236.1|2889844_2890057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042944734.1|2890053_2890347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042944732.1|2890359_2891436_-	hypothetical protein	NA	U5P0A0	Shigella_phage	36.2	9.5e-23
WP_042944730.1|2891701_2892115_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	69.8	3.2e-43
WP_042944728.1|2892173_2892386_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042944726.1|2892494_2893091_+	helix-turn-helix transcriptional regulator	NA	K7P850	Enterobacteria_phage	27.1	3.7e-08
WP_042944725.1|2893429_2893753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142395356.1|2893723_2894173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042944723.1|2894490_2894784_+	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_123828190.1|2894849_2895083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042944716.1|2895125_2895350_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	59.5	1.4e-16
WP_042944714.1|2895346_2896042_+	hypothetical protein	NA	R9VWB9	Serratia_phage	59.5	4.2e-72
WP_042944712.1|2896038_2896743_+	hypothetical protein	NA	A0A1W6JP46	Morganella_phage	32.6	3.0e-25
WP_004111685.1|2896835_2897051_+	DUF1233 family excisionase	NA	NA	NA	NA	NA
WP_042944710.1|2897050_2898337_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	54.5	1.7e-122
>prophage 212
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2908011	2909865	5883411		Bacillus_virus(100.0%)	1	NA	NA
WP_014228532.1|2908011_2909865_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G3M9Y6	Bacillus_virus	28.8	2.7e-09
>prophage 213
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2914043	2916476	5883411		Citrobacter_phage(100.0%)	1	NA	NA
WP_085521766.1|2914043_2916476_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	42.0	1.0e-08
>prophage 214
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2924716	2927831	5883411		Tupanvirus(50.0%)	2	NA	NA
WP_042944703.1|2924716_2926309_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.8	5.0e-60
WP_104876858.1|2926343_2927831_+	recombinase family protein	NA	A0A288WFZ3	Bacillus_phage	24.7	1.6e-15
>prophage 215
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2933513	2934137	5883411		Clostridium_phage(100.0%)	1	NA	NA
WP_104876861.1|2933513_2934137_+	recombinase family protein	NA	A0A0A8WJD4	Clostridium_phage	28.1	1.1e-07
>prophage 216
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2939538	2942107	5883411		Pandoravirus(50.0%)	2	NA	NA
WP_025108091.1|2939538_2940915_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	24.0	5.0e-24
WP_025108092.1|2941066_2942107_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	35.0	1.0e-05
>prophage 217
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2946019	2951123	5883411		Escherichia_phage(33.33%)	6	NA	NA
WP_004130755.1|2946019_2946532_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	31.3	2.3e-14
WP_004100495.1|2946883_2947771_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_004130751.1|2947989_2948493_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	24.6	1.9e-05
WP_004849110.1|2948864_2949611_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_004100490.1|2949744_2950404_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_004849106.1|2950400_2951123_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	1.5e-35
>prophage 218
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2962420	2970956	5883411		Synechococcus_phage(20.0%)	8	NA	NA
WP_004849092.1|2962420_2963098_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	31.0	3.4e-18
WP_004130731.1|2963166_2963433_+	DksA/TraR family C4-type zinc finger protein	NA	A0A0A0PZH0	Pectobacterium_bacteriophage	57.3	9.5e-17
WP_004130722.1|2963717_2963978_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_085521779.1|2964113_2965082_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_042944686.1|2965124_2967269_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	2.0e-43
WP_004849082.1|2967468_2968818_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.5	1.0e-45
WP_042944684.1|2969118_2970111_-	transketolase family protein	NA	NA	NA	NA	NA
WP_014228507.1|2970110_2970956_-	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	31.6	6.4e-06
>prophage 219
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2976098	2977838	5883411		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_032718693.1|2976098_2977838_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.0	1.5e-17
>prophage 220
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2987621	2988527	5883411		Streptococcus_phage(100.0%)	1	NA	NA
WP_004849048.1|2987621_2988527_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	29.2	3.1e-27
>prophage 221
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2995092	2995815	5883411		Staphylococcus_phage(100.0%)	1	NA	NA
WP_085521782.1|2995092_2995815_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	6.2e-10
>prophage 222
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	2999490	3004444	5883411		Klosneuvirus(50.0%)	4	NA	NA
WP_014228483.1|2999490_3000780_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.8	5.0e-18
WP_009653774.1|3000849_3001326_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_004849033.1|3001425_3002808_-	amino acid permease	NA	NA	NA	NA	NA
WP_085521787.1|3002920_3004444_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.5	1.9e-80
>prophage 223
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3011209	3011941	5883411		Enterobacteria_phage(100.0%)	1	NA	NA
WP_014228475.1|3011209_3011941_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	51.8	1.7e-52
>prophage 224
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3019114	3025641	5883411		Planktothrix_phage(33.33%)	7	NA	NA
WP_038424230.1|3019114_3020173_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.8	3.1e-18
WP_085521798.1|3020175_3020865_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014228467.1|3020864_3021638_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004848993.1|3021784_3021934_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_004848991.1|3022087_3022876_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_014228466.1|3022943_3024413_+	molybdate ABC transporter ATP-binding protein ModF	NA	W5SAS9	Pithovirus	29.6	4.3e-10
WP_004130603.1|3024624_3025641_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.4	7.5e-78
>prophage 225
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3029961	3033478	5883411		Edwardsiella_phage(33.33%)	4	NA	NA
WP_014228462.1|3029961_3031014_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.6	1.8e-82
WP_014228461.1|3031328_3031700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014228460.1|3031817_3032762_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.8	5.2e-25
WP_104876865.1|3032758_3033478_-	nicotinamide riboside transporter PnuC	NA	A0A2I7SAC7	Vibrio_phage	25.1	2.1e-13
>prophage 226
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3072384	3073176	5883411		Kaumoebavirus(100.0%)	1	NA	NA
WP_025106369.1|3072384_3073176_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.4	9.8e-09
>prophage 227
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3078973	3086465	5883411		Acinetobacter_phage(33.33%)	6	NA	NA
WP_032694307.1|3078973_3080455_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	2.9e-46
WP_076752518.1|3080417_3081866_-	deoxyribodipyrimidine photo-lyase	NA	F2Y1K1	Organic_Lake_phycodnavirus	31.8	1.6e-57
WP_004848892.1|3082110_3082317_-	DUF2517 family protein	NA	NA	NA	NA	NA
WP_009651669.1|3082626_3082716_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_038424222.1|3082715_3084395_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_014837833.1|3084416_3086465_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.9	5.5e-27
>prophage 228
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3094732	3096217	5883411		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004848870.1|3094732_3096217_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.8	2.5e-21
>prophage 229
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3102661	3103435	5883411		Mycobacterium_phage(100.0%)	1	NA	NA
WP_032694316.1|3102661_3103435_+	esterase	NA	W0LK50	Mycobacterium_phage	37.0	2.6e-06
>prophage 230
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3106440	3116392	5883411	tRNA	Lactobacillus_phage(25.0%)	7	NA	NA
WP_104876870.1|3106440_3107844_+	FAD-dependent tricarballylate dehydrogenase TcuA	NA	A0A2P0ZL82	Lactobacillus_phage	26.4	2.3e-08
WP_014837817.1|3107830_3108970_+	tricarballylate utilization 4Fe-4S protein TcuB	NA	NA	NA	NA	NA
WP_014228416.1|3109024_3110320_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.5	1.8e-60
WP_004848843.1|3110372_3110705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004130464.1|3110751_3112155_-	chitoporin	NA	NA	NA	NA	NA
WP_014228415.1|3112593_3114261_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	92.4	1.3e-310
WP_014228414.1|3114439_3116392_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	3.2e-08
>prophage 231
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3121019	3122681	5883411		Ostreococcus_mediterraneus_virus(100.0%)	1	NA	NA
WP_014228410.1|3121019_3122681_+	asparagine synthase B	NA	A0A0P0C0R1	Ostreococcus_mediterraneus_virus	39.7	7.9e-85
>prophage 232
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3127336	3128401	5883411		Pseudomonas_phage(100.0%)	1	NA	NA
WP_085954924.1|3127336_3128401_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.6	6.5e-48
>prophage 233
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3135611	3143710	5883411	tRNA	Planktothrix_phage(33.33%)	5	NA	NA
WP_004100186.1|3135611_3136337_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	1.7e-28
WP_104876871.1|3136708_3138376_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_014228405.1|3138431_3140219_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	34.2	6.2e-27
WP_014228404.1|3140418_3140901_-	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_104876872.1|3141127_3143710_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.4	1.2e-188
>prophage 234
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3150726	3153170	5883411		Synechococcus_phage(50.0%)	2	NA	NA
WP_042944620.1|3150726_3151827_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	51.6	1.0e-08
WP_014228398.1|3151970_3153170_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	48.7	1.4e-104
>prophage 235
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3157086	3158624	5883411		Paramecium_bursaria_Chlorella_virus(33.33%)	3	NA	NA
WP_014837805.1|3157086_3157875_-	deaminated glutathione amidase	NA	M1HKP1	Paramecium_bursaria_Chlorella_virus	24.2	2.8e-08
WP_004848768.1|3157966_3158350_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	50.0	5.2e-24
WP_004100146.1|3158414_3158624_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	80.6	4.5e-22
>prophage 236
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3162711	3181373	5883411		Morganella_phage(14.29%)	16	NA	NA
WP_004100140.1|3162711_3163140_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.7	2.5e-19
WP_004848755.1|3163216_3164782_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.6	6.4e-44
WP_002894394.1|3164951_3165515_-	alkyl hydroperoxide reductase subunit C	NA	NA	NA	NA	NA
WP_014228389.1|3166381_3167293_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014228388.1|3167397_3168621_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.1	2.6e-61
WP_014228387.1|3168605_3169235_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.3	2.0e-52
WP_014228386.1|3169235_3170396_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_085521854.1|3170575_3171265_+	acireductone synthase	NA	NA	NA	NA	NA
WP_014837799.1|3171261_3171804_+	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_104876873.1|3171987_3174297_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	32.8	9.7e-81
WP_004848735.1|3174835_3175816_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_047725149.1|3175860_3177366_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.2	6.6e-14
WP_032694338.1|3177362_3178349_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_042944610.1|3178348_3179350_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014837794.1|3179361_3180306_+	sugar kinase	NA	NA	NA	NA	NA
WP_004848726.1|3180344_3181373_-	2-hydroxyacid dehydrogenase	NA	A0A2R8FCS0	Cedratvirus	34.1	1.7e-29
>prophage 237
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3198873	3202490	5883411		Staphylococcus_phage(50.0%)	4	NA	NA
WP_046878155.1|3198873_3200376_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	6.0e-15
WP_085521868.1|3200536_3201625_+	oxidoreductase	NA	NA	NA	NA	NA
WP_071889099.1|3201811_3202105_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_085521870.1|3202085_3202490_+	helix-turn-helix domain-containing protein	NA	A0A1S5NNJ5	Burkholderia_phage	34.1	3.6e-07
>prophage 238
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3211555	3213673	5883411		Plodia_interpunctella_granulovirus(100.0%)	1	NA	NA
WP_085521874.1|3211555_3213673_+	chitinase	NA	A0A1L5JGH0	Plodia_interpunctella_granulovirus	28.5	1.8e-33
>prophage 239
