The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026750	Acinetobacter baumannii strain WCHAB005133 chromosome, complete genome	3893541	996196	1041556	3893541	tail,integrase,holin,head	Acinetobacter_phage(66.67%)	54	1025876:1025890	1051421:1051435
WP_000108908.1|996196_996523_+	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	36.0	3.2e-06
WP_000612880.1|996519_997374_+	phosphoadenosine phosphosulfate reductase	NA	NA	NA	NA	NA
WP_000049976.1|997370_998474_+	hypothetical protein	NA	A0A0P0IKQ2	Acinetobacter_phage	56.1	1.4e-29
WP_000631609.1|998470_998929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000755976.1|998925_999792_+	hypothetical protein	NA	A0A2H4J5Y9	uncultured_Caudovirales_phage	43.7	1.4e-72
WP_000779000.1|999803_1000202_+	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	48.5	1.5e-26
WP_001039747.1|1000198_1000381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001293626.1|1000367_1000769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000203140.1|1000765_1001173_+	DUF1064 domain-containing protein	NA	A0A0R6PIZ9	Moraxella_phage	51.8	4.0e-22
WP_001279874.1|1001182_1001467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000214487.1|1001488_1002052_+	hypothetical protein	NA	A0A1B1P9I8	Acinetobacter_phage	52.5	3.2e-46
WP_001989822.1|1002232_1002463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000837652.1|1002648_1003419_+	restriction endonuclease subunit M	NA	Q8W6S4	Burkholderia_virus	60.8	1.4e-89
WP_002016982.1|1003520_1003724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377939.1|1003896_1004364_+	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	76.8	4.4e-65
WP_000372127.1|1004332_1004974_+	hypothetical protein	NA	J7I4N9	Acinetobacter_phage	97.2	4.4e-124
WP_000729373.1|1005032_1005503_+	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	89.7	2.6e-73
WP_000102065.1|1005492_1006920_+	hypothetical protein	NA	A0A0D4DCE6	Acinetobacter_phage	88.4	1.2e-251
WP_001286349.1|1006916_1008368_+	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	90.2	1.2e-259
WP_000741600.1|1008369_1009473_+|head	head morphogenesis protein	head	A0A0D4DBL9	Acinetobacter_phage	83.4	5.9e-177
WP_000166323.1|1009765_1010278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000159880.1|1010346_1010661_+	hypothetical protein	NA	A0A0S3UFT8	Pseudomonas_phage	48.5	3.4e-13
WP_000770060.1|1010774_1011542_+	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	94.1	8.1e-117
WP_000214195.1|1011569_1012526_+	hypothetical protein	NA	A0A0D4DBM4	Acinetobacter_phage	93.7	5.6e-168
WP_000767881.1|1012590_1013256_+	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	67.4	5.2e-72
WP_000008492.1|1013260_1013650_+	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	98.4	9.5e-66
WP_001197735.1|1013606_1014020_+	hypothetical protein	NA	J7I467	Acinetobacter_phage	76.6	5.6e-56
WP_000248324.1|1014028_1014433_+	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	92.5	4.9e-65
WP_000539752.1|1014404_1014773_+	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	80.3	4.8e-51
WP_001132270.1|1014774_1015173_+	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	71.2	4.0e-51
WP_000121166.1|1015174_1015387_+	hypothetical protein	NA	A0A0D4DC29	Acinetobacter_phage	75.4	1.3e-21
WP_000094300.1|1015494_1016424_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	40.8	5.3e-54
WP_001185622.1|1016468_1017002_+	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	59.9	6.3e-44
WP_000838146.1|1017333_1017516_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	100.0	7.4e-29
WP_000966689.1|1017580_1017985_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	88.8	1.0e-62
WP_000720591.1|1018065_1018467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000191304.1|1018527_1022493_+	replication protein	NA	A0A0D4DC37	Acinetobacter_phage	44.7	3.7e-165
WP_001281459.1|1022610_1022952_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000985763.1|1023006_1023357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175075.1|1023366_1024065_+|tail	phage minor tail protein L	tail	A0A0R6PIG8	Moraxella_phage	68.1	4.8e-92
WP_000778488.1|1024071_1024827_+|tail	tail protein	tail	A0A0R6PIM4	Moraxella_phage	57.4	4.5e-88
WP_000920736.1|1024810_1025482_+|tail	tail assembly protein	tail	A0A0R6PIW1	Moraxella_phage	46.8	1.2e-39
WP_001018917.1|1025548_1035568_+|tail	tail protein	tail	A0A0R6PIC9	Moraxella_phage	37.2	1.6e-10
1025876:1025890	attL	TTTAATAATATTGAT	NA	NA	NA	NA
WP_001141976.1|1035568_1035892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000371015.1|1035891_1036617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000999700.1|1036685_1036979_+|holin	holin	holin	NA	NA	NA	NA
WP_000200151.1|1036959_1037184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019749.1|1037242_1037788_+	hypothetical protein	NA	A0A0B5KTG8	Acinetobacter_phage	89.4	1.1e-91
WP_000189398.1|1037788_1038106_+	hypothetical protein	NA	A0A1W5PUJ8	Salmonella_phage	58.5	9.6e-24
