The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	440910	511415	4268596	bacteriocin,tRNA,transposase	Paenibacillus_phage(45.45%)	61	NA	NA
WP_077997612.1|440910_442173_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.3	2.2e-87
WP_077996631.1|442204_442906_+	protein rep	NA	NA	NA	NA	NA
WP_024093087.1|443860_445309_+	amino acid permease	NA	NA	NA	NA	NA
WP_042119415.1|445366_447229_+	tyrosine decarboxylase	NA	NA	NA	NA	NA
WP_023483977.1|447338_448154_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_079940500.1|448245_449631_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_077996632.1|449917_450214_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_077997613.1|450523_451174_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_077996633.1|451402_452218_+	N-acetylmuramoyl-L-alanine amidase	NA	D6QWP2	uncultured_phage	52.9	1.7e-40
WP_077996634.1|453782_454340_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	43.4	5.4e-38
WP_077996635.1|454336_455296_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	45.7	6.6e-76
WP_036655890.1|455292_456147_+	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_077996636.1|456390_456972_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_149867746.1|457262_457898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996638.1|458073_458328_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_079940501.1|458811_460176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155121069.1|460162_460339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996641.1|460503_461010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996642.1|461028_461355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996644.1|462270_463152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996645.1|463174_464107_+	type III-B CRISPR module RAMP protein Cmr1	NA	NA	NA	NA	NA
WP_077996646.1|464106_465780_+	type III-B CRISPR-associated protein Cas10/Cmr2	NA	NA	NA	NA	NA
WP_079940503.1|465779_466904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997614.1|466917_467814_+	type III-B CRISPR module RAMP protein Cmr4	NA	NA	NA	NA	NA
WP_042118428.1|467797_468202_+	type III-B CRISPR module-associated protein Cmr5	NA	NA	NA	NA	NA
WP_149867747.1|468275_469034_+	type III-B CRISPR module RAMP protein Cmr6	NA	NA	NA	NA	NA
WP_077996650.1|470934_471606_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.7	3.6e-12
WP_077996651.1|473736_474225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996653.1|475676_476933_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_077996654.1|477100_478288_+	alanine racemase	NA	NA	NA	NA	NA
WP_024093124.1|478522_478804_+	CopG family ribbon-helix-helix protein	NA	NA	NA	NA	NA
WP_023485406.1|478807_479158_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A2P0ZKX3	Lactobacillus_phage	38.6	6.9e-15
WP_104932789.1|479329_481534_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_077997616.1|481735_482302_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_023485404.1|482699_483158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093128.1|483242_483470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940505.1|483725_484925_+	S8 family peptidase	NA	A0A217EQY2	Bacillus_phage	38.8	3.4e-45
WP_096761197.1|485233_485341_-	cortex morphogenetic protein CmpA	NA	NA	NA	NA	NA
WP_077996657.1|485502_485859_-	hydrolase/acyltransferase	NA	NA	NA	NA	NA
WP_077996658.1|485957_486428_+	SprT family protein	NA	NA	NA	NA	NA
WP_077996659.1|488139_488904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996660.1|489203_489794_+	hypothetical protein	NA	S5MNY5	Brevibacillus_phage	24.9	1.1e-12
WP_077996661.1|489805_490096_+	hypothetical protein	NA	E2ELK3	Clostridium_phage	50.5	1.5e-18
WP_036655918.1|490409_490646_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	R9W0N4	Paenibacillus_phage	98.6	6.0e-31
WP_077996662.1|491323_491569_+|transposase	transposase	transposase	A0A2I7SC00	Paenibacillus_phage	93.8	2.2e-31
WP_149867748.1|491929_492331_+	hypothetical protein	NA	D2XR29	Bacillus_phage	45.1	3.3e-21
WP_036655919.1|493054_493501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996665.1|494578_495262_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	97.8	6.9e-120
WP_079940506.1|496190_496835_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_104932629.1|496811_497929_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	99.3	2.1e-153
WP_079940507.1|497953_499351_+	phosphatidylinositol-specific phospholipase C domain-containing protein	NA	NA	NA	NA	NA
WP_036654509.1|499712_500396_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932634.1|500416_501286_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_077996666.1|501871_503146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940508.1|503216_505829_+	peptidase	NA	A0A1V0E026	Clostridioides_phage	33.4	2.6e-98
WP_079940509.1|506354_506960_+	ADP-ribosyltransferase	NA	Q331X8	Clostridium_botulinum_C_phage	41.8	9.7e-33
WP_077996667.1|507314_508286_+	hypothetical protein	NA	A0A2I7SCU7	Paenibacillus_phage	78.9	2.9e-143
WP_077996668.1|508345_509365_+	hypothetical protein	NA	A0A2I7SDE4	Paenibacillus_phage	61.5	1.9e-60
WP_077996669.1|509381_509789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932629.1|510145_511262_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	99.3	2.1e-153
WP_104932635.1|511316_511415_+	dihydroorotate dehydrogenase	NA	A0A2I7SCT3	Paenibacillus_phage	96.9	2.3e-08
>prophage 2
NZ_CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	595355	639752	4268596	bacteriocin,transposase	Paenibacillus_phage(30.77%)	49	NA	NA
WP_077996720.1|595355_595691_-|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_079940518.1|596648_597737_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_024095277.1|597961_598507_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_077997624.1|598654_599047_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_079940519.1|599084_601055_-	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_024095275.1|601101_601302_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_024095273.1|601489_601915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036654509.1|602215_602899_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932621.1|602919_603789_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_144029657.1|603895_604855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996722.1|605073_605892_+	RNA polymerase sigma factor SigI	NA	NA	NA	NA	NA
WP_077996723.1|605884_606997_+	anti-sigma factor domain-containing protein	NA	NA	NA	NA	NA
WP_077996724.1|607209_608115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932621.1|608186_609056_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_036654509.1|609076_609760_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_077996725.1|609879_610329_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_052337463.1|610469_611009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940521.1|611369_612836_-	glycine dehydrogenase subunit 2	NA	E3ST28	Prochlorococcus_phage	39.4	1.8e-80
WP_077996726.1|612832_614188_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	38.1	5.3e-55
WP_077996727.1|614228_615335_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_024095265.1|615951_616341_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_023484889.1|616562_616997_+	universal stress protein	NA	NA	NA	NA	NA
WP_077585182.1|617296_617581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996728.1|617610_618567_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	64.0	2.3e-121
WP_023484892.1|618621_619107_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	42.5	1.1e-31
WP_077996729.1|619175_619484_+	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_023484894.1|619504_619705_+	heavy-metal-associated domain-containing protein	NA	A0A218MNH0	uncultured_virus	40.0	6.3e-05
WP_079940522.1|619799_622226_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.0	4.8e-115
WP_077997625.1|622282_622906_-	YcnI family protein	NA	NA	NA	NA	NA
WP_023484897.1|622995_623673_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_036657484.1|623669_624476_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_036655989.1|624765_625008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996732.1|625731_626016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996733.1|626188_627874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996734.1|628183_628540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996735.1|628766_629429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996736.1|629742_629937_+	helix-turn-helix transcriptional regulator	NA	A0A139ZPI6	Marinitoga_camini_virus	37.3	8.0e-05
WP_024095256.1|630336_631038_-	iron-sulfur cluster repair di-iron protein	NA	NA	NA	NA	NA
WP_077996738.1|631395_632628_+	FprA family A-type flavoprotein	NA	NA	NA	NA	NA
WP_077996739.1|632652_633891_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024095255.1|634028_634193_+	rubredoxin	NA	NA	NA	NA	NA
WP_077996740.1|634264_634972_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_077996741.1|635247_635901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996742.1|636017_637199_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_155121072.1|637384_637549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996743.1|638006_638129_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_158672712.1|638095_638452_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	42.2	3.3e-12
WP_077996746.1|638530_638848_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158672713.1|638915_639752_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.5	1.9e-47
>prophage 3
NZ_CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	763737	854197	4268596	head,capsid,transposase,integrase,protease,portal,terminase,tail	Paenibacillus_phage(70.15%)	106	768921:768980	830684:832406
WP_077995397.1|763737_764961_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	4.0e-227
WP_023485364.1|766735_767107_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_023485363.1|767183_768695_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_079940531.1|768718_768943_+	hypothetical protein	NA	NA	NA	NA	NA
768921:768980	attL	ATGATATGCTCCCCTTGCGGTAGACAGTTGAAATAATAAAACTGTTTACTGTAAGGAGGA	NA	NA	NA	NA
WP_036654509.1|768990_769674_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932621.1|769694_770564_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_077996804.1|770763_771180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996805.1|771444_771756_+	DUF1805 domain-containing protein	NA	NA	NA	NA	NA
WP_077996806.1|771742_772108_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077996807.1|772154_772796_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_077996808.1|772931_774038_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_077996809.1|774057_775287_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_024093280.1|775505_775955_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.3	8.5e-42
WP_077996810.1|776126_776699_+	DUF1802 family protein	NA	NA	NA	NA	NA
WP_077996811.1|776879_777713_+	Fe-S cluster assembly ATPase SufC	NA	W8CYL7	Bacillus_phage	25.3	2.2e-06
WP_024093282.1|777780_779076_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_077996812.1|779072_780299_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	46.5	2.5e-112
WP_023485352.1|780285_780723_+	SUF system NifU family Fe-S cluster assembly protein	NA	A0A218MKD1	uncultured_virus	31.2	1.1e-12
WP_023485351.1|780747_782145_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_077997632.1|782226_783393_-|integrase	site-specific integrase	integrase	S5MBZ0	Brevibacillus_phage	37.2	3.6e-60
