The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	440872	512774	4489122	tRNA,transposase,bacteriocin	Paenibacillus_phage(47.83%)	63	NA	NA
WP_077997612.1|440872_442135_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.3	2.2e-87
WP_077996631.1|442166_442868_+	protein rep	NA	NA	NA	NA	NA
WP_024093087.1|443822_445271_+	amino acid permease	NA	NA	NA	NA	NA
WP_042119415.1|445328_447191_+	tyrosine decarboxylase	NA	NA	NA	NA	NA
WP_023483977.1|447300_448116_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_079940500.1|448207_449593_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_077996632.1|449879_450176_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_077997613.1|450485_451136_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_077996633.1|451364_452180_+	N-acetylmuramoyl-L-alanine amidase	NA	D6QWP2	uncultured_phage	52.9	1.7e-40
WP_077996634.1|453744_454302_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	43.4	5.4e-38
WP_077996635.1|454298_455258_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	45.7	6.6e-76
WP_036655890.1|455254_456109_+	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_077996636.1|456352_456934_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_149867746.1|457224_457860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996638.1|458035_458290_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_079940501.1|458773_460138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155121069.1|460124_460301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996641.1|460465_460972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996642.1|460990_461317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996644.1|462232_463114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996645.1|463136_464069_+	type III-B CRISPR module RAMP protein Cmr1	NA	NA	NA	NA	NA
WP_077996646.1|464068_465742_+	type III-B CRISPR-associated protein Cas10/Cmr2	NA	NA	NA	NA	NA
WP_079940503.1|465741_466866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997614.1|466879_467776_+	type III-B CRISPR module RAMP protein Cmr4	NA	NA	NA	NA	NA
WP_042118428.1|467759_468164_+	type III-B CRISPR module-associated protein Cmr5	NA	NA	NA	NA	NA
WP_149867747.1|468237_468996_+	type III-B CRISPR module RAMP protein Cmr6	NA	NA	NA	NA	NA
WP_077996650.1|470896_471568_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.7	3.6e-12
WP_077996651.1|473698_474187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996653.1|475638_476895_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_077996654.1|477062_478250_+	alanine racemase	NA	NA	NA	NA	NA
WP_024093124.1|478484_478766_+	CopG family ribbon-helix-helix protein	NA	NA	NA	NA	NA
WP_023485406.1|478769_479120_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A2P0ZKX3	Lactobacillus_phage	38.6	6.9e-15
WP_104932789.1|479291_481496_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_077997616.1|481697_482264_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_023485404.1|482661_483120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093128.1|483204_483432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940505.1|483687_484887_+	S8 family peptidase	NA	A0A217EQY2	Bacillus_phage	38.8	3.4e-45
WP_096761197.1|485195_485303_-	cortex morphogenetic protein CmpA	NA	NA	NA	NA	NA
WP_077996657.1|485464_485821_-	hydrolase/acyltransferase	NA	NA	NA	NA	NA
WP_077996658.1|485919_486390_+	SprT family protein	NA	NA	NA	NA	NA
WP_077996659.1|488101_488866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996660.1|489165_489756_+	hypothetical protein	NA	S5MNY5	Brevibacillus_phage	24.9	1.1e-12
WP_077996661.1|489767_490058_+	hypothetical protein	NA	E2ELK3	Clostridium_phage	50.5	1.5e-18
WP_036655918.1|490371_490608_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	R9W0N4	Paenibacillus_phage	98.6	6.0e-31
WP_077996662.1|491285_491531_+|transposase	transposase	transposase	A0A2I7SC00	Paenibacillus_phage	93.8	2.2e-31
WP_149867748.1|491891_492293_+	hypothetical protein	NA	D2XR29	Bacillus_phage	45.1	3.3e-21
WP_158530383.1|492279_492438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104932633.1|493016_493445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995397.1|493451_494675_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	4.0e-227
WP_077996665.1|495937_496621_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	97.8	6.9e-120
WP_079940506.1|497549_498194_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_104932629.1|498170_499288_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	99.3	2.1e-153
WP_079940507.1|499312_500710_+	phosphatidylinositol-specific phospholipase C domain-containing protein	NA	NA	NA	NA	NA
WP_036654509.1|501071_501755_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932634.1|501775_502645_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_077996666.1|503230_504505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940508.1|504575_507188_+	peptidase	NA	A0A1V0E026	Clostridioides_phage	33.4	2.6e-98
WP_079940509.1|507713_508319_+	ADP-ribosyltransferase	NA	Q331X8	Clostridium_botulinum_C_phage	41.8	9.7e-33
WP_077996667.1|508673_509645_+	hypothetical protein	NA	A0A2I7SCU7	Paenibacillus_phage	78.9	2.9e-143
WP_077996668.1|509704_510724_+	hypothetical protein	NA	A0A2I7SDE4	Paenibacillus_phage	61.5	1.9e-60
WP_077996669.1|510740_511148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932629.1|511504_512621_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	99.3	2.1e-153
WP_104932635.1|512675_512774_+	dihydroorotate dehydrogenase	NA	A0A2I7SCT3	Paenibacillus_phage	96.9	2.3e-08
>prophage 2
NZ_CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	596715	650602	4489122	tRNA,transposase,holin,bacteriocin	Paenibacillus_phage(16.67%)	55	NA	NA
WP_077996720.1|596715_597051_-|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_079940518.1|598008_599097_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_024095277.1|599321_599867_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_077997624.1|600014_600407_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_079940519.1|600444_602415_-	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_024095275.1|602461_602662_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_024095273.1|602849_603275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036654509.1|603575_604259_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932621.1|604279_605149_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_023484880.1|605255_606236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996722.1|606433_607252_+	RNA polymerase sigma factor SigI	NA	NA	NA	NA	NA
WP_077996723.1|607244_608357_+	anti-sigma factor domain-containing protein	NA	NA	NA	NA	NA
WP_079940520.1|608569_609964_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_052337463.1|610104_610644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940521.1|611004_612471_-	glycine dehydrogenase subunit 2	NA	E3ST28	Prochlorococcus_phage	39.4	1.8e-80
WP_077996726.1|612467_613823_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	38.1	5.3e-55
WP_077996727.1|613863_614970_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_024095265.1|615586_615976_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_023484889.1|616197_616632_+	universal stress protein	NA	NA	NA	NA	NA
WP_077585182.1|616931_617216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996728.1|617245_618202_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	64.0	2.3e-121
WP_023484892.1|618256_618742_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	42.5	1.1e-31
WP_077996729.1|618810_619119_+	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_023484894.1|619139_619340_+	heavy-metal-associated domain-containing protein	NA	A0A218MNH0	uncultured_virus	40.0	6.3e-05
WP_079940522.1|619434_621861_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.0	4.8e-115
WP_077997625.1|621917_622541_-	YcnI family protein	NA	NA	NA	NA	NA
WP_023484897.1|622630_623308_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_036657484.1|623304_624111_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_036655989.1|624400_624643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996732.1|625366_625651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996733.1|625823_627509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996734.1|627818_628175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996735.1|628401_629064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996736.1|629377_629572_+	helix-turn-helix transcriptional regulator	NA	A0A139ZPI6	Marinitoga_camini_virus	37.3	8.0e-05
WP_024095256.1|629971_630673_-	iron-sulfur cluster repair di-iron protein	NA	NA	NA	NA	NA
WP_077996738.1|631030_632263_+	FprA family A-type flavoprotein	NA	NA	NA	NA	NA
WP_077996739.1|632287_633526_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024095255.1|633663_633828_+	rubredoxin	NA	NA	NA	NA	NA
WP_077996740.1|633899_634607_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_077996741.1|634882_635536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996742.1|635652_636834_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_155121072.1|637019_637184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996743.1|637641_637764_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_158672712.1|637730_638087_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	42.2	3.3e-12
WP_077996746.1|638165_638483_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158672713.1|638550_639387_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.5	1.9e-47
WP_024095236.1|639786_640710_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_023483724.1|640876_641392_+	signal peptidase I	NA	NA	NA	NA	NA
WP_104932642.1|641813_642011_+	PTS transporter subunit EIIB	NA	NA	NA	NA	NA
WP_077996747.1|642493_643522_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.9	1.7e-29
WP_079940523.1|643545_645996_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_077996748.1|646102_649003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483729.1|649008_649548_+	CvpA family protein	NA	NA	NA	NA	NA
WP_036656016.1|649629_649992_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_023483731.1|650233_650602_-|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 3
NZ_CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	763358	915053	4489122	tail,holin,terminase,integrase,capsid,coat,head,protease,transposase,portal	Paenibacillus_phage(62.82%)	164	768543:768602	858018:859739
WP_077995397.1|763358_764582_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	4.0e-227
WP_023485364.1|766356_766728_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_023485363.1|766804_768316_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_079940531.1|768339_768564_+	hypothetical protein	NA	NA	NA	NA	NA
768543:768602	attL	TGATATGCTCCCCTTGCGGTAGACAGTTGAAATAATAAAACTGTTTACTGTAAGGAGGAG	NA	NA	NA	NA
WP_036654509.1|768611_769295_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932621.1|769315_770185_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_077996804.1|770384_770801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996805.1|771065_771377_+	DUF1805 domain-containing protein	NA	NA	NA	NA	NA
WP_077996806.1|771363_771729_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077996807.1|771775_772417_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_077996808.1|772552_773659_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_077996809.1|773678_774908_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_024093280.1|775126_775576_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.3	8.5e-42
WP_077996810.1|775747_776320_+	DUF1802 family protein	NA	NA	NA	NA	NA
WP_077996811.1|776500_777334_+	Fe-S cluster assembly ATPase SufC	NA	W8CYL7	Bacillus_phage	25.3	2.2e-06
WP_024093282.1|777401_778697_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_077996812.1|778693_779920_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	46.5	2.5e-112
WP_023485352.1|779906_780344_+	SUF system NifU family Fe-S cluster assembly protein	NA	A0A218MKD1	uncultured_virus	31.2	1.1e-12
WP_023485351.1|780368_781766_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_077997632.1|781847_783014_-|integrase	site-specific integrase	integrase	S5MBZ0	Brevibacillus_phage	37.2	3.6e-60
WP_077996813.1|783096_783729_-	helix-turn-helix domain-containing protein	NA	A0A1B2APZ3	Phage_Wrath	67.6	3.2e-79
WP_077996814.1|783881_784130_+	helix-turn-helix transcriptional regulator	NA	A0A1B2APZ4	Phage_Wrath	68.0	4.6e-21
WP_077997633.1|784163_784436_+	group-specific protein	NA	A0A1B1P7U4	Bacillus_phage	57.1	1.8e-23
WP_077996815.1|784520_784775_+	hypothetical protein	NA	A0A0C5AER7	Bacteriophage	91.5	1.3e-34
WP_077996816.1|784771_785143_+	hypothetical protein	NA	R9VW30	Paenibacillus_phage	90.0	8.5e-56
WP_077996817.1|785139_785364_+	hypothetical protein	NA	A0A0K2CZE0	Paenibacillus_phage	72.5	7.8e-20
WP_158672717.1|785360_785531_+	hypothetical protein	NA	A0A0K2CZS8	Paenibacillus_phage	92.0	8.2e-22
WP_077996818.1|785535_785724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996819.1|785720_786398_+	hypothetical protein	NA	A0A2I7SCV5	Paenibacillus_phage	84.5	1.8e-59
WP_077996820.1|786412_786676_+	hypothetical protein	NA	A0A0C5AFB6	Paenibacillus_phage	70.1	5.7e-30
WP_155121034.1|786854_787022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996822.1|787963_788767_+	hypothetical protein	NA	A0A0P0IZH9	Lactobacillus_phage	40.0	5.4e-47
WP_077996823.1|788816_789218_+	single-stranded DNA-binding protein	NA	A0A0K2CYR2	Paenibacillus_phage	73.5	3.9e-46
WP_077996824.1|789242_789575_+	hypothetical protein	NA	A0A0K2CY25	Paenibacillus_phage	92.7	1.6e-53
WP_077996825.1|789623_790514_+	DnaD domain protein	NA	A0A0K2CY85	Paenibacillus_phage	86.5	2.7e-124
WP_104932794.1|790404_791226_+	ATP-binding protein	NA	A0A0K2CYY7	Paenibacillus_phage	97.2	3.0e-117
WP_077996826.1|791343_791574_+	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	98.6	9.7e-34
WP_077996827.1|791554_792076_+	hypothetical protein	NA	R9TMF8	Paenibacillus_phage	53.5	1.5e-50
WP_077996828.1|792257_792488_+	hypothetical protein	NA	R9TMG2	Paenibacillus_phage	66.2	6.1e-20
WP_077996830.1|793048_793417_+	hypothetical protein	NA	R9W0Q6	Paenibacillus_phage	77.3	1.4e-13
WP_077996831.1|793423_793657_+	hypothetical protein	NA	A0A0K2CYJ4	Paenibacillus_phage	69.8	1.7e-14
WP_158672718.1|793649_794060_+	hypothetical protein	NA	A8ASP1	Listeria_phage	39.4	8.9e-14
WP_077996833.1|794049_794286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996834.1|794313_794751_+	transcriptional regulator	NA	A0A0K2CYZ6	Paenibacillus_phage	95.9	2.5e-70
WP_077996835.1|794956_795298_+	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	100.0	8.4e-58
WP_077996836.1|795308_796772_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	49.1	1.3e-123
WP_104932795.1|796913_797213_+	DUF3310 domain-containing protein	NA	E5DV94	Deep-sea_thermophilic_phage	42.9	4.8e-09
WP_077996839.1|797393_797708_+	hypothetical protein	NA	A0A0K2CZ01	Paenibacillus_phage	86.5	8.3e-44
WP_077996840.1|797694_798036_+	HNH endonuclease	NA	A0A0K2CYS9	Paenibacillus_phage	98.2	4.4e-59
WP_077996841.1|798170_798488_+|terminase	phage terminase small subunit P27 family	terminase	A0A0C5AMZ2	Paenibacillus_phage	89.5	1.7e-44
WP_077996842.1|798462_800196_+|terminase	terminase large subunit	terminase	A0A0K2CZH9	Paenibacillus_phage	63.5	1.1e-214
WP_077996843.1|800214_801474_+|portal	phage portal protein	portal	A0A0A7RUE7	Clostridium_phage	22.9	4.9e-18
WP_077996844.1|801409_802012_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	34.6	7.7e-14
WP_158672719.1|802023_803208_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_158672720.1|803209_803506_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J6E5	uncultured_Caudovirales_phage	40.7	2.9e-14
WP_158672721.1|803483_803801_+|head	phage head closure protein	head	A0A0C5AE87	Paenibacillus_phage	92.4	2.2e-52
WP_077996848.1|803800_804229_+	hypothetical protein	NA	A0A0C5AJ13	Paenibacillus_phage	94.4	3.0e-68
WP_158672722.1|804212_804608_+	DUF3168 domain-containing protein	NA	A0A0C5AEH4	Paenibacillus_phage	84.7	9.1e-56
WP_077996850.1|804609_805044_+|tail	phage major tail protein, TP901-1 family	tail	A0A2I7SCY9	Paenibacillus_phage	95.8	2.0e-72
WP_104932650.1|805043_805382_+	hypothetical protein	NA	A0A0C5ABB9	Paenibacillus_phage	51.3	1.5e-22
WP_158672723.1|805414_805663_+	hypothetical protein	NA	A0A0C5AE91	Paenibacillus_phage	70.4	4.7e-26
WP_077996853.1|805717_808354_+|tail	phage tail tape measure protein	tail	A0A0C5AJ16	Paenibacillus_phage	95.9	8.0e-249
WP_158672724.1|808350_809226_+|tail	phage tail family protein	tail	A0A0C5AEI0	Paenibacillus_phage	46.0	5.0e-70
WP_158672725.1|809228_810359_+	hypothetical protein	NA	A0A0K2CZQ1	Paenibacillus_phage	33.8	1.7e-59
WP_104932651.1|810363_812331_+	hypothetical protein	NA	E2ELJ8	Clostridium_phage	48.7	1.5e-53
WP_077996857.1|812343_812529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996858.1|812546_812729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158672726.1|812721_812877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094415.1|812917_813157_+	hypothetical protein	NA	R9W0N4	Paenibacillus_phage	100.0	2.8e-36
WP_077996859.1|814100_814343_+|transposase	transposase	transposase	A0A0C5AN23	Paenibacillus_phage	93.8	4.3e-32