WP_002016874.1|1038277_1038508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000958559.1|1038528_1038858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000566934.1|1039105_1039696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000200051.1|1039757_1039949_+	hypothetical protein	NA	A0A0D4DBH0	Acinetobacter_phage	83.9	4.4e-24
WP_000537617.1|1039951_1041556_-|integrase	site-specific integrase	integrase	A0A2H4J8L8	uncultured_Caudovirales_phage	46.1	1.4e-91
1051421:1051435	attR	ATCAATATTATTAAA	NA	NA	NA	NA
>prophage 2
NZ_CP026750	Acinetobacter baumannii strain WCHAB005133 chromosome, complete genome	3893541	1204717	1219523	3893541		Acinetobacter_phage(100.0%)	10	NA	NA
WP_000062631.1|1204717_1205272_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	100.0	2.7e-98
WP_000893683.1|1205528_1207028_+	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	100.0	6.1e-286
WP_001076817.1|1207029_1209405_+	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	100.0	0.0e+00
WP_001164226.1|1209411_1210395_+	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	100.0	2.0e-189
WP_000066126.1|1210405_1211101_-	hypothetical protein	NA	A0A0P0IDT4	Acinetobacter_phage	100.0	5.8e-122
WP_000608304.1|1211110_1211917_-	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	100.0	7.9e-147
WP_001982145.1|1211926_1212976_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
WP_000281127.1|1213331_1216064_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	99.9	0.0e+00
WP_000960548.1|1216143_1218843_+	M1 family peptidase	NA	A0A0P0IY26	Acinetobacter_phage	100.0	0.0e+00
WP_000925673.1|1218938_1219523_-	type 1 glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	100.0	1.7e-111
>prophage 3
NZ_CP026750	Acinetobacter baumannii strain WCHAB005133 chromosome, complete genome	3893541	1606354	1644945	3893541	protease,transposase	Bacillus_phage(33.33%)	38	NA	NA
WP_000992582.1|1606354_1607710_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_002016574.1|1607747_1610273_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001037943.1|1610314_1610818_+	membrane protein	NA	NA	NA	NA	NA
WP_000868104.1|1610822_1611893_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000140523.1|1611899_1612385_+	3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ	NA	NA	NA	NA	NA
WP_000064875.1|1612381_1613170_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_001178068.1|1613223_1614108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476756.1|1614535_1615018_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_000344169.1|1615071_1616121_-	DNA recombination/repair protein RecA	NA	A0A0S2MVG1	Bacillus_phage	59.4	5.7e-113
WP_000040959.1|1616266_1616707_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_000349155.1|1616690_1617353_-	haloacid dehalogenase	NA	NA	NA	NA	NA
WP_000798360.1|1617548_1617908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000525041.1|1618006_1618243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000689660.1|1618357_1618651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000573222.1|1618702_1619239_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_001099948.1|1619283_1619733_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000632796.1|1619879_1621130_+	kynureninase	NA	NA	NA	NA	NA
WP_000093788.1|1621170_1622577_+	amino acid permease	NA	NA	NA	NA	NA
WP_001233774.1|1622584_1623331_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001026393.1|1624559_1625738_+|protease	serine protease	protease	A0A2K9L570	Tupanvirus	40.6	3.2e-32
WP_000957160.1|1625785_1627240_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	69.3	1.0e-181
WP_001067858.1|1627857_1628562_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000679427.1|1628730_1629078_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|1629071_1629911_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000050481.1|1630315_1631857_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001100753.1|1632215_1633142_+	class A extended-spectrum beta-lactamase PER-1	NA	NA	NA	NA	NA
WP_001176353.1|1633215_1633791_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_032495614.1|1633829_1635671_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.6	8.6e-32
WP_032495674.1|1636041_1636743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033917513.1|1636715_1637045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033917514.1|1637038_1637533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032495677.1|1637543_1637774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|1638087_1638927_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000050481.1|1639331_1640873_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000359986.1|1642271_1643045_+	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_077252464.1|1643025_1643307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002026779.1|1643526_1643712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002001451.1|1643760_1644945_+|transposase	IS4 family transposase ISEc29	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