WP_077996813.1|783475_784108_-	helix-turn-helix domain-containing protein	NA	A0A1B2APZ3	Phage_Wrath	67.6	3.2e-79
WP_077996814.1|784260_784509_+	helix-turn-helix transcriptional regulator	NA	A0A1B2APZ4	Phage_Wrath	68.0	4.6e-21
WP_077997633.1|784542_784815_+	group-specific protein	NA	A0A1B1P7U4	Bacillus_phage	57.1	1.8e-23
WP_077996815.1|784899_785154_+	hypothetical protein	NA	A0A0C5AER7	Bacteriophage	91.5	1.3e-34
WP_077996816.1|785150_785522_+	hypothetical protein	NA	R9VW30	Paenibacillus_phage	90.0	8.5e-56
WP_077996817.1|785518_785743_+	hypothetical protein	NA	A0A0K2CZE0	Paenibacillus_phage	72.5	7.8e-20
WP_158672717.1|785739_785910_+	hypothetical protein	NA	A0A0K2CZS8	Paenibacillus_phage	92.0	8.2e-22
WP_077996818.1|785914_786103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996819.1|786099_786777_+	hypothetical protein	NA	A0A2I7SCV5	Paenibacillus_phage	84.5	1.8e-59
WP_077996820.1|786791_787055_+	hypothetical protein	NA	A0A0C5AFB6	Paenibacillus_phage	70.1	5.7e-30
WP_155121034.1|787233_787401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996822.1|788342_789146_+	hypothetical protein	NA	A0A0P0IZH9	Lactobacillus_phage	40.0	5.4e-47
WP_077996823.1|789195_789597_+	single-stranded DNA-binding protein	NA	A0A0K2CYR2	Paenibacillus_phage	73.5	3.9e-46
WP_077996824.1|789621_789954_+	hypothetical protein	NA	A0A0K2CY25	Paenibacillus_phage	92.7	1.6e-53
WP_077996825.1|790002_790893_+	DnaD domain protein	NA	A0A0K2CY85	Paenibacillus_phage	86.5	2.7e-124
WP_077997634.1|790783_791605_+	ATP-binding protein	NA	A0A0K2CYY7	Paenibacillus_phage	96.8	8.6e-117
WP_077996826.1|791722_791953_+	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	98.6	9.7e-34
WP_077996827.1|791933_792455_+	hypothetical protein	NA	R9TMF8	Paenibacillus_phage	53.5	1.5e-50
WP_077996828.1|792636_792867_+	hypothetical protein	NA	R9TMG2	Paenibacillus_phage	66.2	6.1e-20
WP_077996830.1|793427_793796_+	hypothetical protein	NA	R9W0Q6	Paenibacillus_phage	77.3	1.4e-13
WP_077996831.1|793802_794036_+	hypothetical protein	NA	A0A0K2CYJ4	Paenibacillus_phage	69.8	1.7e-14
WP_158672718.1|794028_794439_+	hypothetical protein	NA	A8ASP1	Listeria_phage	39.4	8.9e-14
WP_077996833.1|794428_794665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996834.1|794692_795130_+	transcriptional regulator	NA	A0A0K2CYZ6	Paenibacillus_phage	95.9	2.5e-70
WP_077996835.1|795335_795677_+	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	100.0	8.4e-58
WP_077996836.1|795687_797151_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	49.1	1.3e-123
WP_104932795.1|797292_797592_+	DUF3310 domain-containing protein	NA	E5DV94	Deep-sea_thermophilic_phage	42.9	4.8e-09
WP_077996839.1|797772_798087_+	hypothetical protein	NA	A0A0K2CZ01	Paenibacillus_phage	86.5	8.3e-44
WP_077996840.1|798073_798415_+	HNH endonuclease	NA	A0A0K2CYS9	Paenibacillus_phage	98.2	4.4e-59
WP_077996841.1|798549_798867_+|terminase	phage terminase small subunit P27 family	terminase	A0A0C5AMZ2	Paenibacillus_phage	89.5	1.7e-44
WP_077996842.1|798841_800575_+|terminase	terminase large subunit	terminase	A0A0K2CZH9	Paenibacillus_phage	63.5	1.1e-214
WP_077996843.1|800593_801853_+|portal	phage portal protein	portal	A0A0A7RUE7	Clostridium_phage	22.9	4.9e-18
WP_158676621.1|801809_802391_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	34.0	4.4e-14
WP_158672719.1|802402_803587_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_158672720.1|803588_803885_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J6E5	uncultured_Caudovirales_phage	40.7	2.9e-14
WP_158672721.1|803862_804180_+|head	phage head closure protein	head	A0A0C5AE87	Paenibacillus_phage	92.4	2.2e-52
WP_077996848.1|804179_804608_+	hypothetical protein	NA	A0A0C5AJ13	Paenibacillus_phage	94.4	3.0e-68
WP_158672722.1|804591_804987_+	DUF3168 domain-containing protein	NA	A0A0C5AEH4	Paenibacillus_phage	84.7	9.1e-56
WP_077996850.1|804988_805423_+|tail	phage major tail protein, TP901-1 family	tail	A0A2I7SCY9	Paenibacillus_phage	95.8	2.0e-72
WP_104932650.1|805422_805761_+	hypothetical protein	NA	A0A0C5ABB9	Paenibacillus_phage	51.3	1.5e-22
WP_158672723.1|805793_806042_+	hypothetical protein	NA	A0A0C5AE91	Paenibacillus_phage	70.4	4.7e-26
WP_077996853.1|806096_808733_+|tail	phage tail tape measure protein	tail	A0A0C5AJ16	Paenibacillus_phage	95.9	8.0e-249
WP_158672724.1|808729_809605_+|tail	phage tail family protein	tail	A0A0C5AEI0	Paenibacillus_phage	46.0	5.0e-70
WP_158672725.1|809607_810738_+	hypothetical protein	NA	A0A0K2CZQ1	Paenibacillus_phage	33.8	1.7e-59
WP_104932651.1|810742_812710_+	hypothetical protein	NA	E2ELJ8	Clostridium_phage	48.7	1.5e-53
WP_077996857.1|812722_812908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996858.1|812925_813108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158672726.1|813100_813256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094415.1|813296_813536_+	hypothetical protein	NA	R9W0N4	Paenibacillus_phage	100.0	2.8e-36
WP_077996859.1|814479_814722_+|transposase	transposase	transposase	A0A0C5AN23	Paenibacillus_phage	93.8	4.3e-32
WP_104932634.1|815984_816854_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_036654509.1|816874_817558_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_036656178.1|817653_817836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996860.1|817991_818585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996861.1|818827_819430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996863.1|819783_820185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155121080.1|820171_820312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996864.1|820461_821331_+	hypothetical protein	NA	A0A2I7SC02	Paenibacillus_phage	45.3	1.3e-09
WP_155121081.1|821303_821456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093293.1|821593_821833_+	hypothetical protein	NA	R9W0N4	Paenibacillus_phage	96.2	4.1e-35
WP_077996865.1|822580_822826_+|transposase	transposase	transposase	A0A2I7SC00	Paenibacillus_phage	88.9	2.8e-31
WP_077996866.1|823012_824410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104935363.1|825442_828046_+	hypothetical protein	NA	A0A0K2CYN4	Paenibacillus_phage	56.8	4.6e-265
WP_077996868.1|828821_830384_+	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_036654509.1|830753_831437_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932621.1|831457_832327_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_077996871.1|832791_832956_+	hypothetical protein	NA	NA	NA	NA	NA
830684:832406	attR	ATGATATGCTCCCCTTGCGGTAGACAGTTGAAATAATAAAACTGTTTACTGTAAGGAGGAGCATTTTTTCATGTCCCATAAAGCAAAAGTATCAGGATCAGAAAAGATTGCAGCTGTTGAAAAGTATTTACGTGGAGAAGATTCGCTTAATCATTTAGCAGCACTTCTTGATGTACGCCATTCATCCGTTAGGCAATGGCTTCAGACTTACCAGTCGCTAGGCCCAAACGGATTGCTTCAAACATCACAGAATGCATCTTACTCCGCAGAGTTAAAAAGAATAGCTGTCGAGGACTATTTGGCTGGCGGCGGTTCTCACATGGATATTTGTAAAAGATATGGCATTAAGTCAACTTGCCAATTGCGGGATTGGATTCTGAAGTATAATAGTCATGAGAAGTTGAACACTTCCGGAACGGGAGGAGTGCCGATCATGACAAAAGGACGAACAACTACTTACGATGAGAGAGTTGAAATCGTCAGATTCTGCATTGAACATCAACACAATTATGCCCAGACAGCTGATAAATTCCAGGTATCCTATCAGCAAGTTTATTCATGGACAAATAAATACTTAACATCTGGTGTGGATGCACTTCAGGACAGACGCGGGAAAAGAAAATCTGAGGATGAGATGTCCGAAGTGGAGAAACTAAGGGCTCAGAATAAGCTGTTACAGGCTGAGAACAGAAGGAAGCAGATGGAGATCGATTTGCTAAAAAAGTTGGACGAGATCGAAAGGAGGCGGTTCTAAGCCAGGTAAGGTATGAAACGATATACCTTGCAATACGCGGGCTCCGTGAAACGAAGTCATATCCCATATGTCAATTATGTGATCTTATTGGGATCCAACGTTCATCGTATTATAAATGGATCAACCGGAAAGAAAGTATTAATGAGATCTTTAATAAAGCGTTGCTTCCCATGATTAAAGATGCCTACGAGGAAAAGGATGGCATCCTTGGATATCGCCAGATGACCATTAAACTAAACCGGGAACGCCATGTAACTGTCAATCATAAGCGAATATACAGACTTATGGGCATCCTAGGCCTTAAATCGGTATGCCGCAGGAAGCGAAAAAACTACATCCATTCCACACCTGAAATTACGGCGGAAAATATCCTGAACAGAGACTTTGAATCCTCTGAGTTTGGTACGAAATGGCTCACAGATGTGACTGAAATGAAGTATGGCAACCAAAACAAGGCTTATCTTAGTGCAATCCTTGATTTGTCGGATAAAAGCATTGTTTCTTTTGTGGTAGGGCATTCCAACAACAATGAACTTGTATTTAAAACTTTTGATATCGCCCATATGACTTATCCTGACGCTACACCCCTCTTTCACAGTGACCGGGGTTTCCAATATACATGTAAAATCTTCAAGAAAAAACTAGACGATGCAGGTATGATCCAAAGCATGTCCAGGGTATCCAGATGTATAGATAATGGCCCAATGGAATCATTCTGGGGAATGATGAAATCCGAAATGTATTATCTTCGTAAGTTCTATACATATGAGGAACTGGAAGCAGCCGTGATAGAATACATCGATTACTACAATACTCGTCGATACCAGAAAAGACTTAATTGTATGACGCCGTTGGAATATAGGCAATACCTTCTAAGTTCAGCAGCATAGAAAATGGCACCAACCATGTATGGTTAGTGCCACAACTTTTTTTGTTTTTTACACTGTCTACTTGACAGGGGTCAGTTCA	NA	NA	NA	NA
WP_077996872.1|834248_834869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158672727.1|835008_836292_+	MFS transporter	NA	D0R099	Streptococcus_phage	22.5	1.2e-08
WP_077996875.1|837979_838612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995249.1|838854_840075_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
WP_077997637.1|842847_843885_+	amidinotransferase	NA	NA	NA	NA	NA
WP_077996877.1|844311_844512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158672728.1|845074_845275_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	52.4	3.1e-12
WP_155121082.1|845376_845550_+	hypothetical protein	NA	A0A0C5AMZ7	Paenibacillus_phage	90.7	7.1e-13
WP_155121083.1|845593_845767_+	hypothetical protein	NA	A0A2I7SDE4	Paenibacillus_phage	98.2	8.3e-22
WP_077996880.1|845994_846402_+	hypothetical protein	NA	A0A2I7SDE8	Paenibacillus_phage	94.0	3.4e-66
WP_077995249.1|846746_847967_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
WP_077996881.1|849044_849233_-	hypothetical protein	NA	A0A2I7SC09	Paenibacillus_phage	78.7	9.1e-22
WP_077996882.1|850050_850455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996883.1|850436_850733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155121084.1|851269_851434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996884.1|851668_852604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996885.1|852627_853017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155121085.1|853013_853151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093300.1|853870_854197_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	865555	921237	4268596	holin,transposase,coat	Paenibacillus_phage(43.75%)	50	NA	NA
WP_104932652.1|865555_866419_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	98.3	2.8e-134
WP_077996122.1|866441_867125_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	96.9	1.7e-118
WP_077585196.1|867305_867518_+|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_024093310.1|867790_868057_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_040932682.1|868098_868668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996892.1|869060_869357_+	hypothetical protein	NA	A0A0K2CZ50	Paenibacillus_phage	70.6	3.5e-12
WP_023484389.1|869586_870492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158225767.1|870614_870749_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_024093313.1|871695_871893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996893.1|872588_873194_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.5	6.1e-51
WP_077996894.1|873326_873821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036657847.1|874058_874448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036654509.1|874612_875296_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932621.1|875316_876186_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_077996895.1|876577_877126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996896.1|877152_877407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996897.1|877811_880127_+	cation-translocating P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	24.7	4.9e-32
WP_023483454.1|880904_881573_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077996898.1|881858_883511_+	mannitol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_077996899.1|883501_884572_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_077996900.1|886197_887592_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_023483448.1|887657_888308_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_077996901.1|888309_889314_+	sugar kinase	NA	NA	NA	NA	NA
