The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026719	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0060 chromosome, complete genome	5104736	62105	141844	5104736	head,portal,integrase,tail,terminase,coat,holin,protease,capsid	Enterobacterial_phage(32.73%)	97	87781:87796	147436:147451
WP_049134265.1|62105_63068_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_049134263.1|63064_65449_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_049134261.1|65424_66186_-	molecular chaperone	NA	NA	NA	NA	NA
WP_032669620.1|66202_66751_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_017693232.1|66758_67331_-	fimbrial major subunit CsuA/B family protein	NA	NA	NA	NA	NA
WP_017384415.1|67758_69018_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_003859699.1|69114_69618_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017384416.1|69637_71647_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_003859697.1|71651_72581_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_003859696.1|72577_73465_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_003859695.1|73588_74167_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_006811111.1|74169_74529_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_017384418.1|75315_75744_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_015570257.1|75759_77184_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_017384420.1|77158_77962_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_003859689.1|78115_79096_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_023303911.1|79110_80625_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	1.6e-12
WP_017384422.1|80696_81686_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_049133043.1|82003_82561_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_049133040.1|83062_83566_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_017693227.1|84142_85486_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_003859683.1|85566_85818_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_003859682.1|85924_86008_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_049012704.1|86222_87641_+	MFS transporter	NA	NA	NA	NA	NA
WP_003859680.1|87683_88322_-	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
87781:87796	attL	ACCAGCTCAGGATCGA	NA	NA	NA	NA
WP_015570249.1|88567_88906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003859676.1|89106_89604_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_003859673.1|89640_89877_-	YecH family protein	NA	NA	NA	NA	NA
WP_049133999.1|90068_91280_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_003859671.1|91596_92265_-	YecA family protein	NA	NA	NA	NA	NA
WP_003859669.1|92676_93798_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_049133186.1|93866_94781_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_049133189.1|94792_96067_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_015570244.1|96063_96939_+	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	25.3	4.0e-11
WP_017384431.1|96935_97652_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	1.0e-12
WP_045910790.1|97817_98288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045910791.1|98293_99220_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049019479.1|99774_100095_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	55.7	7.2e-27
WP_039268852.1|100094_100334_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	71.8	3.5e-26
WP_104879676.1|100416_101691_-|tail	phage tail protein	tail	K7PKG5	Enterobacteria_phage	69.4	5.2e-161
WP_017382566.1|101749_101983_-	hypothetical protein	NA	E4WL42	Enterobacteria_phage	78.9	3.9e-30
WP_063159496.1|102090_102762_-	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	73.1	3.4e-87
WP_023303629.1|102762_103077_-	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	66.7	5.9e-34
WP_104879677.1|103119_106953_-	DUF1983 domain-containing protein	NA	K7P840	Enterobacteria_phage	78.1	0.0e+00
WP_104879678.1|107006_107606_-|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	73.3	4.6e-75
WP_104879679.1|107662_107998_-	hypothetical protein	NA	Q6UAW3	Klebsiella_phage	47.7	1.6e-21
WP_104879680.1|108004_108352_-	hypothetical protein	NA	Q5G8W9	Enterobacteria_phage	51.7	2.0e-06
WP_104879681.1|108385_109096_-	peptidase P60	NA	K7PGV2	Enterobacterial_phage	96.6	4.6e-143
WP_045407314.1|109097_109856_-|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	99.6	1.1e-147
WP_023332594.1|109852_110191_-|tail	phage tail protein	tail	K7P7R1	Enterobacteria_phage	99.1	1.1e-62
WP_104879682.1|110193_113472_-|tail	phage tail tape measure protein	tail	A0A220NRN7	Escherichia_phage	95.7	0.0e+00
WP_032622502.1|113507_113771_-	DUF4035 domain-containing protein	NA	K7P7L5	Enterobacteria_phage	93.1	2.7e-40
WP_032622503.1|113794_114196_-|tail	phage tail protein	tail	K7P7C2	Enterobacteria_phage	95.5	1.3e-65
WP_104879683.1|114250_114721_-|tail	phage tail protein	tail	K7PJR9	Enterobacterial_phage	80.8	9.1e-63
WP_049133285.1|114775_115123_-	DUF3168 domain-containing protein	NA	K7P7Q9	Enterobacteria_phage	93.0	5.2e-55
WP_104879684.1|115119_115569_-	HK97 gp10 family phage protein	NA	K7PH84	Enterobacterial_phage	98.7	7.6e-75
WP_104879685.1|115565_115904_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	73.2	6.0e-40
WP_022650848.1|115912_116239_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	81.5	1.3e-47
WP_023296252.1|116282_117494_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.9	9.5e-197
WP_104879686.1|117503_118352_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	91.4	4.6e-137
WP_045347669.1|118365_119670_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	88.9	4.4e-224
WP_104879687.1|119669_121412_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.9	2.0e-139
WP_104879688.1|121365_121830_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.7e-48
WP_045332798.1|121957_122302_-	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	73.9	3.0e-47
WP_104879689.1|122298_122889_-	hypothetical protein	NA	S4TR53	Salmonella_phage	79.5	7.6e-91
WP_039268833.1|123054_123339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039268832.1|123354_123585_-	DUF1327 domain-containing protein	NA	NA	NA	NA	NA
WP_104879690.1|123603_125061_-	glycosyltransferase	NA	K7PKP3	Enterobacterial_phage	89.1	1.4e-263
WP_049019287.1|125078_125306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063945197.1|125317_126157_-	DUF1983 domain-containing protein	NA	M9NZE9	Enterobacteria_phage	57.4	8.4e-51
WP_049019286.1|126506_126701_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	87.8	4.8e-18
WP_049019289.1|126651_126933_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	78.5	5.7e-28
WP_063436809.1|126940_127570_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	88.0	2.4e-103