>prophage 4
NZ_CP026750	Acinetobacter baumannii strain WCHAB005133 chromosome, complete genome	3893541	2584906	2641071	3893541	tRNA,transposase,integrase	Escherichia_phage(29.41%)	57	2627768:2627827	2638161:2638986
WP_000020858.1|2584906_2585623_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_000912930.1|2585793_2586420_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_000703552.1|2586430_2587210_-	DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_000026482.1|2587296_2588712_-	OmpA family protein	NA	NA	NA	NA	NA
WP_001987632.1|2588925_2590170_-	aspartate carbamoyltransferase	NA	NA	NA	NA	NA
WP_000546639.1|2590173_2591190_-	aspartate carbamoyltransferase	NA	NA	NA	NA	NA
WP_000654268.1|2591313_2591658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000498918.1|2591875_2594101_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_001060738.1|2594126_2594543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000941316.1|2594811_2595300_+	CinA family protein	NA	A0A218MNG4	uncultured_virus	43.3	4.0e-29
WP_001210050.1|2595356_2597936_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	32.4	1.3e-123
WP_001237344.1|2598237_2599044_+	M23 family peptidase	NA	G9BW84	Planktothrix_phage	35.9	9.0e-18
WP_001026230.1|2599040_2599466_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001195082.1|2599557_2599980_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000203217.1|2600418_2601126_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001159802.1|2601286_2602336_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_000928919.1|2602395_2603181_-	M48 family peptidase	NA	NA	NA	NA	NA
WP_000776215.1|2603291_2603609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000517792.1|2603731_2605051_-	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	36.0	4.8e-69
WP_000155680.1|2605115_2606282_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_001188823.1|2606557_2607583_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000199457.1|2607852_2610489_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.6	1.8e-75
WP_001185176.1|2610554_2611835_+	aspartate kinase	NA	NA	NA	NA	NA
WP_000906487.1|2612081_2612336_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	8.8e-12
WP_000495836.1|2612405_2612972_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	42.4	1.8e-25
WP_000735756.1|2613037_2613427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111760.1|2613665_2614223_+	cytochrome b	NA	NA	NA	NA	NA
WP_001077405.1|2614266_2615265_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_000729980.1|2615376_2616696_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.8	7.8e-59
WP_000608973.1|2617018_2617246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256760.1|2617614_2619165_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000599996.1|2619188_2620019_-	KR domain-containing protein	NA	NA	NA	NA	NA
WP_000226456.1|2620084_2621047_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001067855.1|2621143_2621848_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000107496.1|2622675_2623299_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000626177.1|2623823_2624783_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000600025.1|2624845_2625679_+	KR domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|2626511_2627216_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
2627768:2627827	attL	TTTATCGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATG	NA	NA	NA	NA
WP_001067855.1|2627836_2628541_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001297012.1|2628761_2628875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|2629180_2629681_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_001993321.1|2629699_2629879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|2629808_2630648_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|2630641_2630989_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206316.1|2631152_2631944_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000995519.1|2632035_2632341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102919.1|2632356_2632869_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002016612.1|2632894_2633554_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002089484.1|2633525_2633990_-	AAC(3)-I family aminoglycoside 3-N-acetyltransferase	NA	NA	NA	NA	NA
WP_000845054.1|2634160_2635174_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_004193519.1|2635112_2635727_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|2635852_2636413_+|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001067855.1|2637446_2638151_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018326.1|2638280_2639096_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
