The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026756	Klebsiella aerogenes strain AR_0062 chromosome, complete genome	5264003	2226022	2268474	5264003	terminase,tail,holin	Salmonella_phage(40.0%)	51	NA	NA
WP_015370334.1|2226022_2227489_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	8.8e-88
WP_015703162.1|2227558_2229136_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_015370337.1|2229328_2230579_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	81.4	2.2e-196
WP_032723172.1|2230595_2230904_-	hypothetical protein	NA	I6PD68	Cronobacter_phage	53.9	1.6e-23
WP_015370338.1|2230903_2231206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015370339.1|2231202_2231793_-	adenine DNA methyltransferase	NA	T1SA14	Salmonella_phage	92.8	4.0e-108
WP_032723171.1|2231785_2232082_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	69.7	5.2e-32
WP_015370341.1|2232191_2232440_-	AlpA family phage regulatory protein	NA	A0A193GYW1	Enterobacter_phage	85.4	8.5e-36
WP_015370342.1|2232490_2233372_-	DNA recombination protein RecT	NA	T1SBJ5	Salmonella_phage	86.3	1.3e-139
WP_015370343.1|2233368_2234190_-	hypothetical protein	NA	A0A193GYK2	Enterobacter_phage	93.4	7.5e-153
WP_032723407.1|2234401_2234701_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	49.5	6.1e-20
WP_015370347.1|2235003_2235591_-	transcriptional regulator	NA	G9L6A6	Escherichia_phage	61.0	6.3e-61
WP_032723170.1|2235745_2235976_+	hypothetical protein	NA	A0A193GYK6	Enterobacter_phage	90.8	3.0e-35
WP_032723169.1|2236124_2236334_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	81.2	8.0e-27
WP_032723168.1|2236333_2237101_+	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	88.6	7.0e-137
WP_032723167.1|2237097_2237883_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	89.3	1.4e-137
WP_015370350.1|2238002_2238347_+	DUF1064 domain-containing protein	NA	T1SA23	Salmonella_phage	86.0	2.4e-52
WP_104891098.1|2239221_2239641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104891099.1|2239773_2240289_+	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	75.8	3.8e-70
WP_104891100.1|2240820_2241159_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	87.3	4.1e-49
WP_015370357.1|2241234_2241564_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	60.7	1.0e-28
WP_015370358.1|2241621_2242206_+|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	84.5	1.2e-85
WP_032723164.1|2242202_2243672_+	hypothetical protein	NA	Q858H3	Salmonella_phage	94.1	2.0e-281
WP_032723163.1|2243707_2243983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032723162.1|2244641_2244848_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	2.6e-06
WP_032723161.1|2244862_2246542_+|tail	tail protein	tail	T1S9Z7	Salmonella_phage	81.2	2.4e-262
WP_032723160.1|2246538_2246835_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	72.4	8.6e-35
WP_032723159.1|2246840_2247110_+	hypothetical protein	NA	V5KSC6	Escherichia_phage	83.8	3.1e-23
WP_032723158.1|2247120_2247819_+	peptidase	NA	G9L6C4	Escherichia_phage	86.2	4.8e-76
WP_032723157.1|2247833_2248820_+	phage protein	NA	A0A193GZ49	Enterobacter_phage	93.6	5.2e-177
WP_104891101.1|2248873_2249329_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	84.1	5.7e-62
WP_032723155.1|2249339_2249687_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	68.7	4.1e-36
WP_104891102.1|2249737_2250061_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	7.0e-46
WP_049031495.1|2250060_2250666_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	78.0	8.1e-88
WP_049031493.1|2250665_2253143_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.6	0.0e+00
WP_032408585.1|2253142_2253607_+	hypothetical protein	NA	T1SA73	Salmonella_phage	81.8	9.6e-73
WP_049031492.1|2253606_2254149_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	66.1	5.3e-54
WP_104891103.1|2254160_2256695_+	hypothetical protein	NA	Q858G0	Salmonella_phage	82.3	0.0e+00
WP_104891104.1|2256694_2258260_+	hypothetical protein	NA	Q858F9	Salmonella_phage	69.1	1.6e-220