WP_104932634.1|815605_816475_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_036654509.1|816495_817179_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_077996871.1|817632_817797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996872.1|819089_819710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158672727.1|819849_821133_+	MFS transporter	NA	D0R099	Streptococcus_phage	22.5	1.2e-08
WP_077996875.1|822820_823453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932796.1|823546_823693_+|holin	putative holin-like toxin	holin	A0A0K2CYN9	Paenibacillus_phage	100.0	2.8e-18
WP_077997637.1|826321_827359_+	amidinotransferase	NA	NA	NA	NA	NA
WP_077996877.1|827785_827986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158672728.1|828548_828749_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	52.4	3.1e-12
WP_155121082.1|828850_829024_+	hypothetical protein	NA	A0A0C5AMZ7	Paenibacillus_phage	90.7	7.1e-13
WP_155121083.1|829067_829241_+	hypothetical protein	NA	A0A2I7SDE4	Paenibacillus_phage	98.2	8.3e-22
WP_077996880.1|829468_829876_+	hypothetical protein	NA	A0A2I7SDE8	Paenibacillus_phage	94.0	3.4e-66
WP_077995249.1|830220_831441_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
WP_077996881.1|832518_832707_-	hypothetical protein	NA	A0A2I7SC09	Paenibacillus_phage	78.7	9.1e-22
WP_077996882.1|833524_833929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996883.1|833910_834207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155121084.1|834743_834908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996884.1|835142_836078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996885.1|836101_836491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155121085.1|836487_836625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093300.1|837344_837671_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_024093303.1|838416_839460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996887.1|839479_839785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158225766.1|839815_839914_+	sporulation protein YjcZ	NA	NA	NA	NA	NA
WP_023484376.1|840147_840543_+	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_077996888.1|840738_841785_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_036656196.1|841863_842196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158672729.1|842388_843357_+	collagen-like repeat preface domain-containing protein	NA	NA	NA	NA	NA
WP_079940534.1|843541_844957_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_023484381.1|845101_845953_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_077585292.1|846340_847444_+	radical SAM/CxCxxxxC motif protein YfkAB	NA	NA	NA	NA	NA
WP_077996890.1|847496_848867_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_104932652.1|849029_849893_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	98.3	2.8e-134
WP_077996122.1|849915_850599_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	96.9	1.7e-118
WP_077585196.1|850779_850992_+|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_024093310.1|851264_851531_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_040932682.1|851572_852142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996892.1|852534_852831_+	hypothetical protein	NA	A0A0K2CZ50	Paenibacillus_phage	70.6	3.5e-12
WP_023484389.1|853060_853966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158225767.1|854088_854223_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_024093313.1|855169_855367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996893.1|856062_856668_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.5	6.1e-51
WP_077996894.1|856800_857295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036657847.1|857532_857922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036654509.1|858086_858770_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932621.1|858790_859660_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_077996895.1|860051_860600_+	hypothetical protein	NA	NA	NA	NA	NA
858018:859739	attR	TGATATGCTCCCCTTGCGGTAGACAGTTGAAATAATAAAACTGTTTACTGTAAGGAGGAGCATTTTTTCATGTCCCATAAAGCAAAAGTATCAGGATCAGAAAAGATTGCAGCTGTTGAAAAGTATTTACGTGGAGAAGATTCGCTTAATCATTTAGCAGCACTTCTTGATGTACGCCATTCATCCGTTAGGCAATGGCTTCAGACTTACCAGTCGCTAGGCCCAAACGGATTGCTTCAAACATCACAGAATGCATCTTACTCCGCAGAGTTAAAAAGAATAGCTGTCGAGGACTATTTGGCTGGCGGCGGTTCTCACATGGATATTTGTAAAAGATATGGCATTAAGTCAACTTGCCAATTGCGGGATTGGATTCTGAAGTATAATAGTCATGAGAAGTTGAACACTTCCGGAACGGGAGGAGTGCCGATCATGACAAAAGGACGAACAACTACTTACGATGAGAGAGTTGAAATCGTCAGATTCTGCATTGAACATCAACACAATTATGCCCAGACAGCTGATAAATTCCAGGTATCCTATCAGCAAGTTTATTCATGGACAAATAAATACTTAACATCTGGTGTGGATGCACTTCAGGACAGACGCGGGAAAAGAAAATCTGAGGATGAGATGTCCGAAGTGGAGAAACTAAGGGCTCAGAATAAGCTGTTACAGGCTGAGAACAGAAGGAAGCAGATGGAGATCGATTTGCTAAAAAAGTTGGACGAGATCGAAAGGAGGCGGTTCTAAGCCAGGTAAGGTATGAAACGATATACCTTGCAATACGCGGGCTCCGTGAAACGAAGTCATATCCCATATGTCAATTATGTGATCTTATTGGGATCCAACGTTCATCGTATTATAAATGGATCAACCGGAAAGAAAGTATTAATGAGATCTTTAATAAAGCGTTGCTTCCCATGATTAAAGATGCCTACGAGGAAAAGGATGGCATCCTTGGATATCGCCAGATGACCATTAAACTAAACCGGGAACGCCATGTAACTGTCAATCATAAGCGAATATACAGACTTATGGGCATCCTAGGCCTTAAATCGGTATGCCGCAGGAAGCGAAAAAACTACATCCATTCCACACCTGAAATTACGGCGGAAAATATCCTGAACAGAGACTTTGAATCCTCTGAGTTTGGTACGAAATGGCTCACAGATGTGACTGAAATGAAGTATGGCAACCAAAACAAGGCTTATCTTAGTGCAATCCTTGATTTGTCGGATAAAAGCATTGTTTCTTTTGTGGTAGGGCATTCCAACAACAATGAACTTGTATTTAAAACTTTTGATATCGCCCATATGACTTATCCTGACGCTACACCCCTCTTTCACAGTGACCGGGGTTTCCAATATACATGTAAAATCTTCAAGAAAAAACTAGACGATGCAGGTATGATCCAAAGCATGTCCAGGGTATCCAGATGTATAGATAATGGCCCAATGGAATCATTCTGGGGAATGATGAAATCCGAAATGTATTATCTTCGTAAGTTCTATACATATGAGGAACTGGAAGCAGCCGTGATAGAATACATCGATTACTACAATACTCGTCGATACCAGAAAAGACTTAATTGTATGACGCCGTTGGAATATAGGCAATACCTTCTAAGTTCAGCAGCATAGAAAATGGCACCAACCATGTATGGTTAGTGCCACAACTTTTTTTGTTTTTTACACTGTCTACTTGACAGGGGTCAGTTCA	NA	NA	NA	NA
WP_077996896.1|860626_860881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996897.1|861285_863601_+	cation-translocating P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	24.7	4.9e-32
WP_023483454.1|864378_865047_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077996898.1|865332_866985_+	mannitol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_077996899.1|866975_868046_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_077996900.1|869671_871066_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_023483448.1|871131_871782_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_077996901.1|871783_872788_+	sugar kinase	NA	NA	NA	NA	NA
WP_158672833.1|872761_872893_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_158530409.1|872988_874824_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_077996903.1|874843_875722_+	ketose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_079940350.1|875749_877633_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_077996904.1|877661_878126_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_036658101.1|878155_878470_+	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_104932653.1|878478_879579_+	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_077996906.1|879959_881489_-	glycosyltransferase	NA	A0A0N7G7L1	Chrysochromulina_ericina_virus	32.4	5.9e-42
WP_077996907.1|881706_882573_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	31.4	1.1e-08
WP_077996908.1|882688_883828_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_077996909.1|883824_884466_+	acetyltransferase	NA	NA	NA	NA	NA
WP_077996910.1|884483_885206_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_077996911.1|885601_886240_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_036656232.1|888438_888717_-	HU family DNA-binding protein	NA	M4SRV7	Rhodobacter_phage	38.3	7.2e-07
WP_023483458.1|888817_889024_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	64.6	4.6e-19
WP_158672834.1|890556_892509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155121046.1|893541_893685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932654.1|894075_895193_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	100.0	2.4e-154
WP_155116254.1|895467_895611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996914.1|896510_896951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996915.1|897237_897519_-	sugar nucleotide-binding protein	NA	NA	NA	NA	NA
WP_077996916.1|897326_897785_-	sugar nucleotide-binding protein	NA	NA	NA	NA	NA
WP_077996917.1|898748_899471_-	NTP transferase domain-containing protein	NA	H9NC64	Sphingomonas_phage	40.6	7.8e-45
WP_158672730.1|899716_899899_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077996919.1|900484_901375_+	hypothetical protein	NA	A0A024B055	Bacillus_phage	43.6	3.7e-12
WP_077997639.1|901679_902561_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_077996920.1|903112_903994_+	hypothetical protein	NA	D2KRB9	Lactobacillus_phage	33.0	2.0e-10
WP_023484075.1|904310_904709_+|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	43.5	1.1e-21
WP_077996921.1|904811_905330_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_077996922.1|905320_905695_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_077996923.1|905933_907103_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_023484080.1|907099_907828_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_077997640.1|907831_908689_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077996924.1|908876_909545_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_077996925.1|909593_910799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932797.1|910832_912782_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_077996927.1|912991_914491_-	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	27.2	1.6e-07
WP_077997641.1|914531_915053_-|protease	protease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	1018046	1085262	4489122	tail,bacteriocin,coat,plate,tRNA,transposase,portal	Paenibacillus_phage(30.77%)	77	NA	NA
WP_024095080.1|1018046_1018208_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_024095079.1|1018670_1018928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023482424.1|1019037_1020093_+	nucleoid-associated protein	NA	A0A0A8WF33	Clostridium_phage	25.0	6.3e-11
WP_079940336.1|1020107_1021589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996979.1|1021641_1022118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997645.1|1022435_1022798_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2P1JU12	Anoxybacillus_phage	40.7	7.9e-14
WP_077996980.1|1022898_1023354_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_079940799.1|1023607_1024048_+	transcriptional regulator	NA	A0A0C5AC66	Paenibacillus_phage	78.0	1.1e-57
WP_079940335.1|1024149_1024821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023482429.1|1025292_1025721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996983.1|1025695_1025878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996984.1|1025878_1027213_+|tail	phage tail sheath protein	tail	A0A0A7S087	Clostridium_phage	46.4	1.7e-109
WP_077996985.1|1027214_1027676_+|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	60.3	2.1e-48
WP_077996986.1|1027695_1028118_+|portal	phage portal protein	portal	X5JAB6	Clostridium_phage	41.8	4.4e-24
WP_079940334.1|1028489_1030535_+	hypothetical protein	NA	A0A0K2CP22	Brevibacillus_phage	41.7	3.0e-134
WP_079940333.1|1030534_1031176_+	LysM peptidoglycan-binding domain-containing protein	NA	S5MUH0	Brevibacillus_phage	46.3	4.6e-49
WP_077996990.1|1031180_1032149_+	hypothetical protein	NA	S5MNC9	Brevibacillus_phage	59.8	1.7e-111
WP_077996991.1|1032148_1032436_+	DUF2577 domain-containing protein	NA	S5MC71	Brevibacillus_phage	39.3	1.5e-15
WP_077996992.1|1032438_1032861_+	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	48.5	2.5e-27
WP_104932655.1|1032838_1033915_+|plate	baseplate J/gp47 family protein	plate	S5MUH6	Brevibacillus_phage	50.3	5.3e-98
WP_077997646.1|1033919_1034489_+	DUF2313 domain-containing protein	NA	S5MA71	Brevibacillus_phage	42.3	2.7e-32
WP_077996993.1|1034485_1034764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996994.1|1034767_1036540_+	hypothetical protein	NA	S5MNY5	Brevibacillus_phage	45.2	3.2e-15
WP_077996995.1|1036552_1036948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155121041.1|1036940_1037099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996996.1|1037137_1037377_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	R9W0N4	Paenibacillus_phage	98.7	6.3e-36
WP_104932656.1|1038297_1038528_+|transposase	transposase	transposase	A0A2I7SC00	Paenibacillus_phage	100.0	3.9e-27
WP_155121040.1|1038674_1038842_+	hypothetical protein	NA	A0A0K2CZ50	Paenibacillus_phage	78.1	6.2e-06
WP_079940798.1|1039193_1040252_+	malate permease	NA	NA	NA	NA	NA
WP_077996997.1|1040288_1041311_+	lactate dehydrogenase	NA	A0A1V0SBV6	Catovirus	28.5	6.3e-16
WP_077996998.1|1041492_1041699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995249.1|1041828_1043049_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
WP_158672732.1|1043261_1044533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997000.1|1045214_1045562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997648.1|1045612_1045957_-	DUF2512 family protein	NA	NA	NA	NA	NA
WP_023484507.1|1046141_1046345_+|coat	spore coat-like protein	coat	NA	NA	NA	NA
WP_024093574.1|1046363_1046666_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_023484509.1|1047492_1048632_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_077997001.1|1048816_1049170_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_023484510.1|1049181_1049613_+	EutP/PduV family microcompartment system protein	NA	NA	NA	NA	NA
WP_036655167.1|1049847_1050420_+	ANTAR domain-containing response regulator	NA	NA	NA	NA	NA
WP_077997002.1|1050412_1051837_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_077997003.1|1051978_1053409_+	ethanolamine ammonia-lyase reactivating factor EutA	NA	NA	NA	NA	NA
WP_077997004.1|1053438_1054803_+	ethanolamine ammonia-lyase subunit EutB	NA	NA	NA	NA	NA
WP_077997005.1|1054824_1055775_+	ethanolamine ammonia-lyase subunit EutC	NA	NA	NA	NA	NA
WP_023484516.1|1055793_1056447_+	ethanolamine utilization microcompartment protein EutL	NA	NA	NA	NA	NA
WP_077997006.1|1056458_1057199_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_077997007.1|1057349_1058813_+	acetaldehyde dehydrogenase (acetylating)	NA	NA	NA	NA	NA
WP_036655161.1|1058862_1059150_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_077997008.1|1059294_1060122_+	cobalamin adenosyltransferase	NA	NA	NA	NA	NA
WP_077997009.1|1060133_1060772_+	phosphate propanoyltransferase	NA	NA	NA	NA	NA
WP_024093587.1|1060790_1061474_+	putative ethanolamine utilization protein	NA	NA	NA	NA	NA
WP_036655159.1|1061486_1061759_+	EutN/CcmL family microcompartment protein	NA	NA	NA	NA	NA
WP_036655157.1|1061751_1062297_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_077997010.1|1062316_1063432_+	ethanolamine utilization protein EutH	NA	NA	NA	NA	NA
WP_077997011.1|1063770_1064622_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036655155.1|1066058_1066253_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077997012.1|1066586_1067054_+	hypothetical protein	NA	A0A0K2CP77	Brevibacillus_phage	30.5	3.5e-22
WP_144029556.1|1067979_1068282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997013.1|1068298_1068823_+	VanZ family protein	NA	NA	NA	NA	NA
WP_077997014.1|1068892_1069306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997015.1|1069578_1069881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997016.1|1070265_1070703_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_077997017.1|1071291_1072347_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	30.5	1.7e-16
WP_077997019.1|1072743_1073382_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_077997020.1|1073670_1074732_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_077997021.1|1074786_1075839_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_077997022.1|1076098_1076569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093604.1|1076631_1077009_+	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_077585253.1|1077055_1077202_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077585252.1|1077767_1078292_-	GNAT family N-acetyltransferase	NA	D0R097	Streptococcus_phage	28.3	1.0e-06
WP_077997023.1|1080615_1081914_+	alpha-glucosidase/alpha-galactosidase	NA	NA	NA	NA	NA
WP_036654509.1|1082009_1082693_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932657.1|1082713_1083583_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	99.6	1.1e-135
WP_077997024.1|1083704_1084670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155121039.1|1084830_1085010_+	hypothetical protein	NA	A0A2I7SCT0	Paenibacillus_phage	98.3	1.1e-29
WP_077997025.1|1085019_1085262_+|transposase	transposase	transposase	A0A2I7SCT4	Paenibacillus_phage	93.8	1.2e-31
>prophage 5
NZ_CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	1233169	1271627	4489122	protease,transposase,holin,integrase	Paenibacillus_phage(45.45%)	38	1247275:1247290	1273741:1273756
WP_077995375.1|1233169_1234393_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_077997111.1|1234576_1235773_+	MFS transporter	NA	NA	NA	NA	NA
WP_077997112.1|1236675_1237380_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_023483185.1|1237575_1238529_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A097BYJ7	Leuconostoc_phage	26.3	1.2e-05
WP_079940311.1|1240627_1241887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997115.1|1241927_1242491_-	signal peptidase I	NA	NA	NA	NA	NA