WP_158672833.1|889287_889419_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077996902.1|889517_891350_+	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_077996903.1|891369_892248_+	ketose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_079940350.1|892275_894159_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_077996904.1|894187_894652_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_036658101.1|894681_894996_+	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_104932653.1|895004_896105_+	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_077996906.1|896485_898015_-	glycosyltransferase	NA	A0A0N7G7L1	Chrysochromulina_ericina_virus	32.4	5.9e-42
WP_077996907.1|898232_899099_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	31.4	1.1e-08
WP_077996908.1|899214_900354_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_077996909.1|900350_900992_+	acetyltransferase	NA	NA	NA	NA	NA
WP_077996910.1|901009_901732_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_077996911.1|902127_902766_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_036656232.1|904966_905245_-	HU family DNA-binding protein	NA	M4SRV7	Rhodobacter_phage	38.3	7.2e-07
WP_023483458.1|905345_905552_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	64.6	4.6e-19
WP_155121046.1|910069_910213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932654.1|910603_911721_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	100.0	2.4e-154
WP_155116254.1|911995_912139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996914.1|913038_913479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996915.1|913765_914047_-	sugar nucleotide-binding protein	NA	NA	NA	NA	NA
WP_077996916.1|913854_914313_-	sugar nucleotide-binding protein	NA	NA	NA	NA	NA
WP_077996917.1|915276_915999_-	NTP transferase domain-containing protein	NA	H9NC64	Sphingomonas_phage	40.6	7.8e-45
WP_158672730.1|916244_916427_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077996919.1|917012_917903_+	hypothetical protein	NA	A0A024B055	Bacillus_phage	43.6	3.7e-12
WP_077997639.1|918207_919089_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_077996920.1|919640_920522_+	hypothetical protein	NA	D2KRB9	Lactobacillus_phage	33.0	2.0e-10
WP_023484075.1|920838_921237_+|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	43.5	1.1e-21
>prophage 5
NZ_CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	1034574	1101790	4268596	transposase,plate,portal,coat,bacteriocin,tRNA,tail	Paenibacillus_phage(30.77%)	77	NA	NA
WP_024095080.1|1034574_1034736_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_024095079.1|1035198_1035456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023482424.1|1035565_1036621_+	nucleoid-associated protein	NA	A0A0A8WF33	Clostridium_phage	25.0	6.3e-11
WP_079940336.1|1036635_1038117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996979.1|1038169_1038646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997645.1|1038963_1039326_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2P1JU12	Anoxybacillus_phage	40.7	7.9e-14
WP_077996980.1|1039426_1039882_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_079940799.1|1040135_1040576_+	transcriptional regulator	NA	A0A0C5AC66	Paenibacillus_phage	78.0	1.1e-57
WP_079940335.1|1040677_1041349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023482429.1|1041820_1042249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996983.1|1042223_1042406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996984.1|1042406_1043741_+|tail	phage tail sheath protein	tail	A0A0A7S087	Clostridium_phage	46.4	1.7e-109
WP_077996985.1|1043742_1044204_+|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	60.3	2.1e-48
WP_077996986.1|1044223_1044646_+|portal	phage portal protein	portal	X5JAB6	Clostridium_phage	41.8	4.4e-24
WP_079940334.1|1045017_1047063_+	hypothetical protein	NA	A0A0K2CP22	Brevibacillus_phage	41.7	3.0e-134
WP_079940333.1|1047062_1047704_+	LysM peptidoglycan-binding domain-containing protein	NA	S5MUH0	Brevibacillus_phage	46.3	4.6e-49
WP_077996990.1|1047708_1048677_+	hypothetical protein	NA	S5MNC9	Brevibacillus_phage	59.8	1.7e-111
WP_077996991.1|1048676_1048964_+	DUF2577 domain-containing protein	NA	S5MC71	Brevibacillus_phage	39.3	1.5e-15
WP_077996992.1|1048966_1049389_+	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	48.5	2.5e-27
WP_079940332.1|1049366_1050443_+|plate	baseplate J/gp47 family protein	plate	S5MUH6	Brevibacillus_phage	50.6	4.8e-99
WP_077997646.1|1050447_1051017_+	DUF2313 domain-containing protein	NA	S5MA71	Brevibacillus_phage	42.3	2.7e-32
WP_077996993.1|1051013_1051292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996994.1|1051295_1053068_+	hypothetical protein	NA	S5MNY5	Brevibacillus_phage	45.2	3.2e-15
WP_077996995.1|1053080_1053476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155121041.1|1053468_1053627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996996.1|1053665_1053905_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	R9W0N4	Paenibacillus_phage	98.7	6.3e-36
WP_104932656.1|1054825_1055056_+|transposase	transposase	transposase	A0A2I7SC00	Paenibacillus_phage	100.0	3.9e-27
WP_155121040.1|1055202_1055370_+	hypothetical protein	NA	A0A0K2CZ50	Paenibacillus_phage	78.1	6.2e-06
WP_079940798.1|1055721_1056780_+	malate permease	NA	NA	NA	NA	NA
WP_077996997.1|1056816_1057839_+	lactate dehydrogenase	NA	A0A1V0SBV6	Catovirus	28.5	6.3e-16
WP_077996998.1|1058020_1058227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995249.1|1058356_1059577_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
WP_158672732.1|1059789_1061061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997000.1|1061742_1062090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997648.1|1062140_1062485_-	DUF2512 family protein	NA	NA	NA	NA	NA
WP_023484507.1|1062669_1062873_+|coat	spore coat-like protein	coat	NA	NA	NA	NA
WP_024093574.1|1062891_1063194_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_023484509.1|1064020_1065160_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_077997001.1|1065344_1065698_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_023484510.1|1065709_1066141_+	EutP/PduV family microcompartment system protein	NA	NA	NA	NA	NA
WP_036655167.1|1066375_1066948_+	ANTAR domain-containing response regulator	NA	NA	NA	NA	NA
WP_077997002.1|1066940_1068365_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_077997003.1|1068506_1069937_+	ethanolamine ammonia-lyase reactivating factor EutA	NA	NA	NA	NA	NA
WP_077997004.1|1069966_1071331_+	ethanolamine ammonia-lyase subunit EutB	NA	NA	NA	NA	NA
WP_077997005.1|1071352_1072303_+	ethanolamine ammonia-lyase subunit EutC	NA	NA	NA	NA	NA
WP_023484516.1|1072321_1072975_+	ethanolamine utilization microcompartment protein EutL	NA	NA	NA	NA	NA
WP_077997006.1|1072986_1073727_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_077997007.1|1073877_1075341_+	acetaldehyde dehydrogenase (acetylating)	NA	NA	NA	NA	NA
WP_036655161.1|1075390_1075678_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_077997008.1|1075822_1076650_+	cobalamin adenosyltransferase	NA	NA	NA	NA	NA
WP_077997009.1|1076661_1077300_+	phosphate propanoyltransferase	NA	NA	NA	NA	NA
WP_024093587.1|1077318_1078002_+	putative ethanolamine utilization protein	NA	NA	NA	NA	NA
WP_036655159.1|1078014_1078287_+	EutN/CcmL family microcompartment protein	NA	NA	NA	NA	NA
WP_036655157.1|1078279_1078825_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_077997010.1|1078844_1079960_+	ethanolamine utilization protein EutH	NA	NA	NA	NA	NA
WP_077997011.1|1080298_1081150_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036655155.1|1082586_1082781_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077997012.1|1083114_1083582_+	hypothetical protein	NA	A0A0K2CP77	Brevibacillus_phage	30.5	3.5e-22
WP_144029556.1|1084507_1084810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997013.1|1084826_1085351_+	VanZ family protein	NA	NA	NA	NA	NA
WP_077997014.1|1085420_1085834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997015.1|1086106_1086409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997016.1|1086793_1087231_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_077997017.1|1087819_1088875_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	30.5	1.7e-16
WP_077997019.1|1089271_1089910_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_077997020.1|1090198_1091260_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_077997021.1|1091314_1092367_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_077997022.1|1092626_1093097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093604.1|1093159_1093537_+	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_077585253.1|1093583_1093730_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077585252.1|1094295_1094820_-	GNAT family N-acetyltransferase	NA	D0R097	Streptococcus_phage	28.3	1.0e-06
WP_077997023.1|1097143_1098442_+	alpha-glucosidase/alpha-galactosidase	NA	NA	NA	NA	NA
WP_036654509.1|1098537_1099221_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932657.1|1099241_1100111_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	99.6	1.1e-135
WP_077997024.1|1100232_1101198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155121039.1|1101358_1101538_+	hypothetical protein	NA	A0A2I7SCT0	Paenibacillus_phage	98.3	1.1e-29
WP_077997025.1|1101547_1101790_+|transposase	transposase	transposase	A0A2I7SCT4	Paenibacillus_phage	93.8	1.2e-31
>prophage 6
NZ_CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	1249702	1288160	4268596	holin,transposase,integrase,protease	Paenibacillus_phage(45.45%)	38	1263808:1263823	1290274:1290289
WP_077995375.1|1249702_1250926_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_077997111.1|1251109_1252306_+	MFS transporter	NA	NA	NA	NA	NA
WP_077997112.1|1253208_1253913_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_023483185.1|1254108_1255062_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A097BYJ7	Leuconostoc_phage	26.3	1.2e-05
WP_079940311.1|1257160_1258420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997115.1|1258460_1259024_-	signal peptidase I	NA	NA	NA	NA	NA
WP_077997116.1|1259223_1260144_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_104932660.1|1260369_1262580_-	SpoIID/LytB domain-containing protein	NA	Q2XU88	Pseudomonas_phage	25.5	3.5e-11
WP_023483179.1|1263065_1263980_+	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	45.5	1.8e-70
1263808:1263823	attL	AATTTCAAATGCTTTA	NA	NA	NA	NA
WP_024094971.1|1264006_1265575_+	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_077997118.1|1265799_1266723_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_077997119.1|1266908_1267904_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_077997652.1|1268250_1268763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997120.1|1268861_1269440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997121.1|1269592_1271026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997122.1|1271055_1272045_-	glycosyltransferase family 2 protein	NA	B9UDL7	Salmonella_phage	40.0	2.4e-49
WP_158672737.1|1272332_1272824_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_077997124.1|1272963_1273593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997125.1|1273589_1274648_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_077997126.1|1274704_1275643_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.0	7.8e-21