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3217644	3222419	5883411		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_014228352.1|3217644_3218439_+	iron-enterobactin ABC transporter ATP-binding protein	NA	M1HRF1	Paramecium_bursaria_Chlorella_virus	25.6	5.8e-09
WP_085521876.1|3218537_3222419_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	27.2	1.6e-56
>prophage 240
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3233966	3235511	5883411		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_085521886.1|3233966_3235511_+	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	6.8e-14
>prophage 241
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3238976	3244894	5883411	holin	Vibrio_phage(50.0%)	4	NA	NA
WP_025107047.1|3238976_3241010_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	28.1	5.8e-21
WP_032693526.1|3241138_3241732_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_042944581.1|3241742_3243215_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_085521888.1|3243229_3244894_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	1.5e-59
>prophage 242
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3250281	3258599	5883411		Planktothrix_phage(33.33%)	8	NA	NA
WP_038424196.1|3250281_3250986_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.4	4.0e-22
WP_038424195.1|3251094_3252432_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_014228329.1|3252614_3253379_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014228328.1|3253922_3254684_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.6e-19
WP_004130263.1|3254676_3255342_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_085521892.1|3255356_3255998_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004848610.1|3256046_3256898_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_085521894.1|3257132_3258599_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	22.0	8.2e-17
>prophage 243
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3263949	3265993	5883411		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_085521898.1|3263949_3264960_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.2	1.6e-11
WP_004848592.1|3264949_3265993_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.3	6.0e-14
>prophage 244
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3276621	3279333	5883411		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_088168788.1|3276621_3279333_-	cation-transporting P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	27.2	1.2e-66
>prophage 245
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3299634	3302322	5883411		Bacillus_phage(100.0%)	1	NA	NA
WP_085521934.1|3299634_3302322_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	36.0	4.3e-40
>prophage 246
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3324290	3325040	5883411		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_085521941.1|3324290_3325040_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.2	1.3e-18
>prophage 247
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3340593	3341385	5883411		Bacillus_virus(100.0%)	1	NA	NA
WP_025107094.1|3340593_3341385_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.7	2.7e-14
>prophage 248
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3345779	3347180	5883411		Bacillus_phage(100.0%)	1	NA	NA
WP_032694591.1|3345779_3347180_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.1	1.7e-16
>prophage 249
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3359900	3364975	5883411	tRNA	Salmonella_phage(33.33%)	4	NA	NA
WP_014228247.1|3359900_3360776_+	class A extended-spectrum beta-lactamase OXY-1-1	NA	A0A1B0VBP7	Salmonella_phage	74.6	3.1e-112
WP_014228246.1|3361043_3361457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004848495.1|3361609_3363127_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.1	2.5e-85
WP_104876881.1|3363499_3364975_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	4.2e-45
>prophage 250
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3371754	3372630	5883411		Burkholderia_virus(100.0%)	1	NA	NA
WP_085521965.1|3371754_3372630_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.5	5.2e-19
>prophage 251
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3384209	3385211	5883411		Bacillus_virus(100.0%)	1	NA	NA
WP_032694552.1|3384209_3385211_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.4	3.1e-28
>prophage 252
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3391177	3391426	5883411		Salmonella_phage(100.0%)	1	NA	NA
WP_032694558.1|3391177_3391426_+	AlpA family phage regulatory protein	NA	T1SA17	Salmonella_phage	71.8	4.7e-26
>prophage 253
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3394608	3397369	5883411	tRNA	Enterococcus_phage(50.0%)	3	NA	NA
WP_004099791.1|3394608_3395475_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	6.5e-30
WP_025107125.1|3395476_3395689_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004848430.1|3395983_3397369_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.1	1.0e-45
>prophage 254
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3406220	3406907	5883411		Planktothrix_phage(100.0%)	1	NA	NA
WP_014228231.1|3406220_3406907_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.5	7.6e-34
>prophage 255
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3410093	3410774	5883411		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_004848402.1|3410093_3410774_-	iron ABC transporter ATP-binding protein FetA	NA	F2Y165	Organic_Lake_phycodnavirus	31.3	2.7e-15
>prophage 256
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3415672	3419499	5883411		uncultured_virus(50.0%)	2	NA	NA
WP_032694165.1|3415672_3418174_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.2	5.0e-115
WP_014228221.1|3418248_3419499_-	phospholipase	NA	A0A1B1MR92	Pteropox_virus	22.4	9.1e-25
>prophage 257
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3433917	3441764	5883411	transposase	uncultured_Mediterranean_phage(25.0%)	9	NA	NA
WP_009653565.1|3433917_3435792_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.3	5.6e-111
WP_004129946.1|3435903_3436509_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_004099673.1|3436508_3436841_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_042934011.1|3436898_3438806_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.2	1.3e-43
WP_004099669.1|3438897_3439449_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.2	2.3e-28
WP_104877016.1|3439599_3439977_-	DUF454 family protein	NA	NA	NA	NA	NA
WP_032694161.1|3440046_3440574_+	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_064506547.1|3440588_3440762_+	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_085522001.1|3440828_3441764_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.6	4.3e-64
>prophage 258
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3447280	3456668	5883411		Leptospira_phage(33.33%)	10	NA	NA
WP_014228207.1|3447280_3450427_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.8	3.5e-49
WP_004129911.1|3450907_3451282_+	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
WP_004099646.1|3451308_3451527_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_038423299.1|3451689_3452256_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_014228205.1|3452382_3452853_+	membrane protein	NA	NA	NA	NA	NA
WP_014228204.1|3452827_3454282_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.5	4.0e-16
WP_014228203.1|3454383_3455082_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003859006.1|3455078_3455219_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_004848323.1|3455218_3455482_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_014228202.1|3455594_3456668_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	41.1	4.1e-66
>prophage 259
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3465820	3466930	5883411		Bacillus_phage(100.0%)	1	NA	NA
WP_004848307.1|3465820_3466930_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.1	9.2e-13
>prophage 260
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3478348	3481892	5883411		Bacillus_phage(100.0%)	2	NA	NA
WP_085522009.1|3478348_3480127_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	6.4e-40
WP_014228187.1|3480119_3481892_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.0	1.3e-48
>prophage 261
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3486319	3487015	5883411		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_014228183.1|3486319_3487015_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.4e-88
>prophage 262
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3490392	3495442	5883411	protease	Sodalis_phage(25.0%)	4	NA	NA
WP_002444653.1|3490392_3490665_-	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	61.8	8.5e-21
WP_004099539.1|3490873_3493228_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.1	1.0e-223
WP_004099538.1|3493411_3494686_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.1	2.8e-130
WP_003021624.1|3494818_3495442_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 263
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3510601	3512305	5883411		Lactobacillus_phage(100.0%)	1	NA	NA
WP_085522022.1|3510601_3512305_+	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	27.1	6.3e-21
>prophage 264
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3529320	3530988	5883411		Staphylococcus_phage(50.0%)	2	NA	NA
WP_004129690.1|3529320_3529791_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	46.7	1.7e-29
WP_104876884.1|3529884_3530988_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.3	3.2e-50
>prophage 265
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3535968	3540308	5883411	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
WP_004848195.1|3535968_3536940_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.8	7.2e-46
WP_071886312.1|3536950_3538798_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_004099423.1|3538825_3539158_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_004129667.1|3539180_3540308_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.6	1.5e-90
>prophage 266
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3557262	3566483	5883411		Bacillus_phage(60.0%)	7	NA	NA
WP_004848171.1|3557262_3558552_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	27.9	1.0e-26
WP_004099401.1|3558573_3559263_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	3.3e-37
WP_085522039.1|3559541_3560744_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	34.7	6.3e-07
WP_104876887.1|3560740_3563875_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	6.4e-11
WP_014228145.1|3564164_3564527_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_014228144.1|3564575_3565481_-	fructokinase	NA	NA	NA	NA	NA
WP_004099396.1|3565571_3566483_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.9	4.2e-104
>prophage 267
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3590862	3591630	5883411		Planktothrix_phage(100.0%)	1	NA	NA
WP_004848135.1|3590862_3591630_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	38.6	1.5e-25
>prophage 268
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3599686	3600733	5883411		Bacillus_virus(100.0%)	1	NA	NA
WP_014228120.1|3599686_3600733_+	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	8.9e-34
>prophage 269
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3612125	3616250	5883411		Brazilian_cedratvirus(66.67%)	5	NA	NA
WP_014228113.1|3612125_3612908_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	23.7	5.1e-10
WP_004848112.1|3612900_3613596_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.9	8.1e-07
WP_004129481.1|3613703_3613886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032693222.1|3614608_3615418_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032693224.1|3615431_3616250_+	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.9	2.3e-16
>prophage 270
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3625495	3626338	5883411		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_014228100.1|3625495_3626338_+	phosphonate ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.6	1.2e-12
>prophage 271
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3633522	3634266	5883411		Bacillus_virus(100.0%)	1	NA	NA
WP_014837530.1|3633522_3634266_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.3	7.8e-32
>prophage 272
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3639017	3644306	5883411	integrase	Enterobacteria_phage(50.0%)	4	3637147:3637160	3644309:3644322
3637147:3637160	attL	GAAGCTGATGCTGA	NA	NA	NA	NA
WP_004129421.1|3639017_3640070_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.2	1.3e-112
WP_004848066.1|3640360_3641464_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.2	2.4e-61
WP_085522067.1|3641474_3642728_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.1	4.9e-95
WP_104876888.1|3643091_3644306_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	54.1	2.5e-128
3644309:3644322	attR	GAAGCTGATGCTGA	NA	NA	NA	NA
>prophage 273
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3657851	3659240	5883411		Leptospira_phage(100.0%)	1	NA	NA
WP_104876896.1|3657851_3659240_+	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	28.4	2.4e-50
>prophage 274