WP_077997116.1|1242690_1243611_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_104932660.1|1243836_1246047_-	SpoIID/LytB domain-containing protein	NA	Q2XU88	Pseudomonas_phage	25.5	3.5e-11
WP_023483179.1|1246532_1247447_+	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	45.5	1.8e-70
1247275:1247290	attL	AATTTCAAATGCTTTA	NA	NA	NA	NA
WP_024094971.1|1247473_1249042_+	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_077997118.1|1249266_1250190_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_077997119.1|1250375_1251371_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_077997652.1|1251717_1252230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997120.1|1252328_1252907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997121.1|1253059_1254493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997122.1|1254522_1255512_-	glycosyltransferase family 2 protein	NA	B9UDL7	Salmonella_phage	40.0	2.4e-49
WP_158672737.1|1255799_1256291_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_077997124.1|1256430_1257060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997125.1|1257056_1258115_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_077997126.1|1258171_1259110_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.0	7.8e-21
WP_077997127.1|1259102_1259882_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_079940308.1|1260069_1261419_+	hypothetical protein	NA	A0A0K2CP77	Brevibacillus_phage	35.1	3.1e-71
WP_155121036.1|1261422_1261563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997129.1|1261546_1261759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997130.1|1261849_1262377_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_158672738.1|1262818_1264777_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_077997133.1|1264769_1265912_+	amidohydrolase/deacetylase family metallohydrolase	NA	NA	NA	NA	NA
WP_024094960.1|1265890_1266253_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_023483163.1|1266292_1266649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158672739.1|1266652_1266991_+	DUF4312 family protein	NA	NA	NA	NA	NA
WP_036658006.1|1267011_1267797_+	DUF4311 domain-containing protein	NA	NA	NA	NA	NA
WP_079940306.1|1267799_1268465_+	DUF4310 family protein	NA	NA	NA	NA	NA
WP_023483159.1|1268506_1269613_+	DgaE family pyridoxal phosphate-dependent ammonia lyase	NA	NA	NA	NA	NA
WP_023483158.1|1269616_1270351_+	oxo-acid lyase	NA	NA	NA	NA	NA
WP_024094956.1|1270580_1270736_-|integrase	phage integrase family protein	integrase	A0A0K2CZ62	Paenibacillus_phage	88.2	4.5e-19
WP_077997135.1|1270749_1271082_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	78.3	1.0e-44
WP_149867773.1|1271103_1271295_-	hypothetical protein	NA	A0A0K2CZ62	Paenibacillus_phage	76.2	1.6e-21
WP_077584997.1|1271540_1271627_+|holin	putative holin-like toxin	holin	A0A0K2CZR6	Paenibacillus_phage	100.0	2.0e-05
1273741:1273756	attR	TAAAGCATTTGAAATT	NA	NA	NA	NA
>prophage 6
NZ_CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	1398546	1405301	4489122		Staphylococcus_phage(57.14%)	7	NA	NA
WP_023482600.1|1398546_1398984_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	45.3	1.6e-21
WP_036658391.1|1399928_1401041_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.5	1.2e-52
WP_023482602.1|1401044_1401710_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	43.3	3.4e-39
WP_077997196.1|1401744_1402977_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	51.3	5.6e-112
WP_024093718.1|1403008_1403479_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	57.9	6.2e-43
WP_077997197.1|1403908_1404691_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.3	1.3e-08
WP_036658393.1|1404659_1405301_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	31.9	8.2e-14
>prophage 7
NZ_CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	1519905	1585027	4489122	transposase	Paenibacillus_phage(42.86%)	50	NA	NA
WP_149867779.1|1519905_1520526_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024093806.1|1521355_1522168_+	exported lipase-like protein	NA	NA	NA	NA	NA
WP_023482722.1|1522215_1523193_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.4	4.0e-36
WP_036658426.1|1523185_1524178_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_077997249.1|1524205_1526179_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.4	4.9e-126
WP_036657935.1|1526240_1528700_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.0	7.3e-111
WP_077997250.1|1528764_1529601_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_077995397.1|1529776_1531000_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	4.0e-227
WP_079940555.1|1531133_1532135_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_077997251.1|1532179_1533112_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_077997252.1|1533131_1534280_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_077997253.1|1534297_1535221_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.0	5.1e-25
WP_158672745.1|1535252_1536008_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_077997255.1|1536620_1537013_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158672835.1|1537464_1537785_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_036658430.1|1538133_1538364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997257.1|1538360_1538891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093817.1|1539042_1539294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149867781.1|1539382_1539619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932666.1|1540725_1549122_+	glycosyl transferase family 36	NA	NA	NA	NA	NA
WP_079940556.1|1549351_1550059_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_079940557.1|1550075_1559186_+	hypothetical protein	NA	S5W9C6	Leptospira_phage	38.0	5.4e-10
WP_077997262.1|1559198_1559789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149867782.1|1560369_1560666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940559.1|1560960_1561656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997266.1|1561669_1562071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149867783.1|1562214_1562805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997268.1|1562801_1563332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158672746.1|1563390_1564251_+	hypothetical protein	NA	S5W9C6	Leptospira_phage	44.6	2.6e-07
WP_158672747.1|1564258_1564765_+	DUF2247 family protein	NA	NA	NA	NA	NA
WP_079940560.1|1565167_1565926_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_077995397.1|1565918_1567142_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	4.0e-227
WP_158672748.1|1567206_1568172_+	hypothetical protein	NA	S5W9C6	Leptospira_phage	41.5	1.1e-09
WP_079940561.1|1568242_1568869_+	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
WP_077997276.1|1568918_1569227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997277.1|1569204_1569531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997661.1|1569820_1570084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997279.1|1570096_1570402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995375.1|1570642_1571866_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_158672749.1|1571947_1572682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940562.1|1572700_1573393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158672750.1|1573432_1574476_+	RHS repeat-associated core domain-containing protein	NA	S5W9C6	Leptospira_phage	37.2	4.8e-11
WP_149867785.1|1577670_1577970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995375.1|1578326_1579550_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_077997286.1|1580150_1580555_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077997287.1|1580565_1581297_-	RNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_079940564.1|1581300_1582167_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_077997288.1|1582370_1583387_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_036654509.1|1583453_1584137_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932621.1|1584157_1585027_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
>prophage 8
NZ_CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	1604862	1660203	4489122	protease,transposase,bacteriocin	Paenibacillus_phage(50.0%)	42	NA	NA
WP_104932634.1|1604862_1605732_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_023482953.1|1605844_1606270_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_077997298.1|1606398_1607262_-	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_149867787.1|1607603_1608635_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_096761176.1|1608864_1609302_+	DUF2383 domain-containing protein	NA	NA	NA	NA	NA
WP_077997300.1|1609407_1609731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997664.1|1610611_1610851_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_079940567.1|1610957_1612721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997303.1|1612717_1613257_+	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_077997305.1|1613828_1614497_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	2.3e-14
WP_077997665.1|1614856_1616380_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_077997306.1|1616476_1617454_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_077997307.1|1617461_1618472_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_079940568.1|1618464_1619493_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_077997308.1|1619839_1621021_+	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	38.9	7.7e-26
WP_104932668.1|1621176_1622294_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	99.3	4.6e-153
WP_077997309.1|1622406_1623243_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077997310.1|1623305_1624181_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_079940569.1|1624328_1625546_-	cytochrome P450	NA	NA	NA	NA	NA
WP_079940570.1|1626008_1627889_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_042119509.1|1627975_1628245_-	DUF2642 domain-containing protein	NA	NA	NA	NA	NA
WP_079940571.1|1628664_1629465_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_077997313.1|1629587_1630694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940572.1|1631035_1634011_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_155121089.1|1634044_1634227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940574.1|1634288_1634468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940575.1|1635583_1636258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997318.1|1636790_1637513_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077997319.1|1638879_1639179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155121090.1|1639487_1639637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940576.1|1641076_1643158_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_079940577.1|1643996_1645037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997666.1|1645564_1646317_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_079940578.1|1646379_1647072_-	LrgB family protein	NA	NA	NA	NA	NA
WP_077997322.1|1647061_1647427_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_155121120.1|1647754_1648957_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_077997323.1|1649165_1650488_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_155121091.1|1650773_1650935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940580.1|1650994_1652287_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_079940821.1|1652328_1653915_+	malate synthase A	NA	NA	NA	NA	NA
WP_104932669.1|1654050_1657176_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_079940583.1|1657953_1660203_+|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
>prophage 9
NZ_CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	1664921	1700777	4489122	coat,transposase,integrase,tRNA	Cafeteria_roenbergensis_virus(14.29%)	28	1664435:1664449	1701694:1701708
1664435:1664449	attL	CTTTTAAGTAACCTC	NA	NA	NA	NA
WP_079940822.1|1664921_1665881_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
WP_023482840.1|1668504_1669467_+	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_023482839.1|1669564_1670134_+|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
WP_104932670.1|1670235_1671591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940586.1|1671714_1674396_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	22.1	3.8e-28
WP_079940587.1|1674426_1676475_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.0	3.5e-66
WP_036656949.1|1676595_1677375_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_077997333.1|1677362_1678325_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_077997334.1|1678402_1678642_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_024094598.1|1678790_1681223_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_079940823.1|1681433_1682081_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	48.8	5.4e-21
WP_077997337.1|1682131_1682518_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_052337439.1|1682707_1683409_+	YdcF family protein	NA	NA	NA	NA	NA
WP_023482829.1|1683450_1684452_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_024094593.1|1684578_1685568_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	45.5	3.4e-51
WP_042119655.1|1685605_1686883_+	GTPase HflX	NA	NA	NA	NA	NA
WP_024094591.1|1686925_1688176_+	aluminum resistance protein	NA	NA	NA	NA	NA
WP_023482825.1|1688346_1688754_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_104932671.1|1688787_1690122_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_023483571.1|1692976_1693351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155121093.1|1693311_1694103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158672751.1|1694168_1697525_+	hypothetical protein	NA	A0A1V0E026	Clostridioides_phage	38.0	8.2e-89
WP_077995249.1|1697757_1698978_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
WP_158672752.1|1699112_1699355_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_158672753.1|1699263_1699545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104935368.1|1699597_1699918_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077997348.1|1699962_1700289_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077997349.1|1700357_1700777_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2SXP1	Bacillus_phage	61.4	4.8e-39
1701694:1701708	attR	CTTTTAAGTAACCTC	NA	NA	NA	NA
>prophage 10
NZ_CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	1948434	1956918	4489122	transposase	Paenibacillus_phage(77.78%)	10	NA	NA
WP_077997474.1|1948434_1948959_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CZC9	Paenibacillus_phage	80.0	1.1e-45
WP_077584965.1|1949098_1949272_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CZS1	Paenibacillus_phage	91.3	2.9e-14
WP_079940630.1|1949472_1951548_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_036654509.1|1951871_1952555_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932621.1|1952575_1953445_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_079940631.1|1953696_1953879_+	hypothetical protein	NA	A0A0C5AEH5	Bacteriophage	89.7	9.7e-21
WP_158672763.1|1953875_1954244_+	hypothetical protein	NA	A0A2I7SC06	Paenibacillus_phage	86.9	4.5e-49
WP_077995249.1|1954342_1955563_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
WP_077997680.1|1956254_1956458_-	hypothetical protein	NA	A0A0C5AEJ6	Paenibacillus_phage	89.6	2.7e-27
WP_077997477.1|1956474_1956918_-	hypothetical protein	NA	A0A0K2CZD8	Paenibacillus_phage	56.6	1.7e-42
>prophage 11
NZ_CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	1983230	2041047	4489122	tail,holin,terminase,capsid,integrase,portal	Paenibacillus_phage(91.43%)	86	1975490:1975521	2036171:2036202
1975490:1975521	attL	TTTTAATTTTCCGTTCCCCTCGTGTTGTTATC	NA	NA	NA	NA
WP_079940638.1|1983230_1984454_-|integrase	site-specific integrase	integrase	A0A0C5AN64	Paenibacillus_phage	86.0	9.3e-200
WP_079940639.1|1984479_1985178_-	LexA family transcriptional regulator	NA	A0A2I7SCV6	Paenibacillus_phage	46.0	2.1e-47
WP_079940640.1|1985314_1985515_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J3K6	uncultured_Caudovirales_phage	44.1	1.6e-08
WP_079940641.1|1985580_1985808_+	excisionase family DNA-binding protein	NA	A0A0C5AN65	Paenibacillus_phage	77.1	9.0e-24
WP_155121099.1|1985833_1986247_+	hypothetical protein	NA	A0A0N9SSV8	Paenibacillus_phage	60.0	2.5e-24
WP_079940643.1|1986226_1986535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940644.1|1986654_1987293_+	hypothetical protein	NA	A0A0N9RZD8	Paenibacillus_phage	99.1	6.5e-128
WP_079940645.1|1987315_1988110_+	phage antirepressor KilAC domain-containing protein	NA	A0A0N9SJU0	Paenibacillus_phage	87.3	2.0e-126
WP_155121100.1|1988106_1988283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155121101.1|1988279_1988453_+	hypothetical protein	NA	A0A0N9SIN5	Paenibacillus_phage	91.2	1.6e-20
WP_077995167.1|1988449_1988752_+	hypothetical protein	NA	A0A0N9S7X2	Paenibacillus_phage	96.0	3.5e-47
WP_077995168.1|1988767_1989094_+	helix-turn-helix domain-containing protein	NA	A0A0N7GFE9	Paenibacillus_phage	94.4	6.6e-52
WP_149867651.1|1989229_1989721_+	hypothetical protein	NA	A0A0N9SJV6	Paenibacillus_phage	44.4	1.3e-19
WP_079940646.1|1989778_1990150_+	hypothetical protein	NA	A0A0N9SHL8	Paenibacillus_phage	92.7	3.4e-60
WP_040932746.1|1990133_1990511_+	hypothetical protein	NA	A0A0N9SSX1	Paenibacillus_phage	84.8	1.9e-55