WP_049019334.1|127569_127851_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	95.7	1.9e-44
WP_017145563.1|127837_128233_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
WP_053504488.1|128431_129262_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	46.9	3.9e-56
WP_063946504.1|129274_130264_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	86.0	8.4e-167
WP_063921715.1|130260_130986_-	antirepressor	NA	G0ZND1	Cronobacter_phage	52.2	1.7e-55
WP_045332649.1|131001_131391_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	87.3	1.4e-61
WP_059443612.1|131387_131708_-	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	79.2	5.8e-45
WP_022650831.1|131704_131932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063159430.1|131928_132588_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	78.9	2.7e-97
WP_063946503.1|132587_133082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063946502.1|133078_134032_-	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	93.7	3.2e-171
WP_044703885.1|134364_134919_-	hypothetical protein	NA	S5FXP0	Shigella_phage	54.2	1.1e-46
WP_044703883.1|134941_135145_-	hypothetical protein	NA	A0A1W6JP24	Morganella_phage	60.9	2.1e-16
WP_044703881.1|135245_135878_+	helix-turn-helix domain-containing protein	NA	A0A1W6JP50	Morganella_phage	56.1	1.1e-50
WP_154817508.1|136026_136407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720086.1|136732_137146_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	86.1	6.2e-55
WP_063946565.1|137145_137973_+	hypothetical protein	NA	K7PKM7	Enterobacterial_phage	86.7	5.1e-125
WP_063132193.1|138436_138685_+	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	86.2	3.7e-31
WP_063132192.1|138681_139062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162873700.1|139064_139241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063946570.1|139919_140237_+	hypothetical protein	NA	K7P7P8	Enterobacteria_phage	92.3	4.3e-48
WP_063436767.1|140303_140573_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	84.3	1.4e-36
WP_016063584.1|140606_140834_+	DUF4224 domain-containing protein	NA	K7PHA0	Enterobacterial_phage	100.0	3.4e-39
WP_063436768.1|140833_141844_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PLZ2	Enterobacterial_phage	91.4	6.8e-180
147436:147451	attR	ACCAGCTCAGGATCGA	NA	NA	NA	NA
>prophage 2
NZ_CP026719	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0060 chromosome, complete genome	5104736	318432	327318	5104736		Tupanvirus(28.57%)	8	NA	NA
WP_049134167.1|318432_319044_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.8	9.2e-15
WP_023303969.1|319083_320064_-	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_049134169.1|320256_321261_+	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.0	3.8e-34
WP_003859477.1|321308_322475_-	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	54.0	4.1e-112
WP_049134171.1|322714_323596_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.7	6.9e-104
WP_049134173.1|323596_324682_-	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	52.3	6.3e-99
WP_006811221.1|324771_326178_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	5.2e-37
WP_075207977.1|326304_327318_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	48.3	2.3e-87
>prophage 3
NZ_CP026719	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0060 chromosome, complete genome	5104736	1362689	1430519	5104736	head,portal,integrase,tail,plate,lysis,terminase,tRNA,holin,capsid	Salmonella_phage(45.83%)	85	1355653:1355672	1442282:1442301
1355653:1355672	attL	CGGTATCGCGCTCGGGGGAA	NA	NA	NA	NA
WP_015571911.1|1362689_1363703_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	1.4e-108
WP_001144069.1|1363939_1364155_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003862574.1|1364270_1366016_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	1.4e-76
WP_015571912.1|1366168_1368013_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_017384024.1|1368113_1368620_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_024146528.1|1368956_1369175_-	DNA-binding transcriptional regulator	NA	Q53ZE7	Salmonella_virus	75.0	4.9e-27
WP_057057191.1|1369244_1370345_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	92.9	3.7e-187
WP_001528562.1|1370341_1370827_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.8	5.0e-72
WP_057057192.1|1370823_1374273_-|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	63.8	0.0e+00
WP_023206368.1|1374265_1374385_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	92.3	5.7e-14
WP_032636603.1|1374399_1374702_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	97.0	1.4e-43
WP_024552851.1|1374756_1375272_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	98.2	5.1e-91
WP_063132327.1|1375281_1376454_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	7.3e-210
WP_063132328.1|1376587_1377184_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	47.9	4.3e-49
WP_063132329.1|1377183_1378488_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	52.0	1.3e-127
WP_063132330.1|1378484_1379090_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	96.0	4.3e-113
WP_063132331.1|1379082_1379991_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.7	2.4e-144
WP_045329999.1|1379977_1380337_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	92.4	1.8e-55
WP_063160527.1|1380333_1380912_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	97.9	1.3e-106
WP_023223446.1|1380980_1381427_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	89.7	6.4e-66
WP_063160526.1|1381419_1381851_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	97.2	4.7e-74
WP_162891020.1|1381946_1382375_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	97.2	7.3e-67
WP_104879738.1|1382371_1382749_-	peptidase	NA	A0A1S6KZZ2	Salmonella_phage	96.8	7.6e-60
WP_104879739.1|1382753_1383263_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.6	1.9e-93
WP_000171565.1|1383243_1383459_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_094464777.1|1383462_1383666_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	98.5	1.1e-33
WP_025711939.1|1383665_1384130_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	1.9e-84
WP_024552863.1|1384223_1384874_-	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	99.5	1.4e-114
WP_023223453.1|1384877_1385939_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	98.9	2.3e-194
WP_088728467.1|1385955_1386789_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	97.5	3.8e-128
WP_104879740.1|1386931_1388698_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	94.9	0.0e+00
WP_104879741.1|1388966_1390007_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.4	8.8e-175
WP_032636651.1|1390057_1390396_-	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_032636653.1|1390395_1391370_-	hypothetical protein	NA	A4PE73	Ralstonia_virus	41.5	1.6e-53