2638161:2638986	attR	CATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGATAAAAATATATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACGTCTTGCTCGAGGCCGCGATTAAATTCCAACCTGGATGCTGATTTATATGGGTATAGATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGATTGTATGGGAAGCCCAATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGCATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGGAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCTAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAGCTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCC	NA	NA	NA	NA
WP_000902128.1|2639249_2639429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|2639695_2640400_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000904905.1|2640411_2641071_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.4e-37
>prophage 5
NZ_CP026750	Acinetobacter baumannii strain WCHAB005133 chromosome, complete genome	3893541	2721869	2750543	3893541	head,terminase,tail	Acinetobacter_phage(93.75%)	38	NA	NA
WP_001019739.1|2721869_2722415_-	hypothetical protein	NA	A0A0B5L5G7	Acinetobacter_phage	100.0	4.7e-103
WP_000433907.1|2722456_2722846_-	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	99.2	3.3e-66
WP_000598554.1|2722913_2726339_-	hypothetical protein	NA	A0A0P0HSH9	Acinetobacter_phage	94.2	0.0e+00
WP_000835160.1|2726331_2726694_-	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	79.2	8.1e-51
WP_000368388.1|2726690_2727197_-	DUF1833 domain-containing protein	NA	J7HXQ5	Acinetobacter_phage	97.0	1.5e-90
WP_000277448.1|2727196_2727595_-	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.7	4.1e-72
WP_000721057.1|2727687_2728275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000046573.1|2728365_2732676_-|tail	phage tail tape measure protein	tail	A0A0D4DC37	Acinetobacter_phage	98.3	0.0e+00
WP_001275792.1|2732803_2733067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000721572.1|2733068_2733749_-	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	49.3	2.5e-53
WP_000274931.1|2733853_2734312_-	transcriptional regulator	NA	A0A0P0IRJ4	Acinetobacter_phage	100.0	1.1e-84
WP_033918531.1|2734320_2734620_-	DUF4258 domain-containing protein	NA	A0A0P0IE58	Acinetobacter_phage	99.0	2.8e-49
WP_000424822.1|2734865_2735195_-	hypothetical protein	NA	A0A1B1P9F7	Acinetobacter_phage	55.1	4.5e-24
WP_001185585.1|2735122_2735638_-	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	96.6	2.5e-77
WP_000094278.1|2735707_2736625_-	hypothetical protein	NA	J7HXP7	Acinetobacter_phage	100.0	2.0e-170
WP_000002408.1|2736677_2737856_-	hypothetical protein	NA	A0A0D4DCQ4	Acinetobacter_phage	66.3	1.2e-103
WP_000064593.1|2737855_2738209_-	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	96.6	3.3e-57
WP_000749909.1|2738305_2738827_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_001277696.1|2738935_2739154_-	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	94.2	1.2e-28
WP_001984404.1|2739155_2739599_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	94.6	2.0e-75
WP_000539749.1|2739555_2739924_-	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	82.8	2.0e-52
WP_000248411.1|2739895_2740306_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	73.3	7.7e-50
WP_000235282.1|2740357_2740651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000540685.1|2740658_2740856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000524257.1|2740924_2741293_-	hypothetical protein	NA	J7I467	Acinetobacter_phage	92.6	8.7e-61
WP_000008459.1|2741293_2741674_-	hypothetical protein	NA	A0A0P0IVQ3	Acinetobacter_phage	84.9	6.9e-53
WP_000524488.1|2741677_2742013_-	hypothetical protein	NA	A0A0N7IRE4	Acinetobacter_phage	100.0	2.7e-53
WP_000852265.1|2742057_2743008_-	hypothetical protein	NA	A0A0P0HSG2	Acinetobacter_phage	94.9	3.7e-172
WP_000056390.1|2743021_2743813_-	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	74.2	2.3e-90
WP_000589038.1|2743899_2744214_-	hypothetical protein	NA	A0A0S3UFT8	Pseudomonas_phage	50.5	5.2e-14
WP_000004550.1|2744433_2744664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000146970.1|2744660_2745767_-|head	head morphogenesis protein	head	A0A0P0IR98	Acinetobacter_phage	90.2	2.1e-190
WP_000301495.1|2745776_2747117_-	DUF4055 domain-containing protein	NA	A0A0P0IDW1	Acinetobacter_phage	92.2	3.4e-235
WP_001132930.1|2747156_2748449_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	86.0	6.4e-215
WP_000729387.1|2748408_2748924_-	DUF2280 domain-containing protein	NA	A0A1B1P9C2	Acinetobacter_phage	61.3	3.2e-45
WP_000435230.1|2748982_2749624_-	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	88.7	6.3e-115
WP_000378523.1|2749592_2750027_-	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	84.7	7.4e-67
WP_001136773.1|2750087_2750543_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	95.4	2.7e-80
>prophage 6
NZ_CP026750	Acinetobacter baumannii strain WCHAB005133 chromosome, complete genome	3893541	2754501	2766849	3893541		Acinetobacter_phage(95.65%)	24	NA	NA
WP_001277128.1|2754501_2754978_-	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.3	1.2e-25
WP_000100162.1|2754974_2755376_-	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	96.2	2.6e-66