WP_040932748.1|1990529_1990796_+	hypothetical protein	NA	A0A0N9RRC8	Paenibacillus_phage	84.1	3.7e-37
WP_077995171.1|1990803_1991574_+	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	94.9	2.5e-142
WP_077995172.1|1991570_1992947_+	AAA family ATPase	NA	A0A0N9SIP5	Paenibacillus_phage	84.5	2.3e-223
WP_079940647.1|1992959_1993910_+	toprim domain-containing protein	NA	A0A0N9S7Y2	Paenibacillus_phage	82.9	1.5e-152
WP_077995175.1|1993969_1994548_+	hypothetical protein	NA	A0A0N9SGJ9	Paenibacillus_phage	55.2	7.6e-51
WP_077995176.1|1994613_1995141_+	hypothetical protein	NA	A0A0N9RTM1	Paenibacillus_phage	93.7	8.4e-81
WP_077995177.1|1995225_1995948_+	hypothetical protein	NA	A0A0N9SJW5	Paenibacillus_phage	90.2	9.3e-123
WP_077995178.1|1996123_1996465_+	hypothetical protein	NA	A0A7H5	Microcystis_virus	43.5	4.7e-08
WP_077995179.1|1996609_1997023_+	hypothetical protein	NA	A0A0N9RZF9	Paenibacillus_phage	96.4	5.0e-73
WP_079940648.1|1997234_1997831_+	hypothetical protein	NA	A0A0N9SIQ5	Paenibacillus_phage	67.8	1.3e-61
WP_079940828.1|1997996_1999628_+	DNA polymerase I	NA	A0A0N9S7Z3	Paenibacillus_phage	94.3	2.9e-305
WP_149867652.1|1999596_1999947_+	hypothetical protein	NA	A0A0N9SGL0	Paenibacillus_phage	60.7	1.8e-31
WP_077995183.1|1999940_2001068_+	hypothetical protein	NA	A0A0N9RTM8	Paenibacillus_phage	79.4	4.6e-177
WP_077995184.1|2001068_2001266_+	hypothetical protein	NA	A0A0N7GFF2	Paenibacillus_phage	95.4	4.7e-29
WP_077995185.1|2001262_2001877_+	3'-5' exonuclease	NA	A0A0N9SJX9	Paenibacillus_phage	96.1	2.8e-104
WP_077995186.1|2001861_2002881_+	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	81.1	4.6e-136
WP_158672766.1|2003137_2003389_+	hypothetical protein	NA	A0A0N9ST03	Paenibacillus_phage	85.5	3.2e-30
WP_077995188.1|2003385_2003568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995189.1|2003533_2005852_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0Y0AS84	Bacillus_phage	63.4	1.3e-279
WP_077995190.1|2005865_2006897_+	ribonucleotide-diphosphate reductase subunit beta	NA	U5Q1G6	Bacillus_phage	61.2	1.9e-121
WP_079940649.1|2006908_2007436_+	dUTP diphosphatase	NA	D2XR49	Bacillus_phage	54.3	1.9e-40
WP_077995192.1|2007428_2007725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995193.1|2007721_2008060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040930425.1|2008060_2008387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995194.1|2008528_2008729_+	hypothetical protein	NA	A0A0N7GFF3	Paenibacillus_phage	95.2	1.1e-28
WP_077995195.1|2008725_2008956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995196.1|2008957_2009275_+	hypothetical protein	NA	A0A0N9S804	Paenibacillus_phage	87.6	1.6e-50
WP_077995197.1|2009268_2009739_+	DUF4065 domain-containing protein	NA	A0A0N9SGM1	Paenibacillus_phage	86.8	3.2e-76
WP_077995198.1|2009735_2010104_+	DUF5406 family protein	NA	NA	NA	NA	NA
WP_077995199.1|2010147_2011227_+	hypothetical protein	NA	A0A0N9RTN7	Paenibacillus_phage	51.7	3.6e-62
WP_079940650.1|2011210_2011771_+	AAA family ATPase	NA	A0A0N9SJZ0	Paenibacillus_phage	85.8	1.6e-85
WP_155121102.1|2011727_2011982_-	hypothetical protein	NA	A0A0N9SHP7	Paenibacillus_phage	76.2	9.7e-35
WP_079940652.1|2012189_2012597_+	DUF134 domain-containing protein	NA	A0A0N9RZI0	Paenibacillus_phage	88.1	2.0e-58
WP_077995202.1|2012586_2013039_+	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	77.3	4.5e-59
WP_079940653.1|2013960_2014206_+	hypothetical protein	NA	A0A0N9SIR9	Paenibacillus_phage	97.8	4.5e-13
WP_079940829.1|2014198_2015029_+	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	97.8	2.6e-153
WP_077995205.1|2015371_2015566_+	hypothetical protein	NA	A0A0N9RTP7	Paenibacillus_phage	86.2	1.4e-06
WP_077995206.1|2015587_2016007_+	hypothetical protein	NA	A0A0N9SJZ8	Paenibacillus_phage	92.8	4.8e-71
WP_024094642.1|2015996_2016395_+	helix-turn-helix domain-containing protein	NA	A0A0N7GFF5	Paenibacillus_phage	99.2	7.5e-66
WP_155121103.1|2017316_2017481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155121104.1|2017584_2017761_+	hypothetical protein	NA	A0A0N9SSS1	Paenibacillus_phage	94.8	2.2e-17
WP_079940654.1|2018026_2018326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997491.1|2018538_2020224_+|terminase	phage terminase large subunit	terminase	A0A0N9RZA7	Paenibacillus_phage	97.6	5.8e-301
WP_077995210.1|2020247_2021732_+|portal	phage portal protein	portal	A0A0N7GFE4	Paenibacillus_phage	92.1	5.7e-244
WP_077995211.1|2021728_2022589_+|capsid	minor capsid protein	capsid	A0A0N9SJR1	Paenibacillus_phage	93.4	1.6e-145
WP_079940655.1|2022680_2023316_+	hypothetical protein	NA	A0A0N9SIL0	Paenibacillus_phage	74.4	3.0e-61
WP_077995214.1|2023371_2024307_+	hypothetical protein	NA	A0A0N9S7T7	Paenibacillus_phage	94.9	2.7e-167
WP_079940656.1|2024321_2024705_+	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	95.3	9.7e-63
WP_077995215.1|2024705_2025038_+	hypothetical protein	NA	A0A0N9RTI3	Paenibacillus_phage	96.4	1.7e-55
WP_077995216.1|2025034_2025460_+	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	92.2	3.5e-69
WP_077995217.1|2025456_2025831_+	hypothetical protein	NA	A0A0N7GFE5	Paenibacillus_phage	94.4	4.7e-62
WP_077995218.1|2025843_2026392_+	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	95.1	2.9e-92
WP_079940657.1|2026442_2026820_+	hypothetical protein	NA	A0A0N9SST2	Paenibacillus_phage	92.0	5.1e-56
WP_155121105.1|2026999_2027170_+	hypothetical protein	NA	A0A0N9RZB8	Paenibacillus_phage	74.5	2.8e-14
WP_079940658.1|2027197_2030092_+|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	56.2	5.2e-249
WP_077995224.1|2030091_2031549_+|tail	phage tail family protein	tail	A0A0N9RRA9	Paenibacillus_phage	94.8	1.3e-277
WP_158672767.1|2031551_2033873_+	hypothetical protein	NA	A0A0N9SIL8	Paenibacillus_phage	97.5	0.0e+00
WP_158672768.1|2033869_2034307_+	hypothetical protein	NA	A0A0N9S7V6	Paenibacillus_phage	90.3	1.1e-67
WP_077995228.1|2034294_2034711_+|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	97.1	2.9e-68
WP_077995229.1|2034703_2035573_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	95.2	1.6e-161
WP_077995230.1|2035860_2036154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995231.1|2036292_2036505_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
2036171:2036202	attR	TTTTAATTTTCCGTTCCCCTCGTGTTGTTATC	NA	NA	NA	NA
WP_077995232.1|2036507_2036891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995233.1|2036896_2037133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995234.1|2037578_2037941_-	hypothetical protein	NA	A0A142F168	Bacillus_phage	46.7	7.6e-17
WP_077995235.1|2038414_2038594_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_155121106.1|2038605_2038974_-	hypothetical protein	NA	A0A2I7SCF4	Paenibacillus_phage	83.2	2.6e-52
WP_077995236.1|2038976_2039327_-	hypothetical protein	NA	A0A2I7SCF2	Paenibacillus_phage	87.1	4.6e-51
WP_040931863.1|2039371_2039797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995237.1|2039961_2040588_-	hypothetical protein	NA	A0A0N9SJT2	Paenibacillus_phage	62.4	2.5e-39
WP_079940660.1|2040660_2041047_-	hypothetical protein	NA	A0A0N9SIM5	Paenibacillus_phage	94.5	3.4e-63
>prophage 12
NZ_CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	2318178	2380121	4489122	protease,transposase,bacteriocin	Paenibacillus_phage(55.0%)	53	NA	NA
WP_158672772.1|2318178_2318643_-|protease	trypsin-like serine protease	protease	W5SAB9	Pithovirus	41.1	3.4e-09
WP_155121112.1|2318686_2318848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940833.1|2318972_2320145_+	MFS transporter	NA	NA	NA	NA	NA
WP_077995360.1|2320167_2320926_-	TrmB family transcriptional regulator	NA	NA	NA	NA	NA
WP_079940834.1|2321104_2321836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940693.1|2321864_2323331_+	antitoxin	NA	NA	NA	NA	NA
WP_079940835.1|2323415_2323979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094102.1|2324103_2325000_-	cation transporter	NA	NA	NA	NA	NA
WP_024094104.1|2325983_2326352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995363.1|2326542_2327277_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_023484542.1|2327332_2328118_-	delta-lactam-biosynthetic de-N-acetylase	NA	NA	NA	NA	NA
WP_079940695.1|2328231_2329749_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_104932805.1|2329828_2330845_-	amidase domain-containing protein	NA	NA	NA	NA	NA
WP_023484539.1|2331421_2331694_-	ribonuclease inhibitor-like protein	NA	NA	NA	NA	NA
WP_104932703.1|2331714_2332134_-	ribonuclease	NA	NA	NA	NA	NA
WP_077995368.1|2332656_2334087_-	MBL fold metallo-hydrolase	NA	A0A2N9QVZ6	Dishui_lake_phycodnavirus	36.6	1.3e-06
WP_077995369.1|2334161_2335361_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_077995370.1|2335843_2336074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158672773.1|2336337_2337396_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_024094116.1|2337510_2338527_+	NTP transferase domain-containing protein	NA	K7QKA7	Escherichia_phage	33.5	8.7e-26
WP_104932488.1|2339470_2339698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484729.1|2339786_2340560_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_077995376.1|2340900_2341431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104932704.1|2341810_2344237_-	penicillin acylase family protein	NA	NA	NA	NA	NA
WP_036656619.1|2344730_2345522_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_079940699.1|2345557_2346238_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_077995379.1|2346242_2347775_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_079940700.1|2348148_2349267_-	UDP-glucuronosyltransferase	NA	NA	NA	NA	NA
WP_023484737.1|2349443_2350271_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_079940701.1|2350717_2352280_-	gluconokinase	NA	NA	NA	NA	NA
WP_042118974.1|2352314_2353676_-	GntP family permease	NA	NA	NA	NA	NA
WP_024094123.1|2353786_2354464_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023484741.1|2355639_2355957_-	DUF4870 domain-containing protein	NA	A0A2H4JDX0	uncultured_Caudovirales_phage	45.0	3.4e-13
WP_077995381.1|2356545_2356857_-	DUF4870 domain-containing protein	NA	A0A2H4J741	uncultured_Caudovirales_phage	45.9	1.4e-11
WP_104932806.1|2357306_2358352_-|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	20.9	7.9e-06
WP_077995382.1|2358827_2359019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995383.1|2359671_2360061_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_077995384.1|2360549_2363105_-	hypothetical protein	NA	A0A0K2CYN4	Paenibacillus_phage	56.1	1.9e-258
WP_077997499.1|2363358_2363778_+	DUF4064 domain-containing protein	NA	A0A0K2CZQ0	Paenibacillus_phage	100.0	5.7e-24
WP_079940702.1|2364070_2366704_-	hypothetical protein	NA	A0A0K2CYN4	Paenibacillus_phage	47.7	3.1e-232
WP_077995388.1|2368253_2369195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997500.1|2370002_2370221_-	helix-turn-helix transcriptional regulator	NA	A0A2I7SC05	Paenibacillus_phage	50.0	4.0e-13
WP_079940703.1|2370679_2370871_+	hypothetical protein	NA	A0A0K2CZ26	Paenibacillus_phage	94.7	3.4e-24
WP_036654824.1|2370867_2371140_+	hypothetical protein	NA	A0A0C5AEQ9	Bacteriophage	100.0	3.9e-42
WP_077995391.1|2371143_2371356_+	hypothetical protein	NA	A0A2I7SC04	Paenibacillus_phage	97.0	1.3e-29
WP_077995392.1|2371707_2372256_-	hypothetical protein	NA	A0A0C5AEH5	Bacteriophage	85.8	9.9e-77
WP_104932621.1|2372507_2373377_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_036654509.1|2373397_2374081_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_079940836.1|2374338_2374521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036654509.1|2374751_2375435_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932621.1|2375455_2376325_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_077995401.1|2378190_2378463_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	R9W0N4	Paenibacillus_phage	93.3	4.5e-30
WP_077995402.1|2378666_2380121_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.9	2.2e-123
>prophage 13
NZ_CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	2642346	2696343	4489122	tRNA,protease,transposase,integrase	Paenibacillus_phage(34.78%)	58	2681255:2681270	2696824:2696839
WP_042119028.1|2642346_2643741_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	27.6	3.8e-40
WP_036653992.1|2643910_2644453_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_077997509.1|2644631_2645960_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_023484649.1|2645972_2648063_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	40.9	1.8e-110
WP_077995507.1|2648210_2649320_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	40.4	3.7e-38
WP_077995508.1|2649423_2650359_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_077995509.1|2650415_2651576_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_024094298.1|2651964_2652225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094299.1|2652256_2652652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997510.1|2652866_2654390_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_024094301.1|2654487_2654892_-	YraN family protein	NA	NA	NA	NA	NA
WP_023484363.1|2654901_2655234_-	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_104932713.1|2655230_2657042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484361.1|2657096_2657780_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	37.7	5.7e-21
WP_077995513.1|2658072_2658954_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_077995514.1|2659062_2659647_-	signal peptidase I	NA	NA	NA	NA	NA
WP_023484358.1|2659758_2660100_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_024094305.1|2660242_2660995_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_077995515.1|2660991_2661513_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_023484355.1|2661738_2661969_-	KH domain-containing protein	NA	NA	NA	NA	NA
WP_023484354.1|2661991_2662264_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_023484353.1|2662305_2663673_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_024094307.1|2663702_2664065_-	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_077995516.1|2664198_2665206_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_023484350.1|2665290_2668869_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_077997511.1|2669037_2669739_-	ribonuclease III	NA	A0A167RGU4	Powai_lake_megavirus	29.6	2.1e-26
WP_024094309.1|2669918_2671154_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_024094310.1|2671243_2671477_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	38.0	6.0e-07
WP_024094311.1|2671595_2672336_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	36.4	5.0e-23
WP_023484345.1|2672435_2673371_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_077995517.1|2673402_2674389_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_024094313.1|2674399_2675386_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_077584878.1|2675387_2675978_-	transcription factor FapR	NA	NA	NA	NA	NA
WP_023484341.1|2676153_2676327_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_077995518.1|2676445_2676958_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_036658730.1|2677045_2678119_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_023484339.1|2678303_2679653_+	spore cortex formation factor-like protein	NA	NA	NA	NA	NA
WP_023484338.1|2679663_2680173_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	39.5	2.0e-26
WP_023484337.1|2680190_2680748_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
2681255:2681270	attL	TTATTTTGCACAAAAA	NA	NA	NA	NA
WP_024094320.1|2681297_2681495_-	helix-turn-helix transcriptional regulator	NA	D0R7I7	Paenibacillus_phage	76.9	2.4e-09
WP_024094321.1|2681559_2681973_+	hypothetical protein	NA	A0A0K2CYM1	Paenibacillus_phage	98.6	8.7e-33
WP_024094322.1|2682120_2682510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995520.1|2683291_2683429_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_079940765.1|2683609_2684941_-	chitin-binding protein	NA	A0A2D1GD28	Mycobacterium_phage	29.3	4.1e-07
WP_104932807.1|2685387_2686432_+|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	20.9	6.0e-06
WP_077995522.1|2686497_2686740_-|transposase	transposase	transposase	A0A2I7SCT4	Paenibacillus_phage	98.8	8.6e-33
WP_077585229.1|2686749_2687418_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0K2CXQ8	Paenibacillus_phage	95.9	4.0e-128
WP_024094328.1|2687417_2687657_-	hypothetical protein	NA	A0A0C5AEG8	Bacteriophage	100.0	2.8e-36
WP_104932714.1|2688069_2689285_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	28.7	6.6e-12
WP_077995527.1|2690628_2690979_-	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	60.9	5.8e-30
WP_077995375.1|2691028_2692252_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_158672787.1|2692632_2692923_-	hypothetical protein	NA	A0A0C5AFG5	Paenibacillus_phage	79.8	6.5e-35
WP_077995529.1|2693062_2693578_+	DUF3231 family protein	NA	NA	NA	NA	NA
WP_042119037.1|2693660_2693864_-	hypothetical protein	NA	A0A0S2SXP3	Bacillus_phage	40.0	6.8e-07
WP_158672788.1|2694459_2694684_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158672838.1|2694947_2695541_+	hypothetical protein	NA	R9VW28	Paenibacillus_phage	44.2	4.0e-39
WP_158672789.1|2695560_2696118_+|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	40.4	3.0e-28
WP_158672790.1|2696127_2696343_+|integrase	tyrosine-type recombinase/integrase	integrase	S5MNZ2	Brevibacillus_phage	71.6	3.3e-20
2696824:2696839	attR	TTATTTTGCACAAAAA	NA	NA	NA	NA