WP_104891105.1|2258259_2261025_+	hypothetical protein	NA	Q858F8	Salmonella_phage	94.8	0.0e+00
WP_104891106.1|2261161_2261551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104891159.1|2261589_2262066_-	hypothetical protein	NA	G9L6E0	Escherichia_phage	71.0	9.6e-60
WP_047065066.1|2262112_2262292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032408579.1|2262481_2263153_-	hypothetical protein	NA	A0A193GYJ9	Enterobacter_phage	62.2	3.7e-73
WP_032723151.1|2263466_2263727_-	hypothetical protein	NA	T1SA06	Salmonella_phage	82.4	1.9e-33
WP_104891107.1|2263920_2266308_+|tail	phage tail protein	tail	R9TMK5	Aeromonas_phage	37.8	7.6e-89
WP_032723150.1|2266311_2266572_+	hypothetical protein	NA	L0ARW5	Klebsiella_phage	56.6	6.2e-21
WP_032723149.1|2266661_2267066_+	membrane protein	NA	T1SA79	Salmonella_phage	83.6	3.2e-56
WP_032723148.1|2267052_2267358_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	6.0e-39
WP_015370383.1|2267347_2267977_+	phage endolysin	NA	Q858F0	Salmonella_phage	84.7	4.8e-99
WP_015370384.1|2267973_2268474_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	5.9e-60
>prophage 2
NZ_CP026756	Klebsiella aerogenes strain AR_0062 chromosome, complete genome	5264003	3150743	3209633	5264003	terminase,tail,holin	Klebsiella_phage(17.24%)	75	NA	NA
WP_015366242.1|3150743_3151553_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.0	6.1e-14
WP_015366243.1|3151554_3152547_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	26.1	1.6e-08
WP_015366244.1|3152546_3153437_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_080889668.1|3153613_3154801_+	DUF4102 domain-containing protein	NA	K7PGY1	Enterobacteria_phage	52.7	1.6e-119
WP_071890767.1|3154697_3155012_-	hypothetical protein	NA	K7PM28	Enterobacteria_phage	52.4	4.1e-11
WP_071890774.1|3155021_3155261_-	DUF4060 domain-containing protein	NA	M9P0E0	Enterobacteria_phage	71.4	1.9e-24
WP_045419491.1|3155268_3155577_-	hypothetical protein	NA	I6PD68	Cronobacter_phage	56.9	1.9e-24
WP_049045108.1|3155573_3156248_-	hypothetical protein	NA	A0A077KCB2	Edwardsiella_phage	46.3	1.1e-48
WP_045419488.1|3156291_3157380_-	enterohemolysin	NA	H6WRX0	Salmonella_phage	56.8	3.3e-108
WP_045419485.1|3157391_3160532_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	54.4	7.0e-276
WP_045419483.1|3160671_3160830_-	hypothetical protein	NA	K7P7H7	Enterobacteria_phage	59.6	2.9e-13
WP_045419480.1|3160838_3161030_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
WP_104411493.1|3161091_3161235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049045100.1|3161515_3161728_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	74.2	4.3e-20
WP_049045099.1|3161756_3162200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049045098.1|3162189_3162423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049045097.1|3163115_3163502_-	XRE family transcriptional regulator	NA	K7PM35	Enterobacteria_phage	74.0	3.7e-46
WP_029503646.1|3163606_3163840_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	61.6	2.1e-20
WP_049045096.1|3163842_3164379_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	70.9	2.5e-64
WP_104891120.1|3164730_3165645_+	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	62.5	3.0e-94
WP_049045094.1|3165641_3166385_+	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	54.4	1.3e-63
WP_049045093.1|3166377_3166713_+	DUF977 domain-containing protein	NA	H6WRX9	Salmonella_phage	46.8	1.1e-12
WP_049045092.1|3166705_3167491_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	5.3e-63
WP_020804603.1|3167487_3167691_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	84.8	3.8e-26
WP_049045091.1|3167683_3167935_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	49.3	1.8e-09
WP_047041368.1|3167934_3168192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049045090.1|3168188_3170168_+	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	53.7	8.0e-201
WP_004179624.1|3170320_3170764_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_049045089.1|3171243_3171477_+	hypothetical protein	NA	A0A0M4R5D9	Salmonella_phage	54.5	1.3e-17