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3676142	3681013	5883411		Anomala_cuprea_entomopoxvirus(50.0%)	5	NA	NA
WP_032693202.1|3676142_3677240_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.2	1.0e-08
WP_004848024.1|3677236_3677881_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014228066.1|3677883_3678564_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_104876900.1|3678594_3679470_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_085522109.1|3679480_3681013_+	aromatic amino acid lyase	NA	A0A1V0S940	Catovirus	35.0	1.8e-67
>prophage 275
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3698479	3699955	5883411		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_014228053.1|3698479_3699955_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.8	1.7e-46
>prophage 276
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3734970	3735552	5883411		Caulobacter_phage(100.0%)	1	NA	NA
WP_004099149.1|3734970_3735552_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	29.6	1.1e-12
>prophage 277
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3739653	3743864	5883411		Bradyrhizobium_phage(33.33%)	5	NA	NA
WP_014228028.1|3739653_3740385_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.0	4.6e-37
WP_004129160.1|3740450_3740918_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	59.7	3.8e-53
WP_014228026.1|3740914_3741637_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014837463.1|3741669_3742425_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_014228024.1|3742496_3743864_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	30.6	4.3e-12
>prophage 278
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3747908	3748712	5883411		Indivirus(100.0%)	1	NA	NA
WP_014837458.1|3747908_3748712_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.1	1.2e-38
>prophage 279
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3755400	3756432	5883411		Planktothrix_phage(100.0%)	1	NA	NA
WP_014837456.1|3755400_3756432_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.3	7.2e-36
>prophage 280
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3771203	3775321	5883411		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_009654544.1|3771203_3774686_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.4	2.5e-205
WP_014228005.1|3774724_3775321_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	38.9	4.6e-27
>prophage 281
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3784155	3784914	5883411		Flavobacterium_phage(100.0%)	1	NA	NA
WP_004098751.1|3784155_3784914_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	2.1e-24
>prophage 282
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3795438	3801242	5883411	protease	Helicoverpa_armigera_granulovirus(50.0%)	3	NA	NA
WP_085520350.1|3795438_3798417_+	viral enhancin protein	NA	A9YMZ4	Helicoverpa_armigera_granulovirus	23.8	2.5e-41
WP_004098741.1|3798453_3799611_-	CdaR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004098740.1|3799802_3801242_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.5	1.8e-24
>prophage 283
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3805373	3805718	5883411		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_004098733.1|3805373_3805718_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	1.6e-27
>prophage 284
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3808884	3813540	5883411	transposase	Sodalis_phage(50.0%)	4	NA	NA
WP_085520351.1|3808884_3809814_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	40.7	4.2e-59
WP_038424086.1|3809873_3811856_-	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
WP_014837439.1|3811852_3812743_-	Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD	NA	NA	NA	NA	NA
WP_004098728.1|3812742_3813540_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	1.2e-14
>prophage 285
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3835535	3842301	5883411	tRNA	Niemeyer_virus(50.0%)	6	NA	NA
WP_085520358.1|3835535_3837965_-	ATP-dependent helicase HrpB	NA	A0A0U2UIE6	Niemeyer_virus	31.9	5.6e-39
WP_014837425.1|3838037_3838574_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_014227967.1|3838573_3839290_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_004098689.1|3839454_3839910_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_085520359.1|3839970_3840852_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_071881716.1|3840903_3842301_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.8	4.9e-27
>prophage 286
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3854906	3861487	5883411		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_014227952.1|3854906_3855833_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.8e-22
WP_004098666.1|3855940_3856603_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_014227950.1|3856654_3857191_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.8	2.7e-18
WP_014227949.1|3857394_3859785_+	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_014227948.1|3859885_3861487_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	48.3	1.1e-19
>prophage 287
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3866365	3867136	5883411		Escherichia_phage(100.0%)	1	NA	NA
WP_014227944.1|3866365_3867136_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	37.0	7.5e-30
>prophage 288
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3876914	3878339	5883411		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_004098637.1|3876914_3878339_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	4.6e-41
>prophage 289
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3889587	3890139	5883411		Thiobacimonas_phage(100.0%)	1	NA	NA
WP_014227932.1|3889587_3890139_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1B0T6G1	Thiobacimonas_phage	32.8	1.9e-14
>prophage 290
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3894468	3895512	5883411		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_009654638.1|3894468_3895512_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.6	2.2e-101
>prophage 291
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3921629	3923354	5883411		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_014227916.1|3921629_3923354_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.2	3.9e-34
>prophage 292
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3944123	3944825	5883411		Bacillus_virus(100.0%)	1	NA	NA
WP_014227903.1|3944123_3944825_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	34.7	1.3e-20
>prophage 293
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3951038	3956490	5883411		Heterocapsa_circularisquama_DNA_virus(50.0%)	2	NA	NA
WP_085520374.1|3951038_3953396_+	DNA polymerase II	NA	D0FZR7	Heterocapsa_circularisquama_DNA_virus	37.1	8.0e-06
WP_014227898.1|3953583_3956490_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.6	2.9e-21
>prophage 294
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3969031	3970400	5883411		Salmonella_phage(50.0%)	2	NA	NA
WP_014227890.1|3969031_3969880_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	30.7	9.9e-07
WP_004098524.1|3969920_3970400_-	type 3 dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	40.9	6.7e-29
>prophage 295
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	3977003	3978152	5883411		Halovirus(100.0%)	1	NA	NA
WP_014837384.1|3977003_3978152_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	31.9	1.8e-48
>prophage 296
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4004448	4011136	5883411	tRNA	Tupanvirus(50.0%)	5	NA	NA
WP_014227864.1|4004448_4007265_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	25.4	6.7e-76
WP_004098483.1|4007309_4008248_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_003018940.1|4008578_4008842_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_014227863.1|4009008_4009908_-	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_014227862.1|4009960_4011136_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	49.1	8.4e-89
>prophage 297
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4015773	4024057	5883411		Plodia_interpunctella_granulovirus(25.0%)	7	NA	NA
WP_085520282.1|4015773_4017873_-	chitinase	NA	A0A1L5JGH0	Plodia_interpunctella_granulovirus	28.5	3.1e-33
WP_014227858.1|4018258_4018702_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_032719260.1|4018718_4019252_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	55.5	3.3e-53
WP_014227856.1|4019329_4019677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014227855.1|4019801_4020749_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014837364.1|4020916_4022053_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.5	3.6e-28
WP_004128758.1|4022140_4024057_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	6.4e-147
>prophage 298
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4028444	4029398	5883411		Cyanophage(100.0%)	1	NA	NA
WP_004098458.1|4028444_4029398_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	2.8e-10
>prophage 299
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4040482	4041907	5883411		Bacillus_phage(100.0%)	1	NA	NA
WP_014227844.1|4040482_4041907_-	two-component system sensor histidine kinase CreC	NA	W8CYF6	Bacillus_phage	27.7	2.1e-17
>prophage 300
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4045871	4051091	5883411		Bacillus_phage(33.33%)	3	NA	NA
WP_104876913.1|4045871_4047809_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.5	3.6e-12
WP_014227837.1|4048082_4049750_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.6	1.4e-41
WP_004098414.1|4049858_4051091_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.0	4.1e-86
>prophage 301
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4057390	4058713	5883411		Geobacillus_virus(100.0%)	1	NA	NA
WP_014227832.1|4057390_4058713_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.4	2.6e-78
>prophage 302
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4063381	4066086	5883411		Salmonella_phage(50.0%)	3	NA	NA
WP_003856556.1|4063381_4063543_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	69.8	3.0e-13
WP_014227828.1|4063667_4064279_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_004098388.1|4064496_4066086_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.3	2.4e-30
>prophage 303
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4079394	4080674	5883411		Salmonella_phage(50.0%)	2	NA	NA
WP_085520273.1|4079394_4079934_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	60.6	7.1e-27
WP_014227813.1|4079936_4080674_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.2	1.3e-63
>prophage 304
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4083827	4086995	5883411	transposase	Sodalis_phage(50.0%)	3	NA	NA
WP_032692991.1|4083827_4084766_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.9	8.5e-68
WP_089046413.1|4084905_4085937_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_014227808.1|4085933_4086995_-	SIS domain-containing protein	NA	M1I2B0	Paramecium_bursaria_Chlorella_virus	23.3	2.1e-06
>prophage 305
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4094207	4095230	5883411		Tupanvirus(100.0%)	1	NA	NA
WP_014227801.1|4094207_4095230_-	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	28.4	3.6e-11
>prophage 306
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4129176	4131014	5883411		uncultured_marine_virus(50.0%)	2	NA	NA
WP_014227775.1|4129176_4129803_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.3	3.2e-55
WP_085520257.1|4129802_4131014_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	32.5	1.3e-57
>prophage 307
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4143532	4147506	5883411		Rhodobacter_phage(50.0%)	2	NA	NA
WP_085520256.1|4143532_4145962_+	DEAD/DEAH box helicase family protein	NA	A0A0K1LLU7	Rhodobacter_phage	23.7	6.7e-08
WP_085520255.1|4146036_4147506_+	type I restriction-modification system subunit M	NA	J7I0U9	Acinetobacter_phage	27.6	8.7e-35
>prophage 308
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4155780	4156365	5883411		Moraxella_phage(100.0%)	1	NA	NA
WP_004098242.1|4155780_4156365_+	TetR/AcrR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.3	5.0e-10
>prophage 309
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4162242	4165629	5883411	holin	Serratia_phage(100.0%)	1	NA	NA
WP_104876917.1|4162242_4165629_+|holin	choline trimethylamine-lyase	holin	A0A1S6UAD4	Serratia_phage	45.0	9.7e-05
>prophage 310
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4174177	4179892	5883411		Bacillus_phage(50.0%)	3	NA	NA
WP_085520243.1|4174177_4175575_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.9	3.4e-20
WP_032693056.1|4176098_4177166_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_085520242.1|4177162_4179892_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.1	1.7e-20
>prophage 311
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4192590	4193955	5883411		Burkholderia_virus(100.0%)	1	NA	NA
WP_014227732.1|4192590_4193955_-	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.3e-45
>prophage 312
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4207776	4212476	5883411		Streptococcus_phage(50.0%)	2	NA	NA
WP_085520326.1|4207776_4208949_+	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	32.9	1.6e-44