>prophage 14
NZ_CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	2790520	2826307	4489122	tail,terminase,capsid,bacteriocin,plate,transposase,portal	Brevibacillus_phage(57.69%)	40	NA	NA
WP_149867691.1|2790520_2790622_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_077997514.1|2791082_2791367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995568.1|2791347_2792760_-	NADP-dependent phosphogluconate dehydrogenase	NA	E3SJC4	Synechococcus_phage	29.4	3.0e-32
WP_104932718.1|2793440_2793680_-	hypothetical protein	NA	A0A0K2CYG5	Paenibacillus_phage	64.9	1.5e-21
WP_104932719.1|2794343_2795603_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_104932720.1|2796288_2796780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104932721.1|2797481_2798471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940233.1|2798440_2799313_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_079940235.1|2799711_2800194_-	SocA family protein	NA	A0A0N9SGM1	Paenibacillus_phage	41.3	1.2e-25
WP_079940237.1|2801395_2803114_-	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_079940238.1|2803104_2803332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940239.1|2803318_2804302_-	SMEK domain-containing protein	NA	NA	NA	NA	NA
WP_079940787.1|2804733_2805369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940240.1|2805403_2806120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940241.1|2806255_2806498_-|transposase	transposase	transposase	A0A2I7SCT4	Paenibacillus_phage	96.2	7.3e-32
WP_036655918.1|2807461_2807698_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	R9W0N4	Paenibacillus_phage	98.6	6.0e-31
WP_077996661.1|2808011_2808302_-	hypothetical protein	NA	E2ELK3	Clostridium_phage	50.5	1.5e-18
WP_077996660.1|2808313_2808904_-	hypothetical protein	NA	S5MNY5	Brevibacillus_phage	24.9	1.1e-12
WP_079940243.1|2808907_2809186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104932808.1|2809182_2809746_-	DUF2313 domain-containing protein	NA	S5MA71	Brevibacillus_phage	46.4	5.7e-35
WP_079940245.1|2809756_2810833_-|plate	baseplate J/gp47 family protein	plate	A0A0K2CP27	Brevibacillus_phage	53.3	1.2e-102
WP_079940246.1|2810825_2811236_-	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	50.0	1.2e-29
WP_079940247.1|2811238_2811481_-	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	47.6	3.1e-14
WP_079940248.1|2811480_2812464_-	hypothetical protein	NA	S5MA66	Brevibacillus_phage	55.9	2.6e-104
WP_079940249.1|2812468_2813107_-	LysM peptidoglycan-binding domain-containing protein	NA	S5MUH0	Brevibacillus_phage	49.5	2.2e-51
WP_079940250.1|2813103_2815221_-	hypothetical protein	NA	A0A0K2CP22	Brevibacillus_phage	42.3	1.2e-141
WP_023485206.1|2815444_2815870_-	hypothetical protein	NA	X5JAB6	Clostridium_phage	44.8	1.6e-26
WP_079940251.1|2815896_2816361_-|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	62.7	7.2e-52
WP_158672793.1|2817696_2817864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940253.1|2817856_2818267_-	hypothetical protein	NA	S5MUN8	Brevibacillus_phage	45.2	2.3e-25
WP_079940789.1|2818674_2818995_-	ABC transporter ATP-binding protein	NA	S5M673	Brevibacillus_phage	57.5	6.5e-28
WP_079940255.1|2819035_2819407_-	DNA-packaging protein	NA	S5MP25	Brevibacillus_phage	60.5	1.3e-32
WP_079940256.1|2819432_2819690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940257.1|2819701_2820745_-|capsid	phage capsid protein	capsid	A0A0K2CP76	Brevibacillus_phage	87.0	1.1e-172
WP_079940790.1|2820760_2821120_-	hypothetical protein	NA	A0A0K2CNR0	Brevibacillus_phage	73.0	3.6e-43
WP_079940258.1|2821132_2821756_-	hypothetical protein	NA	A0A0K2CP96	Brevibacillus_phage	68.9	2.4e-71
WP_079940259.1|2821799_2822819_-|capsid	minor capsid protein	capsid	S5MTV5	Brevibacillus_phage	53.8	2.6e-102
WP_104932722.1|2822815_2824288_-|portal	phage portal protein	portal	A0A0K2CNK4	Brevibacillus_phage	62.0	3.5e-169
WP_079940260.1|2824302_2825574_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	66.0	1.3e-164
WP_079940261.1|2825566_2826307_-	hypothetical protein	NA	A0A2H4J4R0	uncultured_Caudovirales_phage	48.4	2.1e-45
>prophage 15
NZ_CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	2829317	2845582	4489122	integrase	Paenibacillus_phage(76.92%)	32	2842279:2842292	2851407:2851420
WP_079940266.1|2829317_2829530_-	DUF2829 domain-containing protein	NA	A0A1C8E971	Bacillus_phage	87.0	7.8e-30
WP_079940267.1|2829590_2829941_-	hypothetical protein	NA	A0A0K2CZA6	Paenibacillus_phage	88.8	6.2e-56
WP_155121032.1|2829961_2830135_-	hypothetical protein	NA	A0A0K2CZI7	Paenibacillus_phage	77.2	8.1e-17
WP_079940268.1|2830353_2830557_-	hypothetical protein	NA	A0A0K2CZA1	Paenibacillus_phage	86.6	1.9e-25
WP_104932809.1|2830690_2831146_-	transcriptional regulator	NA	A0A0C5AC66	Paenibacillus_phage	73.0	5.8e-54
WP_104932723.1|2831296_2831629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104932724.1|2831621_2832029_-	hypothetical protein	NA	A8ASP1	Listeria_phage	39.6	4.9e-12
WP_104932725.1|2832035_2832260_-	hypothetical protein	NA	A0A0K2CYJ4	Paenibacillus_phage	94.4	1.2e-31
WP_036654579.1|2832266_2832545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158672794.1|2832596_2832740_-	hypothetical protein	NA	R9W0Q6	Paenibacillus_phage	80.0	4.5e-13
WP_104932810.1|2832755_2833451_-	dUTPase	NA	A0A1L2JY27	Aeribacillus_phage	39.1	4.7e-31
WP_104932726.1|2833571_2834672_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CZU8	Paenibacillus_phage	79.5	1.4e-159
WP_104932727.1|2834876_2835251_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0K2CYQ8	Paenibacillus_phage	67.5	2.6e-44
WP_104932728.1|2835252_2835462_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	86.8	1.7e-29
WP_104932729.1|2835580_2836402_-	ATP-binding protein	NA	A0A0K2CYM7	Paenibacillus_phage	98.6	4.9e-120
WP_077996825.1|2836292_2837183_-	DnaD domain protein	NA	A0A0K2CY85	Paenibacillus_phage	86.5	2.7e-124
WP_077996824.1|2837231_2837564_-	hypothetical protein	NA	A0A0K2CY25	Paenibacillus_phage	92.7	1.6e-53
WP_077996823.1|2837588_2837990_-	single-stranded DNA-binding protein	NA	A0A0K2CYR2	Paenibacillus_phage	73.5	3.9e-46
WP_077996822.1|2838039_2838843_-	hypothetical protein	NA	A0A0P0IZH9	Lactobacillus_phage	40.0	5.4e-47
WP_155121034.1|2839784_2839952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996820.1|2840130_2840394_-	hypothetical protein	NA	A0A0C5AFB6	Paenibacillus_phage	70.1	5.7e-30
WP_077996819.1|2840408_2841086_-	hypothetical protein	NA	A0A2I7SCV5	Paenibacillus_phage	84.5	1.8e-59
WP_077996818.1|2841082_2841271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158672717.1|2841275_2841446_-	hypothetical protein	NA	A0A0K2CZS8	Paenibacillus_phage	92.0	8.2e-22
WP_077996817.1|2841442_2841667_-	hypothetical protein	NA	A0A0K2CZE0	Paenibacillus_phage	72.5	7.8e-20
WP_104932730.1|2841663_2842035_-	hypothetical protein	NA	R9VW30	Paenibacillus_phage	90.0	3.2e-55
WP_104932731.1|2842027_2842315_-	hypothetical protein	NA	NA	NA	NA	NA
2842279:2842292	attL	TCGTAATGTTCATT	NA	NA	NA	NA
WP_104932732.1|2842330_2842621_-	helix-turn-helix domain-containing protein	NA	A0A0K2CZS5	Paenibacillus_phage	84.2	1.9e-39
WP_104932733.1|2842617_2843358_-	phage antirepressor Ant	NA	A0A0C5AFE7	Paenibacillus_phage	96.3	2.9e-132
WP_104932734.1|2843354_2843624_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_104932735.1|2843850_2844270_+	helix-turn-helix domain-containing protein	NA	Q786F1	Bacillus_phage	49.4	3.4e-16
WP_104932736.1|2844352_2845582_+|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	54.6	1.6e-119
2851407:2851420	attR	AATGAACATTACGA	NA	NA	NA	NA
>prophage 16
NZ_CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	2900556	2911682	4489122	integrase	Paenibacillus_phage(61.54%)	15	2908404:2908417	2913364:2913377
WP_079940192.1|2900556_2901930_-	family 10 glycosylhydrolase	NA	A0A2I7SC76	Paenibacillus_phage	88.5	4.8e-27
WP_079940193.1|2902639_2902972_-	hypothetical protein	NA	A0A2I7SCG0	Paenibacillus_phage	90.5	8.5e-31
WP_077995599.1|2903121_2903511_+	hypothetical protein	NA	A0A0K2CZD8	Paenibacillus_phage	50.7	1.3e-06
WP_024094459.1|2903700_2903904_+	hypothetical protein	NA	A0A0C5AEJ6	Paenibacillus_phage	88.1	5.0e-26
WP_077995601.1|2904528_2905173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995602.1|2905787_2905991_+	hypothetical protein	NA	A0A0K2CYF6	Paenibacillus_phage	60.0	5.8e-06
WP_024094463.1|2906059_2906281_-	helix-turn-helix transcriptional regulator	NA	A0A0E3U244	Fusobacterium_phage	44.4	3.8e-11
WP_077995603.1|2906379_2906571_+	hypothetical protein	NA	A0A2I7SC25	Paenibacillus_phage	100.0	4.4e-24
WP_155121024.1|2906574_2906727_+	hypothetical protein	NA	A0A2I7SC04	Paenibacillus_phage	81.2	2.3e-07
WP_079940195.1|2907141_2907633_-	hypothetical protein	NA	A0A0C5AEH5	Bacteriophage	90.9	1.7e-72
WP_079940196.1|2908022_2908523_-	hypothetical protein	NA	R9VWV6	Paenibacillus_phage	31.7	7.1e-05
2908404:2908417	attL	GTGGTTACTTTCAA	NA	NA	NA	NA
WP_077995606.1|2909102_2909285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995607.1|2909580_2909991_+	helix-turn-helix transcriptional regulator	NA	F8J1E0	Lactobacillus_phage	39.8	2.3e-09
WP_077995608.1|2910022_2910439_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2P1JU12	Anoxybacillus_phage	37.0	4.6e-18
WP_079940197.1|2910560_2911682_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	45.3	4.4e-87
2913364:2913377	attR	TTGAAAGTAACCAC	NA	NA	NA	NA
>prophage 17
NZ_CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	3210243	3310831	4489122	tail,terminase,bacteriocin,capsid,integrase,tRNA,plate,protease,transposase,portal	Paenibacillus_phage(43.33%)	118	3250371:3250388	3307375:3307392
WP_024094745.1|3210243_3211380_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.4	5.2e-88
WP_077995745.1|3211385_3212480_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_023482764.1|3212589_3213594_-	Holliday junction branch migration DNA helicase RuvB	NA	NA	NA	NA	NA
WP_024094746.1|3213621_3214242_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_024094747.1|3214238_3214742_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_036657674.1|3214896_3215574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023482986.1|3217945_3218824_-	branched-chain-amino-acid transaminase	NA	NA	NA	NA	NA
WP_077995747.1|3218842_3219709_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_104932745.1|3219705_3220671_-	homoserine kinase	NA	NA	NA	NA	NA
WP_077995748.1|3220740_3221805_-	threonine synthase	NA	NA	NA	NA	NA
WP_079940225.1|3221829_3223116_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_042119159.1|3223140_3223623_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_077995749.1|3223828_3224335_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_104932746.1|3224408_3225779_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_077995750.1|3225817_3227119_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_077995751.1|3227128_3227893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094757.1|3228111_3228423_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_077995752.1|3228428_3228776_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_023482975.1|3228791_3229103_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_023482973.1|3230011_3230887_-|protease	membrane metalloprotease-like protein	protease	NA	NA	NA	NA
WP_077995754.1|3230879_3231794_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_079940228.1|3231922_3233095_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_023482970.1|3233107_3233902_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_023482969.1|3233999_3234638_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_077995755.1|3234707_3235238_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_023482967.1|3235237_3236095_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_024094763.1|3236137_3237169_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_024094764.1|3237235_3237925_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_024094765.1|3238410_3238842_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_077995756.1|3238922_3239519_-	septum formation protein Maf	NA	NA	NA	NA	NA
WP_077995757.1|3239588_3239831_-	DUF4321 domain-containing protein	NA	NA	NA	NA	NA
WP_077997528.1|3240081_3241224_+	hypothetical protein	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	35.5	2.9e-22
WP_024094768.1|3241324_3242614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995759.1|3242736_3244125_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_023484266.1|3244132_3245506_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_079940786.1|3245576_3248243_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	41.4	4.1e-168
WP_077995760.1|3249035_3250187_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
3250371:3250388	attL	TCCCCCGTGATAGGGTGA	NA	NA	NA	NA
WP_079940229.1|3250596_3250836_-	hypothetical protein	NA	A0A0K2CYG5	Paenibacillus_phage	66.7	1.3e-20
WP_079940230.1|3251450_3251789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932747.1|3251927_3254498_-	hypothetical protein	NA	A0A0K2CYN4	Paenibacillus_phage	51.8	3.5e-233
WP_079940232.1|3256740_3257730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940233.1|3257699_3258572_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_079940235.1|3258970_3259453_-	SocA family protein	NA	A0A0N9SGM1	Paenibacillus_phage	41.3	1.2e-25
WP_079940237.1|3260654_3262373_-	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_079940238.1|3262363_3262591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940239.1|3262577_3263561_-	SMEK domain-containing protein	NA	NA	NA	NA	NA
WP_104932657.1|3263983_3264853_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	99.6	1.1e-135
WP_036654509.1|3264873_3265557_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_079940787.1|3265717_3266353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940240.1|3266387_3267104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940241.1|3267239_3267482_-|transposase	transposase	transposase	A0A2I7SCT4	Paenibacillus_phage	96.2	7.3e-32
WP_036655918.1|3268445_3268682_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	R9W0N4	Paenibacillus_phage	98.6	6.0e-31
WP_077996661.1|3268995_3269286_-	hypothetical protein	NA	E2ELK3	Clostridium_phage	50.5	1.5e-18
WP_077996660.1|3269297_3269888_-	hypothetical protein	NA	S5MNY5	Brevibacillus_phage	24.9	1.1e-12
WP_079940243.1|3269891_3270170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104932808.1|3270166_3270730_-	DUF2313 domain-containing protein	NA	S5MA71	Brevibacillus_phage	46.4	5.7e-35
WP_079940245.1|3270740_3271817_-|plate	baseplate J/gp47 family protein	plate	A0A0K2CP27	Brevibacillus_phage	53.3	1.2e-102
WP_079940246.1|3271809_3272220_-	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	50.0	1.2e-29
WP_079940247.1|3272222_3272465_-	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	47.6	3.1e-14
WP_079940248.1|3272464_3273448_-	hypothetical protein	NA	S5MA66	Brevibacillus_phage	55.9	2.6e-104
WP_079940249.1|3273452_3274091_-	LysM peptidoglycan-binding domain-containing protein	NA	S5MUH0	Brevibacillus_phage	49.5	2.2e-51
WP_079940250.1|3274087_3276205_-	hypothetical protein	NA	A0A0K2CP22	Brevibacillus_phage	42.3	1.2e-141
WP_023485206.1|3276428_3276854_-	hypothetical protein	NA	X5JAB6	Clostridium_phage	44.8	1.6e-26
WP_079940251.1|3276880_3277345_-|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	62.7	7.2e-52
WP_079940252.1|3277346_3278678_-|tail	phage tail sheath protein	tail	A0A0K2CNL4	Brevibacillus_phage	50.1	2.9e-114
WP_155121029.1|3278678_3278849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940253.1|3278841_3279252_-	hypothetical protein	NA	S5MUN8	Brevibacillus_phage	45.2	2.3e-25
WP_079940254.1|3279248_3279659_-	HK97 gp10 family phage protein	NA	A0A0A7RTT0	Clostridium_phage	58.0	2.1e-39
WP_079940789.1|3279658_3279979_-	ABC transporter ATP-binding protein	NA	S5M673	Brevibacillus_phage	57.5	6.5e-28
WP_079940255.1|3280019_3280391_-	DNA-packaging protein	NA	S5MP25	Brevibacillus_phage	60.5	1.3e-32
WP_079940256.1|3280417_3280675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940257.1|3280686_3281730_-|capsid	phage capsid protein	capsid	A0A0K2CP76	Brevibacillus_phage	87.0	1.1e-172
WP_079940790.1|3281745_3282105_-	hypothetical protein	NA	A0A0K2CNR0	Brevibacillus_phage	73.0	3.6e-43
WP_079940258.1|3282117_3282741_-	hypothetical protein	NA	A0A0K2CP96	Brevibacillus_phage	68.9	2.4e-71
WP_079940259.1|3282784_3283804_-|capsid	minor capsid protein	capsid	S5MTV5	Brevibacillus_phage	53.8	2.6e-102
WP_104932722.1|3283800_3285273_-|portal	phage portal protein	portal	A0A0K2CNK4	Brevibacillus_phage	62.0	3.5e-169
WP_079940260.1|3285287_3286559_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	66.0	1.3e-164
WP_079940261.1|3286551_3287292_-	hypothetical protein	NA	A0A2H4J4R0	uncultured_Caudovirales_phage	48.4	2.1e-45
WP_155121030.1|3287350_3287518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162544753.1|3287561_3287972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940792.1|3287951_3288218_+	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_079940263.1|3288778_3289084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940264.1|3289209_3289644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940265.1|3289661_3290165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940266.1|3290302_3290515_-	DUF2829 domain-containing protein	NA	A0A1C8E971	Bacillus_phage	87.0	7.8e-30