WP_001217561.1|1391716_1391950_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
WP_001154443.1|1391961_1392150_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	6.1e-26
WP_104879742.1|1392314_1394723_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	97.1	0.0e+00
WP_063132333.1|1394713_1395571_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	94.0	1.9e-154
WP_063132334.1|1395567_1395795_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	5.1e-35
WP_001744223.1|1395794_1396028_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	80.5	5.4e-24
WP_000963477.1|1396095_1396437_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	86.7	2.6e-51
WP_015386352.1|1396400_1396601_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.9	8.7e-31
WP_015386351.1|1396608_1397118_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	93.5	1.0e-83
WP_023206292.1|1397152_1397389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063840536.1|1397476_1398127_+	phage repressor protein CI	NA	F1BUN8	Cronobacter_phage	33.5	1.1e-26
WP_057057207.1|1398152_1398698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023206295.1|1398703_1399717_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	60.2	4.8e-117
WP_104879743.1|1400062_1400953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104879744.1|1401567_1403244_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	63.0	2.5e-203
WP_044857203.1|1403246_1403795_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	74.7	6.0e-66
WP_104879745.1|1403766_1404492_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	51.0	2.0e-61
WP_104879746.1|1404481_1404997_-|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	54.4	1.3e-46
WP_104879747.1|1407418_1408006_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	80.5	9.9e-91
WP_104879748.1|1407998_1409183_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.5	2.6e-175
WP_104879749.1|1409179_1409509_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	73.4	5.4e-38
WP_104879750.1|1409505_1411818_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	56.7	1.8e-215
WP_057058812.1|1412005_1412266_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	62.8	1.6e-21
WP_042863242.1|1412385_1412754_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	52.4	1.8e-21
WP_039268768.1|1412753_1413095_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	89.1	5.4e-49
WP_032657752.1|1413091_1413379_-|holin	holin	holin	C7BGD7	Burkholderia_phage	51.8	2.1e-14
WP_032657750.1|1413388_1413844_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	73.5	5.4e-60
WP_104879752.1|1413840_1414968_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	82.7	9.6e-175
WP_104879753.1|1414964_1415672_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	78.6	2.7e-103
WP_087924283.1|1415668_1416175_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	70.9	3.9e-67
WP_032657740.1|1416171_1416663_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	77.3	3.2e-58
WP_104879754.1|1416722_1417424_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	67.7	5.2e-86
WP_047362322.1|1417427_1418450_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	79.4	4.2e-153
WP_104879755.1|1418509_1419304_-|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	52.4	2.5e-68
WP_104879756.1|1419476_1421252_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	82.9	1.7e-290
WP_104879757.1|1421248_1422301_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	78.6	4.0e-159
WP_042863253.1|1422297_1422621_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	90.4	2.0e-48
WP_104879758.1|1422594_1422801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104879759.1|1422922_1424971_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	75.6	4.7e-305
WP_104879760.1|1424939_1425152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104879761.1|1425148_1426015_-	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	93.6	1.1e-146
WP_104879762.1|1426011_1426287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104879763.1|1426277_1426511_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_013097408.1|1426577_1426979_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	54.1	6.0e-39
WP_104879764.1|1426978_1427407_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.2	4.5e-24
WP_042863261.1|1427396_1427591_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_104879765.1|1427689_1427932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104879766.1|1428012_1428516_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	69.5	5.6e-58
WP_023136170.1|1428546_1428768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104879767.1|1428901_1429483_+	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	35.5	1.4e-28
WP_104879768.1|1429484_1430519_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.4	1.9e-121
1442282:1442301	attR	CGGTATCGCGCTCGGGGGAA	NA	NA	NA	NA
>prophage 4
NZ_CP026719	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0060 chromosome, complete genome	5104736	3340045	3388913	5104736	head,integrase,tail,terminase,holin	Salmonella_phage(24.19%)	76	3339986:3340032	3389093:3389139
3339986:3340032	attL	CTTCTAAGCCGTAGGTCGTAGGTTCGAATCCTACAGGGCGTGCCATT	NA	NA	NA	NA
WP_025756108.1|3340045_3341209_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	99.5	1.4e-229
WP_071882737.1|3341085_3341421_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_063401378.1|3341531_3341792_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	48.1	4.3e-06
WP_049134161.1|3341801_3342041_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	75.6	7.5e-29
WP_049134092.1|3342018_3342516_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.1	2.8e-70
WP_049134091.1|3342515_3342734_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	68.1	1.3e-19
WP_049134090.1|3343000_3343192_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	62.7	2.1e-13
WP_104879809.1|3343188_3343461_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	65.9	5.7e-25
WP_104879810.1|3343480_3343699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080350712.1|3343695_3344298_-	hypothetical protein	NA	A0A142IF90	Pseudomonas_phage	43.7	1.1e-23
WP_049134702.1|3344281_3344923_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	90.9	9.4e-111
WP_049134703.1|3344919_3345072_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	44.2	1.6e-05
WP_049134704.1|3345068_3345497_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	97.9	4.0e-73
WP_049134705.1|3345493_3346174_-	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	94.7	1.0e-126
WP_049134706.1|3346170_3347016_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	60.3	1.2e-68