WP_049045088.1|3171512_3172109_+	DUF1367 domain-containing protein	NA	K7PKS6	Enterobacteria_phage	77.0	6.8e-87
WP_047037788.1|3172113_3172314_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	75.8	5.5e-25
WP_032705538.1|3172894_3173035_+	YlcG family protein	NA	NA	NA	NA	NA
WP_049045087.1|3173031_3173853_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	72.9	6.4e-112
WP_049045086.1|3174349_3174661_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	68.0	5.7e-29
WP_049045085.1|3174657_3175200_+	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	71.9	5.1e-73
WP_049045084.1|3175196_3175544_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	72.2	2.0e-35
WP_047040261.1|3175540_3175816_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	51.1	6.4e-16
WP_080973403.1|3175805_3175955_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	82.6	3.8e-15
WP_049045082.1|3176219_3176477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032708501.1|3176871_3177123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049045081.1|3177552_3177753_+	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	61.9	1.0e-15
WP_049045105.1|3177875_3178211_+	membrane protein	NA	NA	NA	NA	NA
WP_049045080.1|3178359_3178605_+	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	86.4	1.0e-28
WP_049045079.1|3178673_3179678_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	44.2	2.0e-35
WP_012967901.1|3179655_3180960_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	60.3	2.2e-146
WP_049045078.1|3180964_3182389_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	71.7	2.0e-193
WP_049045077.1|3182372_3183485_+	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	53.3	9.9e-108
WP_040206331.1|3183591_3184356_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	59.4	1.1e-76
WP_004184463.1|3184443_3185580_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	76.5	2.8e-158
WP_049045076.1|3185625_3185838_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	53.7	4.5e-09
WP_049045075.1|3185841_3186252_+	hypothetical protein	NA	A0A0H5AUF0	Pseudomonas_phage	38.2	6.6e-09
WP_049045074.1|3186253_3186487_+	hypothetical protein	NA	A0A1V0E8A3	Vibrio_phage	51.5	3.6e-12
WP_049045073.1|3186473_3186857_+	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	41.3	6.6e-19
WP_049045072.1|3186858_3187410_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.3	2.3e-28
WP_049045071.1|3187406_3187799_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_049045070.1|3187822_3188995_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.9	6.5e-25
WP_049045069.1|3189049_3189532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080973401.1|3189699_3189867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049045068.1|3189933_3190617_+	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	41.9	3.2e-40
WP_049045067.1|3190976_3193925_+|tail	tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	36.9	9.7e-102
WP_032712199.1|3193924_3194398_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.1	3.1e-58
WP_049045066.1|3194384_3194867_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	73.1	2.3e-61
WP_049045065.1|3194876_3195257_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	81.0	1.0e-59
WP_080973404.1|3195742_3198289_+	kinase	NA	A0A286S259	Klebsiella_phage	69.9	0.0e+00
WP_061856942.1|3200466_3201042_+	hypothetical protein	NA	A0A286S1R5	Klebsiella_phage	44.3	4.3e-30
WP_049045062.1|3201173_3201956_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_049045061.1|3202034_3202250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049045060.1|3202474_3202765_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	41.2	1.9e-10
WP_049045059.1|3202764_3204030_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	81.0	5.1e-201
WP_047041439.1|3204136_3204562_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	1.7e-52
WP_049045058.1|3204574_3205864_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.4	3.8e-167