WP_079940267.1|3290575_3290926_-	hypothetical protein	NA	A0A0K2CZA6	Paenibacillus_phage	88.8	6.2e-56
WP_155121032.1|3290946_3291120_-	hypothetical protein	NA	A0A0K2CZI7	Paenibacillus_phage	77.2	8.1e-17
WP_079940268.1|3291338_3291542_-	hypothetical protein	NA	A0A0K2CZA1	Paenibacillus_phage	86.6	1.9e-25
WP_104932809.1|3291675_3292131_-	transcriptional regulator	NA	A0A0C5AC66	Paenibacillus_phage	73.0	5.8e-54
WP_079940270.1|3292281_3292722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940271.1|3292714_3292939_-	hypothetical protein	NA	A0A0K2CYJ4	Paenibacillus_phage	60.3	4.7e-17
WP_155121033.1|3292990_3293155_-	hypothetical protein	NA	R9W0Q6	Paenibacillus_phage	85.0	3.6e-14
WP_079940793.1|3293170_3293866_-	hypothetical protein	NA	A0A1L2JY27	Aeribacillus_phage	39.5	2.8e-31
WP_079940272.1|3293986_3295087_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2I7SC33	Paenibacillus_phage	79.5	6.5e-160
WP_079940273.1|3295290_3295665_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0K2CYQ8	Paenibacillus_phage	65.0	8.4e-43
WP_079940274.1|3295666_3295876_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	83.8	5.5e-28
WP_079940275.1|3295994_3296816_-	ATP-binding protein	NA	A0A0K2CYM7	Paenibacillus_phage	98.2	1.9e-119
WP_079940276.1|3296706_3297597_-	DnaD domain protein	NA	A0A0K2CY85	Paenibacillus_phage	86.1	6.1e-124
WP_079940277.1|3297645_3297978_-	hypothetical protein	NA	A0A0K2CY25	Paenibacillus_phage	91.8	6.1e-53
WP_079940278.1|3298002_3298404_-	single-stranded DNA-binding protein	NA	A0A0K2CYR2	Paenibacillus_phage	73.5	3.0e-46
WP_079940279.1|3298453_3299257_-	hypothetical protein	NA	A0A0P0IZH9	Lactobacillus_phage	40.0	1.2e-46
WP_079940280.1|3299219_3300110_-	hypothetical protein	NA	A0A0A7S0A9	Clostridium_phage	57.8	6.8e-83
WP_155121034.1|3300200_3300368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940282.1|3300679_3301006_-	hypothetical protein	NA	A0A0K2CYQ7	Paenibacillus_phage	93.2	9.8e-48
WP_079940283.1|3301020_3301698_-	hypothetical protein	NA	A0A2I7SCV5	Paenibacillus_phage	83.1	6.8e-59
WP_079940284.1|3301694_3301883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940285.1|3301918_3302227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940286.1|3302223_3302979_-	phage repressor protein/antirepressor Ant	NA	A0A0C5AEJ9	Bacteriophage	76.5	1.5e-107
WP_155121035.1|3303015_3303180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940287.1|3303326_3303587_-	hypothetical protein	NA	R9W0P6	Paenibacillus_phage	76.1	5.6e-22
WP_079940288.1|3303583_3303955_-	hypothetical protein	NA	R9VW30	Paenibacillus_phage	88.3	1.5e-55
WP_079940289.1|3303947_3304130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940290.1|3304239_3304530_-	helix-turn-helix domain-containing protein	NA	A0A0K2CZS5	Paenibacillus_phage	85.3	4.3e-39
WP_079940291.1|3304776_3304986_-	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	44.3	6.3e-08
WP_023483881.1|3305260_3305986_+	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	42.2	1.5e-11
WP_079940292.1|3306053_3307283_+|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	75.6	1.3e-180
WP_079940293.1|3307355_3308189_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
3307375:3307392	attR	TCCCCCGTGATAGGGTGA	NA	NA	NA	NA
WP_077997530.1|3309874_3310831_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	34.6	1.2e-32
>prophage 18
NZ_CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	3321195	3454657	4489122	tail,terminase,bacteriocin,capsid,integrase,tRNA,plate,coat,head,protease,transposase,portal	Paenibacillus_phage(42.06%)	170	3353761:3353779	3409795:3409813
WP_079940295.1|3321195_3322596_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_023484282.1|3322767_3323301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995767.1|3323438_3323840_-	adenosylmethionine decarboxylase	NA	A0A0E3FA82	Synechococcus_phage	36.4	1.5e-18
WP_023484284.1|3324212_3324800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995768.1|3325190_3325805_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_083039125.1|3325823_3328157_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	41.5	9.5e-169
WP_024094788.1|3328306_3330025_-|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	24.7	4.7e-16
WP_104932751.1|3330240_3330948_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_077995769.1|3330998_3332120_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_077995770.1|3332224_3333487_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.0	5.9e-149
WP_024094790.1|3333502_3334093_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.6	4.2e-57
WP_104932752.1|3334257_3335559_-	trigger factor	NA	NA	NA	NA	NA
WP_046655164.1|3335738_3336641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940297.1|3336771_3337992_-	CapA family protein	NA	A0A2H4J5Z6	uncultured_Caudovirales_phage	34.2	1.3e-55
WP_024094793.1|3338218_3338332_-	DUF4023 family protein	NA	NA	NA	NA	NA
WP_158672797.1|3338386_3339892_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_077995775.1|3339884_3340361_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_024094796.1|3340527_3340881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094797.1|3341169_3343014_+	asparagine synthase (glutamine-hydrolyzing)	NA	L7RC73	Acanthamoeba_polyphaga_moumouvirus	24.7	5.8e-28
WP_079940299.1|3343081_3343714_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_024094798.1|3343700_3344456_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_079940300.1|3344766_3345798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036656345.1|3346034_3346550_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.6	8.5e-38
WP_077995776.1|3346661_3347471_+	MFS transporter	NA	NA	NA	NA	NA
WP_104932621.1|3347708_3348578_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_036654509.1|3348598_3349282_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932668.1|3349534_3350651_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	99.3	4.6e-153
WP_077995777.1|3350804_3351119_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_023485249.1|3351118_3351460_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_024094809.1|3351527_3352109_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_079940351.1|3352464_3352926_+	hypothetical protein	NA	A0A2I7SC09	Paenibacillus_phage	47.0	2.1e-35
WP_079940352.1|3352965_3353169_+	hypothetical protein	NA	A0A0C5AEJ6	Paenibacillus_phage	65.7	1.6e-16
3353761:3353779	attL	CAATTTGTATTTCCAATTT	NA	NA	NA	NA
WP_079940353.1|3354582_3354822_-|transposase	transposase	transposase	A0A2I7SDD6	Paenibacillus_phage	93.7	1.6e-31
WP_079940354.1|3355755_3355992_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A0K2CZB4	Paenibacillus_phage	100.0	1.0e-30
WP_024094416.1|3356027_3356186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995811.1|3356178_3356574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940355.1|3356586_3357954_-	kelch-like protein	NA	S5MNY5	Brevibacillus_phage	38.5	2.4e-10
WP_079940243.1|3357957_3358236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104932808.1|3358232_3358796_-	DUF2313 domain-containing protein	NA	S5MA71	Brevibacillus_phage	46.4	5.7e-35
WP_079940357.1|3358806_3359883_-|plate	baseplate J/gp47 family protein	plate	A0A0K2CP27	Brevibacillus_phage	53.5	1.6e-102
WP_079940358.1|3359875_3360286_-	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	47.8	1.4e-27
WP_079940359.1|3360288_3360531_-	DUF2577 domain-containing protein	NA	S5MC71	Brevibacillus_phage	35.9	1.1e-11
WP_079940360.1|3360530_3361514_-	hypothetical protein	NA	S5MNC9	Brevibacillus_phage	55.3	7.7e-104
WP_079940361.1|3361518_3362157_-	LysM peptidoglycan-binding domain-containing protein	NA	S5MUH0	Brevibacillus_phage	50.5	9.9e-52
WP_079940362.1|3362153_3364262_-	hypothetical protein	NA	A0A0K2CP22	Brevibacillus_phage	43.0	3.3e-144
WP_077995249.1|3364382_3365603_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
WP_079940363.1|3365681_3366323_-	hypothetical protein	NA	S5MUN3	Brevibacillus_phage	41.2	1.1e-34
WP_079940364.1|3366561_3366987_-|portal	phage portal protein	portal	X5JAB6	Clostridium_phage	44.8	1.6e-26
WP_079940365.1|3367010_3367478_-|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	64.3	4.2e-52
WP_079940366.1|3367479_3368811_-|tail	phage tail sheath protein	tail	A0A0K2CNL4	Brevibacillus_phage	49.9	6.5e-114
WP_155121029.1|3368811_3368982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940367.1|3368974_3369385_-	hypothetical protein	NA	S5MUN8	Brevibacillus_phage	47.6	8.3e-28
WP_079940368.1|3369381_3369789_-	HK97 gp10 family phage protein	NA	S5MNW5	Brevibacillus_phage	60.3	2.6e-37
WP_079940803.1|3369788_3370109_-	ABC transporter ATP-binding protein	NA	S5M673	Brevibacillus_phage	56.6	2.5e-27
WP_079940369.1|3370149_3370518_-	DNA-packaging protein	NA	S5MP25	Brevibacillus_phage	51.7	1.5e-28
WP_079940370.1|3370504_3371515_-|coat	coat protein	coat	D2J006	Enterococcus_phage	65.6	2.2e-114
WP_079940371.1|3371532_3372174_-	hypothetical protein	NA	A0A0K2CP96	Brevibacillus_phage	71.8	1.5e-63
WP_079940372.1|3372214_3373234_-|capsid	minor capsid protein	capsid	S5M601	Brevibacillus_phage	55.5	2.9e-106
WP_104932812.1|3373230_3374670_-|portal	phage portal protein	portal	S5MNW1	Brevibacillus_phage	62.1	9.1e-170
WP_079940374.1|3374677_3375931_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0K2CP71	Brevibacillus_phage	79.7	2.8e-199
WP_079940375.1|3375917_3376355_-|terminase	terminase small subunit	terminase	S6B9Y6	Thermus_phage	63.9	1.3e-47
WP_155121047.1|3376404_3376572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155121048.1|3376605_3376779_-	hypothetical protein	NA	A0A0C5AJR9	Paenibacillus_phage	78.0	3.3e-10
WP_104932753.1|3376997_3377627_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_077995927.1|3377586_3377826_-	hypothetical protein	NA	A0A0K2CZP1	Paenibacillus_phage	75.4	9.8e-21
WP_079940378.1|3377943_3379056_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CZU8	Paenibacillus_phage	80.3	1.2e-161
WP_079940379.1|3379239_3379461_-	hypothetical protein	NA	A0A0K2CZG3	Paenibacillus_phage	93.2	2.1e-33
WP_079940380.1|3379465_3379870_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A2I7SC39	Paenibacillus_phage	96.2	3.9e-70
WP_079940381.1|3379850_3380435_-	hypothetical protein	NA	K7Z7Q9	Megavirus	39.9	1.8e-28
WP_079940382.1|3380830_3381160_-	hypothetical protein	NA	A0A0C5JZC6	Enterococcus_phage	49.3	3.3e-11
WP_079940383.1|3381165_3383379_-	AAA family ATPase	NA	A0A2I7SC35	Paenibacillus_phage	93.2	0.0e+00
WP_079940384.1|3383728_3383893_-	DUF3797 domain-containing protein	NA	A0A0K2CZU3	Paenibacillus_phage	95.6	8.7e-21
WP_079940385.1|3383902_3385483_-	DEAD/DEAH box helicase	NA	A0A0K2CZF8	Paenibacillus_phage	97.3	6.9e-296
WP_079940386.1|3385492_3386002_-	hypothetical protein	NA	A0A0K2CZ91	Paenibacillus_phage	92.9	4.6e-84
WP_079940387.1|3386023_3387103_-	ATP-binding protein	NA	A0A0K2CZH1	Paenibacillus_phage	84.4	1.2e-174
WP_079940388.1|3387102_3388413_-	AAA family ATPase	NA	A0A2I7SC23	Paenibacillus_phage	81.2	8.5e-175
WP_079940389.1|3388478_3389189_-	hypothetical protein	NA	A0A2I7SC22	Paenibacillus_phage	98.3	7.5e-125
WP_079940390.1|3389225_3389597_-	hypothetical protein	NA	A0A0K2CZF3	Paenibacillus_phage	95.9	5.3e-58
WP_079940391.1|3389664_3389865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940392.1|3389885_3390107_-	hypothetical protein	NA	A0A0K2CZM7	Paenibacillus_phage	69.9	5.7e-23
WP_079940393.1|3390146_3390422_-	hypothetical protein	NA	A0A0N9RRC2	Paenibacillus_phage	89.0	3.4e-25
WP_079940394.1|3390697_3390964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940395.1|3390965_3391199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940396.1|3391337_3391589_-	hypothetical protein	NA	R9W0P6	Paenibacillus_phage	72.2	1.9e-22
WP_155121049.1|3391589_3391844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940398.1|3391873_3392167_-	helix-turn-helix domain-containing protein	NA	A0A2I7SC15	Paenibacillus_phage	86.6	1.4e-40
WP_079940399.1|3392163_3392901_-	phage antirepressor Ant	NA	A0A2I7SC24	Paenibacillus_phage	92.7	2.7e-130
WP_079940400.1|3392918_3393548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940401.1|3393765_3393957_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_079940402.1|3394082_3394499_+	helix-turn-helix transcriptional regulator	NA	R9W020	Paenibacillus_phage	76.4	8.4e-44
WP_158672798.1|3394479_3395508_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0F6N3H6	Staphylococcus_phage	30.6	1.2e-06
WP_079940404.1|3395606_3396842_+|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	96.6	1.4e-232
WP_079940405.1|3397099_3398083_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_077995778.1|3398092_3398827_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_079940804.1|3399329_3400274_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_077995780.1|3401090_3401549_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155121050.1|3401675_3402038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162544755.1|3402057_3402225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104932754.1|3402155_3402350_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_079940407.1|3402863_3406460_+	hypothetical protein	NA	A0A126FC74	Lonomia_obliqua_multiple_nucleopolyhedrovirus	25.6	2.8e-42
WP_077995782.1|3406532_3407102_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_079940408.1|3407610_3408516_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A7AR08	Bacillus_phage	57.2	3.4e-90
WP_023483458.1|3408925_3409132_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	64.6	4.6e-19
WP_036656232.1|3409232_3409511_+	HU family DNA-binding protein	NA	M4SRV7	Rhodobacter_phage	38.3	7.2e-07
WP_023482516.1|3410175_3410814_+	hemolysin III family protein	NA	NA	NA	NA	NA
3409795:3409813	attR	CAATTTGTATTTCCAATTT	NA	NA	NA	NA
WP_077995375.1|3412126_3413350_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_077995783.1|3414158_3415721_-	recombinase family protein	NA	A0A0C5AJM7	Paenibacillus_phage	98.5	5.6e-290
WP_144029589.1|3415659_3415908_-	hypothetical protein	NA	A0A0C5AF76	Paenibacillus_phage	98.8	9.8e-40
WP_077995784.1|3415952_3416411_-	transcriptional regulator	NA	A0A0C5AC66	Paenibacillus_phage	96.7	5.4e-76
WP_077995785.1|3416461_3416920_-	hypothetical protein	NA	A0A2I7SCC0	Paenibacillus_phage	98.0	2.7e-75
WP_104932755.1|3417078_3417666_-	hypothetical protein	NA	A0A0C5ABQ1	Bacteriophage	93.8	4.7e-101
WP_077995787.1|3417662_3417875_-	hypothetical protein	NA	R9VYB7	Paenibacillus_phage	85.7	8.3e-32
WP_077995788.1|3417982_3418174_-	hypothetical protein	NA	A0A0K2CZP1	Paenibacillus_phage	80.0	3.4e-16
WP_077995789.1|3418223_3418589_-	helix-turn-helix transcriptional regulator	NA	R9W020	Paenibacillus_phage	95.8	9.9e-57
WP_155116288.1|3418635_3418785_-	hypothetical protein	NA	R9W0Q6	Paenibacillus_phage	100.0	5.0e-23
WP_077995790.1|3418799_3419105_-	hypothetical protein	NA	A0A0C5AEC7	Paenibacillus_phage	91.1	4.9e-49
WP_077997534.1|3419107_3420430_-	AAA family ATPase	NA	A0A0K2CY23	Paenibacillus_phage	98.6	2.4e-246
WP_149867712.1|3420395_3421064_-	hypothetical protein	NA	A0A2I7SDJ4	Paenibacillus_phage	98.6	1.9e-122
WP_023483155.1|3421245_3421560_-	hypothetical protein	NA	A0A0C5AEL1	Paenibacillus_phage	100.0	2.0e-37
WP_077995791.1|3421556_3422315_-	MBL fold metallo-hydrolase	NA	A0A0B5A2C7	Paenibacillus_phage	94.8	1.5e-139
WP_077995792.1|3422327_3423242_-	recombinase RecT	NA	A0A0C5AEK7	Bacteriophage	85.9	8.9e-147
WP_077995793.1|3423244_3423442_-	hypothetical protein	NA	A0A0C5AN67	Paenibacillus_phage	93.8	8.0e-29
WP_077995794.1|3423438_3424959_-	AAA family ATPase	NA	A0A0C5AN14	Bacteriophage	83.9	8.5e-227
WP_077995795.1|3424942_3425236_-	hypothetical protein	NA	A0A0C5AJQ8	Paenibacillus_phage	95.9	3.8e-43
WP_077995796.1|3425240_3425501_-	hypothetical protein	NA	A0A0C5AN52	Paenibacillus_phage	64.4	5.5e-25
WP_077995797.1|3425536_3425947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995798.1|3426108_3426342_-	hypothetical protein	NA	A0A0C5AN13	Bacteriophage	88.3	4.9e-33
WP_077995799.1|3426338_3426581_-	hypothetical protein	NA	A0A0C5AER7	Bacteriophage	78.9	2.0e-29
WP_155121051.1|3426677_3426854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995800.1|3426837_3427110_-	hypothetical protein	NA	A0A0C5AEJ1	Bacteriophage	95.5	3.6e-43
WP_077995801.1|3427136_3427877_-	phage antirepressor protein	NA	A0A2I7SDG8	Paenibacillus_phage	97.2	8.9e-129
WP_155121052.1|3427905_3428049_-	hypothetical protein	NA	A0A2I7SCU1	Paenibacillus_phage	95.7	2.7e-18
WP_077995803.1|3428246_3428465_-	helix-turn-helix transcriptional regulator	NA	A0A0C5AMZ9	Paenibacillus_phage	95.7	5.6e-31
WP_077995804.1|3428682_3429129_+	helix-turn-helix transcriptional regulator	NA	A0A0C5AN12	Bacteriophage	96.6	1.3e-71
WP_077995805.1|3429702_3429906_+	YqaE/Pmp3 family membrane protein	NA	A0A0C5AJ71	Bacteriophage	100.0	6.3e-29
WP_077995806.1|3430002_3430233_-	helix-turn-helix transcriptional regulator	NA	A0A0C5ABM0	Bacteriophage	96.0	3.0e-35
WP_077995807.1|3430708_3430900_+	hypothetical protein	NA	A0A0K2CZ26	Paenibacillus_phage	96.6	1.1e-25
WP_079940409.1|3430896_3431163_+	hypothetical protein	NA	A0A2I7SC25	Paenibacillus_phage	84.3	8.0e-32
WP_079940410.1|3431166_3431373_+	hypothetical protein	NA	A0A2I7SC04	Paenibacillus_phage	89.7	4.2e-28
WP_077995809.1|3431464_3431707_-|transposase	transposase	transposase	A0A0C5AEQ4	Bacteriophage	96.2	7.6e-29