WP_049134707.1|3347034_3347319_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	94.7	1.5e-47
WP_006809788.1|3347391_3347601_-	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	95.7	6.7e-34
WP_023330205.1|3347597_3347756_-	hypothetical protein	NA	G8C7T3	Escherichia_phage	92.3	1.1e-20
WP_049134708.1|3348287_3348620_-	hypothetical protein	NA	A0A2I7R1U5	Vibrio_phage	41.8	8.8e-12
WP_049134709.1|3348825_3349188_-	hypothetical protein	NA	C6ZR44	Salmonella_phage	74.2	5.6e-44
WP_047746403.1|3349395_3349578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154400857.1|3349578_3349743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023313997.1|3350167_3350365_+	hypothetical protein	NA	G8C7T7	Escherichia_phage	93.8	9.2e-25
WP_032655965.1|3350500_3351448_-	hypothetical protein	NA	A9YX09	Burkholderia_phage	42.3	2.0e-61
WP_050594912.1|3351586_3352228_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	76.8	5.2e-93
WP_006809779.1|3352331_3352547_+	helix-turn-helix transcriptional regulator	NA	K7PMD5	Enterobacterial_phage	81.7	2.8e-27
WP_049134618.1|3352577_3353123_+	hypothetical protein	NA	G8C7U3	Escherichia_phage	97.8	2.8e-95
WP_139154216.1|3353184_3353901_+	GIY-YIG nuclease family protein	NA	A0A088F856	Sulfitobacter_phage	46.3	5.6e-11
WP_032676293.1|3353901_3354765_+	hypothetical protein	NA	G8C7U5	Escherichia_phage	95.5	1.4e-154
WP_049134613.1|3354761_3355451_+	phage replication protein P	NA	G8C7U6	Escherichia_phage	96.1	7.7e-127
WP_049134614.1|3355452_3356025_+	protein ren	NA	K7P7J0	Enterobacteria_phage	38.3	1.1e-09
WP_049134615.1|3356021_3356489_+	hypothetical protein	NA	A0A2H4N7F5	Pectobacterium_phage	58.9	1.1e-10
WP_049134616.1|3356485_3356722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049134617.1|3356718_3357192_+	ead/Ea22-like family protein	NA	K7P6V8	Enterobacteria_phage	47.8	2.6e-09
WP_053087146.1|3357326_3358184_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	38.3	8.7e-19
WP_049134621.1|3358263_3358773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049134563.1|3359025_3359475_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	49.0	1.6e-35
WP_049134562.1|3359467_3360115_+	bacteriophage Lambda NinG protein	NA	S4TSR3	Salmonella_phage	73.0	1.1e-82
WP_049134561.1|3360111_3360336_+	hypothetical protein	NA	Q76H69	Enterobacteria_phage	68.9	2.5e-26
WP_049134560.1|3360448_3361072_+	hypothetical protein	NA	A0A2H4FND2	Salmonella_phage	71.6	5.6e-84
WP_001514183.1|3361888_3362290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001514184.1|3362286_3362562_+|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	5.8e-09
WP_023296427.1|3362564_3363107_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	70.4	1.6e-74
WP_104879812.1|3363103_3363382_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	49.4	7.4e-12
WP_045339775.1|3363614_3363824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047642428.1|3363970_3364174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049134553.1|3364177_3364816_+	hypothetical protein	NA	I6S676	Salmonella_phage	92.0	1.2e-113
WP_049134554.1|3364846_3365305_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	80.3	8.1e-64
WP_104879813.1|3365297_3366551_+|terminase	PBSX family phage terminase large subunit	terminase	I6RSK1	Salmonella_phage	96.2	2.9e-212
WP_049134535.1|3366644_3366848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154816550.1|3366857_3367013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104879814.1|3367270_3368593_+	DUF1073 domain-containing protein	NA	A0A1V0E5Q5	Salmonella_phage	88.0	1.0e-228
WP_049134710.1|3368579_3369506_+|head	SPP1 gp7 family phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	93.5	6.2e-164
WP_049134711.1|3369572_3370832_+	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	89.0	4.7e-215
WP_049133596.1|3370844_3371294_+	hypothetical protein	NA	H6WRT3	Salmonella_phage	86.6	1.9e-65
WP_049133592.1|3371311_3372388_+	hypothetical protein	NA	Q5G8Y0	Enterobacteria_phage	91.6	1.0e-189
WP_049133589.1|3372397_3372691_+	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	88.7	1.1e-42
WP_049133969.1|3372753_3373155_+	hypothetical protein	NA	A0A1V0E5R0	Salmonella_phage	80.8	1.6e-55
WP_006820518.1|3373154_3373328_+	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	49.1	7.8e-12
WP_049133930.1|3373327_3373678_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	66.1	7.6e-38
WP_045324574.1|3373691_3373880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014883994.1|3373922_3374291_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	74.6	3.0e-45
WP_049133934.1|3374287_3374671_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	50.4	1.9e-34
WP_049133936.1|3374729_3375485_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	53.6	9.9e-59
WP_049133940.1|3375535_3376276_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	53.5	3.8e-63
WP_033817211.1|3376364_3376724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049133943.1|3376812_3379317_+	tape measure protein	NA	A0A1B1W284	Salmonella_phage	39.4	1.5e-98
WP_032669794.1|3379316_3379814_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	89.1	4.8e-86
WP_058671452.1|3379813_3380284_+	hypothetical protein	NA	F1C5F1	Cronobacter_phage	92.9	7.0e-79
WP_049133949.1|3380297_3380663_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	90.8	1.4e-63
WP_049133956.1|3380649_3383127_+|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	92.4	0.0e+00
WP_128755640.1|3383185_3385651_+	right-handed parallel beta-helix repeat-containing protein	NA	F1C5A8	Cronobacter_phage	59.2	3.0e-40
WP_049133960.1|3385680_3387138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104879815.1|3387134_3388052_-	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	92.4	4.6e-159
WP_047746728.1|3388048_3388411_-	GtrA family protein	NA	U5P0S6	Shigella_phage	84.2	3.4e-49
WP_047746730.1|3388523_3388913_+	DNA polymerase V	NA	K7P6F7	Enterobacteria_phage	66.4	1.7e-46
3389093:3389139	attR	CTTCTAAGCCGTAGGTCGTAGGTTCGAATCCTACAGGGCGTGCCATT	NA	NA	NA	NA
>prophage 5
NZ_CP026719	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0060 chromosome, complete genome	5104736	4019763	4151708	5104736	head,portal,transposase,integrase,tail,plate,terminase,holin,tRNA,protease,capsid	Enterobacteria_phage(27.93%)	150	4026183:4026205	4136910:4136925
WP_104879842.1|4019763_4020882_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	44.7	3.0e-80
WP_023303435.1|4020856_4021120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104879843.1|4021187_4023752_-	exonuclease	NA	K7P6V4	Enterobacteria_phage	46.5	6.4e-142
WP_104879844.1|4023892_4024189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104879845.1|4024354_4024537_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_032658059.1|4024927_4025308_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	69.6	3.3e-18