WP_047052019.1|3205908_3206229_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	43.8	7.7e-21
WP_047052018.1|3206314_3207013_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.9	1.7e-89
WP_049045057.1|3207364_3208537_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_061856941.1|3208955_3209633_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	3.1e-80
>prophage 3
NZ_CP026756	Klebsiella aerogenes strain AR_0062 chromosome, complete genome	5264003	4836301	4907804	5264003	tail,head,transposase,holin,tRNA,integrase	Cronobacter_phage(22.03%)	84	4856752:4856798	4904904:4904950
WP_015367856.1|4836301_4837819_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.1	1.2e-84
WP_032705564.1|4838023_4839496_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.6	3.6e-49
WP_015367858.1|4839556_4841704_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_015367859.1|4841786_4843124_-	arginine:agmatine antiporter	NA	NA	NA	NA	NA
WP_032705563.1|4843489_4845016_-	transcriptional regulator CadC	NA	NA	NA	NA	NA
WP_015367861.1|4845221_4846328_+	alkene reductase	NA	NA	NA	NA	NA
WP_015367862.1|4846438_4846711_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_015367863.1|4846815_4847736_-	lipid A biosynthesis (KDO)2-(lauroyl)-lipid IVA acyltransferase	NA	A0A1W6JP29	Morganella_phage	41.9	1.2e-55
WP_015367864.1|4848016_4848853_-	alpha/beta hydrolase	NA	A0A1I9SAY0	Mycobacterium_phage	37.7	6.3e-14
WP_015367866.1|4849478_4850345_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015367867.1|4850463_4851363_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015367868.1|4851363_4852164_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015367869.1|4852173_4853481_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.8	3.1e-60
WP_015367870.1|4853735_4854572_-	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_015367871.1|4854790_4855789_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_015367872.1|4856191_4856593_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
4856752:4856798	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_104891141.1|4856939_4857266_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.9	1.8e-25
WP_104891160.1|4857265_4857505_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	60.8	1.1e-19
WP_104891161.1|4857679_4858933_+|tail	phage tail protein	tail	A0A1J0MHZ5	Klebsiella_phage	45.3	1.8e-89
WP_001407551.1|4859015_4860032_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_047041882.1|4861501_4861762_-	hypothetical protein	NA	A0A1J0MFY2	Serratia_phage	46.6	1.8e-12
WP_104891142.1|4861766_4863860_-	hypothetical protein	NA	A0A1J0MG53	Serratia_phage	52.3	1.6e-162
WP_100278947.1|4863917_4866395_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	91.6	0.0e+00
WP_104891143.1|4866381_4866798_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	86.0	4.9e-68
WP_045363946.1|4866760_4867231_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	89.7	2.5e-76
WP_104891144.1|4867230_4867728_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	88.5	3.3e-87
WP_104891145.1|4867727_4870658_-|tail	tail protein (tape measure)	tail	F1C5E9	Cronobacter_phage	43.0	3.0e-143
WP_052766713.1|4870715_4871165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047041892.1|4871225_4871909_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	50.5	2.1e-52
WP_047041894.1|4871967_4872711_-	DNA breaking-rejoining protein	NA	F1C5E5	Cronobacter_phage	81.9	2.4e-73
WP_032723565.1|4872771_4873155_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	63.8	5.2e-40
WP_047041897.1|4873151_4873616_-	hypothetical protein	NA	A0A2P1MXA4	Escherichia_phage	44.2	3.8e-29
WP_047041899.1|4873618_4873969_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	66.1	1.2e-38
WP_047041901.1|4873968_4874142_-	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	58.9	2.9e-14
WP_040239892.1|4874138_4874543_-	hypothetical protein	NA	A0A1V0E5R0	Salmonella_phage	74.6	9.6e-53