WP_158660695.1|4209440_4212476_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	26.2	2.3e-34
>prophage 313
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4217798	4222673	5883411		Tupanvirus(50.0%)	5	NA	NA
WP_104876922.1|4217798_4218818_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	32.3	9.9e-46
WP_025107468.1|4219009_4219882_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_104876923.1|4219871_4220759_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_032718883.1|4220769_4221594_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_104876924.1|4221599_4222673_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	1.6e-22
>prophage 314
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4238391	4247441	5883411	tRNA	Klebsiella_phage(33.33%)	6	NA	NA
WP_014227677.1|4238391_4239894_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.0	8.8e-83
WP_014227676.1|4239935_4241018_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_004098132.1|4241017_4242115_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_004098131.1|4242508_4244020_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	9.2e-48
WP_032695176.1|4244142_4244586_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_004098127.1|4244585_4247441_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.8	6.0e-141
>prophage 315
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4252585	4260368	5883411		Paramecium_bursaria_Chlorella_virus(25.0%)	6	NA	NA
WP_014227670.1|4252585_4253521_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.5	7.7e-53
WP_004098115.1|4253533_4253995_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_085520309.1|4254255_4255725_+	N-acetylglucosamine-binding protein GbpA	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	38.5	1.9e-21
WP_009652347.1|4255879_4256266_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_064375401.1|4256333_4259042_-	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.0	2.8e-47
WP_014227667.1|4259420_4260368_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	23.0	1.3e-12
>prophage 316
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4268201	4272989	5883411		Vibrio_phage(33.33%)	3	NA	NA
WP_032747666.1|4268201_4270340_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
WP_014227659.1|4270674_4271139_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	8.5e-53
WP_085520327.1|4271156_4272989_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	34.1	1.2e-20
>prophage 317
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4293530	4300083	5883411		Klosneuvirus(33.33%)	6	NA	NA
WP_004098053.1|4293530_4294529_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_004098052.1|4294573_4295560_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_014837207.1|4295546_4296572_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014837206.1|4296582_4298085_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	2.2e-09
WP_004098043.1|4298195_4299152_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004098041.1|4299555_4300083_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	7.1e-56
>prophage 318
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4340145	4344507	5883411		Lactococcus_phage(50.0%)	3	NA	NA
WP_004097981.1|4340145_4342596_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	31.9	3.2e-66
WP_004097980.1|4342633_4343059_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_004097979.1|4343208_4344507_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	1.7e-66
>prophage 319
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4350033	4353271	5883411		Wolbachia_phage(50.0%)	2	NA	NA
WP_085520320.1|4350033_4351923_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.0	1.5e-58
WP_085520321.1|4351933_4353271_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	29.6	4.4e-17
>prophage 320
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4358009	4358555	5883411		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_004097954.1|4358009_4358555_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	7.7e-29
>prophage 321
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4365806	4371024	5883411		Tupanvirus(33.33%)	6	NA	NA
WP_014227612.1|4365806_4366784_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.1	1.2e-27
WP_014227611.1|4367059_4368850_+	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	26.8	2.2e-16
WP_004097940.1|4368842_4369577_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_004097939.1|4369587_4369983_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_004097938.1|4369993_4370353_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_085520324.1|4370493_4371024_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	6.7e-46
>prophage 322
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4381919	4387449	5883411		Bacillus_phage(33.33%)	5	NA	NA
WP_032719313.1|4381919_4384043_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.0	1.2e-29
WP_014837171.1|4384065_4384932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004097909.1|4384978_4385332_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_014227597.1|4385465_4387112_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.1	1.0e-188
WP_003855929.1|4387155_4387449_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	2.1e-12
>prophage 323
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4400466	4404171	5883411		Pseudomonas_phage(33.33%)	4	NA	NA
WP_004097877.1|4400466_4401147_+	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	41.3	2.7e-31
WP_014227587.1|4401297_4402218_+	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	43.8	9.7e-08
WP_014837163.1|4402217_4402523_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_025107668.1|4402668_4404171_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.0	7.0e-56
>prophage 324
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4409496	4411139	5883411		Bacillus_virus(50.0%)	2	NA	NA
WP_014227581.1|4409496_4410255_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	25.8	2.2e-13
WP_004097859.1|4410452_4411139_+	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.9	1.1e-08
>prophage 325
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4416806	4427918	5883411		Bacillus_virus(33.33%)	8	NA	NA
WP_085519965.1|4416806_4418339_+	D-allose ABC transporter ATP-binding protein AlsA	NA	G3M9Y6	Bacillus_virus	26.5	1.4e-11
WP_014837152.1|4418317_4419298_+	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_014227571.1|4419308_4420004_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_042944119.1|4419987_4420899_+	allose kinase	NA	NA	NA	NA	NA
WP_077598952.1|4421160_4423308_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.3	4.1e-33
WP_014837150.1|4423514_4424198_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004109428.1|4424234_4425548_-	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
WP_014227567.1|4425959_4427918_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.5	2.7e-92
>prophage 326
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4440182	4441532	5883411		Moraxella_phage(100.0%)	1	NA	NA
WP_014227555.1|4440182_4441532_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.8	6.7e-159
>prophage 327
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4453344	4458635	5883411		Vibrio_phage(33.33%)	3	NA	NA
WP_104876932.1|4453344_4454949_+	lytic transglycosylase F	NA	K7RVN3	Vibrio_phage	31.7	2.4e-06
WP_004097799.1|4455035_4455563_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	96.4	3.5e-55
WP_004097797.1|4455809_4458635_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
>prophage 328
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4462755	4465402	5883411		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
WP_014837135.1|4462755_4463835_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.1	2.6e-28
WP_004097788.1|4463986_4465402_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	2.8e-200
>prophage 329
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4471242	4471851	5883411		Lactococcus_phage(100.0%)	1	NA	NA
WP_004097774.1|4471242_4471851_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	40.7	7.8e-14
>prophage 330
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4479051	4480161	5883411		Mycoplasma_phage(100.0%)	1	NA	NA
WP_004097762.1|4479051_4480161_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
>prophage 331
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4493070	4493859	5883411		Pseudomonas_phage(100.0%)	1	NA	NA
WP_032719362.1|4493070_4493859_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.9	1.1e-47
>prophage 332
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4510178	4513862	5883411		Dickeya_phage(100.0%)	1	NA	NA
WP_085519979.1|4510178_4513862_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	4.9e-26
>prophage 333
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4527669	4536442	5883411		Prochlorococcus_phage(25.0%)	9	NA	NA
WP_085520237.1|4527669_4529259_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.1e-67
WP_085520236.1|4529274_4530567_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_032721071.1|4530563_4531898_-	sigma-54-dependent response regulator transcription factor ZraR	NA	Q6XM27	Feldmannia_irregularis_virus	29.9	2.4e-07
WP_014227505.1|4531894_4533283_-	two-component system sensor histidine kinase ZraS	NA	NA	NA	NA	NA
WP_014227504.1|4533535_4533970_+	zinc resistance sensor/chaperone ZraP	NA	NA	NA	NA	NA
WP_085520240.1|4533973_4534666_-	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_004097675.1|4534678_4534951_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	56.7	1.2e-19
WP_004097673.1|4535137_4535728_-	YjaG family protein	NA	NA	NA	NA	NA
WP_014227502.1|4535770_4536442_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	31.2	1.9e-21
>prophage 334
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4544987	4564705	5883411		Bacillus_phage(16.67%)	14	NA	NA
WP_104876936.1|4544987_4546520_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.7	2.9e-09
WP_004097653.1|4546692_4546998_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_004097651.1|4547001_4547319_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_004097650.1|4547362_4548703_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_014227492.1|4549112_4553336_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.3	1.3e-67
WP_004097647.1|4553412_4557441_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	30.2	1.1e-23
WP_004097645.1|4557766_4558132_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_004097644.1|4558198_4558696_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_004097642.1|4559115_4559820_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_004097640.1|4559823_4560252_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_002438628.1|4560405_4560951_-	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	29.1	3.1e-14
WP_004097638.1|4560952_4561336_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_004097636.1|4561568_4562753_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	8.9e-14
WP_104876937.1|4563754_4564705_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	31.6	2.3e-28
>prophage 335
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4574585	4575200	5883411		Streptococcus_phage(100.0%)	1	NA	NA
WP_014227487.1|4574585_4575200_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	32.1	1.4e-18
>prophage 336
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4584405	4590584	5883411		uncultured_Mediterranean_phage(33.33%)	7	NA	NA
WP_004097593.1|4584405_4585179_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	30.0	1.5e-25
WP_014227481.1|4585181_4585721_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_004097589.1|4585724_4585976_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_032693754.1|4586053_4587694_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.9	1.5e-40
WP_014837090.1|4587690_4588296_-	SCP2 domain-containing protein	NA	NA	NA	NA	NA
WP_004097585.1|4588309_4589065_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_032720771.1|4589135_4590584_-	DNA recombination protein RmuC	NA	R9RFD7	Alteromonas_phage	56.4	6.8e-08
>prophage 337
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4601388	4603215	5883411		Catovirus(100.0%)	1	NA	NA
WP_014837082.1|4601388_4603215_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.6	2.8e-83
>prophage 338
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4607064	4610923	5883411		Bacillus_phage(50.0%)	3	NA	NA
WP_004127467.1|4607064_4609227_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	7.8e-117
WP_014227468.1|4609304_4610021_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_009651718.1|4610020_4610923_-	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	28.9	2.3e-17
>prophage 339
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4634285	4640425	5883411		uncultured_marine_virus(20.0%)	6	NA	NA
WP_004097526.1|4634285_4635416_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	42.5	5.1e-19
WP_032720761.1|4635420_4636095_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_064375203.1|4636072_4636954_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	66.0	1.5e-106
WP_032720759.1|4636971_4638039_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.8	5.1e-101