WP_072199678.1|4025414_4025630_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_104879846.1|4025633_4026188_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	36.0	2.9e-15
4026183:4026205	attL	TTTTAATCGAGTTTTGACCAATG	NA	NA	NA	NA
WP_128755641.1|4026224_4027283_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	46.0	3.3e-36
4026183:4026205	attL	TTTTAATCGAGTTTTGACCAATG	NA	NA	NA	NA
WP_164913540.1|4027068_4027740_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	76.8	3.0e-67
WP_023303444.1|4027754_4028174_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012132763.1|4028177_4028438_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	73.5	8.1e-29
WP_164913541.1|4028434_4028608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023295209.1|4028767_4029172_+	hypothetical protein	NA	Q5G8V2	Enterobacteria_phage	74.0	7.5e-13
WP_104879848.1|4032102_4033125_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.7	4.7e-104
WP_104879849.1|4033441_4033843_+	DNA-binding protein	NA	Q8SBE8	Shigella_phage	46.2	1.2e-15
WP_104879851.1|4034047_4035067_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	52.8	1.1e-97
WP_104879916.1|4035079_4035685_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	67.3	9.3e-76
WP_032619483.1|4036023_4036428_+	exported phage-related protein	NA	NA	NA	NA	NA
WP_044489029.1|4036424_4036721_+|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	33.8	5.5e-05
WP_104879852.1|4036717_4037347_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	89.5	5.4e-103
WP_058687563.1|4037354_4037633_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	43.2	5.9e-09
WP_058687564.1|4037583_4037769_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	76.4	4.6e-18
WP_058687565.1|4037825_4038059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023303457.1|4038463_4038967_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	61.7	3.4e-47
WP_032667900.1|4038967_4041091_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	74.5	2.1e-303
WP_023303459.1|4041087_4041303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023303460.1|4041311_4042832_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	55.4	3.7e-153
WP_032667901.1|4042821_4044900_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	51.8	8.7e-198
WP_023303462.1|4044968_4045304_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	43.6	4.4e-11
WP_023303463.1|4045303_4045660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023303464.1|4045661_4046324_+	hypothetical protein	NA	R9TR34	Vibrio_phage	36.7	1.4e-21
WP_023303465.1|4046332_4046887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023303466.1|4046879_4047503_+|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	30.3	3.6e-06
WP_023303467.1|4047541_4049011_+	hypothetical protein	NA	R9TMQ0	Vibrio_phage	47.4	3.7e-78
WP_023299868.1|4049007_4049514_+|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_023303468.1|4049565_4049853_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_023303470.1|4052054_4052525_+|tail	phage tail protein	tail	D4HTW5	Vibrio_phage	34.9	6.4e-16
WP_023303471.1|4052499_4052715_+	hypothetical protein	NA	R9TR63	Vibrio_phage	52.9	8.8e-13
WP_023303472.1|4052717_4053836_+	hypothetical protein	NA	R9TNM7	Vibrio_phage	33.4	5.4e-37
WP_023303473.1|4053872_4054226_+	hypothetical protein	NA	E5FFH4	Burkholderia_phage	50.0	1.1e-20
WP_023303474.1|4054209_4055124_+	hypothetical protein	NA	A0A088FQL4	Escherichia_phage	49.7	5.9e-66
WP_023303475.1|4055116_4055668_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	44.1	3.3e-27
WP_023303477.1|4057790_4058306_+|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	41.5	7.0e-24
WP_023303478.1|4058302_4059169_-	beta-1,4-mannosyl-glycoprotein beta-1,4-N-acetylglucosaminyltransferase	NA	M1I711	Paramecium_bursaria_Chlorella_virus	34.2	5.1e-27
WP_023303479.1|4059282_4059693_-	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	51.1	1.9e-35
WP_012906750.1|4059714_4059894_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	72.9	1.3e-17
WP_104879842.1|4060317_4061436_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	44.7	3.0e-80
WP_023303435.1|4061410_4061674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104879843.1|4061741_4064306_-	exonuclease	NA	K7P6V4	Enterobacteria_phage	46.5	6.4e-142
WP_104879844.1|4064446_4064743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104879845.1|4064908_4065091_-	DUF1482 family protein	NA	NA	NA	NA	NA
4064892:4064914	attR	CATTGGTCAAAACTCGATTAAAA	NA	NA	NA	NA
WP_032658059.1|4065480_4065861_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	69.6	3.3e-18
4064892:4064914	attR	CATTGGTCAAAACTCGATTAAAA	NA	NA	NA	NA
WP_072199678.1|4065967_4066183_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_104879846.1|4066186_4066741_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	36.0	2.9e-15
WP_128755641.1|4066777_4067836_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	46.0	3.3e-36
WP_164913540.1|4067621_4068293_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	76.8	3.0e-67
WP_023303444.1|4068307_4068727_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012132763.1|4068730_4068991_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	73.5	8.1e-29
WP_022651653.1|4068987_4069320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023295209.1|4069319_4069724_+	hypothetical protein	NA	Q5G8V2	Enterobacteria_phage	74.0	7.5e-13
WP_104879853.1|4069726_4070473_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.7	2.6e-67
WP_104879854.1|4070469_4072353_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	52.1	7.1e-199
WP_104879855.1|4072574_4073684_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	60.6	7.9e-105
WP_104879849.1|4074000_4074402_+	DNA-binding protein	NA	Q8SBE8	Shigella_phage	46.2	1.2e-15
WP_104879851.1|4074606_4075626_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	52.8	1.1e-97
WP_104879916.1|4075638_4076244_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	67.3	9.3e-76
WP_032619483.1|4076582_4076987_+	exported phage-related protein	NA	NA	NA	NA	NA
WP_044489029.1|4076983_4077280_+|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	33.8	5.5e-05
WP_104879852.1|4077276_4077906_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	89.5	5.4e-103
WP_058687563.1|4077913_4078192_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	43.2	5.9e-09
WP_058687564.1|4078142_4078328_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	76.4	4.6e-18
WP_058687565.1|4078384_4078618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023303457.1|4079022_4079526_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	61.7	3.4e-47
WP_032667900.1|4079526_4081650_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	74.5	2.1e-303