WP_077997536.1|3431959_3432631_-	hypothetical protein	NA	A0A2I7SC18	Paenibacillus_phage	93.3	6.8e-128
WP_077995810.1|3432630_3432870_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	R9W0N4	Paenibacillus_phage	96.2	3.1e-35
WP_024094416.1|3432905_3433064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995811.1|3433056_3433452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995812.1|3433464_3435249_-	hypothetical protein	NA	A0A0C5AEQ0	Bacteriophage	90.6	2.3e-69
WP_079940411.1|3435249_3435813_-|tail	phage tail protein I	tail	A0A0C5AJ63	Bacteriophage	91.4	1.9e-91
WP_079940805.1|3435809_3436919_-|plate	baseplate J/gp47 family protein	plate	A0A0C5AEG2	Bacteriophage	99.7	1.6e-203
WP_077995813.1|3436930_3437257_-	hypothetical protein	NA	A0A0C5ABJ8	Bacteriophage	98.1	7.3e-51
WP_077995814.1|3437246_3437648_-|tail	phage tail protein	tail	A0A0C5AN08	Bacteriophage	95.5	1.0e-70
WP_079940412.1|3437644_3438022_-	hypothetical protein	NA	A0A0C5AEP6	Bacteriophage	90.4	1.6e-57
WP_077995816.1|3438024_3439053_-	late control protein	NA	A0A0C5AJ59	Bacteriophage	91.8	1.3e-186
WP_079940413.1|3439255_3441751_-	tape measure protein	NA	A0A0C5ABJ2	Bacteriophage	84.4	0.0e+00
WP_077995821.1|3441910_3442246_-|tail	phage tail assembly protein	tail	A0A0C5AEP1	Bacteriophage	85.0	6.8e-44
WP_077995822.1|3442273_3442792_-|tail	phage major tail tube protein	tail	A0A0C5AJ56	Bacteriophage	94.8	9.4e-85
WP_077995823.1|3442804_3444247_-|tail	phage tail protein	tail	A0A0C5AEE8	Bacteriophage	92.1	3.5e-262
WP_077995824.1|3444250_3444523_-	hypothetical protein	NA	A0A0C5ABI6	Bacteriophage	95.6	1.4e-42
WP_077995825.1|3444519_3444987_-	hypothetical protein	NA	A0A0C5AN06	Bacteriophage	97.4	2.3e-82
WP_077995826.1|3444983_3445535_-	hypothetical protein	NA	A0A0C5AEN6	Bacteriophage	98.9	3.1e-94
WP_077995827.1|3445531_3445843_-	hypothetical protein	NA	A0A0C5AJ53	Bacteriophage	100.0	4.8e-52
WP_155121053.1|3445839_3445989_-	hypothetical protein	NA	A0A0C5AEE3	Bacteriophage	100.0	3.0e-20
WP_077995828.1|3446002_3447031_-|capsid	major capsid protein	capsid	A0A0C5ABI0	Bacteriophage	99.4	1.7e-194
WP_077995829.1|3447046_3447403_-|head	head decoration protein	head	A0A0C5AN05	Bacteriophage	97.5	6.3e-56
WP_079940414.1|3447399_3448521_-|protease	Clp protease ClpP	protease	A0A0C5AEN1	Bacteriophage	98.4	6.7e-205
WP_077995832.1|3448480_3450040_-|portal	phage portal protein	portal	A0A0C5AJ48	Bacteriophage	96.3	9.2e-293
WP_077995833.1|3450036_3450258_-	hypothetical protein	NA	A0A0C5AEE0	Bacteriophage	89.0	1.8e-29
WP_077995834.1|3450274_3452137_-|terminase	phage terminase large subunit family protein	terminase	A0A0C5ABH4	Bacteriophage	98.7	0.0e+00
WP_077995835.1|3452120_3452633_-	hypothetical protein	NA	A0A0C5AN04	Bacteriophage	84.0	3.4e-71
WP_036654551.1|3453780_3453984_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0C5AC70	Paenibacillus_phage	100.0	1.5e-33
WP_077995836.1|3454014_3454425_+	pilus assembly protein HicB	NA	A0A0C5AEN7	Bacteriophage	98.5	7.2e-72
WP_077995837.1|3454453_3454657_-	hypothetical protein	NA	A0A0C5ABQ7	Bacteriophage	98.5	5.2e-31
>prophage 19
NZ_CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	3560009	3619449	4489122	tail,holin,terminase,capsid,integrase,tRNA,coat,transposase,portal	Paenibacillus_phage(60.78%)	78	3579035:3579051	3619457:3619473
WP_104932657.1|3560009_3560879_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	99.6	1.1e-135
WP_024094875.1|3561027_3561708_-	LrgB family protein	NA	NA	NA	NA	NA
WP_023483267.1|3561704_3562076_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_036654876.1|3562198_3563092_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_104932764.1|3563467_3564025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995895.1|3564135_3565284_-	transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_077995896.1|3565311_3565551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155116295.1|3565573_3565726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483263.1|3565844_3566987_+	MFS transporter	NA	NA	NA	NA	NA
WP_077995897.1|3567186_3567537_+	DNA primase	NA	NA	NA	NA	NA
WP_077995898.1|3567538_3568180_-	SCO family protein	NA	NA	NA	NA	NA
WP_096761322.1|3568270_3569197_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_024094881.1|3569441_3571454_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.3	3.2e-11
WP_023483257.1|3572061_3572541_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_077995899.1|3572579_3572858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036654885.1|3572945_3573929_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_023483255.1|3574065_3574290_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	47.8	5.6e-10
WP_042119744.1|3574416_3574602_+	DUF5325 family protein	NA	NA	NA	NA	NA
WP_036654887.1|3574794_3575781_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_077995900.1|3576159_3577623_-	cobyrinate a,c-diamide synthase	NA	NA	NA	NA	NA
WP_036654889.1|3577790_3578429_-	ribonuclease H	NA	NA	NA	NA	NA
3579035:3579051	attL	TGTGGGCAAAATGTGGG	NA	NA	NA	NA
WP_077995901.1|3579170_3579557_+	DUF3862 domain-containing protein	NA	NA	NA	NA	NA
WP_077584997.1|3579768_3579855_-|holin	putative holin-like toxin	holin	A0A0K2CZR6	Paenibacillus_phage	100.0	2.0e-05
WP_158672803.1|3579950_3580178_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CYV5	Paenibacillus_phage	85.1	3.0e-27
WP_077995903.1|3580647_3580833_+	hypothetical protein	NA	A0A0K2CZ26	Paenibacillus_phage	82.0	3.6e-23
WP_077995904.1|3580918_3581182_+	hypothetical protein	NA	A0A0K2CYM1	Paenibacillus_phage	97.7	1.4e-41
WP_104932621.1|3581310_3582180_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_036654509.1|3582200_3582884_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932814.1|3583036_3583672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995908.1|3583706_3584423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995909.1|3584558_3584801_-|transposase	transposase	transposase	A0A2I7SCT4	Paenibacillus_phage	96.2	1.1e-32
WP_077997545.1|3584810_3585479_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A2I7SD00	Paenibacillus_phage	96.4	2.5e-130
WP_024094328.1|3585478_3585718_-	hypothetical protein	NA	A0A0C5AEG8	Bacteriophage	100.0	2.8e-36
WP_077995910.1|3585897_3586230_-	hypothetical protein	NA	A0A2I7SBZ3	Paenibacillus_phage	87.2	8.2e-50
WP_077995911.1|3586239_3586992_-	hypothetical protein	NA	A0A0K2CZJ3	Paenibacillus_phage	98.0	4.8e-82
WP_077995912.1|3586994_3588467_-	hypothetical protein	NA	A0A1B2APX2	Phage_Wrath	53.9	1.2e-124
WP_077995913.1|3588466_3589168_-	hypothetical protein	NA	A0A1B2APY0	Phage_Wrath	42.1	2.9e-44
WP_155121055.1|3589170_3590514_-	hypothetical protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	65.1	1.3e-16
WP_077995249.1|3590662_3591883_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
WP_077995915.1|3591941_3593738_-	tape measure protein	NA	M1IEW1	Bacillus_virus	39.8	1.3e-53
WP_104932815.1|3593758_3594058_-	phenylalanine racemase	NA	A0A097PAX1	Streptococcus_pyogenes_phage	47.4	3.7e-17
WP_077997546.1|3594171_3594474_-	segregation and condensation protein B	NA	NA	NA	NA	NA
WP_077995917.1|3594476_3594995_-|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	71.6	1.0e-51
WP_077995918.1|3595008_3595419_-	DUF5072 family protein	NA	A0A097PAW5	Streptococcus_pyogenes_phage	44.1	1.7e-33
WP_036658585.1|3595423_3595759_-	hypothetical protein	NA	A0A097PAT9	Streptococcus_pyogenes_phage	37.2	2.4e-09
WP_077995919.1|3595764_3596070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995920.1|3596066_3596387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995921.1|3596389_3596938_-	hypothetical protein	NA	A7J297	Streptococcus_phage	49.2	7.2e-35
WP_077995249.1|3597016_3598237_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
WP_077995922.1|3598278_3598644_-	hypothetical protein	NA	A7J297	Streptococcus_phage	55.3	1.2e-25
WP_077995923.1|3598656_3599247_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_077995924.1|3599333_3600227_-|capsid	minor capsid protein	capsid	S5MTV5	Brevibacillus_phage	33.9	8.7e-38
WP_077995925.1|3600135_3601548_-|portal	phage portal protein	portal	A0A1P8BLJ1	Lactococcus_phage	49.3	7.4e-116
WP_077997547.1|3601548_3602967_-|terminase	phage terminase large subunit	terminase	A0A090EUA8	Clostridium_phage	69.4	2.9e-189
WP_077997548.1|3602962_3603460_-|transposase	transposase	transposase	A0A0E3U2Q7	Fusobacterium_phage	65.2	6.7e-40
WP_077995926.1|3603675_3604299_-	RNA polymerase subunit sigma-24	NA	NA	NA	NA	NA
WP_077995927.1|3604264_3604504_-	hypothetical protein	NA	A0A0K2CZP1	Paenibacillus_phage	75.4	9.8e-21
WP_158672804.1|3604621_3605725_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2I7SC33	Paenibacillus_phage	89.6	4.2e-183
WP_077995929.1|3605741_3605963_-	hypothetical protein	NA	A0A0K2CZG3	Paenibacillus_phage	94.5	5.5e-34
WP_077995930.1|3605966_3606362_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A2I7SC39	Paenibacillus_phage	97.7	6.9e-72
WP_079940424.1|3606351_3606630_-	hypothetical protein	NA	A0A0K2CZH7	Paenibacillus_phage	98.9	1.4e-47
WP_077995932.1|3606916_3609169_-	AAA family ATPase	NA	A0A2I7SC35	Paenibacillus_phage	99.9	0.0e+00
WP_077995933.1|3609173_3609503_-	hypothetical protein	NA	A0A2I7SC50	Paenibacillus_phage	99.1	1.9e-62
WP_077995934.1|3609499_3611089_-	DEAD/DEAH box helicase	NA	A0A2I7SC38	Paenibacillus_phage	98.9	1.4e-301
WP_023485397.1|3611098_3611599_-	hypothetical protein	NA	A0A2I7SC41	Paenibacillus_phage	100.0	3.1e-93
WP_104932765.1|3611623_3612322_-	hypothetical protein	NA	A0A2I7SC26	Paenibacillus_phage	99.6	5.2e-139
WP_077995935.1|3612353_3613457_-	ATP-binding protein	NA	A0A2I7SC30	Paenibacillus_phage	99.2	7.6e-209
WP_077995936.1|3613456_3614767_-	AAA family ATPase	NA	A0A2I7SC23	Paenibacillus_phage	76.4	2.5e-174
WP_104932766.1|3614827_3615538_-	hypothetical protein	NA	A0A2I7SC22	Paenibacillus_phage	98.7	3.3e-125
WP_023484471.1|3615587_3615959_-	hypothetical protein	NA	A0A2I7SC29	Paenibacillus_phage	100.0	3.4e-60
WP_051427850.1|3615988_3616273_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	100.0	3.8e-48
WP_079940425.1|3616276_3616510_-	hypothetical protein	NA	A0A0K2CZM7	Paenibacillus_phage	84.1	4.3e-21
WP_077995939.1|3616525_3616780_-	hypothetical protein	NA	A0A0K2CYH1	Paenibacillus_phage	43.4	2.8e-10
WP_077995940.1|3616751_3616973_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077995941.1|3617057_3617300_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CZL1	Paenibacillus_phage	69.3	2.4e-22
WP_077995942.1|3617424_3617757_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CZS1	Paenibacillus_phage	55.8	2.7e-16
WP_077995943.1|3617766_3618228_+	ImmA/IrrE family metallo-endopeptidase	NA	R9TQI1	Paenibacillus_phage	64.1	8.7e-50
WP_077995944.1|3618309_3619449_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	39.6	4.2e-61
3619457:3619473	attR	TGTGGGCAAAATGTGGG	NA	NA	NA	NA
>prophage 20
NZ_CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	3698484	3822971	4489122	protease,transposase,holin,integrase	Paenibacillus_phage(21.43%)	108	3700350:3700364	3830218:3830232
WP_077995988.1|3698484_3699030_-|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	37.4	7.0e-22
WP_079940438.1|3699463_3700168_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
3700350:3700364	attL	GATTATATTTCATTT	NA	NA	NA	NA
WP_077995989.1|3700723_3703951_+	lantibiotic dehydratase	NA	A0A2H4PQG8	Staphylococcus_phage	24.4	1.1e-77
3700350:3700364	attL	GATTATATTTCATTT	NA	NA	NA	NA
WP_158672808.1|3703943_3705299_+	lanthionine synthetase C family protein	NA	NA	NA	NA	NA
WP_077995991.1|3705587_3706904_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_077995992.1|3707192_3708176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940439.1|3708523_3710542_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_036658223.1|3710581_3710860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995995.1|3711655_3712453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094946.1|3712670_3714128_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_149867718.1|3714321_3715350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158672809.1|3715652_3716042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997553.1|3716017_3716770_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077995998.1|3716866_3718060_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_036658210.1|3718085_3719645_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_024094951.1|3720410_3720659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036658206.1|3720665_3720929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094953.1|3721112_3722054_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023484418.1|3722235_3722850_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_077997554.1|3723072_3724263_-	MFS transporter	NA	NA	NA	NA	NA
WP_023484416.1|3724298_3724988_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_149867719.1|3725187_3725502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996002.1|3725953_3727225_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.0	1.4e-09
WP_077996004.1|3727463_3727958_-	DUF4261 domain-containing protein	NA	NA	NA	NA	NA
WP_077996005.1|3728320_3728851_+	lysoplasmalogenase	NA	NA	NA	NA	NA
WP_149867720.1|3728845_3729610_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_104932770.1|3729880_3730621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996008.1|3730802_3731027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996009.1|3731125_3731740_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_077996010.1|3731771_3733688_-	AAA family ATPase	NA	Q331U3	Clostridium_botulinum_C_phage	35.2	3.2e-05
WP_077996011.1|3733947_3735234_+	MFS transporter	NA	NA	NA	NA	NA
WP_077996012.1|3735461_3735794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036658190.1|3736112_3736382_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_077997555.1|3736414_3736708_+	mRNA-degrading endonuclease	NA	NA	NA	NA	NA
WP_023483432.1|3736959_3737250_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077996013.1|3737246_3739757_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_036658187.1|3739861_3740158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995375.1|3741260_3742484_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_077996014.1|3742639_3744088_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.9	2.2e-123
WP_023483464.1|3744222_3744609_-	DUF1878 family protein	NA	NA	NA	NA	NA
WP_077996015.1|3744630_3745089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155121056.1|3745780_3745930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149867721.1|3745919_3747128_-	DNA-binding protein	NA	A0A0K2CP77	Brevibacillus_phage	36.5	1.7e-68
WP_077996017.1|3747375_3747537_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155121057.1|3748001_3748154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996018.1|3748143_3748752_-	hypothetical protein	NA	A0A0K2CP77	Brevibacillus_phage	34.5	1.1e-31
WP_077996019.1|3748794_3749499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996021.1|3750444_3750885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996022.1|3751017_3751389_-	3'-5' exonuclease	NA	A2I2Z6	Vibrio_virus	42.0	1.8e-13
WP_077996023.1|3751656_3751956_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_104932771.1|3751989_3752223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155121058.1|3752209_3752560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996025.1|3752860_3754390_-	alkyl hydroperoxide reductase subunit F	NA	A0A2I2L5E1	Orpheovirus	32.4	5.7e-37
WP_042118705.1|3754401_3754965_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_036658506.1|3755108_3755273_-	FeoB-associated Cys-rich membrane protein	NA	NA	NA	NA	NA
WP_077996026.1|3755289_3757278_-	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_036658128.1|3757274_3757502_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_077996027.1|3759081_3760239_+	MFS transporter	NA	NA	NA	NA	NA
3759158:3759172	attR	AAATGAAATATAATC	NA	NA	NA	NA
WP_036658123.1|3760497_3761010_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
3759158:3759172	attR	AAATGAAATATAATC	NA	NA	NA	NA
WP_083039549.1|3761006_3761300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997556.1|3761443_3762367_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.6	1.4e-30
WP_077996029.1|3762881_3763244_-	hypothetical protein	NA	A0A2I7SCG2	Paenibacillus_phage	80.0	9.9e-49
WP_104932772.1|3763258_3763708_-	hypothetical protein	NA	A0A2I7SCF1	Paenibacillus_phage	80.8	5.0e-58
WP_077996030.1|3764288_3765263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996031.1|3765214_3766030_+	S8 family peptidase	NA	A0A127AWU5	Bacillus_phage	37.4	1.1e-36
WP_079940442.1|3766274_3767540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995375.1|3767572_3768796_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_077997558.1|3768910_3769099_-	hypothetical protein	NA	A0A1V0E026	Clostridioides_phage	58.9	6.5e-12
WP_051428085.1|3769082_3769274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996034.1|3769326_3770073_-	hypothetical protein	NA	Q331X8	Clostridium_botulinum_C_phage	40.9	1.7e-31
WP_079940443.1|3770339_3772787_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_077996035.1|3772798_3773845_-	aminomethyl transferase family protein	NA	NA	NA	NA	NA