WP_085520341.1|4638035_4639298_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.6	2.2e-26
WP_004097518.1|4639294_4640425_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	33.3	1.9e-26
>prophage 340
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4644475	4655310	5883411		Indivirus(20.0%)	9	NA	NA
WP_004097507.1|4644475_4644805_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	2.5e-14
WP_004127388.1|4645146_4646412_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.8	8.3e-42
WP_014227453.1|4646546_4648034_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_032720758.1|4648098_4648839_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014227452.1|4649060_4650077_+	ADP-ribosylglycohydrolase family protein	NA	A0A172WZB4	Catopsilia_pomona_nucleopolyhedrovirus	25.3	2.2e-08
WP_014837065.1|4650095_4651511_+	purine-cytosine permease	NA	NA	NA	NA	NA
WP_085520342.1|4651494_4652457_+	ribokinase	NA	NA	NA	NA	NA
WP_014227450.1|4652460_4654479_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.5	3.2e-112
WP_004097491.1|4654581_4655310_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.0	1.6e-21
>prophage 341
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4665001	4666648	5883411		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_085520344.1|4665001_4666648_-	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.8	4.8e-66
>prophage 342
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4676849	4678718	5883411		Acinetobacter_phage(100.0%)	1	NA	NA
WP_085522131.1|4676849_4678718_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	27.7	2.8e-06
>prophage 343
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4693448	4696148	5883411		Cyanophage(50.0%)	3	NA	NA
WP_004107558.1|4693448_4694111_+	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	34.0	3.5e-28
WP_014227433.1|4694166_4695270_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_104876940.1|4695398_4696148_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	34.1	1.0e-23
>prophage 344
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4708522	4709857	5883411		Erwinia_phage(100.0%)	1	NA	NA
WP_004127247.1|4708522_4709857_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	30.3	1.1e-44
>prophage 345
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4714475	4718002	5883411		Feldmannia_irregularis_virus(33.33%)	4	NA	NA
WP_004127228.1|4714475_4715174_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
WP_004107505.1|4715170_4716544_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	23.3	4.5e-09
WP_014227423.1|4716635_4717310_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_004127220.1|4717381_4718002_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
>prophage 346
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4726306	4727818	5883411		Bacillus_virus(100.0%)	1	NA	NA
WP_014227417.1|4726306_4727818_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.5	5.1e-14
>prophage 347
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4788728	4789646	5883411		Pandoravirus(100.0%)	1	NA	NA
WP_085521443.1|4788728_4789646_+	alpha/beta hydrolase	NA	S4W4Z4	Pandoravirus	30.0	3.2e-19
>prophage 348
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4796470	4798938	5883411		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_004127098.1|4796470_4797520_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.7	2.2e-08
WP_004107350.1|4797528_4798938_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.3	4.8e-06
>prophage 349
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4802829	4805619	5883411		uncultured_virus(100.0%)	1	NA	NA
WP_025106523.1|4802829_4805619_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	33.6	2.5e-75
>prophage 350
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4819812	4825691	5883411		Enterobacteria_phage(33.33%)	5	NA	NA
WP_004855794.1|4819812_4820703_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	24.5	7.4e-05
WP_004855792.1|4820730_4821696_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_032718765.1|4821701_4823207_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	22.5	6.9e-19
WP_004855789.1|4823217_4823637_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_014227355.1|4823822_4825691_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.5	1.4e-66
>prophage 351
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4828860	4829853	5883411		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_038423898.1|4828860_4829853_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	38.0	4.2e-49
>prophage 352
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4844434	4852037	5883411		Chrysochromulina_ericina_virus(25.0%)	6	NA	NA
WP_032694281.1|4844434_4845805_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	37.4	9.6e-36
WP_014227346.1|4845987_4847817_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	41.7	1.6e-126
WP_004127017.1|4848133_4849174_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	38.4	4.0e-50
WP_004107261.1|4849366_4850326_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_004855748.1|4850325_4851216_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_004855746.1|4851263_4852037_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.1	9.9e-14
>prophage 353
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4857916	4859254	5883411		Moraxella_phage(100.0%)	1	NA	NA
WP_104876944.1|4857916_4859254_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.2	9.9e-62
>prophage 354
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4866730	4874249	5883411		Staphylococcus_phage(33.33%)	7	NA	NA
WP_004871831.1|4866730_4866988_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	55.2	7.1e-17
WP_004871829.1|4866951_4867311_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_004871828.1|4867326_4867467_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_004871826.1|4868088_4869489_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_004107206.1|4869493_4870594_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.3	6.9e-53
WP_004126948.1|4870732_4871806_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_004126944.1|4871834_4874249_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	33.9	4.8e-115
>prophage 355
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4879681	4880830	5883411		Oenococcus_phage(100.0%)	1	NA	NA
WP_025107562.1|4879681_4880830_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.5	1.8e-51
>prophage 356
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4884373	4885334	5883411		Cyanophage(50.0%)	2	NA	NA
WP_004126917.1|4884373_4884787_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	35.4	1.3e-17
WP_032694291.1|4884905_4885334_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	37.3	3.2e-14
>prophage 357
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4896730	4902072	5883411		Salmonella_phage(50.0%)	6	NA	NA
WP_004855651.1|4896730_4897915_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.7	2.9e-12
WP_014227319.1|4898092_4898926_-	EamA family transporter	NA	NA	NA	NA	NA
WP_085521466.1|4898996_4899443_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004107126.1|4899514_4899604_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_004107123.1|4900185_4900281_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_085521468.1|4900383_4902072_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	31.0	9.0e-60
>prophage 358
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4914504	4915617	5883411		Bacillus_virus(100.0%)	1	NA	NA
WP_014227307.1|4914504_4915617_+	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	34.5	8.6e-27
>prophage 359
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4923838	4924432	5883411	integrase	Escherichia_phage(100.0%)	1	4922261:4922273	4926117:4926129
4922261:4922273	attL	GAAGCTGACGCTG	NA	NA	NA	NA
WP_085521485.1|4923838_4924432_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	48.6	1.5e-46
WP_085521485.1|4923838_4924432_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	48.6	1.5e-46
4926117:4926129	attR	CAGCGTCAGCTTC	NA	NA	NA	NA
>prophage 360
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4931380	4932346	5883411	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_038423881.1|4931380_4932346_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.1	1.0e-68
>prophage 361
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4936833	4938000	5883411		Salmonella_phage(100.0%)	1	NA	NA
WP_085520169.1|4936833_4938000_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.1	6.5e-25
>prophage 362
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4953590	4966128	5883411	integrase	Enterobacteria_phage(40.0%)	14	4949220:4949235	4970429:4970444
4949220:4949235	attL	TCCCCGGAGGCGGCGC	NA	NA	NA	NA
WP_014227281.1|4953590_4954640_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.2	4.5e-70
WP_014839815.1|4954798_4955101_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_085520173.1|4955102_4956110_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_014227279.1|4956222_4956690_-	DUF3237 domain-containing protein	NA	NA	NA	NA	NA
WP_085520174.1|4956877_4957483_+	shikimate kinase	NA	NA	NA	NA	NA
WP_085520175.1|4957479_4958103_-	hypothetical protein	NA	Q9JMN3	Wolbachia_phage	46.3	1.4e-37
WP_032695122.1|4958227_4958515_-	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_004855540.1|4958641_4958833_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_142274041.1|4959216_4960197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158660696.1|4960532_4961216_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	77.4	2.2e-97
WP_158660697.1|4961246_4961459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085520178.1|4962657_4963080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085520179.1|4963076_4964936_-	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	20.7	2.5e-10
WP_085520180.1|4964955_4966128_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	83.7	7.3e-186
4970429:4970444	attR	GCGCCGCCTCCGGGGA	NA	NA	NA	NA
>prophage 363
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4984277	4985669	5883411		environmental_Halophage(100.0%)	1	NA	NA
WP_085520186.1|4984277_4985669_-	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	95.9	1.6e-67
>prophage 364
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	4989275	4990127	5883411		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_004855525.1|4989275_4990127_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	1.3e-14
>prophage 365
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5001243	5006270	5883411		Bordetella_phage(33.33%)	4	NA	NA
WP_004855514.1|5001243_5003364_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	2.8e-10
WP_004106927.1|5003382_5003658_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_004126677.1|5003712_5004336_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	36.2	2.6e-20
WP_085520188.1|5004593_5006270_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.9	2.1e-21
>prophage 366
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5011837	5016576	5883411		Xanthomonas_phage(25.0%)	7	NA	NA
WP_009652760.1|5011837_5012293_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	58.8	1.8e-47
WP_071889477.1|5012273_5013485_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	35.5	3.8e-44
WP_004126657.1|5013660_5014326_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_002436699.1|5014542_5014779_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_003024094.1|5014799_5014967_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_014227251.1|5015166_5015976_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.6	3.8e-24
WP_004106901.1|5016099_5016576_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.7	2.4e-26
>prophage 367
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5029438	5038586	5883411		Prochlorococcus_phage(20.0%)	9	NA	NA
WP_014227239.1|5029438_5030383_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.1	8.6e-36
WP_014227238.1|5030597_5031791_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.3	1.7e-36
WP_004855475.1|5031800_5032826_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	1.0e-18
WP_085520192.1|5032987_5033785_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_009652761.1|5033781_5034669_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_025107808.1|5034720_5035992_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	33.9	2.1e-08
WP_014227235.1|5036001_5037546_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_004126582.1|5037791_5038223_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_004106850.1|5038334_5038586_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	53.4	7.6e-16
>prophage 368
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5054838	5056680	5883411		Tupanvirus(100.0%)	1	NA	NA
WP_014227224.1|5054838_5056680_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	25.1	2.0e-12
>prophage 369
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5078520	5080062	5883411		Staphylococcus_phage(100.0%)	1	NA	NA
WP_085520201.1|5078520_5080062_-	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.2	1.3e-17
>prophage 370