WP_077997127.1|1275635_1276415_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_079940308.1|1276602_1277952_+	hypothetical protein	NA	A0A0K2CP77	Brevibacillus_phage	35.1	3.1e-71
WP_155121036.1|1277955_1278096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997129.1|1278079_1278292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997130.1|1278382_1278910_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_158672738.1|1279351_1281310_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_077997133.1|1281302_1282445_+	amidohydrolase/deacetylase family metallohydrolase	NA	NA	NA	NA	NA
WP_024094960.1|1282423_1282786_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_023483163.1|1282825_1283182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158672739.1|1283185_1283524_+	DUF4312 family protein	NA	NA	NA	NA	NA
WP_036658006.1|1283544_1284330_+	DUF4311 domain-containing protein	NA	NA	NA	NA	NA
WP_079940306.1|1284332_1284998_+	DUF4310 family protein	NA	NA	NA	NA	NA
WP_023483159.1|1285039_1286146_+	DgaE family pyridoxal phosphate-dependent ammonia lyase	NA	NA	NA	NA	NA
WP_023483158.1|1286149_1286884_+	oxo-acid lyase	NA	NA	NA	NA	NA
WP_024094956.1|1287113_1287269_-|integrase	phage integrase family protein	integrase	A0A0K2CZ62	Paenibacillus_phage	88.2	4.5e-19
WP_077997135.1|1287282_1287615_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	78.3	1.0e-44
WP_149867773.1|1287636_1287828_-	hypothetical protein	NA	A0A0K2CZ62	Paenibacillus_phage	76.2	1.6e-21
WP_077584997.1|1288073_1288160_+|holin	putative holin-like toxin	holin	A0A0K2CZR6	Paenibacillus_phage	100.0	2.0e-05
1290274:1290289	attR	TAAAGCATTTGAAATT	NA	NA	NA	NA
>prophage 7
NZ_CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	1415079	1421834	4268596		Staphylococcus_phage(57.14%)	7	NA	NA
WP_023482600.1|1415079_1415517_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	45.3	1.6e-21
WP_036658391.1|1416461_1417574_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.5	1.2e-52
WP_023482602.1|1417577_1418243_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	43.3	3.4e-39
WP_077997196.1|1418277_1419510_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	51.3	5.6e-112
WP_024093718.1|1419541_1420012_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	57.9	6.2e-43
WP_077997197.1|1420441_1421224_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.3	1.3e-08
WP_036658393.1|1421192_1421834_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	31.9	8.2e-14
>prophage 8
NZ_CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	1581054	1621406	4268596	transposase,protease	Paenibacillus_phage(77.78%)	39	NA	NA
WP_077995397.1|1581054_1582278_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	4.0e-227
WP_158672748.1|1582342_1583308_+	hypothetical protein	NA	S5W9C6	Leptospira_phage	41.5	1.1e-09
WP_079940561.1|1583378_1584005_+	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
WP_077997276.1|1584054_1584363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997277.1|1584340_1584667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997661.1|1584956_1585220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997279.1|1585232_1585538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995375.1|1585778_1587002_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_158672749.1|1587083_1587818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940562.1|1587836_1588529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158672750.1|1588568_1589612_+	RHS repeat-associated core domain-containing protein	NA	S5W9C6	Leptospira_phage	37.2	4.8e-11
WP_149867785.1|1592806_1593106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995375.1|1593462_1594686_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_077997286.1|1595286_1595691_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077997287.1|1595701_1596433_-	RNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_079940564.1|1596436_1597303_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_077997288.1|1597506_1598523_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_036654509.1|1598589_1599273_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932621.1|1599293_1600163_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_077997289.1|1600279_1601134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997290.1|1601130_1602279_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_079940565.1|1602285_1603395_+	glucose-1-phosphate adenylyltransferase subunit GlgD	NA	NA	NA	NA	NA
WP_077997291.1|1603425_1604871_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_024093827.1|1605345_1605576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149867786.1|1605892_1606231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997293.1|1606290_1606548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997294.1|1606566_1607142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997662.1|1608993_1610520_-	family 10 glycosylhydrolase	NA	NA	NA	NA	NA
WP_079940566.1|1610858_1612082_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_077997296.1|1612417_1613659_+	arginine deiminase	NA	NA	NA	NA	NA
WP_077997663.1|1613676_1614675_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_024093832.1|1614770_1616186_+	arginine-ornithine antiporter	NA	NA	NA	NA	NA
WP_042118868.1|1616202_1617156_+	carbamate kinase	NA	NA	NA	NA	NA
WP_024093834.1|1617194_1617881_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_023482955.1|1617936_1618434_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_077997297.1|1618869_1619190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036654509.1|1619294_1619978_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932634.1|1619998_1620868_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_023482953.1|1620980_1621406_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
>prophage 9
NZ_CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	1625747	1693461	4268596	transposase,protease,coat,bacteriocin,tRNA	Staphylococcus_phage(20.0%)	50	NA	NA
WP_077997664.1|1625747_1625987_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_079940567.1|1626093_1627857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997303.1|1627853_1628393_+	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_077997305.1|1628964_1629633_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	2.3e-14
WP_077997665.1|1629992_1631516_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_077997306.1|1631612_1632590_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_077997307.1|1632597_1633608_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_079940568.1|1633600_1634629_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_077997308.1|1634975_1636157_+	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	38.9	7.7e-26
WP_104932668.1|1636312_1637430_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	99.3	4.6e-153
WP_077997309.1|1637542_1638379_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077997310.1|1638441_1639317_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_079940569.1|1639464_1640682_-	cytochrome P450	NA	NA	NA	NA	NA
WP_079940570.1|1641144_1643025_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_042119509.1|1643111_1643381_-	DUF2642 domain-containing protein	NA	NA	NA	NA	NA
WP_079940571.1|1643800_1644601_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_077997313.1|1644723_1645830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940572.1|1646171_1649147_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_155121089.1|1649180_1649363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940574.1|1649424_1649604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940575.1|1650719_1651394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997318.1|1651926_1652649_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077997319.1|1654015_1654315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155121090.1|1654623_1654773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940576.1|1656212_1658294_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_079940577.1|1659132_1660173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997666.1|1660700_1661453_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_079940578.1|1661515_1662208_-	LrgB family protein	NA	NA	NA	NA	NA
WP_077997322.1|1662197_1662563_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_155121120.1|1662890_1664093_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_077997323.1|1664301_1665624_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_155121091.1|1665909_1666071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940580.1|1666130_1667423_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_079940821.1|1667464_1669051_+	malate synthase A	NA	NA	NA	NA	NA
WP_104932669.1|1669186_1672312_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_079940583.1|1673089_1675339_+|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
WP_077997330.1|1675504_1675783_-	DUF2653 family protein	NA	NA	NA	NA	NA
WP_023482849.1|1675782_1676214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042119140.1|1676341_1676896_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_077997331.1|1676892_1677483_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_042119138.1|1677505_1677841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940584.1|1677947_1679468_+	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_079940822.1|1680057_1681017_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
WP_023482840.1|1683640_1684603_+	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_023482839.1|1684700_1685270_+|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
WP_104932670.1|1685371_1686727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940586.1|1686850_1689532_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	22.1	3.8e-28
WP_079940587.1|1689562_1691611_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.0	3.5e-66
WP_036656949.1|1691731_1692511_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_077997333.1|1692498_1693461_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	1712893	1770326	4268596	transposase,integrase	Paenibacillus_phage(36.84%)	52	1705524:1705540	1775514:1775530
1705524:1705540	attL	TAAAAACATTCATAATC	NA	NA	NA	NA
WP_077995249.1|1712893_1714114_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
WP_158672752.1|1714248_1714491_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_158672753.1|1714399_1714681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104935368.1|1714733_1715054_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077997348.1|1715098_1715425_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_104935369.1|1715493_1715913_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2SXP1	Bacillus_phage	61.4	8.2e-39
WP_046655237.1|1715992_1716343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052337438.1|1719018_1720110_+	LCP family protein	NA	NA	NA	NA	NA
WP_077997668.1|1720210_1720441_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CYV5	Paenibacillus_phage	49.3	4.4e-10
WP_024094581.1|1720937_1721204_+	hypothetical protein	NA	A0A2I7SCW2	Paenibacillus_phage	72.7	1.9e-28
WP_077997351.1|1721349_1721967_-	transcriptional repressor LexA	NA	E5DV74	Deep-sea_thermophilic_phage	35.6	5.3e-18
WP_036656935.1|1722245_1722491_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036654904.1|1722672_1722858_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_077997352.1|1722884_1723679_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_023484144.1|1723784_1724327_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_079940589.1|1724603_1728044_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	46.7	5.1e-09