WP_047041905.1|4874603_4874888_-	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	73.2	9.5e-31
WP_047041907.1|4874898_4876002_-	hypothetical protein	NA	G0ZND9	Cronobacter_phage	73.8	6.7e-157
WP_104891146.1|4876015_4876474_-	hypothetical protein	NA	A0A125RNM2	Pseudomonas_phage	77.9	3.0e-58
WP_032705556.1|4876486_4877752_-	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	91.0	5.4e-219
WP_032705555.1|4877754_4878681_-|head	SPP1 gp7 family phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	92.5	2.6e-162
WP_104891147.1|4878640_4879990_-	DUF1073 domain-containing protein	NA	Q5G8Y4	Enterobacteria_phage	78.6	2.7e-208
WP_032705552.1|4880058_4880475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032705551.1|4880544_4882023_-	phage DNA Packaging protein	NA	G0ZND4	Cronobacter_phage	87.0	2.9e-256
WP_032705550.1|4882009_4882489_-	DUF2280 domain-containing protein	NA	F1C5D6	Cronobacter_phage	59.7	1.0e-48
WP_032706161.1|4882519_4883158_-	hypothetical protein	NA	I6S676	Salmonella_phage	88.7	2.9e-112
WP_032705549.1|4883160_4883361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032705548.1|4883351_4883552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072026024.1|4883558_4883750_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	80.7	1.5e-19
WP_104891148.1|4883706_4883979_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	39.3	6.3e-08
WP_104891149.1|4883975_4884518_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	74.7	6.4e-76
WP_047063138.1|4884514_4884793_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	40.5	2.6e-09
WP_047063140.1|4884789_4885188_-	membrane protein	NA	NA	NA	NA	NA
WP_104891150.1|4885494_4886307_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	62.6	1.2e-94
WP_032705538.1|4886303_4886444_-	YlcG family protein	NA	NA	NA	NA	NA
WP_032705537.1|4886440_4886665_-	hypothetical protein	NA	Q76H69	Enterobacteria_phage	60.8	1.3e-22
WP_104891151.1|4886661_4887243_-	protein NinG	NA	G0ZNC4	Cronobacter_phage	48.5	6.0e-40
WP_047037788.1|4887245_4887446_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	75.8	5.5e-25
WP_104891152.1|4887450_4888050_-	hypothetical protein	NA	K7PKS6	Enterobacteria_phage	76.9	6.1e-88
WP_032705536.1|4888460_4888694_-	DinI family protein	NA	H6WRY5	Salmonella_phage	67.5	2.4e-24
WP_032705535.1|4888837_4889095_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	71.2	9.8e-27
WP_050483875.1|4889130_4891092_-	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	56.0	4.8e-206
WP_032705534.1|4891088_4891346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032705533.1|4891348_4891693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032705532.1|4891689_4892037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032705530.1|4892881_4893085_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	81.8	1.2e-24
WP_032705529.1|4893081_4893450_-	DUF977 domain-containing protein	NA	H6WRX9	Salmonella_phage	45.6	1.5e-12
WP_032705528.1|4893442_4894186_-	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	54.8	1.3e-63
WP_032705527.1|4894182_4895103_-	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	62.0	1.4e-94
WP_032705524.1|4895454_4895991_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	70.9	1.9e-64
WP_032705523.1|4895993_4896224_-	hypothetical protein	NA	H6WRX5	Salmonella_phage	45.3	2.7e-12
WP_032705521.1|4896334_4896748_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_104891153.1|4896933_4897077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032705520.1|4897138_4897330_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
WP_032705519.1|4897338_4897497_+	hypothetical protein	NA	K7P7H7	Enterobacteria_phage	57.7	3.2e-12
WP_104891154.1|4897636_4900819_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	55.1	5.3e-279
WP_032705517.1|4900831_4901920_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	57.6	3.6e-110
WP_032705515.1|4901954_4902308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032705514.1|4902300_4902912_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	74.5	5.9e-38