WP_023303459.1|4081646_4081862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023303460.1|4081870_4083391_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	55.4	3.7e-153
WP_032667901.1|4083380_4085459_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	51.8	8.7e-198
WP_023303462.1|4085527_4085863_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	43.6	4.4e-11
WP_023303463.1|4085862_4086219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023303464.1|4086220_4086883_+	hypothetical protein	NA	R9TR34	Vibrio_phage	36.7	1.4e-21
WP_023303465.1|4086891_4087446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023303466.1|4087438_4088062_+|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	30.3	3.6e-06
WP_023303467.1|4088100_4089570_+	hypothetical protein	NA	R9TMQ0	Vibrio_phage	47.4	3.7e-78
WP_104879856.1|4090114_4090510_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_104879857.1|4092208_4092607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023303470.1|4092603_4093074_+|tail	phage tail protein	tail	D4HTW5	Vibrio_phage	34.9	6.4e-16
WP_023303471.1|4093048_4093264_+	hypothetical protein	NA	R9TR63	Vibrio_phage	52.9	8.8e-13
WP_023303472.1|4093266_4094385_+	hypothetical protein	NA	R9TNM7	Vibrio_phage	33.4	5.4e-37
WP_023303473.1|4094421_4094775_+	hypothetical protein	NA	E5FFH4	Burkholderia_phage	50.0	1.1e-20
WP_023303474.1|4094758_4095673_+	hypothetical protein	NA	A0A088FQL4	Escherichia_phage	49.7	5.9e-66
WP_023303475.1|4095665_4096217_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	44.1	3.3e-27
WP_023303477.1|4098339_4098855_+|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	41.5	7.0e-24
WP_023303478.1|4098851_4099718_-	beta-1,4-mannosyl-glycoprotein beta-1,4-N-acetylglucosaminyltransferase	NA	M1I711	Paramecium_bursaria_Chlorella_virus	34.2	5.1e-27
WP_023303479.1|4099831_4100242_-	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	51.1	1.9e-35
WP_012906750.1|4100263_4100443_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	72.9	1.3e-17
WP_045340850.1|4100668_4101532_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	24.8	2.7e-12
WP_162837914.1|4101515_4102664_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	34.1	6.6e-30
WP_049132768.1|4102901_4104125_+	peptidase T	NA	NA	NA	NA	NA
WP_049132766.1|4104222_4104714_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_049132763.1|4104802_4105924_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_015570801.1|4106015_4107479_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_026094318.1|4107479_4108151_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_017693621.1|4108561_4109017_+	anti-adapter protein IraM	NA	NA	NA	NA	NA
WP_017693620.1|4109103_4110474_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.8	1.1e-108
WP_006809213.1|4110493_4111123_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_032667904.1|4111150_4112263_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_015570797.1|4112303_4112777_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_017693618.1|4112776_4113439_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_003857898.1|4113556_4114807_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	7.9e-21
WP_049132521.1|4114970_4115702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049132519.1|4115746_4116865_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.9	1.2e-121
WP_088581786.1|4116872_4118020_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	5.0e-147
WP_049134565.1|4118195_4118564_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	61.2	1.9e-39
WP_104879858.1|4118563_4119583_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	51.6	8.0e-96
WP_049134567.1|4119592_4119934_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	78.8	6.4e-50
WP_049134568.1|4119965_4120961_-	RelA/SpoT domain-containing protein	NA	NA	NA	NA	NA
WP_049134569.1|4120957_4122043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087859145.1|4122267_4123376_-|transposase	IS3-like element ISKpn20 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.1e-42
WP_049134570.1|4123452_4123668_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	78.9	1.8e-26
WP_104879859.1|4123667_4124204_+	lysozyme	NA	K7PM52	Enterobacteria_phage	80.0	1.7e-81
WP_049134807.1|4124200_4124716_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	93.6	5.1e-83
WP_049134819.1|4125037_4125370_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	60.9	1.1e-33
WP_049134808.1|4125809_4126355_+|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	93.9	7.1e-91
WP_049134809.1|4126329_4128252_+|terminase	phage terminase large subunit family protein	terminase	K7PGW7	Enterobacteria_phage	93.8	0.0e+00
WP_023292738.1|4128251_4128458_+|head,tail	head-to-tail joining protein W	head,tail	E4WL20	Enterobacteria_phage	95.5	9.3e-28
WP_049134810.1|4128454_4130044_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	91.1	2.9e-286
WP_049134811.1|4130024_4131368_+	S49 family peptidase	NA	O64320	Escherichia_phage	92.4	1.9e-201
WP_023292735.1|4131377_4131710_+|head	head decoration protein	head	E4WL24	Enterobacteria_phage	93.6	1.8e-52
WP_023292734.1|4131764_4132790_+|capsid	major capsid protein	capsid	K7PGW9	Enterobacteria_phage	95.9	2.2e-186
WP_049134812.1|4132835_4133249_+	hypothetical protein	NA	E4WL26	Enterobacteria_phage	55.3	3.5e-26
WP_048029717.1|4133260_4133614_+|tail	tail attachment protein	tail	E4WL27	Enterobacteria_phage	94.0	5.4e-60
WP_074143427.1|4133623_4134208_+|tail	phage tail protein	tail	M9NZH5	Enterobacteria_phage	99.5	2.6e-99
WP_040017196.1|4134204_4134603_+|tail	tail protein	tail	E4WL29	Enterobacteria_phage	100.0	3.5e-71
WP_049134813.1|4134609_4135353_+|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	98.0	2.5e-131
WP_049134814.1|4135363_4135795_+|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	90.2	1.6e-66
WP_072201057.1|4135803_4136118_+|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	93.3	3.7e-52
WP_049134816.1|4136101_4139239_+|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	96.5	0.0e+00
WP_001704112.1|4139235_4139574_+|tail	tail protein	tail	E4WL34	Enterobacteria_phage	100.0	2.3e-60
WP_016063063.1|4139629_4140367_+|tail	phage minor tail protein L	tail	M9NYX1	Enterobacteria_phage	100.0	5.5e-147
WP_049134817.1|4140369_4141089_+	C40 family peptidase	NA	K7PJY5	Enterobacterial_phage	97.5	1.3e-140
WP_039025137.1|4141081_4141699_+|tail	tail assembly protein	tail	K7PH59	Enterobacterial_phage	99.5	3.9e-106
WP_063158471.1|4141741_4145332_+|tail	phage tail protein	tail	K7PMC2	Enterobacterial_phage	90.6	0.0e+00
WP_017694302.1|4145376_4145691_+	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	65.7	3.0e-33