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5085003	5085999	5883411		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_038423835.1|5085003_5085999_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.2	8.6e-10
>prophage 371
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5090386	5092318	5883411		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_104876952.1|5090386_5092006_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2I4R674	Erysipelothrix_phage	25.4	4.8e-26
WP_004126446.1|5092105_5092318_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	71.4	6.0e-22
>prophage 372
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5095676	5096648	5883411		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_085520204.1|5095676_5096648_-	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	26.5	1.1e-17
>prophage 373
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5114774	5120986	5883411		Bacillus_virus(66.67%)	5	NA	NA
WP_014227186.1|5114774_5115758_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.9	2.4e-12
WP_014227185.1|5115754_5116768_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.4	2.5e-17
WP_014227184.1|5117481_5118060_+	cellulose biosynthesis protein BcsO	NA	NA	NA	NA	NA
WP_014227183.1|5118050_5118854_+	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
WP_050595143.1|5118874_5120986_+	UDP-forming cellulose synthase catalytic subunit	NA	M1I277	Paramecium_bursaria_Chlorella_virus	33.9	3.3e-35
>prophage 374
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5137087	5138203	5883411	transposase	Phage_Gifsy-1(100.0%)	1	NA	NA
WP_142274044.1|5137087_5138203_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	88.4	9.4e-191
>prophage 375
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5169006	5171084	5883411		Bacillus_phage(100.0%)	2	NA	NA
WP_014227153.1|5169006_5170368_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.6	1.3e-11
WP_001157751.1|5170364_5171084_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 376
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5182063	5184106	5883411		Indivirus(100.0%)	1	NA	NA
WP_032719958.1|5182063_5184106_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	2.2e-44
>prophage 377
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5196290	5197244	5883411		Cedratvirus(100.0%)	1	NA	NA
WP_014227135.1|5196290_5197244_-	hydroxyacid dehydrogenase	NA	A0A285PXZ1	Cedratvirus	33.9	5.6e-35
>prophage 378
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5200410	5201181	5883411		Bacillus_virus(100.0%)	1	NA	NA
WP_085520218.1|5200410_5201181_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	28.5	2.5e-17
>prophage 379
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5207734	5211841	5883411		Tupanvirus(66.67%)	3	NA	NA
WP_004855110.1|5207734_5208874_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	27.2	2.3e-27
WP_004126208.1|5208875_5209859_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase ArnC	NA	A8CG95	Salmonella_phage	32.7	2.8e-37
WP_014227124.1|5209855_5211841_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.7	1.6e-20
>prophage 380
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5218143	5222209	5883411		Dickeya_phage(50.0%)	4	NA	NA
WP_025106844.1|5218143_5218809_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	56.3	2.8e-57
WP_004106582.1|5218975_5219221_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	6.1e-10
WP_104876958.1|5219299_5221504_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	37.0	7.2e-118
WP_004855080.1|5221582_5222209_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	62.8	5.5e-31
>prophage 381
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5225302	5231063	5883411		Staphylococcus_phage(25.0%)	5	NA	NA
WP_004106557.1|5225302_5225971_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	9.5e-13
WP_025106848.1|5225963_5227022_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_004106554.1|5227278_5228133_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.7	7.0e-45
WP_085520222.1|5228165_5229680_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.1	3.3e-13
WP_104876959.1|5229797_5231063_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	6.4e-26
>prophage 382
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5240448	5241947	5883411		Anomala_cuprea_entomopoxvirus(100.0%)	2	NA	NA
WP_004855045.1|5240448_5241216_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.4e-14
WP_004126158.1|5241233_5241947_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.0	7.2e-11
>prophage 383
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5250286	5252094	5883411		Planktothrix_phage(50.0%)	2	NA	NA
WP_025107858.1|5250286_5251357_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.7	2.6e-20
WP_014227082.1|5251353_5252094_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	26.1	3.1e-12
>prophage 384
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5269967	5272415	5883411		Dickeya_phage(100.0%)	1	NA	NA
WP_014227071.1|5269967_5272415_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	83.3	1.6e-33
>prophage 385
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5275426	5276185	5883411		Escherichia_phage(100.0%)	1	NA	NA
WP_025107850.1|5275426_5276185_+	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.6	3.9e-23
>prophage 386
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5279675	5285853	5883411		Iris_mild_mosaic_virus(50.0%)	3	NA	NA
WP_009654839.1|5279675_5282066_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	41.4	1.2e-14
WP_014227067.1|5282076_5284170_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_085520230.1|5284230_5285853_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	53.1	6.9e-142
>prophage 387
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5300780	5301608	5883411		Vibrio_phage(100.0%)	1	NA	NA
WP_014227055.1|5300780_5301608_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	51.1	1.2e-70
>prophage 388
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5313924	5326776	5883411		Acinetobacter_phage(14.29%)	12	NA	NA
WP_014227049.1|5313924_5314488_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	57.1	4.3e-59
WP_085520234.1|5314577_5315798_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_014839675.1|5315787_5317866_-	membrane protein	NA	H9YQA8	environmental_Halophage	86.2	1.8e-62
WP_000242758.1|5317917_5318550_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_004854875.1|5318854_5319259_+	OsmC family protein	NA	NA	NA	NA	NA
WP_004854874.1|5319302_5320175_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_004125965.1|5320210_5320429_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	38.8	4.0e-05
WP_004854871.1|5320425_5321448_-	hydrolase	NA	NA	NA	NA	NA
WP_014227046.1|5321529_5322249_-	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	27.3	3.3e-19
WP_014227045.1|5322445_5323315_+	ribose-phosphate pyrophosphokinase	NA	A0A2P1CBA5	Salmonella_phage	41.3	4.1e-48
WP_085520239.1|5323319_5324810_+	nicotinate phosphoribosyltransferase	NA	K4F7Y4	Cronobacter_phage	50.5	1.4e-141
WP_014839671.1|5324871_5326776_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.1	3.8e-75
>prophage 389
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5332405	5337977	5883411		uncultured_Caudovirales_phage(33.33%)	7	NA	NA
WP_014227040.1|5332405_5332792_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	1.2e-20
WP_049084404.1|5332791_5333151_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_025107828.1|5333158_5333446_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_002920115.1|5333570_5333945_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_004106370.1|5334040_5334511_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_004115957.1|5334607_5336722_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.2	6.2e-58
WP_004097636.1|5336792_5337977_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	8.9e-14
>prophage 390
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5357858	5359330	5883411	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_085519940.1|5357858_5358806_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	32.1	2.2e-07
WP_004854751.1|5358820_5359330_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	6.7e-19
>prophage 391
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5388219	5389263	5883411		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002918653.1|5388219_5389263_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 392
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5408156	5409425	5883411		Oenococcus_phage(100.0%)	1	NA	NA
WP_032694499.1|5408156_5409425_+	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	33.7	3.0e-60
>prophage 393
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5416574	5417942	5883411	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_014226999.1|5416574_5417942_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	24.2	4.3e-20
>prophage 394
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5421846	5425842	5883411	protease	Pseudomonas_phage(50.0%)	4	NA	NA
WP_014226996.1|5421846_5422335_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.7	4.9e-27
WP_032693266.1|5422428_5423235_+	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_014839641.1|5423354_5424248_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_104876966.1|5424354_5425842_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	23.9	1.3e-09
>prophage 395
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5434550	5448533	5883411		Staphylococcus_phage(28.57%)	16	NA	NA
WP_014226987.1|5434550_5435486_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	33.3	2.9e-15
WP_014839635.1|5435617_5437957_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.1	6.0e-38
WP_014226985.1|5438191_5438845_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_014226984.1|5438841_5439567_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_004106170.1|5439619_5439892_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_004106169.1|5439888_5440743_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_004854593.1|5440788_5441277_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_004106167.1|5441342_5441630_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_085520093.1|5441652_5443086_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_004125705.1|5443133_5443859_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	9.3e-22
WP_004125703.1|5443865_5444411_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_004854587.1|5444379_5444955_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_004854584.1|5444951_5445518_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	82.8	1.3e-58
WP_004854583.1|5445532_5446519_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	32.2	3.5e-40
WP_004854581.1|5446533_5447511_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_004125691.1|5447720_5448533_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.8	6.3e-19
>prophage 396
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5452592	5454034	5883411		Vibrio_phage(50.0%)	2	NA	NA
WP_004854566.1|5452592_5452865_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	68.3	1.3e-16
WP_004854564.1|5453062_5454034_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.4	1.3e-07
>prophage 397
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5460620	5472264	5883411	protease	Micromonas_pusilla_virus(25.0%)	8	NA	NA
WP_004854549.1|5460620_5462555_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.5	9.2e-117
WP_014226978.1|5462653_5463502_+	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	31.0	3.7e-22
WP_014226977.1|5463494_5464832_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_004106103.1|5465061_5465391_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_004106101.1|5465646_5466990_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	94.4	1.6e-64
WP_004125659.1|5467581_5468034_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_004854539.1|5468061_5469549_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_004106093.1|5469573_5472264_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.6	3.9e-25
>prophage 398
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5477663	5479625	5883411		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_014839626.1|5477663_5479625_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.0	4.7e-52
>prophage 399
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5484819	5493135	5883411		Bacillus_phage(20.0%)	11	NA	NA
WP_032693256.1|5484819_5485323_+	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	32.7	1.7e-14
WP_014226970.1|5485309_5485594_-	GIY-YIG nuclease family protein	NA	A0A120L170	Cnaphalocrocis_medinalis_granulovirus	50.6	5.8e-12
WP_014226969.1|5485649_5486093_+	YhbP family protein	NA	NA	NA	NA	NA
WP_004854517.1|5486072_5486591_-	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	29.0	2.4e-11
WP_085520097.1|5486719_5487370_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_032720217.1|5487439_5488480_+	permease	NA	NA	NA	NA	NA
WP_004125578.1|5488587_5489163_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_002918211.1|5489172_5489763_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	5.4e-12
WP_085520098.1|5489785_5490172_-	YraN family protein	NA	NA	NA	NA	NA