WP_032705513.1|4902908_4903217_+	hypothetical protein	NA	I6PD68	Cronobacter_phage	56.9	7.1e-24
WP_071609890.1|4903224_4903467_+	DUF4060 domain-containing protein	NA	M9P0E0	Enterobacteria_phage	71.4	2.5e-24
WP_032705512.1|4903726_4904890_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	86.3	1.9e-202
WP_015367875.1|4905301_4906168_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.3	5.0e-30
4904904:4904950	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_015367876.1|4906169_4906382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015367877.1|4906418_4907804_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	4.6e-46
>prophage 1
NZ_CP026757	Klebsiella aerogenes strain AR_0062 plasmid tig00000053_pilon, complete sequence	54418	2463	49878	54418	integrase,protease,transposase	Burkholderia_phage(21.43%)	57	23941:23956	50270:50285
WP_001407551.1|2463_3480_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_104891163.1|3484_3670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024129965.1|3685_4036_-	KorB protein	NA	NA	NA	NA	NA
WP_001749963.1|4099_4834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000440698.1|4842_5124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749962.1|5133_5427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000496058.1|5476_5794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749961.1|5793_8394_+	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
WP_001749960.1|8411_9125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749959.1|9132_9360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749958.1|9375_10416_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_001257173.1|10498_10645_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_000646594.1|10634_11333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019706045.1|11406_12228_+	conjugal transfer protein TraO	NA	NA	NA	NA	NA
WP_104891164.1|12227_13388_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000128596.1|13429_14425_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_000792636.1|14424_14958_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
WP_012579085.1|16542_17742_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000470728.1|17820_18498_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000844627.1|18529_18772_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001749977.1|19176_22419_-	conjugative relaxase	NA	U5J9B0	Bacillus_phage	27.3	2.4e-05
WP_001749976.1|22418_23948_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
23941:23956	attL	TCGTCCATTTCAGCGC	NA	NA	NA	NA
WP_001749975.1|23949_24366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020319858.1|25138_25276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749973.1|25284_26001_+	StdB	NA	NA	NA	NA	NA
WP_000414913.1|26002_26371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048968061.1|26663_26897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749971.1|27007_27328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214483.1|27382_27562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000129958.1|28288_28798_-	antirestriction protein	NA	NA	NA	NA	NA
WP_012561126.1|30150_30483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001750002.1|30691_30976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001750003.1|31044_31404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545925.1|31400_31697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000932975.1|32582_32822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881513.1|32831_33236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000447669.1|33293_33719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861760.1|34133_34574_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	48.8	1.2e-27
WP_104891165.1|34561_35827_+	DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	53.6	1.4e-118
WP_001452808.1|35977_36769_+|protease	zinc metalloprotease	protease	NA	NA	NA	NA