WP_023484146.1|1728218_1729175_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_077996122.1|1731625_1732309_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	96.9	1.7e-118
WP_077997354.1|1732399_1733365_-	ETX/MTX2 family pore-forming toxin	NA	A0A2I7SC07	Paenibacillus_phage	58.2	9.6e-83
WP_149867798.1|1735010_1735220_+	hypothetical protein	NA	A0A0C5AFE4	Paenibacillus_phage	73.8	3.4e-17
WP_077997356.1|1735575_1737861_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_079940590.1|1737857_1739243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997358.1|1739402_1740206_+	Fpg/Nei family DNA glycosylase	NA	W5S5H6	Pithovirus	23.7	3.0e-05
WP_077997359.1|1740205_1741075_+	deoxyribonuclease IV	NA	A0A1V0SCI4	Indivirus	28.9	1.2e-23
WP_077997360.1|1741110_1741443_+	cell division protein FtsJ	NA	NA	NA	NA	NA
WP_077997361.1|1741548_1742253_+	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.5	2.1e-10
WP_077997364.1|1743664_1744141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995375.1|1744569_1745793_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_077997365.1|1745913_1746999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940591.1|1746980_1748231_+	CpaF family protein	NA	NA	NA	NA	NA
WP_023483043.1|1748237_1749152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094719.1|1749156_1750026_+	type II secretion system protein F	NA	NA	NA	NA	NA
WP_036654710.1|1750055_1750274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051427880.1|1750342_1751281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997366.1|1751292_1751901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149867800.1|1751863_1753534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483047.1|1753503_1754208_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_077997368.1|1754215_1754731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932674.1|1754743_1756486_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_077997372.1|1756625_1758182_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	5.7e-53
WP_036656764.1|1758207_1758498_+	Dabb family protein	NA	NA	NA	NA	NA
WP_077997373.1|1759891_1761805_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.9	4.9e-54
WP_036656763.1|1761835_1763455_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	27.9	2.4e-54
WP_023483495.1|1763537_1764071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997376.1|1764093_1764432_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_077997377.1|1764510_1764894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932675.1|1765100_1765553_-	AAA family ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	37.8	8.6e-10
WP_077997378.1|1766364_1767012_-	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_077997379.1|1767001_1767868_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.0e-19
WP_077997380.1|1767864_1768248_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_051427858.1|1768722_1768905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995375.1|1769102_1770326_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
1775514:1775530	attR	GATTATGAATGTTTTTA	NA	NA	NA	NA
>prophage 11
NZ_CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	1964966	1973450	4268596	transposase	Paenibacillus_phage(77.78%)	10	NA	NA
WP_077997474.1|1964966_1965491_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CZC9	Paenibacillus_phage	80.0	1.1e-45
WP_077584965.1|1965630_1965804_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CZS1	Paenibacillus_phage	91.3	2.9e-14
WP_079940630.1|1966004_1968080_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_036654509.1|1968403_1969087_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932621.1|1969107_1969977_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_079940631.1|1970228_1970411_+	hypothetical protein	NA	A0A0C5AEH5	Bacteriophage	89.7	9.7e-21
WP_158672763.1|1970407_1970776_+	hypothetical protein	NA	A0A2I7SC06	Paenibacillus_phage	86.9	4.5e-49
WP_077995249.1|1970874_1972095_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
WP_077997680.1|1972786_1972990_-	hypothetical protein	NA	A0A0C5AEJ6	Paenibacillus_phage	89.6	2.7e-27
WP_077997477.1|1973006_1973450_-	hypothetical protein	NA	A0A0K2CZD8	Paenibacillus_phage	56.6	1.7e-42
>prophage 12
NZ_CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	1999696	2057513	4268596	capsid,holin,integrase,portal,terminase,tail	Paenibacillus_phage(91.3%)	85	1992022:1992053	2052637:2052668
1992022:1992053	attL	TTTTAATTTTCCGTTCCCCTCGTGTTGTTATC	NA	NA	NA	NA
WP_079940638.1|1999696_2000920_-|integrase	site-specific integrase	integrase	A0A0C5AN64	Paenibacillus_phage	86.0	9.3e-200
WP_079940639.1|2000945_2001644_-	LexA family transcriptional regulator	NA	A0A2I7SCV6	Paenibacillus_phage	46.0	2.1e-47
WP_079940640.1|2001780_2001981_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J3K6	uncultured_Caudovirales_phage	44.1	1.6e-08
WP_079940641.1|2002046_2002274_+	excisionase family DNA-binding protein	NA	A0A0C5AN65	Paenibacillus_phage	77.1	9.0e-24
WP_155121099.1|2002299_2002713_+	hypothetical protein	NA	A0A0N9SSV8	Paenibacillus_phage	60.0	2.5e-24
WP_079940643.1|2002692_2003001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940644.1|2003120_2003759_+	hypothetical protein	NA	A0A0N9RZD8	Paenibacillus_phage	99.1	6.5e-128
WP_079940645.1|2003781_2004576_+	phage antirepressor KilAC domain-containing protein	NA	A0A0N9SJU0	Paenibacillus_phage	87.3	2.0e-126
WP_155121100.1|2004572_2004749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155121101.1|2004745_2004919_+	hypothetical protein	NA	A0A0N9SIN5	Paenibacillus_phage	91.2	1.6e-20
WP_077995167.1|2004915_2005218_+	hypothetical protein	NA	A0A0N9S7X2	Paenibacillus_phage	96.0	3.5e-47
WP_077995168.1|2005233_2005560_+	helix-turn-helix domain-containing protein	NA	A0A0N7GFE9	Paenibacillus_phage	94.4	6.6e-52
WP_149867651.1|2005695_2006187_+	hypothetical protein	NA	A0A0N9SJV6	Paenibacillus_phage	44.4	1.3e-19
WP_079940646.1|2006244_2006616_+	hypothetical protein	NA	A0A0N9SHL8	Paenibacillus_phage	92.7	3.4e-60
WP_040932746.1|2006599_2006977_+	hypothetical protein	NA	A0A0N9SSX1	Paenibacillus_phage	84.8	1.9e-55
WP_040932748.1|2006995_2007262_+	hypothetical protein	NA	A0A0N9RRC8	Paenibacillus_phage	84.1	3.7e-37
WP_077995171.1|2007269_2008040_+	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	94.9	2.5e-142
WP_077995172.1|2008036_2009413_+	AAA family ATPase	NA	A0A0N9SIP5	Paenibacillus_phage	84.5	2.3e-223
WP_079940647.1|2009425_2010376_+	toprim domain-containing protein	NA	A0A0N9S7Y2	Paenibacillus_phage	82.9	1.5e-152
WP_077995175.1|2010435_2011014_+	hypothetical protein	NA	A0A0N9SGJ9	Paenibacillus_phage	55.2	7.6e-51
WP_158676623.1|2011067_2011607_+	hypothetical protein	NA	A0A0N9RTM1	Paenibacillus_phage	93.7	1.1e-80
WP_077995177.1|2011691_2012414_+	hypothetical protein	NA	A0A0N9SJW5	Paenibacillus_phage	90.2	9.3e-123
WP_077995178.1|2012589_2012931_+	hypothetical protein	NA	A0A7H5	Microcystis_virus	43.5	4.7e-08
WP_077995179.1|2013075_2013489_+	hypothetical protein	NA	A0A0N9RZF9	Paenibacillus_phage	96.4	5.0e-73
WP_079940648.1|2013700_2014297_+	hypothetical protein	NA	A0A0N9SIQ5	Paenibacillus_phage	67.8	1.3e-61
WP_079940828.1|2014462_2016094_+	DNA polymerase I	NA	A0A0N9S7Z3	Paenibacillus_phage	94.3	2.9e-305
WP_149867652.1|2016062_2016413_+	hypothetical protein	NA	A0A0N9SGL0	Paenibacillus_phage	60.7	1.8e-31
WP_077995183.1|2016406_2017534_+	hypothetical protein	NA	A0A0N9RTM8	Paenibacillus_phage	79.4	4.6e-177
WP_077995184.1|2017534_2017732_+	hypothetical protein	NA	A0A0N7GFF2	Paenibacillus_phage	95.4	4.7e-29
WP_077995185.1|2017728_2018343_+	3'-5' exonuclease	NA	A0A0N9SJX9	Paenibacillus_phage	96.1	2.8e-104
WP_077995186.1|2018327_2019347_+	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	81.1	4.6e-136
WP_158672766.1|2019603_2019855_+	hypothetical protein	NA	A0A0N9ST03	Paenibacillus_phage	85.5	3.2e-30
WP_077995188.1|2019851_2020034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995189.1|2019999_2022318_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0Y0AS84	Bacillus_phage	63.4	1.3e-279
WP_077995190.1|2022331_2023363_+	ribonucleotide-diphosphate reductase subunit beta	NA	U5Q1G6	Bacillus_phage	61.2	1.9e-121
WP_079940649.1|2023374_2023902_+	dUTP diphosphatase	NA	D2XR49	Bacillus_phage	54.3	1.9e-40
WP_077995192.1|2023894_2024191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995193.1|2024187_2024526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040930425.1|2024526_2024853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995194.1|2024994_2025195_+	hypothetical protein	NA	A0A0N7GFF3	Paenibacillus_phage	95.2	1.1e-28
WP_077995195.1|2025191_2025422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995196.1|2025423_2025741_+	hypothetical protein	NA	A0A0N9S804	Paenibacillus_phage	87.6	1.6e-50
WP_077995197.1|2025734_2026205_+	DUF4065 domain-containing protein	NA	A0A0N9SGM1	Paenibacillus_phage	86.8	3.2e-76
WP_077995198.1|2026201_2026570_+	DUF5406 family protein	NA	NA	NA	NA	NA
WP_077995199.1|2026613_2027693_+	hypothetical protein	NA	A0A0N9RTN7	Paenibacillus_phage	51.7	3.6e-62
WP_079940650.1|2027676_2028237_+	AAA family ATPase	NA	A0A0N9SJZ0	Paenibacillus_phage	85.8	1.6e-85
WP_155121102.1|2028193_2028448_-	hypothetical protein	NA	A0A0N9SHP7	Paenibacillus_phage	76.2	9.7e-35
WP_079940652.1|2028655_2029063_+	DUF134 domain-containing protein	NA	A0A0N9RZI0	Paenibacillus_phage	88.1	2.0e-58
WP_077995202.1|2029052_2029505_+	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	77.3	4.5e-59
WP_079940653.1|2030426_2030672_+	hypothetical protein	NA	A0A0N9SIR9	Paenibacillus_phage	97.8	4.5e-13
WP_079940829.1|2030664_2031495_+	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	97.8	2.6e-153
WP_077995205.1|2031837_2032032_+	hypothetical protein	NA	A0A0N9RTP7	Paenibacillus_phage	86.2	1.4e-06
WP_077995206.1|2032053_2032473_+	hypothetical protein	NA	A0A0N9SJZ8	Paenibacillus_phage	92.8	4.8e-71
WP_024094642.1|2032462_2032861_+	helix-turn-helix domain-containing protein	NA	A0A0N7GFF5	Paenibacillus_phage	99.2	7.5e-66
WP_155121103.1|2033782_2033947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155121104.1|2034050_2034227_+	hypothetical protein	NA	A0A0N9SSS1	Paenibacillus_phage	94.8	2.2e-17
WP_079940654.1|2034492_2034792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997491.1|2035004_2036690_+|terminase	phage terminase large subunit	terminase	A0A0N9RZA7	Paenibacillus_phage	97.6	5.8e-301
WP_077995210.1|2036713_2038198_+|portal	phage portal protein	portal	A0A0N7GFE4	Paenibacillus_phage	92.1	5.7e-244
WP_077995211.1|2038194_2039055_+|capsid	minor capsid protein	capsid	A0A0N9SJR1	Paenibacillus_phage	93.4	1.6e-145
WP_079940655.1|2039146_2039782_+	hypothetical protein	NA	A0A0N9SIL0	Paenibacillus_phage	74.4	3.0e-61
WP_077995214.1|2039837_2040773_+	hypothetical protein	NA	A0A0N9S7T7	Paenibacillus_phage	94.9	2.7e-167
WP_079940656.1|2040787_2041171_+	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	95.3	9.7e-63
WP_077995215.1|2041171_2041504_+	hypothetical protein	NA	A0A0N9RTI3	Paenibacillus_phage	96.4	1.7e-55
WP_077995216.1|2041500_2041926_+	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	92.2	3.5e-69
WP_077995217.1|2041922_2042297_+	hypothetical protein	NA	A0A0N7GFE5	Paenibacillus_phage	94.4	4.7e-62
WP_077995218.1|2042309_2042858_+	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	95.1	2.9e-92
WP_079940657.1|2042908_2043286_+	hypothetical protein	NA	A0A0N9SST2	Paenibacillus_phage	92.0	5.1e-56
WP_155121105.1|2043465_2043636_+	hypothetical protein	NA	A0A0N9RZB8	Paenibacillus_phage	74.5	2.8e-14