WP_000462878.1|2755375_2755768_-	hypothetical protein	NA	J7HXM5	Acinetobacter_phage	57.8	1.2e-07
WP_000647826.1|2755760_2756099_-	hypothetical protein	NA	A0A0P0IKW4	Acinetobacter_phage	56.3	1.1e-30
WP_001003671.1|2756095_2756896_-	hypothetical protein	NA	A0A0P0IDV1	Acinetobacter_phage	95.5	2.8e-144
WP_000064627.1|2756898_2757780_-	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	95.2	3.3e-138
WP_000602535.1|2757772_2757997_-	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	97.3	3.2e-34
WP_001984388.1|2758068_2758347_-	hypothetical protein	NA	J7I0V3	Acinetobacter_phage	90.2	6.6e-37
WP_000048916.1|2758402_2758723_-	hypothetical protein	NA	A0A0P0HSE9	Acinetobacter_phage	87.7	1.2e-42
WP_000703023.1|2758733_2758922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000052252.1|2759026_2759779_+	phage repressor protein	NA	J7I4M9	Acinetobacter_phage	74.3	5.5e-102
WP_000370485.1|2759793_2760009_+	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	98.6	9.4e-31
WP_000048052.1|2760060_2761068_+	hypothetical protein	NA	A0A0P0IY33	Acinetobacter_phage	100.0	2.9e-183
WP_001129676.1|2761069_2761573_+	hypothetical protein	NA	A0A0P0I896	Acinetobacter_phage	100.0	1.1e-77
WP_000845537.1|2761711_2761915_+	hypothetical protein	NA	A0A0P0IKZ8	Acinetobacter_phage	100.0	1.2e-27
WP_000051960.1|2761921_2762164_-	hypothetical protein	NA	A0A0P0I4B0	Acinetobacter_phage	100.0	5.2e-38
WP_001101038.1|2762357_2762801_+	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	94.5	1.7e-71
WP_000656405.1|2762800_2763091_+	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	95.8	5.1e-48
WP_000064463.1|2763083_2763407_+	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	95.3	4.8e-55
WP_001207474.1|2763418_2764540_+	ATPase AAA	NA	A0A0N7IRE0	Acinetobacter_phage	99.5	2.8e-211
WP_000698529.1|2764536_2765469_+	hypothetical protein	NA	A0A0P0I438	Acinetobacter_phage	80.0	2.2e-137
WP_000654846.1|2765470_2765722_+	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	6.4e-39
WP_000147323.1|2765722_2766130_+	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	52.2	7.5e-13
WP_000004579.1|2766126_2766849_+	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	88.2	1.7e-55
>prophage 7
NZ_CP026750	Acinetobacter baumannii strain WCHAB005133 chromosome, complete genome	3893541	3580078	3635297	3893541	tRNA,transposase	Staphylococcus_phage(15.38%)	52	NA	NA
WP_000216739.1|3580078_3581011_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000907680.1|3581060_3582257_-	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
WP_000908243.1|3582281_3583628_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_000942498.1|3583788_3584040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001278225.1|3584060_3585914_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_001991212.1|3585910_3586174_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_000608730.1|3586317_3587238_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.7	6.7e-33
WP_000011159.1|3587384_3588200_+	DsbC family protein	NA	NA	NA	NA	NA
WP_000805827.1|3588444_3589746_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_000063593.1|3589801_3590941_+	threonine synthase	NA	NA	NA	NA	NA
WP_000025645.1|3591047_3592055_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_000633799.1|3592306_3592942_+	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_002001070.1|3592997_3594521_+	PAS domain-containing sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.3	2.3e-06
WP_000840549.1|3594545_3595967_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_000942504.1|3595970_3597155_-	peptidase S41	NA	A0A0R6PIZ1	Moraxella_phage	23.0	8.3e-12
WP_000128749.1|3597170_3598718_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_000881094.1|3598843_3599914_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000586912.1|3599913_3601014_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000673449.1|3601157_3602606_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.4	5.5e-50
WP_001151592.1|3602598_3603006_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_001988710.1|3603044_3603683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354154.1|3603813_3604032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493866.1|3604091_3604751_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.6	1.5e-34
WP_001083669.1|3604793_3606086_-	restriction endonuclease subunit M	NA	A0A0P0BWH0	Ostreococcus_mediterraneus_virus	32.6	2.5e-38
WP_001292506.1|3606082_3607168_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.6	5.1e-48
WP_000543541.1|3607183_3607642_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_000738520.1|3607799_3609197_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	5.4e-34