WP_085520099.1|5490129_5492211_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_085520100.1|5492274_5493135_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.7	9.5e-50
>prophage 400
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5502772	5503582	5883411		Escherichia_phage(100.0%)	1	NA	NA
WP_025108325.1|5502772_5503582_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.5	2.5e-28
>prophage 401
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5508850	5509996	5883411		Streptococcus_phage(100.0%)	1	NA	NA
WP_085520103.1|5508850_5509996_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	38.6	2.2e-46
>prophage 402
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5526231	5527200	5883411		Escherichia_phage(100.0%)	1	NA	NA
WP_032751374.1|5526231_5527200_-	TerC family protein	NA	A0A291LBC5	Escherichia_phage	34.9	1.0e-39
>prophage 403
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5539628	5541116	5883411		Bacillus_phage(100.0%)	1	NA	NA
WP_014226925.1|5539628_5541116_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	W8CYL7	Bacillus_phage	28.6	1.6e-07
>prophage 404
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5552480	5559190	5883411	tRNA	Herpes_simplex_virus(50.0%)	4	NA	NA
WP_104876972.1|5552480_5555573_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	33.6	2.4e-159
WP_014226910.1|5556210_5557194_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_014226909.1|5557413_5557746_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_158660699.1|5557783_5559190_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	1.6e-33
>prophage 405
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5577004	5582695	5883411	tRNA	Vibrio_phage(33.33%)	4	NA	NA
WP_004105908.1|5577004_5578849_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_014226898.1|5579122_5580868_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	4.1e-76
WP_001144069.1|5581102_5581318_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_014839584.1|5581681_5582695_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	5.3e-108
>prophage 406
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5591879	5593121	5883411		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_014226887.1|5591879_5593121_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	51.6	2.7e-90
>prophage 407
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5598231	5601516	5883411		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_014839576.1|5598231_5599665_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.6	1.5e-39
WP_004854266.1|5599938_5600148_+	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
WP_085520118.1|5600202_5600484_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_004854262.1|5600862_5601516_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.3	1.2e-44
>prophage 408
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5608848	5610683	5883411		Ralstonia_phage(50.0%)	2	NA	NA
WP_085520120.1|5608848_5610009_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	44.2	4.8e-89
WP_004125303.1|5610014_5610683_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	48.1	4.7e-36
>prophage 409
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5615005	5616901	5883411		Bacillus_virus(100.0%)	1	NA	NA
WP_004854242.1|5615005_5616901_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.9	1.4e-90
>prophage 410
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5620192	5630134	5883411		Stx_converting_phage(20.0%)	8	NA	NA
WP_014839568.1|5620192_5620600_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	52.2	1.5e-21
WP_009651841.1|5620677_5621547_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014226868.1|5621669_5623928_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	5.7e-86
WP_004125254.1|5624120_5624858_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_004854230.1|5624942_5626355_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_014226867.1|5626475_5628659_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	4.5e-104
WP_025105926.1|5628752_5629208_-	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	36.8	2.9e-21
WP_025105927.1|5629306_5630134_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	42.9	2.1e-62
>prophage 411
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5649295	5650666	5883411		Streptococcus_phage(100.0%)	1	NA	NA
WP_085520128.1|5649295_5650666_-	pyridoxal-phosphate dependent enzyme	NA	A0A1X9I5F1	Streptococcus_phage	35.4	3.3e-44
>prophage 412
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5661723	5662809	5883411		Geobacillus_virus(100.0%)	1	NA	NA
WP_014839539.1|5661723_5662809_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	38.1	3.8e-11
>prophage 413
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5680823	5681978	5883411		Staphylococcus_phage(100.0%)	1	NA	NA
WP_104876984.1|5680823_5681978_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.4	8.1e-129
>prophage 414
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5689254	5689911	5883411		Bacillus_virus(100.0%)	1	NA	NA
WP_032693819.1|5689254_5689911_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	25.4	5.3e-08
>prophage 415
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5707404	5708637	5883411		Catovirus(100.0%)	1	NA	NA
WP_004115297.1|5707404_5708637_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.9	1.4e-102
>prophage 416
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5716815	5722718	5883411		Prochlorococcus_phage(50.0%)	4	NA	NA
WP_085520146.1|5716815_5719689_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.3	1.3e-263
WP_025105965.1|5719749_5720493_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004854083.1|5720602_5721094_-	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_025105966.1|5721284_5722718_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.7	1.5e-31
>prophage 417
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5734958	5741041	5883411	tRNA	Brevibacillus_phage(25.0%)	5	NA	NA
WP_004105555.1|5734958_5735855_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	3.6e-31
WP_004854054.1|5735877_5736591_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_049101946.1|5736596_5738330_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	6.0e-59
WP_100248296.1|5738415_5739513_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	3.1e-05
WP_004134430.1|5739523_5741041_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	7.7e-87
>prophage 418
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5745698	5751086	5883411	integrase	Clostridium_phage(25.0%)	6	5744882:5744896	5752329:5752343
5744882:5744896	attL	CCTACGGAAGCCGGT	NA	NA	NA	NA
WP_004854045.1|5745698_5746424_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	35.0	2.5e-11
WP_085520389.1|5746742_5747912_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.1	1.4e-139
WP_014839501.1|5748023_5749154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839500.1|5749143_5750064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085520390.1|5750410_5750779_-	helix-turn-helix domain-containing protein	NA	D0R0F8	Streptococcus_phage	27.2	1.8e-05
WP_085520391.1|5750834_5751086_-	DUF1471 domain-containing protein	NA	A0A1B2IE60	Erwinia_phage	57.7	3.4e-08
5752329:5752343	attR	CCTACGGAAGCCGGT	NA	NA	NA	NA
>prophage 419
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5773219	5774395	5883411		Streptococcus_phage(100.0%)	1	NA	NA
WP_085520410.1|5773219_5774395_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.8	2.0e-42
>prophage 420
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5781757	5783314	5883411		Catovirus(100.0%)	1	NA	NA
WP_014226721.1|5781757_5783314_-	acyl--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.2	8.7e-17
>prophage 421
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5790610	5794459	5883411		Escherichia_phage(50.0%)	4	NA	NA
WP_009654966.1|5790610_5791384_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	6.8e-23
WP_042946027.1|5791364_5791718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014226713.1|5791985_5792408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004124798.1|5792905_5794459_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.8	6.6e-158
>prophage 422
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5825509	5828001	5883411		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_004124661.1|5825509_5826271_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	1.4e-20
WP_014226687.1|5826582_5828001_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.2	1.6e-25
>prophage 423
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5836087	5837215	5883411		Bacillus_phage(100.0%)	1	NA	NA
WP_014226681.1|5836087_5837215_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.9	3.9e-11
>prophage 424
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5848850	5867885	5883411		Enterobacteria_phage(16.67%)	16	NA	NA
WP_014839436.1|5848850_5849861_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	30.2	1.5e-30
WP_014226668.1|5850155_5851493_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_014839435.1|5851500_5852928_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	27.5	4.5e-36
WP_004105268.1|5852996_5853770_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014226666.1|5853766_5854246_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014226665.1|5854206_5855223_-	HTH-type transcriptional regulator GalR	NA	NA	NA	NA	NA
WP_085520427.1|5855845_5858005_+	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	A0A2H4PQU7	Staphylococcus_phage	25.4	4.9e-18
WP_032694706.1|5857997_5859191_+	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
WP_014226662.1|5859329_5860370_-	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_004105255.1|5860607_5860826_-	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_004105253.1|5860950_5861664_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	46.8	1.0e-44
WP_014226661.1|5861745_5862441_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_004124593.1|5863123_5863654_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_014226660.1|5863666_5865913_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	22.9	1.5e-09
WP_014226659.1|5866208_5867084_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_004124584.1|5867090_5867885_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	72.0	2.6e-118
>prophage 425
NZ_CP026715	Klebsiella oxytoca strain AR_0028 chromosome, complete genome	5883411	5873359	5881619	5883411		Klosneuvirus(33.33%)	3	NA	NA
WP_085520430.1|5873359_5876245_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	23.8	2.6e-59
WP_014226653.1|5876241_5879787_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.9	8.0e-10
WP_014839419.1|5879783_5881619_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	42.5	2.6e-04
>prophage 1
NZ_CP026716	Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence	189585	0	145988	189585	integrase,protease,transposase	uncultured_Caudovirales_phage(30.77%)	125	40387:40414	117091:117118
WP_009653212.1|1810_3244_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_004099051.1|3332_4616_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_004099052.1|4745_6938_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_001118616.1|7355_8279_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_022631502.1|8579_8780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019706028.1|13037_13589_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	79.0	1.0e-73
WP_019706029.1|13604_15701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019706030.1|16092_17097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118541.1|17307_20316_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	62.8	0.0e+00
WP_004118540.1|20476_21034_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	47.2	8.4e-39
WP_104877019.1|21165_21498_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011977829.1|21851_23000_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	65.9	1.7e-123
WP_004118534.1|23274_23649_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	56.0	4.5e-28
WP_001549953.1|24177_25374_+	MFS transporter	NA	NA	NA	NA	NA
WP_004118529.1|25445_26273_-	universal stress protein	NA	NA	NA	NA	NA
WP_001549885.1|26291_27770_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	1.6e-198
WP_001549886.1|28253_28607_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.1	5.9e-22
WP_001549887.1|28702_29986_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.6	2.9e-175
WP_001549888.1|30035_30464_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.3e-52
WP_000427623.1|31127_32132_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_003100847.1|32210_32768_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_003100853.1|32761_33133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|33129_33630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100858.1|33626_33953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003465043.1|34207_34564_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|34553_34955_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|34951_35242_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_000427623.1|38363_39368_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_104877020.1|39549_40044_-	hypothetical protein	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	63.1	2.2e-43