WP_079940658.1|2043663_2046558_+|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	56.2	5.2e-249
WP_077995224.1|2046557_2048015_+|tail	phage tail family protein	tail	A0A0N9RRA9	Paenibacillus_phage	94.8	1.3e-277
WP_158672767.1|2048017_2050339_+	hypothetical protein	NA	A0A0N9SIL8	Paenibacillus_phage	97.5	0.0e+00
WP_158672768.1|2050335_2050773_+	hypothetical protein	NA	A0A0N9S7V6	Paenibacillus_phage	90.3	1.1e-67
WP_077995228.1|2050760_2051177_+|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	97.1	2.9e-68
WP_077995229.1|2051169_2052039_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	95.2	1.6e-161
WP_077995230.1|2052326_2052620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995231.1|2052758_2052971_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
2052637:2052668	attR	TTTTAATTTTCCGTTCCCCTCGTGTTGTTATC	NA	NA	NA	NA
WP_077995232.1|2052973_2053357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995233.1|2053362_2053599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995234.1|2054044_2054407_-	hypothetical protein	NA	A0A142F168	Bacillus_phage	46.7	7.6e-17
WP_077995235.1|2054880_2055060_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077995236.1|2055442_2055793_-	hypothetical protein	NA	A0A2I7SCF2	Paenibacillus_phage	87.1	4.6e-51
WP_040931863.1|2055837_2056263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995237.1|2056427_2057054_-	hypothetical protein	NA	A0A0N9SJT2	Paenibacillus_phage	62.4	2.5e-39
WP_079940660.1|2057126_2057513_-	hypothetical protein	NA	A0A0N9SIM5	Paenibacillus_phage	94.5	3.4e-63
>prophage 13
NZ_CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	2234568	2302186	4268596	transposase,protease	Paenibacillus_phage(58.33%)	57	NA	NA
WP_158672772.1|2234568_2235033_-|protease	trypsin-like serine protease	protease	W5SAB9	Pithovirus	41.1	3.4e-09
WP_155121112.1|2235076_2235238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940833.1|2235362_2236535_+	MFS transporter	NA	NA	NA	NA	NA
WP_077995360.1|2236557_2237316_-	TrmB family transcriptional regulator	NA	NA	NA	NA	NA
WP_079940834.1|2237494_2238226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940693.1|2238254_2239721_+	antitoxin	NA	NA	NA	NA	NA
WP_079940835.1|2239805_2240369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094102.1|2240493_2241390_-	cation transporter	NA	NA	NA	NA	NA
WP_024094104.1|2242373_2242742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995363.1|2242932_2243667_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_023484542.1|2243722_2244508_-	delta-lactam-biosynthetic de-N-acetylase	NA	NA	NA	NA	NA
WP_079940695.1|2244621_2246139_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_104932805.1|2246218_2247235_-	amidase domain-containing protein	NA	NA	NA	NA	NA
WP_023484539.1|2247811_2248084_-	ribonuclease inhibitor-like protein	NA	NA	NA	NA	NA
WP_104932703.1|2248104_2248524_-	ribonuclease	NA	NA	NA	NA	NA
WP_077995368.1|2249046_2250477_-	MBL fold metallo-hydrolase	NA	A0A2N9QVZ6	Dishui_lake_phycodnavirus	36.6	1.3e-06
WP_077995369.1|2250551_2251751_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_077995370.1|2252233_2252464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158672773.1|2252727_2253786_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_024094116.1|2253900_2254917_+	NTP transferase domain-containing protein	NA	K7QKA7	Escherichia_phage	33.5	8.7e-26
WP_104932488.1|2255860_2256088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484729.1|2256176_2256950_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_077995376.1|2257290_2257821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104932704.1|2258200_2260627_-	penicillin acylase family protein	NA	NA	NA	NA	NA
WP_036656619.1|2261120_2261912_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_079940699.1|2261947_2262628_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_077995379.1|2262632_2264165_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_079940700.1|2264538_2265657_-	UDP-glucuronosyltransferase	NA	NA	NA	NA	NA
WP_023484737.1|2265833_2266661_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_079940701.1|2267107_2268670_-	gluconokinase	NA	NA	NA	NA	NA
WP_042118974.1|2268704_2270066_-	GntP family permease	NA	NA	NA	NA	NA
WP_024094123.1|2270176_2270854_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023484741.1|2272029_2272347_-	DUF4870 domain-containing protein	NA	A0A2H4JDX0	uncultured_Caudovirales_phage	45.0	3.4e-13
WP_077995381.1|2272935_2273247_-	DUF4870 domain-containing protein	NA	A0A2H4J741	uncultured_Caudovirales_phage	45.9	1.4e-11
WP_104932806.1|2273696_2274742_-|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	20.9	7.9e-06
WP_077995382.1|2275217_2275409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036654509.1|2276039_2276723_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932657.1|2276743_2277613_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	99.6	1.1e-135
WP_077995383.1|2277786_2278176_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_077995384.1|2278664_2281220_-	hypothetical protein	NA	A0A0K2CYN4	Paenibacillus_phage	56.1	1.9e-258
WP_077997499.1|2281473_2281893_+	DUF4064 domain-containing protein	NA	A0A0K2CZQ0	Paenibacillus_phage	100.0	5.7e-24
WP_079940702.1|2282185_2284819_-	hypothetical protein	NA	A0A0K2CYN4	Paenibacillus_phage	47.7	3.1e-232
WP_077995388.1|2286368_2287310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997500.1|2288117_2288336_-	helix-turn-helix transcriptional regulator	NA	A0A2I7SC05	Paenibacillus_phage	50.0	4.0e-13
WP_079940703.1|2288794_2288986_+	hypothetical protein	NA	A0A0K2CZ26	Paenibacillus_phage	94.7	3.4e-24
WP_036654824.1|2288982_2289255_+	hypothetical protein	NA	A0A0C5AEQ9	Bacteriophage	100.0	3.9e-42
WP_077995391.1|2289258_2289471_+	hypothetical protein	NA	A0A2I7SC04	Paenibacillus_phage	97.0	1.3e-29
WP_077995392.1|2289822_2290371_-	hypothetical protein	NA	A0A0C5AEH5	Bacteriophage	85.8	9.9e-77
WP_104932621.1|2290622_2291492_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_036654509.1|2291512_2292196_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_079940836.1|2292453_2292636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036654509.1|2292866_2293550_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932621.1|2293570_2294440_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_077995393.1|2296283_2297084_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2I7SCE7	Paenibacillus_phage	55.3	3.1e-18
WP_077995394.1|2297947_2300155_-	hypothetical protein	NA	A0A142IG93	Bacillus_phage	39.9	2.6e-19
WP_077995395.1|2300494_2300812_-	STAS-like domain-containing protein	NA	J7KJ12	Streptococcus_phage	46.2	1.1e-11
WP_077995375.1|2300962_2302186_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
>prophage 14
NZ_CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	2305286	2377743	4268596	transposase,bacteriocin	Paenibacillus_phage(38.46%)	58	NA	NA
WP_077995397.1|2305286_2306510_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	4.0e-227
WP_077995398.1|2306987_2307617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995399.1|2307609_2308236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995401.1|2309962_2310235_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	R9W0N4	Paenibacillus_phage	93.3	4.5e-30
WP_077995402.1|2310438_2311893_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.9	2.2e-123
WP_077995403.1|2312035_2313628_-	SagB/ThcOx family dehydrogenase	NA	NA	NA	NA	NA
WP_077997501.1|2313652_2315494_-	TOMM precursor leader peptide-binding protein	NA	NA	NA	NA	NA
WP_077995404.1|2317682_2317949_-|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_083041350.1|2318325_2318526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940707.1|2318631_2319408_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_077995405.1|2319764_2321714_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_079940708.1|2321700_2322471_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.2	8.0e-32
WP_079940709.1|2322852_2323416_-	RICIN domain-containing protein	NA	NA	NA	NA	NA
WP_077995407.1|2323779_2324106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094129.1|2324243_2324450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940710.1|2325011_2325560_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_079940711.1|2325775_2326891_+	oxalate decarboxylase family bicupin	NA	NA	NA	NA	NA
WP_077995408.1|2327029_2327458_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_023484627.1|2327624_2328014_-	DoxX family protein	NA	NA	NA	NA	NA
WP_158672774.1|2329001_2329379_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_051427815.1|2329837_2330092_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_077995411.1|2330124_2330646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036654152.1|2331775_2333185_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_023484621.1|2333277_2334165_-	anion permease	NA	NA	NA	NA	NA
WP_077995412.1|2334370_2334709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040931545.1|2334709_2334916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036654150.1|2335308_2336139_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_077995413.1|2336926_2338294_-	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
WP_077995414.1|2338489_2339539_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	1.2e-30
WP_077995415.1|2339532_2339850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932705.1|2339788_2340670_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_042118984.1|2341257_2341716_-	flavodoxin	NA	A7KUZ7	Bacillus_phage	31.6	6.5e-13
WP_036656608.1|2341935_2343270_-	magnesium transporter	NA	NA	NA	NA	NA
WP_077995417.1|2343377_2346026_-	magnesium-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	24.8	5.2e-38
WP_077995418.1|2346968_2347358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940713.1|2347303_2347732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158672837.1|2347826_2349044_-	lipase	NA	NA	NA	NA	NA
WP_104932634.1|2349371_2350241_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_036654509.1|2350261_2350945_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_077995421.1|2351045_2353346_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_077995422.1|2353931_2355014_+	tyrosine recombinase XerS	NA	A0A2R2ZGM9	Clostridioides_phage	24.9	6.7e-08
WP_079940714.1|2355075_2356821_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.7	1.7e-61
WP_024094153.1|2357000_2357804_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_079940715.1|2357810_2358440_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_079940837.1|2358532_2361226_-	pyruvate, phosphate dikinase	NA	A0A2D2W2B1	Stenotrophomonas_phage	40.6	2.1e-95
WP_024094155.1|2361225_2361390_-	GapA-binding peptide SR1P	NA	NA	NA	NA	NA
WP_077995423.1|2361679_2362915_-	MFS transporter	NA	NA	NA	NA	NA
WP_077995424.1|2363144_2364674_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_158672775.1|2365630_2365792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484599.1|2365813_2367019_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_077995425.1|2367015_2368251_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_077997503.1|2368414_2368897_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_077995427.1|2370519_2372163_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_079940716.1|2372251_2373310_+	DctP family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_077995428.1|2373567_2374845_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_158672776.1|2375001_2375160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158672777.1|2375219_2375351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995375.1|2376519_2377743_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