WP_022651030.1|4145691_4146363_+	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	73.1	2.6e-87
WP_010429924.1|4146470_4146704_+	hypothetical protein	NA	E4WL42	Enterobacteria_phage	76.6	3.9e-30
WP_164913542.1|4146763_4148041_+|tail	phage tail protein	tail	G8C7K5	Escherichia_phage	75.7	1.7e-172
WP_128755643.1|4148037_4148868_-|tail	tail fiber domain-containing protein	tail	A0A192Y7T9	Enterobacteria_phage	31.9	3.8e-35
WP_049023557.1|4148950_4149508_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	78.1	5.0e-76
WP_023315851.1|4149710_4151708_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	3.3e-21
>prophage 6
NZ_CP026719	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0060 chromosome, complete genome	5104736	4166683	4179312	5104736	integrase,transposase	Salmonella_phage(25.0%)	15	4163849:4163863	4183316:4183330
4163849:4163863	attL	CAGCTTCAGGGCGCT	NA	NA	NA	NA
WP_104879861.1|4166683_4167826_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	48.4	1.2e-92
WP_071887073.1|4167800_4168064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104879862.1|4168099_4168675_-	hypothetical protein	NA	M9NZE4	Enterobacteria_phage	54.1	8.4e-18
WP_104879863.1|4168671_4169400_-	hypothetical protein	NA	Q858D1	Salmonella_phage	90.9	3.5e-37
WP_104879864.1|4169386_4170412_-	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	89.2	1.3e-165
WP_059443614.1|4170408_4170822_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	83.9	1.4e-54
WP_059443608.1|4170870_4171191_-	hypothetical protein	NA	K7P7N6	Enterobacteria_phage	55.7	6.1e-26
WP_162597870.1|4171592_4171847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063159425.1|4171773_4172082_-	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	40.5	2.6e-10
WP_063159426.1|4172378_4172975_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_063159427.1|4173083_4173314_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	40.5	1.1e-05
WP_063159428.1|4173339_4173810_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	92.9	5.2e-74
WP_072044687.1|4174050_4174236_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	5.2e-14
WP_104879777.1|4174408_4175555_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	5.0e-147
WP_049133746.1|4176936_4179312_+	SGNH/GDSL hydrolase family protein	NA	G0XNW5	Escherichia_phage	32.6	7.3e-92
4183316:4183330	attR	CAGCTTCAGGGCGCT	NA	NA	NA	NA
>prophage 7
NZ_CP026719	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0060 chromosome, complete genome	5104736	4420473	4431473	5104736	transposase	Escherichia_phage(75.0%)	11	NA	NA
WP_049134455.1|4420473_4421151_+	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	62.6	4.7e-76
WP_049134457.1|4421189_4421504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017384548.1|4421618_4421930_-	YebG family protein	NA	NA	NA	NA	NA
WP_017384547.1|4422039_4422654_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	34.7	3.3e-28
WP_023303656.1|4422698_4423553_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	33.1	6.4e-22
WP_023303657.1|4423554_4424172_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	4.0e-74
WP_161799328.1|4424182_4425349_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	47.3	5.9e-87
WP_104879777.1|4426510_4427658_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	5.0e-147
WP_075207950.1|4427718_4429185_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.7	6.5e-123
WP_003857424.1|4429315_4429621_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_087859145.1|4430365_4431473_+|transposase	IS3-like element ISKpn20 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.1e-42
>prophage 8
NZ_CP026719	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0060 chromosome, complete genome	5104736	4602686	4625773	5104736	transposase,protease	uncultured_Caudovirales_phage(40.0%)	19	NA	NA
WP_023300106.1|4602686_4603331_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_032624257.1|4603345_4604599_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_049134200.1|4604598_4606806_+	peptidase domain-containing ABC transporter	NA	F2Y165	Organic_Lake_phycodnavirus	29.8	1.5e-14
WP_049134642.1|4607190_4608186_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_022651194.1|4608230_4608971_+	response regulator	NA	W8CYM9	Bacillus_phage	35.5	2.5e-30
WP_049134641.1|4608967_4610263_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	24.2	6.7e-15
WP_000427623.1|4611542_4612547_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_049132501.1|4612625_4615610_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	54.9	9.0e-305
WP_004206571.1|4615769_4616348_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	35.5	1.9e-22
WP_004206572.1|4616523_4617729_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_004206574.1|4617739_4618045_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016151343.1|4618173_4618872_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	69.4	4.5e-90
WP_104879886.1|4618957_4619278_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	2.2e-20
WP_104879917.1|4619322_4620612_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.1	5.8e-168
WP_023316432.1|4620624_4621050_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.1	1.9e-51
WP_000156884.1|4621230_4622253_+|transposase	IS110-like element IS5708 family transposase	transposase	NA	NA	NA	NA
WP_000427623.1|4622587_4623592_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_157844785.1|4623868_4624012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088581786.1|4624626_4625773_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	5.0e-147
>prophage 9
NZ_CP026719	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0060 chromosome, complete genome	5104736	4651332	4688348	5104736	integrase,transposase	Shigella_phage(20.0%)	28	4653311:4653339	4682680:4682708
WP_104879777.1|4651332_4652479_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	5.0e-147
4653311:4653339	attL	ACCCGAAATCTGATTTATTCAACAAAGCC	NA	NA	NA	NA
WP_001572339.1|4653701_4654880_-	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_001310555.1|4655402_4656419_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_045354665.1|4656891_4657881_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	40.3	2.1e-48
WP_104879889.1|4658127_4659276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049132720.1|4659665_4660190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062939637.1|4660203_4661058_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_104879890.1|4661194_4662370_+	metallohydrolase	NA	NA	NA	NA	NA
WP_104879891.1|4662369_4664598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049134827.1|4664882_4665254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104879892.1|4665695_4666843_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	5.0e-147