WP_077996036.1|3773847_3776640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996037.1|3776636_3777125_-	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_024093465.1|3777131_3777419_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_023484175.1|3777541_3778288_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	46.1	4.9e-10
WP_077996038.1|3778280_3779231_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_036655264.1|3779227_3779647_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_024093462.1|3779652_3780807_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_077996039.1|3780982_3781930_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.4	1.5e-24
WP_042118638.1|3782322_3783375_+	Fic family protein	NA	NA	NA	NA	NA
WP_024093460.1|3783810_3785694_-	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	34.4	3.6e-94
WP_158672810.1|3786412_3787210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996042.1|3787214_3788093_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_077996043.1|3790861_3791761_-	DUF91 domain-containing protein	NA	NA	NA	NA	NA
WP_077996044.1|3791910_3795129_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_104932817.1|3795135_3795762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996045.1|3795889_3797350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940444.1|3797334_3798639_-	DUF2399 domain-containing protein	NA	NA	NA	NA	NA
WP_155121059.1|3798864_3799002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996048.1|3799290_3802641_-	DEAD/DEAH box helicase family protein	NA	Q5YA94	Bacillus_phage	22.9	2.0e-18
WP_158672811.1|3802651_3803062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995375.1|3803143_3804367_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_158672812.1|3804359_3805244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996051.1|3805250_3806708_-	SAM-dependent DNA methyltransferase	NA	A0A1W6JNK1	Staphylococcus_phage	28.6	4.2e-21
WP_077584997.1|3807258_3807345_-|holin	putative holin-like toxin	holin	A0A0K2CZR6	Paenibacillus_phage	100.0	2.0e-05
WP_149867724.1|3807518_3808028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996053.1|3808724_3811898_-	type 2 lantipeptide synthetase LanM	NA	NA	NA	NA	NA
WP_077996054.1|3811999_3812221_-	mersacidin/lichenicidin family type 2 lantibiotic	NA	NA	NA	NA	NA
WP_077996055.1|3812321_3813476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996056.1|3813481_3814180_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	3.1e-14
WP_077996057.1|3814195_3815206_-	S8 family serine peptidase	NA	A0A2H4PQH1	Staphylococcus_phage	28.9	1.2e-22
WP_051428052.1|3815202_3815451_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_077997560.1|3818296_3820234_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.2	1.0e-11
WP_158672813.1|3820550_3820835_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_077996060.1|3820848_3821520_-|transposase	IS3 family transposase	transposase	O48391	Streptococcus_phage	68.8	9.8e-18
WP_149867726.1|3822306_3822678_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158672814.1|3822803_3822971_-|transposase	transposase	transposase	NA	NA	NA	NA
3830218:3830232	attR	GTCGGTAAAGTACAG	NA	NA	NA	NA
>prophage 21
NZ_CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	3841281	3850180	4489122		Synechococcus_phage(28.57%)	8	NA	NA
WP_077996072.1|3841281_3841905_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.9	1.8e-26
WP_077996073.1|3841901_3842948_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.7	1.5e-68
WP_077996074.1|3843041_3844616_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.6	8.7e-49
WP_079940448.1|3844600_3846844_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	44.5	4.5e-168
WP_023485275.1|3846821_3847517_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_023485276.1|3847589_3847832_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FJ99	Synechococcus_phage	35.4	4.3e-08
WP_077996075.1|3847926_3848811_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	33.6	9.5e-37
WP_036655290.1|3848884_3850180_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	34.3	6.3e-21
>prophage 22
NZ_CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	3918127	3972112	4489122	transposase,holin	Paenibacillus_phage(40.0%)	60	NA	NA
WP_036657132.1|3918127_3919276_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	33.6	8.9e-27
WP_077996099.1|3919699_3921001_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_104932776.1|3921006_3921981_-	ATPase	NA	NA	NA	NA	NA
WP_077996100.1|3922026_3923034_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_024093340.1|3923698_3924313_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	62.6	7.5e-73
WP_077996101.1|3924430_3927049_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077996102.1|3927109_3928096_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024093337.1|3928092_3928869_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_077996103.1|3928884_3929832_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	3.8e-23
WP_079940453.1|3929991_3930201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077585258.1|3930549_3930705_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	46.0	9.8e-06
WP_036655317.1|3931016_3931319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036657135.1|3931427_3932588_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_077996105.1|3932746_3933088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023485170.1|3933312_3933705_-	holo-[acyl-carrier-protein] synthase	NA	NA	NA	NA	NA
WP_036655319.1|3933799_3934705_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_077996106.1|3934697_3935624_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.9	1.0e-36
WP_023485173.1|3935828_3936635_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	45.2	1.3e-53
WP_077585259.1|3937081_3937510_-	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_023485175.1|3937654_3938008_-	DUF3905 domain-containing protein	NA	NA	NA	NA	NA
WP_077996107.1|3938011_3938878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996108.1|3938995_3939718_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_023485178.1|3939720_3940239_-	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_077996109.1|3940245_3940911_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_077996110.1|3940965_3941256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023485180.1|3941514_3942201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996111.1|3942340_3943363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940454.1|3943396_3943897_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_155121060.1|3944192_3944363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104932657.1|3944526_3945396_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	99.6	1.1e-135
WP_036654509.1|3945416_3946100_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_077996114.1|3946166_3946427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996115.1|3946516_3947002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996116.1|3947158_3948427_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	60.2	1.4e-28
WP_042118522.1|3948525_3948888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996117.1|3948966_3949299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149867728.1|3949283_3949748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996119.1|3950748_3951342_+	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
WP_158672815.1|3951448_3951685_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	98.3	2.6e-26
WP_077995375.1|3951749_3952973_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_077996122.1|3953734_3954418_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	96.9	1.7e-118
WP_024093255.1|3954605_3955307_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.1	7.3e-32
WP_077996123.1|3955296_3956676_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	31.9	1.7e-19
WP_024093253.1|3956833_3957355_+	C40 family peptidase	NA	NA	NA	NA	NA
WP_077996124.1|3957428_3957911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996125.1|3957961_3958693_-	VOC family protein	NA	NA	NA	NA	NA
WP_077996126.1|3959092_3959884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996127.1|3959880_3960783_-	EamA family transporter	NA	NA	NA	NA	NA
WP_051427941.1|3961114_3962098_-	phosphotransferase	NA	NA	NA	NA	NA
WP_036655338.1|3962355_3963573_-	MFS transporter	NA	NA	NA	NA	NA
WP_024093246.1|3963638_3964229_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077996128.1|3964353_3965415_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_077996129.1|3965691_3966732_-	oxidoreductase	NA	NA	NA	NA	NA
WP_149867729.1|3966816_3967116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655344.1|3967640_3968123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024093241.1|3968532_3969018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042119436.1|3969974_3970289_-	MGMT family protein	NA	NA	NA	NA	NA
WP_024093237.1|3970552_3970924_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077996131.1|3970925_3971351_-	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_077996132.1|3971707_3972112_-|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	55.3	5.1e-30
>prophage 23
NZ_CP019655	Paenibacillus larvae subsp. larvae strain Eric_III chromosome, complete genome	4489122	4032491	4040187	4489122	tRNA	Pneumococcus_phage(33.33%)	6	NA	NA
WP_077996172.1|4032491_4033010_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	63.1	2.2e-49
WP_024093191.1|4033036_4033774_-	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	41.8	4.2e-54
WP_077996173.1|4033766_4034252_-	6-carboxytetrahydropterin synthase QueD	NA	J9PV91	Bacillus_phage	68.2	7.7e-57
WP_077996174.1|4034248_4034920_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	58.3	1.4e-67
WP_077996175.1|4035468_4037172_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.3	4.0e-76
WP_077996177.1|4038204_4040187_+	acyltransferase family protein	NA	B5WZU0	Pseudomonas_phage	32.7	2.0e-42
>prophage 1
NZ_CP019656	Paenibacillus larvae subsp. larvae strain Eric_III plasmid unnamed1, complete sequence	103273	5150	13031	103273	transposase	Paenibacillus_phage(60.0%)	16	NA	NA
WP_104932825.1|5150_5522_-	helix-turn-helix transcriptional regulator	NA	A0A0F6WBJ9	Vibrio_phage	37.3	5.6e-07
WP_104932826.1|5628_5853_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_104932827.1|5889_6294_+	ArpU family transcriptional regulator	NA	NA	NA	NA	NA
WP_104932828.1|6311_7178_+	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_104932829.1|7443_8286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158672839.1|8362_8533_+	hypothetical protein	NA	R9W0Q6	Paenibacillus_phage	81.6	4.6e-17
WP_104932830.1|8586_8901_+	hypothetical protein	NA	A0A0N9SGJ1	Paenibacillus_phage	45.1	5.1e-17
WP_104932831.1|8893_9109_+	hypothetical protein	NA	A0A0K2CY28	Paenibacillus_phage	97.2	7.9e-38
WP_104932832.1|9113_9434_+	hypothetical protein	NA	A0A2I7SCA0	Paenibacillus_phage	88.2	2.1e-47
WP_158672840.1|9430_9589_+	hypothetical protein	NA	A0A0K2CXM5	Paenibacillus_phage	58.5	1.2e-06
WP_104932833.1|10068_10314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932834.1|10303_10573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932835.1|10766_11069_+|transposase	transposase	transposase	A0A191SB13	Nostoc_phage	54.2	1.7e-22
WP_104932836.1|11190_11490_+	hypothetical protein	NA	R9W0Q8	Paenibacillus_phage	70.7	5.7e-10
WP_104932837.1|11623_12679_+	N-acetyltransferase	NA	Q6SE88	Lactobacillus_prophage	38.2	6.2e-59
WP_104932838.1|12656_13031_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	46.0	1.2e-25
>prophage 2
NZ_CP019656	Paenibacillus larvae subsp. larvae strain Eric_III plasmid unnamed1, complete sequence	103273	41447	97457	103273	transposase	Paenibacillus_phage(25.0%)	55	NA	NA
WP_104932862.1|41447_42698_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	40.4	1.7e-63
WP_104932863.1|43828_44347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932919.1|44399_46550_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	40.6	9.9e-88
WP_104932864.1|46563_46758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932865.1|46760_47804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932866.1|48039_49098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932867.1|49272_49623_+	hypothetical protein	NA	A0A0K2CZA6	Paenibacillus_phage	62.6	4.6e-35
WP_104932868.1|49878_50244_+	hypothetical protein	NA	A0A0K2CZ58	Paenibacillus_phage	95.0	6.4e-64
WP_104932869.1|50256_51393_+	site-specific DNA-methyltransferase	NA	A0A1B0VM49	Pseudomonas_phage	45.1	4.9e-78
WP_104932870.1|51542_52226_+	DsbA family protein	NA	NA	NA	NA	NA
WP_104932871.1|52428_52716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932872.1|52712_52904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932873.1|52887_54005_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	99.6	9.2e-154
WP_104932874.1|55380_56732_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	62.3	5.3e-95
WP_104932920.1|57013_57841_-	DNA ligase	NA	O64130	Bacillus_phage	44.3	1.4e-50
WP_158672842.1|57956_59141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932876.1|59115_60528_+	DEAD/DEAH box helicase	NA	I3VYY6	Thermoanaerobacterium_phage	25.9	2.3e-37
WP_104932877.1|60511_61819_+	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	32.6	8.8e-63
WP_104932878.1|61805_62222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932879.1|62222_62870_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.0	2.5e-50
WP_104932880.1|62874_63126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932881.1|63122_63425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932882.1|63467_63833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104932883.1|63850_64480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104932884.1|64651_65482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932885.1|65507_65762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158672843.1|65806_65983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932888.1|66362_67046_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	97.4	2.6e-119
WP_104932890.1|68019_69399_-	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_158672844.1|69410_69629_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_104932892.1|69774_70620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932893.1|70658_70988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932894.1|71052_71694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932895.1|71720_72323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932896.1|73688_73928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932897.1|74062_74497_+	DUF5348 domain-containing protein	NA	NA	NA	NA	NA
WP_104932898.1|74812_75211_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	70.5	1.5e-50
WP_104932899.1|76442_76985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104932900.1|77078_77258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932901.1|77845_79453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104932902.1|79449_80481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104932921.1|80703_81972_+	DNA polymerase IV	NA	O64031	Bacillus_phage	36.7	8.0e-61
WP_104932903.1|82083_83214_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	22.5	4.5e-07
WP_104932922.1|83447_83702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158672845.1|85185_85491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104932923.1|87163_87403_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A0N9S804	Paenibacillus_phage	48.4	1.2e-07
WP_104932905.1|87399_87729_+	mRNA-degrading endonuclease	NA	NA	NA	NA	NA
WP_104932906.1|87754_88045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932907.1|88287_88524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104932908.1|88507_89281_-	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	39.5	5.0e-50
WP_104932909.1|89685_90990_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_104932874.1|91194_92546_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	62.3	5.3e-95
WP_104932910.1|92957_95111_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_104932911.1|95089_96826_+	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	29.0	3.1e-15
WP_104932912.1|97127_97457_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	55.3	1.1e-33
>prophage 1
NZ_CP019657	Paenibacillus larvae subsp. larvae strain Eric_III plasmid unnamed2, complete sequence	60868	23576	29973	60868	integrase	Bacillus_phage(50.0%)	9	25760:25773	31070:31083
WP_077997741.1|23576_23816_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A0N9S804	Paenibacillus_phage	50.0	3.3e-08
WP_077997739.1|23812_24142_+	mRNA-degrading endonuclease	NA	NA	NA	NA	NA
WP_077997682.1|24386_25025_-	hemolysin III family protein	NA	NA	NA	NA	NA
25760:25773	attL	CATCTTTATTTTTT	NA	NA	NA	NA
WP_077997683.1|25792_26071_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	51.7	1.4e-15
WP_077997684.1|26180_26387_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	1.6e-19
WP_077996502.1|26743_27427_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	96.9	1.4e-117
WP_077997687.1|28431_29349_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A7AR08	Bacillus_phage	57.0	2.6e-93
WP_077997688.1|29495_29747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997689.1|29712_29973_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A125RQ76	Bacillus_phage	54.7	2.4e-20
31070:31083	attR	CATCTTTATTTTTT	NA	NA	NA	NA