>prophage 15
NZ_CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	2499737	2508870	4268596	transposase	Paenibacillus_phage(33.33%)	8	NA	NA
WP_077995488.1|2499737_2501024_-	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	30.5	1.4e-09
WP_079940748.1|2501020_2502307_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	29.0	1.2e-43
WP_023484666.1|2502473_2503274_-	spore cortex-lytic enzyme	NA	A0A172JHR8	Bacillus_phage	42.9	1.9e-23
WP_079940749.1|2503522_2506024_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.2	1.4e-85
WP_158672786.1|2506116_2506353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997508.1|2506349_2507087_-	translocation-enhancing protein TepA	NA	NA	NA	NA	NA
WP_104932621.1|2507296_2508166_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_036654509.1|2508186_2508870_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
>prophage 16
NZ_CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	2575662	2628262	4268596	integrase,tRNA,transposase,protease	Paenibacillus_phage(31.82%)	57	2614571:2614586	2628743:2628758
WP_042119028.1|2575662_2577057_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	27.6	3.8e-40
WP_036653992.1|2577226_2577769_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_077997509.1|2577947_2579276_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_023484649.1|2579288_2581379_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	40.9	1.8e-110
WP_077995507.1|2581526_2582636_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	40.4	3.7e-38
WP_077995508.1|2582739_2583675_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_077995509.1|2583731_2584892_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_024094298.1|2585280_2585541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094299.1|2585572_2585968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997510.1|2586182_2587706_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_024094301.1|2587803_2588208_-	YraN family protein	NA	NA	NA	NA	NA
WP_023484363.1|2588217_2588550_-	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_104932713.1|2588546_2590358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484361.1|2590412_2591096_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	37.7	5.7e-21
WP_077995513.1|2591388_2592270_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_077995514.1|2592378_2592963_-	signal peptidase I	NA	NA	NA	NA	NA
WP_023484358.1|2593074_2593416_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_024094305.1|2593558_2594311_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_077995515.1|2594307_2594829_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_023484355.1|2595054_2595285_-	KH domain-containing protein	NA	NA	NA	NA	NA
WP_023484354.1|2595307_2595580_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_023484353.1|2595621_2596989_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_024094307.1|2597018_2597381_-	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_077995516.1|2597514_2598522_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_023484350.1|2598606_2602185_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_077997511.1|2602353_2603055_-	ribonuclease III	NA	A0A167RGU4	Powai_lake_megavirus	29.6	2.1e-26
WP_024094309.1|2603234_2604470_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_024094310.1|2604559_2604793_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	38.0	6.0e-07
WP_024094311.1|2604911_2605652_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	36.4	5.0e-23
WP_023484345.1|2605751_2606687_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_077995517.1|2606718_2607705_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_024094313.1|2607715_2608702_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_077584878.1|2608703_2609294_-	transcription factor FapR	NA	NA	NA	NA	NA
WP_023484341.1|2609469_2609643_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_077995518.1|2609761_2610274_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_036658730.1|2610361_2611435_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_023484339.1|2611619_2612969_+	spore cortex formation factor-like protein	NA	NA	NA	NA	NA
WP_023484338.1|2612979_2613489_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	39.5	2.0e-26
WP_023484337.1|2613506_2614064_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
2614571:2614586	attL	TTATTTTGCACAAAAA	NA	NA	NA	NA
WP_024094320.1|2614613_2614811_-	helix-turn-helix transcriptional regulator	NA	D0R7I7	Paenibacillus_phage	76.9	2.4e-09
WP_024094321.1|2614875_2615289_+	hypothetical protein	NA	A0A0K2CYM1	Paenibacillus_phage	98.6	8.7e-33
WP_024094322.1|2615436_2615826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995520.1|2616607_2616745_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_079940765.1|2616925_2618257_-	chitin-binding protein	NA	A0A2D1GD28	Mycobacterium_phage	29.3	4.1e-07
WP_104932807.1|2618703_2619748_+|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	20.9	6.0e-06
WP_077995522.1|2619813_2620056_-|transposase	transposase	transposase	A0A2I7SCT4	Paenibacillus_phage	98.8	8.6e-33
WP_077585229.1|2620065_2620734_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0K2CXQ8	Paenibacillus_phage	95.9	4.0e-128
WP_024094328.1|2620733_2620973_-	hypothetical protein	NA	A0A0C5AEG8	Bacteriophage	100.0	2.8e-36
WP_104932714.1|2621385_2622601_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	28.7	6.6e-12
WP_077995527.1|2623944_2624295_-	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	60.9	5.8e-30
WP_158672787.1|2624551_2624842_-	hypothetical protein	NA	A0A0C5AFG5	Paenibacillus_phage	79.8	6.5e-35
WP_077995529.1|2624981_2625497_+	DUF3231 family protein	NA	NA	NA	NA	NA
WP_042119037.1|2625579_2625783_-	hypothetical protein	NA	A0A0S2SXP3	Bacillus_phage	40.0	6.8e-07
WP_158672788.1|2626378_2626603_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158676629.1|2626866_2627460_+	hypothetical protein	NA	R9VW28	Paenibacillus_phage	44.2	4.0e-39
WP_158672789.1|2627479_2628037_+|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	40.4	3.0e-28
WP_158672790.1|2628046_2628262_+|integrase	tyrosine-type recombinase/integrase	integrase	S5MNZ2	Brevibacillus_phage	71.6	3.3e-20
2628743:2628758	attR	TTATTTTGCACAAAAA	NA	NA	NA	NA
>prophage 17
NZ_CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	2780054	2792905	4268596	transposase,integrase	Paenibacillus_phage(66.67%)	17	2789627:2789640	2794587:2794600
WP_079940192.1|2780054_2781428_-	family 10 glycosylhydrolase	NA	A0A2I7SC76	Paenibacillus_phage	88.5	4.8e-27
WP_036654509.1|2782304_2782988_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932621.1|2783008_2783878_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_104935371.1|2783949_2784195_-	hypothetical protein	NA	A0A2I7SCG0	Paenibacillus_phage	90.5	6.3e-31
WP_077995599.1|2784344_2784734_+	hypothetical protein	NA	A0A0K2CZD8	Paenibacillus_phage	50.7	1.3e-06
WP_024094459.1|2784923_2785127_+	hypothetical protein	NA	A0A0C5AEJ6	Paenibacillus_phage	88.1	5.0e-26
WP_077995601.1|2785751_2786396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995602.1|2787010_2787214_+	hypothetical protein	NA	A0A0K2CYF6	Paenibacillus_phage	60.0	5.8e-06
WP_024094463.1|2787282_2787504_-	helix-turn-helix transcriptional regulator	NA	A0A0E3U244	Fusobacterium_phage	44.4	3.8e-11
WP_077995603.1|2787602_2787794_+	hypothetical protein	NA	A0A2I7SC25	Paenibacillus_phage	100.0	4.4e-24
WP_155121024.1|2787797_2787950_+	hypothetical protein	NA	A0A2I7SC04	Paenibacillus_phage	81.2	2.3e-07
WP_158676626.1|2788364_2788850_-	hypothetical protein	NA	A0A0C5AEH5	Bacteriophage	90.1	3.2e-71
WP_079940196.1|2789245_2789746_-	hypothetical protein	NA	R9VWV6	Paenibacillus_phage	31.7	7.1e-05
2789627:2789640	attL	GTGGTTACTTTCAA	NA	NA	NA	NA
WP_077995606.1|2790325_2790508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995607.1|2790803_2791214_+	helix-turn-helix transcriptional regulator	NA	F8J1E0	Lactobacillus_phage	39.8	2.3e-09
WP_077995608.1|2791245_2791662_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2P1JU12	Anoxybacillus_phage	37.0	4.6e-18
WP_079940197.1|2791783_2792905_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	45.3	4.4e-87
2794587:2794600	attR	TTGAAAGTAACCAC	NA	NA	NA	NA
>prophage 18
NZ_CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	3109651	3174870	4268596	tRNA,transposase,protease	Paenibacillus_phage(21.43%)	58	NA	NA
WP_077995752.1|3109651_3109999_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_023482975.1|3110014_3110326_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_023482973.1|3111234_3112110_-|protease	membrane metalloprotease-like protein	protease	NA	NA	NA	NA
WP_077995754.1|3112102_3113017_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_079940228.1|3113145_3114318_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_023482970.1|3114330_3115125_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_023482969.1|3115222_3115861_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_077995755.1|3115930_3116461_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_023482967.1|3116460_3117318_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_024094763.1|3117360_3118392_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_024094764.1|3118458_3119148_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_024094765.1|3119633_3120065_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_077995756.1|3120145_3120742_-	septum formation protein Maf	NA	NA	NA	NA	NA
WP_077995757.1|3120811_3121054_-	DUF4321 domain-containing protein	NA	NA	NA	NA	NA
WP_077997528.1|3121304_3122447_+	hypothetical protein	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	35.5	2.9e-22
WP_024094768.1|3122547_3123837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995759.1|3123959_3125348_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_023484266.1|3125355_3126729_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_079940786.1|3126799_3129466_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	41.4	4.1e-168
WP_077995760.1|3130258_3131410_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_077997529.1|3131514_3132405_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_077997530.1|3134093_3135050_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	34.6	1.2e-32
WP_077995761.1|3135194_3136496_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_077995762.1|3136558_3137998_-	protoporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_079940294.1|3138038_3138968_-	ferrochelatase	NA	NA	NA	NA	NA
WP_042119709.1|3138964_3140029_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_077995763.1|3140230_3141226_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_104932750.1|3141246_3142797_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_077995764.1|3142813_3143758_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_077995765.1|3143806_3144544_-	bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase	NA	NA	NA	NA	NA
WP_077995766.1|3144540_3145383_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_079940295.1|3145414_3146815_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_023484282.1|3146986_3147520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995767.1|3147657_3148059_-	adenosylmethionine decarboxylase	NA	A0A0E3FA82	Synechococcus_phage	36.4	1.5e-18
WP_023484284.1|3148431_3149019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995768.1|3149409_3150024_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_083039125.1|3150042_3152376_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	41.5	9.5e-169