WP_000780326.1|3609254_3609593_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_000894500.1|3609872_3610100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000010465.1|3610165_3611023_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001144971.1|3611105_3612893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001082319.1|3613275_3614079_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|3614078_3614915_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000743213.1|3615034_3615259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|3615469_3616963_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000512977.1|3617200_3617605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322387.1|3617582_3618209_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001089073.1|3618287_3619505_+	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_001144964.1|3619587_3621384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000953322.1|3621678_3623166_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	79.4	8.3e-219
WP_000034564.1|3623178_3624030_+	universal stress protein A	NA	A0A2H4J154	uncultured_Caudovirales_phage	45.9	8.2e-70
WP_001095006.1|3624097_3624397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000529372.1|3624469_3624841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085940413.1|3625531_3626621_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000081835.1|3627827_3628943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000417085.1|3628972_3629893_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_020752341.1|3629897_3631808_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_020752340.1|3631808_3632519_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	4.1e-06
WP_071543477.1|3632723_3633017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|3632910_3633213_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|3633299_3634115_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_085940413.1|3634207_3635297_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP026749	Acinetobacter baumannii strain WCHAB005133 plasmid pOXA58_005133, complete sequence	42455	0	14518	42455	transposase	Escherichia_phage(42.86%)	12	NA	NA
WP_026438268.1|189_435_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_005146104.1|796_2284_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	79.6	6.4e-219
WP_002115246.1|2296_3148_+	universal stress family protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	45.2	5.5e-66
WP_001067784.1|3701_4406_-|transposase	IS6 family transposase IS1006	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_001445143.1|5330_5582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|5475_5778_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|5864_6680_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_014386425.1|7194_8178_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214119.1|8205_9420_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	4.2e-19
WP_001067858.1|11089_11794_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_002002480.1|11997_12840_+	carbapenem-hydrolyzing class D beta-lactamase OXA-58	NA	NA	NA	NA	NA
WP_001067858.1|13813_14518_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 2
NZ_CP026749	Acinetobacter baumannii strain WCHAB005133 plasmid pOXA58_005133, complete sequence	42455	18878	20577	42455		Natrialba_phage(50.0%)	2	NA	NA
WP_070153144.1|18878_19652_+	partitioning protein	NA	Q8JL10	Natrialba_phage	33.3	4.4e-14
WP_104915057.1|19665_20577_+	partitioning protein	NA	S5VSZ7	Leptospira_phage	42.9	2.0e-13
>prophage 3
NZ_CP026749	Acinetobacter baumannii strain WCHAB005133 plasmid pOXA58_005133, complete sequence	42455	25044	28281	42455		Liberibacter_phage(100.0%)	1	NA	NA
WP_104915059.1|25044_28281_+	DEAD/DEAH box helicase	NA	A0A220A398	Liberibacter_phage	29.6	1.0e-67
>prophage 4
NZ_CP026749	Acinetobacter baumannii strain WCHAB005133 plasmid pOXA58_005133, complete sequence	42455	31590	41077	42455	transposase	Escherichia_phage(33.33%)	13	NA	NA
WP_001067784.1|31590_32295_-|transposase	IS6 family transposase IS1006	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_104915062.1|32522_33497_+	calcium/sodium antiporter	NA	A0A2I7QY17	Vibrio_phage	27.0	2.8e-05
WP_104915063.1|33777_33990_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_004691518.1|34046_34430_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_104915064.1|34372_34762_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_104915065.1|34836_36483_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	53.4	2.6e-144
WP_104915066.1|37196_37700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019838467.1|37768_38083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104915071.1|38045_38357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004896916.1|38736_38940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104915067.1|38992_39319_-	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	48.8	6.4e-15
WP_004647749.1|39320_39617_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A4JWV2	Burkholderia_virus	38.8	1.2e-15
WP_104915068.1|39857_41077_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	52.6	2.6e-77