WP_000057569.1|36783_37125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749982.1|37684_38404_+	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	28.9	8.6e-20
WP_001749988.1|39505_40075_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
WP_023145375.1|40214_40529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845054.1|40467_41481_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_001083725.1|41625_42123_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001206356.1|42530_43322_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|43485_43833_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|43826_44666_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001993321.1|44595_44775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|44793_45294_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_001297012.1|45599_45713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|45800_46565_+|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_024139167.1|46606_46819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749969.1|46831_48040_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001288432.1|48073_49507_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_001749968.1|49611_49878_+|transposase	IS1 family transposase	transposase	U5P0U6	Shigella_phage	92.0	3.6e-40
50270:50285	attR	GCGCTGAAATGGACGA	NA	NA	NA	NA
>prophage 1
NZ_CP026760	Klebsiella aerogenes strain AR_0062 plasmid unnamed4	67494	732	63900	67494	capsid,head,tail,terminase,portal	Klebsiella_phage(87.5%)	68	NA	NA
WP_104891178.1|732_1467_+	hypothetical protein	NA	A0A0P0IKE4	Klebsiella_phage	47.9	2.6e-19
WP_104891179.1|1408_1723_+	hypothetical protein	NA	A0A0P0IKE4	Klebsiella_phage	48.1	5.1e-09
WP_104891180.1|1641_2037_+	hypothetical protein	NA	Q6UAW1	Klebsiella_phage	32.8	5.4e-08
WP_104891181.1|2036_3152_+	hypothetical protein	NA	A0A0P0IKE4	Klebsiella_phage	40.8	1.2e-36
WP_104891182.1|3105_3522_+	hypothetical protein	NA	J9Q713	Salmonella_phage	42.6	6.5e-20
WP_049061879.1|4022_4631_+	hypothetical protein	NA	A0A1X7QGJ8	Escherichia_phage	38.2	1.5e-33
WP_049061878.1|4639_5776_+|tail	tail fiber	tail	A0A0H4TGH1	Klebsiella_phage	36.9	5.1e-35
WP_047057614.1|5848_6826_-	ParB/RepB/Spo0J family partition protein	NA	Q6UAV8	Klebsiella_phage	95.3	3.6e-170
WP_047057613.1|6828_7992_-	plasmid-partitioning protein SopA	NA	Q6UAV7	Klebsiella_phage	99.7	4.5e-228
WP_047057613.1|9026_10190_+	plasmid-partitioning protein SopA	NA	Q6UAV7	Klebsiella_phage	99.7	4.5e-228
WP_047057614.1|10192_11170_+	ParB/RepB/Spo0J family partition protein	NA	Q6UAV8	Klebsiella_phage	95.3	3.6e-170
WP_049061878.1|11242_12379_-|tail	tail fiber	tail	A0A0H4TGH1	Klebsiella_phage	36.9	5.1e-35
WP_049061879.1|12387_12996_-	hypothetical protein	NA	A0A1X7QGJ8	Escherichia_phage	38.2	1.5e-33
WP_063443018.1|13496_22817_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	44.3	0.0e+00
WP_049061882.1|22883_23477_-|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	74.6	1.8e-76
WP_047057827.1|23530_23878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104891183.1|23910_24621_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	93.6	9.7e-141
WP_047465147.1|24622_25378_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	87.6	5.9e-136
WP_049061884.1|25374_25713_-|tail	minor tail family protein	tail	Q6UAW6	Klebsiella_phage	95.5	3.6e-61
WP_049061900.1|25712_29060_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	91.7	0.0e+00
WP_071890744.1|29059_29278_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	97.2	3.4e-36
WP_045389547.1|29298_29667_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	91.8	1.6e-54
WP_047057823.1|29730_30198_-|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	96.8	9.7e-81
WP_032722465.1|30232_30634_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	99.2	7.5e-66
WP_047057822.1|30630_31020_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	96.9	3.3e-66
WP_047057820.1|31000_31339_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	97.3	6.4e-58