WP_001549890.1|40040_40373_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
40387:40414	attL	TCTATATTTCCAGAATAATAGAAATATA	NA	NA	NA	NA
WP_000427623.1|41220_42225_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000429838.1|42324_42759_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294667.1|42830_43181_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000735441.1|43196_43472_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000654684.1|43474_43720_+	mercury resistance system transport protein MerF	NA	NA	NA	NA	NA
WP_000136268.1|43716_45363_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.3	1.0e-39
WP_003465059.1|45379_45745_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087809.1|45741_45978_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000904941.1|46030_46645_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	50.3	6.6e-37
WP_013213991.1|46776_47250_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013213995.1|48903_49815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019706023.1|49811_51809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019706022.1|51812_52706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157845837.1|52713_53877_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_023317514.1|55272_56130_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_004171457.1|56122_56200_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004099069.1|56416_56695_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_013213996.1|57015_57567_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.1	6.2e-18
WP_023317517.1|60127_60673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023317518.1|60900_61248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023317519.1|61267_61864_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_023317520.1|61935_62661_-	type-F conjugative transfer system pilin acetylase TraX	NA	NA	NA	NA	NA
WP_001568051.1|63979_64210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004182050.1|64301_64529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118473.1|65255_65573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023157779.1|65607_65862_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.0	8.8e-12
WP_004118478.1|66098_66524_-	antirestriction protein	NA	NA	NA	NA	NA
WP_004118481.1|67043_67274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004182039.1|72553_73525_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.3	9.2e-150
WP_004182032.1|73524_74691_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	4.0e-224
WP_004182030.1|75442_76453_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	54.3	3.0e-87
WP_001515717.1|77170_77911_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004182028.1|79054_80002_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	2.3e-12
WP_071527918.1|80028_80340_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004182026.1|80404_81328_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	7.1e-176
WP_004197688.1|82000_82258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080895248.1|82877_84314_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152070.1|85296_86574_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004178088.1|86636_88634_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|89673_90881_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178091.1|92309_92741_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|92991_94467_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|94459_95140_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|95329_96715_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|96743_97097_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004098959.1|97210_98503_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|98513_101660_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|101746_102187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023317528.1|102313_104767_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.5	9.9e-84
WP_000843497.1|104807_105005_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004182013.1|105038_105776_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_000925242.1|106747_108565_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|108564_109461_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|109500_109881_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|109885_110815_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|110869_111550_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|111546_112947_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004152085.1|113163_113598_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_024623170.1|113829_114009_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_004196769.1|115751_116261_+	major intrinsic family protein	NA	NA	NA	NA	NA
WP_004196778.1|116310_116808_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152092.1|117139_117466_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
117091:117118	attR	TATATTTCTATTATTCTGGAAATATAGA	NA	NA	NA	NA
WP_085921126.1|117465_118176_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004182005.1|118184_118730_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152095.1|118805_119168_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004152096.1|121064_121601_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152097.1|121633_122059_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|122071_123361_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|123408_125160_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|125177_125540_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|125589_125940_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152102.1|126297_126567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152103.1|126554_127130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|127160_127655_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152105.1|127698_128067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|128100_128304_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152107.1|128352_128610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152108.1|128685_128940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|129115_129382_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|129369_129852_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001567368.1|130052_131456_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|131484_132117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077253535.1|132342_133689_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004143398.1|133737_134133_+	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_004152113.1|135622_136585_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_009483782.1|136571_137321_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152115.1|137558_137756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152116.1|137755_140551_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152117.1|140674_141244_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152118.1|141278_141560_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004118208.1|141803_142067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118209.1|142081_142345_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004181997.1|143495_144503_-	formamidase	NA	NA	NA	NA	NA
WP_004181996.1|144538_145228_-	urea ABC transporter ATP-binding subunit UrtE	NA	G9BWD6	Planktothrix_phage	29.6	8.5e-17
WP_004181995.1|145238_145988_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	2.4e-17
>prophage 2
NZ_CP026716	Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence	189585	149587	159811	189585	transposase	Hokovirus(25.0%)	5	NA	NA
WP_004181991.1|149587_152968_+	response regulator	NA	A0A1V0SGX0	Hokovirus	30.3	1.7e-41
WP_004181990.1|152930_153851_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.1	2.0e-13
WP_072143344.1|154847_155816_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	2.0e-173
WP_000156884.1|156095_157118_+|transposase	IS110-like element IS5708 family transposase	transposase	NA	NA	NA	NA
WP_104011511.1|158675_159811_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	53.1	2.3e-75
>prophage 3
NZ_CP026716	Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence	189585	163550	164861	189585		Enterobacteria_phage(100.0%)	1	NA	NA
WP_100160450.1|163550_164861_+	purine permease	NA	Q9KX94	Enterobacteria_phage	27.2	4.4e-30
>prophage 4
NZ_CP026716	Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence	189585	171907	172612	189585	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001067855.1|171907_172612_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 5
NZ_CP026716	Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence	189585	176847	177615	189585		Bacillus_virus(100.0%)	1	NA	NA
WP_072193875.1|176847_177615_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.3	1.8e-28
>prophage 6
NZ_CP026716	Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence	189585	187172	188816	189585		Streptococcus_phage(100.0%)	1	NA	NA
WP_004197675.1|187172_188816_-	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	25.0	1.5e-22
>prophage 1
NZ_CP026717	Klebsiella oxytoca strain AR_0028 plasmid unitig_2_pilon, complete sequence	80970	59860	67059	80970	transposase	Aeromonas_phage(28.57%)	10	NA	NA
WP_020314651.1|59860_60562_-	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	34.7	6.2e-23
WP_020314631.1|60996_61227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020314635.1|61430_61676_+	DinI-like family protein	NA	Q7Y3V9	Yersinia_phage	39.3	1.1e-08
WP_046960466.1|61672_62122_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.0	2.3e-31
WP_020314652.1|62133_63408_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.7	1.3e-148
WP_020314634.1|63582_63810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644718.1|63854_64481_-	ParA family protein	NA	A0A2H4EW66	Aeromonas_phage	34.4	4.5e-25
WP_020314642.1|65078_65699_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.0	1.0e-08
WP_022644719.1|65718_65985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020314639.1|66105_67059_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	57.1	9.5e-75
>prophage 1
NZ_CP026718	Klebsiella oxytoca strain AR_0028 plasmid unitig_3_pilon, complete sequence	91175	25516	63913	91175	transposase	Stx2-converting_phage(22.22%)	33	NA	NA
WP_004098871.1|25516_26494_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	59.9	4.4e-75
WP_101867698.1|26451_26640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098873.1|26957_28385_-	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_040118505.1|28401_29001_-	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_038423659.1|29036_30626_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	60.6	9.7e-173
WP_009309933.1|30656_31007_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	67.2	9.6e-41
WP_009309932.1|31003_31408_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	67.5	1.6e-23
WP_004098877.1|31540_32611_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_004098879.1|33207_34308_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_004098881.1|34447_36373_+	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_004098883.1|36350_36899_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_004098885.1|36900_37266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098891.1|37335_38499_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_004098893.1|38536_38965_-	heme-binding protein	NA	NA	NA	NA	NA
WP_004098894.1|39358_41026_+	propanediol/glycerol family dehydratase large subunit	NA	NA	NA	NA	NA
WP_004098897.1|41039_41630_+	propanediol/glycerol family dehydratase medium subunit	NA	NA	NA	NA	NA
WP_004098899.1|41626_42058_+	diol dehydratase small subunit	NA	NA	NA	NA	NA
WP_004098901.1|42070_43918_+	diol dehydratase reactivase subunit alpha	NA	NA	NA	NA	NA
WP_086531829.1|43961_44978_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	3.2e-185
WP_004098904.1|45187_46441_-	lactose permease	NA	NA	NA	NA	NA
WP_004098907.1|46492_49567_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	95.9	0.0e+00
WP_004152286.1|49688_50771_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
WP_087786203.1|50975_51670_-|transposase	IS1-like element IS1N family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	4.4e-130
WP_040118506.1|51709_51955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040118507.1|51955_52927_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_040118508.1|54157_54790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074189070.1|56552_57359_-	SecC motif-containing protein	NA	NA	NA	NA	NA
WP_059509659.1|57367_57808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059509657.1|58039_59401_-	FRG domain-containing protein	NA	Q9AZ51	Lactococcus_phage	34.0	1.8e-05
WP_064407410.1|59414_60218_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_077257948.1|60275_61622_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|61848_62481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|62509_63913_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