WP_045354816.1|4667685_4667856_-	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
WP_049134063.1|4667912_4669166_-	lactose permease	NA	NA	NA	NA	NA
WP_049134064.1|4669217_4672292_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.8	0.0e+00
WP_024195772.1|4672413_4673496_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
WP_072050298.1|4673749_4673947_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004118251.1|4674276_4674570_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
WP_004152282.1|4674668_4675436_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004118246.1|4675436_4676393_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	5.3e-17
WP_004118243.1|4676389_4677388_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004118241.1|4677384_4678287_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_104879893.1|4678331_4680662_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_017146590.1|4680748_4681702_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_001572456.1|4681698_4682220_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_032237994.1|4682695_4683820_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	92.5	9.8e-204
4682680:4682708	attR	GGCTTTGTTGAATAAATCAGATTTCGGGT	NA	NA	NA	NA
WP_024193449.1|4683832_4684063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000156884.1|4685986_4687009_+|transposase	IS110-like element IS5708 family transposase	transposase	NA	NA	NA	NA
WP_000427623.1|4687343_4688348_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP026719	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0060 chromosome, complete genome	5104736	4693123	4698392	5104736		uncultured_Caudovirales_phage(100.0%)	6	NA	NA
WP_000927306.1|4693123_4694602_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.4	7.3e-199
WP_049132940.1|4694620_4695448_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.2	8.3e-43
WP_000065802.1|4695507_4695933_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
WP_000922628.1|4695945_4697235_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	9.9e-168
WP_000941305.1|4697280_4697601_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	1.7e-20
WP_000130816.1|4697687_4698392_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.9	8.8e-86
>prophage 1
NZ_CP026720	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0060 plasmid unitig_2_pilon, complete sequence	77822	4695	56540	77822	integrase,transposase	Escherichia_phage(33.33%)	51	4986:5045	53755:54221
WP_001067855.1|4695_5400_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
4986:5045	attL	CCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCG	NA	NA	NA	NA
WP_001247892.1|8484_8775_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001293886.1|8771_9173_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_003465043.1|9162_9519_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003100858.1|9773_10100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|10096_10597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100853.1|10593_10965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100847.1|10958_11516_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_063850449.1|11609_11843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075206149.1|12160_12370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023279681.1|13740_14721_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.5e-184
WP_024191312.1|14774_15086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001148851.1|15175_16261_-	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000217345.1|16294_17452_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_000135555.1|17448_18615_-	histidinol-phosphate transaminase	NA	A0A1X7QHI1	Faustovirus	27.4	1.5e-18
WP_000993475.1|18673_20356_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_000741484.1|20399_21950_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.1	1.9e-80
WP_016240370.1|22064_22850_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.9	3.2e-36
WP_001087990.1|22849_23731_-	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	29.7	6.4e-25
WP_000069054.1|23742_24729_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000148344.1|24967_25564_-	HutD family protein	NA	NA	NA	NA	NA
WP_001112072.1|25560_26934_-	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_001294851.1|27175_27976_+	histidine utilization repressor	NA	NA	NA	NA	NA
WP_001515701.1|28129_29392_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_000058769.1|29388_30213_+	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_001181218.1|30444_31122_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_077263550.1|31167_32136_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	95.3	2.1e-178
WP_160458683.1|34052_34178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160458682.1|34170_35658_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	9.1e-32
WP_000776034.1|36063_36495_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_004118291.1|36494_37766_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
WP_000064120.1|37847_38822_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
WP_000368714.1|38821_40027_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000339857.1|40441_40711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|41067_41934_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_032409716.1|42468_42573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000764642.1|42701_42959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049245386.1|43016_43793_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_023280892.1|43795_44479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016946795.1|44636_44942_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_004197642.1|44943_45162_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_032415726.1|45756_46005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200905.1|46001_47234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200903.1|47367_47859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017896554.1|49083_49392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567366.1|49885_50434_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_001567367.1|50480_50915_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_063850438.1|51341_51896_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_087859145.1|52574_53683_-|transposase	IS3-like element ISKpn20 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.1e-42
WP_023279681.1|54449_55430_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.5e-184
53755:54221	attR	CCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
WP_023279773.1|55571_56540_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	2.9e-180