WP_047057818.1|31335_31653_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	90.8	2.0e-45
WP_047057817.1|31633_32092_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	89.5	3.2e-44
WP_047057816.1|32158_33445_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	99.3	4.2e-235
WP_047057814.1|33520_34441_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	81.4	6.5e-137
WP_047057812.1|34478_35744_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	95.7	2.4e-235
WP_047057811.1|35743_35923_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	88.1	4.7e-20
WP_032722453.1|35916_37626_-|terminase	terminase large subunit	terminase	Q6UAY0	Klebsiella_phage	95.1	0.0e+00
WP_047057809.1|37660_38095_-|terminase	terminase	terminase	Q6UAY1	Klebsiella_phage	89.6	1.6e-69
WP_047057807.1|38226_38427_-	hypothetical protein	NA	Q6UAR8	Klebsiella_phage	84.8	1.4e-12
WP_047057805.1|38453_38636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047057804.1|39347_39779_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	53.2	2.4e-33
WP_047057803.1|39775_40090_-	hypothetical protein	NA	Q6UAS1	Klebsiella_phage	42.2	3.1e-06
WP_047057801.1|40086_40449_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	93.3	5.4e-63
WP_047057799.1|40448_41174_-	hypothetical protein	NA	Q6UAS3	Klebsiella_phage	78.0	2.7e-98
WP_047057797.1|42067_42538_-	hypothetical protein	NA	Q6UAS7	Klebsiella_phage	79.5	4.2e-60
WP_047057795.1|42554_43046_-	hypothetical protein	NA	Q6UAS8	Klebsiella_phage	89.0	2.7e-81
WP_047057793.1|43042_43354_-	hypothetical protein	NA	Q6UAS9	Klebsiella_phage	91.1	2.0e-45
WP_047057792.1|43412_44474_-	site-specific DNA-methyltransferase	NA	Q6UAT0	Klebsiella_phage	93.2	4.2e-172
WP_047057790.1|44744_44972_-	winged helix-turn-helix domain-containing protein	NA	Q6UAT1	Klebsiella_phage	82.7	5.4e-29
WP_047057837.1|44981_45203_-	hypothetical protein	NA	O64358	Escherichia_phage	84.9	4.3e-31
WP_047057789.1|45372_45681_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	94.2	3.0e-46
WP_047057787.1|45680_45968_+	XRE family transcriptional regulator	NA	Q6UAT4	Klebsiella_phage	94.7	4.9e-43
WP_047057785.1|46014_46218_-	hypothetical protein	NA	Q6UAT5	Klebsiella_phage	76.6	5.9e-19
WP_047057784.1|46321_46549_-	hypothetical protein	NA	Q6UAT6	Klebsiella_phage	77.5	7.6e-23
WP_047057782.1|46569_46896_-	hypothetical protein	NA	Q6UAT7	Klebsiella_phage	94.4	4.3e-51
WP_049061895.1|46888_47140_-	hypothetical protein	NA	A0A1B1W253	Salmonella_phage	37.7	4.2e-06
WP_047057779.1|48038_48332_-	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	6.5e-43
WP_047057777.1|48331_49012_-	hypothetical protein	NA	Q6UAU0	Klebsiella_phage	94.7	6.0e-132
WP_047057775.1|49012_49345_-	hypothetical protein	NA	Q6UAU1	Klebsiella_phage	85.5	4.6e-45
WP_047057773.1|49472_50081_-	3'-5' exonuclease	NA	Q6UAU3	Klebsiella_phage	88.1	2.3e-98
WP_080958615.1|50266_50512_-	hypothetical protein	NA	A0A2I6TCB2	Escherichia_phage	72.8	3.9e-33
WP_047057769.1|50492_51230_-	phage antitermination Q family protein	NA	Q6UAU4	Klebsiella_phage	94.7	8.5e-132
WP_061856907.1|51219_51432_-	hypothetical protein	NA	Q6UAU5	Klebsiella_phage	94.3	2.1e-30
WP_047057767.1|51512_52121_+	XRE family transcriptional regulator	NA	Q6UAU6	Klebsiella_phage	97.0	6.4e-109
WP_047057765.1|52371_56376_+	hypothetical protein	NA	A0A2I6TD01	Escherichia_phage	81.9	0.0e+00
WP_047057763.1|56368_56665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047057761.1|56661_57012_+	hypothetical protein	NA	O64343	Escherichia_phage	77.6	1.3e-50
WP_032413547.1|57618_57783_+	hypothetical protein	NA	Q6UAV3	Klebsiella_phage	96.3	2.8e-19
WP_015974472.1|57779_58010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047057757.1|58006_58786_+	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	89.2	1.9e-126
WP_047057755.1|58840_60763_-	protelomerase	NA	Q6UAV6	Klebsiella_phage	90.0	2.3e-309
WP_047057757.1|63120_63900_-	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	89.2	1.9e-126