WP_024094788.1|3152525_3154244_-|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	24.7	4.7e-16
WP_104932751.1|3154459_3155167_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_077995769.1|3155217_3156339_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_077995770.1|3156443_3157706_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.0	5.9e-149
WP_024094790.1|3157721_3158312_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.6	4.2e-57
WP_104932752.1|3158476_3159778_-	trigger factor	NA	NA	NA	NA	NA
WP_046655164.1|3159957_3160860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940297.1|3160990_3162211_-	CapA family protein	NA	A0A2H4J5Z6	uncultured_Caudovirales_phage	34.2	1.3e-55
WP_024094793.1|3162437_3162551_-	DUF4023 family protein	NA	NA	NA	NA	NA
WP_158672797.1|3162605_3164111_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_077995775.1|3164103_3164580_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_024094796.1|3164746_3165100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094797.1|3165388_3167233_+	asparagine synthase (glutamine-hydrolyzing)	NA	L7RC73	Acanthamoeba_polyphaga_moumouvirus	24.7	5.8e-28
WP_079940299.1|3167300_3167933_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_024094798.1|3167919_3168675_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_079940300.1|3168985_3170017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036656345.1|3170253_3170769_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.6	8.5e-38
WP_077995776.1|3170880_3171690_+	MFS transporter	NA	NA	NA	NA	NA
WP_104932621.1|3171927_3172797_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_036654509.1|3172817_3173501_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932668.1|3173753_3174870_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	99.3	4.6e-153
>prophage 19
NZ_CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	3180566	3266000	4268596	head,capsid,transposase,integrase,plate,protease,portal,bacteriocin,terminase,tail	Bacteriophage(47.95%)	100	3176429:3176445	3198566:3198582
3176429:3176445	attL	CAATCCGTTTTCCCATG	NA	NA	NA	NA
WP_077995780.1|3180566_3181025_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155121050.1|3181151_3181514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162544755.1|3181533_3181701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104932754.1|3181631_3181826_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_079940407.1|3182339_3185936_+	hypothetical protein	NA	A0A126FC74	Lonomia_obliqua_multiple_nucleopolyhedrovirus	25.6	2.8e-42
WP_077995782.1|3186008_3186578_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_079940408.1|3187086_3187992_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A7AR08	Bacillus_phage	57.2	3.4e-90
WP_023483458.1|3188401_3188608_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	64.6	4.6e-19
WP_036656232.1|3188708_3188987_+	HU family DNA-binding protein	NA	M4SRV7	Rhodobacter_phage	38.3	7.2e-07
WP_023482516.1|3189651_3190290_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_077995375.1|3191602_3192826_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_077995783.1|3193634_3195197_-	recombinase family protein	NA	A0A0C5AJM7	Paenibacillus_phage	98.5	5.6e-290
WP_144029589.1|3195135_3195384_-	hypothetical protein	NA	A0A0C5AF76	Paenibacillus_phage	98.8	9.8e-40
WP_077995784.1|3195428_3195887_-	transcriptional regulator	NA	A0A0C5AC66	Paenibacillus_phage	96.7	5.4e-76
WP_077995785.1|3195937_3196396_-	hypothetical protein	NA	A0A2I7SCC0	Paenibacillus_phage	98.0	2.7e-75
WP_077995786.1|3196554_3197142_-	hypothetical protein	NA	A0A0C5ABQ1	Bacteriophage	94.3	7.3e-102
WP_077995787.1|3197138_3197351_-	hypothetical protein	NA	R9VYB7	Paenibacillus_phage	85.7	8.3e-32
WP_077995788.1|3197458_3197650_-	hypothetical protein	NA	A0A0K2CZP1	Paenibacillus_phage	80.0	3.4e-16
WP_077995789.1|3197699_3198065_-	helix-turn-helix transcriptional regulator	NA	R9W020	Paenibacillus_phage	95.8	9.9e-57
WP_155116288.1|3198111_3198261_-	hypothetical protein	NA	R9W0Q6	Paenibacillus_phage	100.0	5.0e-23
WP_077995790.1|3198275_3198581_-	hypothetical protein	NA	A0A0C5AEC7	Paenibacillus_phage	91.1	4.9e-49
WP_077997534.1|3198583_3199906_-	AAA family ATPase	NA	A0A0K2CY23	Paenibacillus_phage	98.6	2.4e-246
3198566:3198582	attR	CAATCCGTTTTCCCATG	NA	NA	NA	NA
WP_149867712.1|3199871_3200540_-	hypothetical protein	NA	A0A2I7SDJ4	Paenibacillus_phage	98.6	1.9e-122
WP_023483155.1|3200721_3201036_-	hypothetical protein	NA	A0A0C5AEL1	Paenibacillus_phage	100.0	2.0e-37
WP_077995791.1|3201032_3201791_-	MBL fold metallo-hydrolase	NA	A0A0B5A2C7	Paenibacillus_phage	94.8	1.5e-139
WP_077995792.1|3201803_3202718_-	recombinase RecT	NA	A0A0C5AEK7	Bacteriophage	85.9	8.9e-147
WP_077995793.1|3202720_3202918_-	hypothetical protein	NA	A0A0C5AN67	Paenibacillus_phage	93.8	8.0e-29
WP_077995794.1|3202914_3204435_-	AAA family ATPase	NA	A0A0C5AN14	Bacteriophage	83.9	8.5e-227
WP_077995795.1|3204418_3204712_-	hypothetical protein	NA	A0A0C5AJQ8	Paenibacillus_phage	95.9	3.8e-43
WP_077995796.1|3204716_3204977_-	hypothetical protein	NA	A0A0C5AN52	Paenibacillus_phage	64.4	5.5e-25
WP_077995797.1|3205012_3205423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995798.1|3205584_3205818_-	hypothetical protein	NA	A0A0C5AN13	Bacteriophage	88.3	4.9e-33
WP_077995799.1|3205814_3206057_-	hypothetical protein	NA	A0A0C5AER7	Bacteriophage	78.9	2.0e-29
WP_155121051.1|3206153_3206330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995800.1|3206313_3206586_-	hypothetical protein	NA	A0A0C5AEJ1	Bacteriophage	95.5	3.6e-43
WP_077995801.1|3206612_3207353_-	phage antirepressor protein	NA	A0A2I7SDG8	Paenibacillus_phage	97.2	8.9e-129
WP_155121052.1|3207381_3207525_-	hypothetical protein	NA	A0A2I7SCU1	Paenibacillus_phage	95.7	2.7e-18
WP_077995803.1|3207722_3207941_-	helix-turn-helix transcriptional regulator	NA	A0A0C5AMZ9	Paenibacillus_phage	95.7	5.6e-31
WP_077995804.1|3208158_3208605_+	helix-turn-helix transcriptional regulator	NA	A0A0C5AN12	Bacteriophage	96.6	1.3e-71
WP_077995805.1|3209178_3209382_+	YqaE/Pmp3 family membrane protein	NA	A0A0C5AJ71	Bacteriophage	100.0	6.3e-29
WP_077995806.1|3209478_3209709_-	helix-turn-helix transcriptional regulator	NA	A0A0C5ABM0	Bacteriophage	96.0	3.0e-35
WP_077995807.1|3210184_3210376_+	hypothetical protein	NA	A0A0K2CZ26	Paenibacillus_phage	96.6	1.1e-25
WP_079940409.1|3210372_3210639_+	hypothetical protein	NA	A0A2I7SC25	Paenibacillus_phage	84.3	8.0e-32
WP_079940410.1|3210642_3210849_+	hypothetical protein	NA	A0A2I7SC04	Paenibacillus_phage	89.7	4.2e-28
WP_077995809.1|3210940_3211183_-|transposase	transposase	transposase	A0A0C5AEQ4	Bacteriophage	96.2	7.6e-29
WP_077997536.1|3211435_3212107_-	hypothetical protein	NA	A0A2I7SC18	Paenibacillus_phage	93.3	6.8e-128
WP_077995810.1|3212106_3212346_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	R9W0N4	Paenibacillus_phage	96.2	3.1e-35
WP_024094416.1|3212381_3212540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995811.1|3212532_3212928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995812.1|3212940_3214725_-	hypothetical protein	NA	A0A0C5AEQ0	Bacteriophage	90.6	2.3e-69
WP_079940411.1|3214725_3215289_-|tail	phage tail protein I	tail	A0A0C5AJ63	Bacteriophage	91.4	1.9e-91
WP_079940805.1|3215285_3216395_-|plate	baseplate J/gp47 family protein	plate	A0A0C5AEG2	Bacteriophage	99.7	1.6e-203
WP_077995813.1|3216406_3216733_-	hypothetical protein	NA	A0A0C5ABJ8	Bacteriophage	98.1	7.3e-51
WP_077995814.1|3216722_3217124_-|tail	phage tail protein	tail	A0A0C5AN08	Bacteriophage	95.5	1.0e-70
WP_079940412.1|3217120_3217498_-	hypothetical protein	NA	A0A0C5AEP6	Bacteriophage	90.4	1.6e-57
WP_077995816.1|3217500_3218529_-	late control protein	NA	A0A0C5AJ59	Bacteriophage	91.8	1.3e-186
WP_079940413.1|3218731_3221227_-	tape measure protein	NA	A0A0C5ABJ2	Bacteriophage	84.4	0.0e+00
WP_077995821.1|3221386_3221722_-|tail	phage tail assembly protein	tail	A0A0C5AEP1	Bacteriophage	85.0	6.8e-44
WP_077995822.1|3221749_3222268_-|tail	phage major tail tube protein	tail	A0A0C5AJ56	Bacteriophage	94.8	9.4e-85
WP_077995823.1|3222280_3223723_-|tail	phage tail protein	tail	A0A0C5AEE8	Bacteriophage	92.1	3.5e-262
WP_077995824.1|3223726_3223999_-	hypothetical protein	NA	A0A0C5ABI6	Bacteriophage	95.6	1.4e-42
WP_077995825.1|3223995_3224463_-	hypothetical protein	NA	A0A0C5AN06	Bacteriophage	97.4	2.3e-82
WP_077995826.1|3224459_3225011_-	hypothetical protein	NA	A0A0C5AEN6	Bacteriophage	98.9	3.1e-94
WP_077995827.1|3225007_3225319_-	hypothetical protein	NA	A0A0C5AJ53	Bacteriophage	100.0	4.8e-52
WP_155121053.1|3225315_3225465_-	hypothetical protein	NA	A0A0C5AEE3	Bacteriophage	100.0	3.0e-20
WP_077995828.1|3225478_3226507_-|capsid	major capsid protein	capsid	A0A0C5ABI0	Bacteriophage	99.4	1.7e-194
WP_077995829.1|3226522_3226879_-|head	head decoration protein	head	A0A0C5AN05	Bacteriophage	97.5	6.3e-56
WP_079940414.1|3226875_3227997_-|protease	Clp protease ClpP	protease	A0A0C5AEN1	Bacteriophage	98.4	6.7e-205
WP_077995832.1|3227956_3229516_-|portal	phage portal protein	portal	A0A0C5AJ48	Bacteriophage	96.3	9.2e-293
WP_077995833.1|3229512_3229734_-	hypothetical protein	NA	A0A0C5AEE0	Bacteriophage	89.0	1.8e-29
WP_077995834.1|3229750_3231613_-|terminase	phage terminase large subunit family protein	terminase	A0A0C5ABH4	Bacteriophage	98.7	0.0e+00
WP_077995835.1|3231596_3232109_-	hypothetical protein	NA	A0A0C5AN04	Bacteriophage	84.0	3.4e-71
WP_036654551.1|3233256_3233460_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0C5AC70	Paenibacillus_phage	100.0	1.5e-33
WP_077995836.1|3233490_3233901_+	pilus assembly protein HicB	NA	A0A0C5AEN7	Bacteriophage	98.5	7.2e-72
WP_077995837.1|3233929_3234133_-	hypothetical protein	NA	A0A0C5ABQ7	Bacteriophage	98.5	5.2e-31
WP_024094814.1|3234603_3235914_-	permease	NA	NA	NA	NA	NA
WP_036654839.1|3236052_3236985_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_077995841.1|3236965_3237667_-	dihydroorotate dehydrogenase electron transfer subunit	NA	NA	NA	NA	NA
WP_077997537.1|3238082_3238610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995842.1|3238693_3239530_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_104932757.1|3239516_3240533_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_077997539.1|3240537_3241314_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_079940415.1|3241482_3242403_+	NAD-dependent epimerase/dehydratase family protein	NA	E3T4Y8	Cafeteria_roenbergensis_virus	30.9	1.6e-31
WP_077995844.1|3242484_3243204_-	glycosyltransferase	NA	K7Z8A5	Megavirus	23.6	2.1e-10
WP_023482889.1|3243211_3244117_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A291LAD7	Escherichia_phage	25.7	1.2e-15
WP_024094822.1|3244113_3244944_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_077995846.1|3244940_3245927_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	33.4	1.6e-40
WP_023482886.1|3245916_3247011_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A2P1ELS7	Moumouvirus	44.4	1.9e-87
WP_077995847.1|3247007_3248468_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_077995848.1|3248741_3249113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995849.1|3249112_3250249_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_077995850.1|3250223_3251414_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_077995851.1|3251410_3252133_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	40.9	1.8e-46
WP_158672799.1|3252387_3260067_-|tail	WIAG-tail domain	tail	NA	NA	NA	NA
WP_036654846.1|3260194_3260533_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_079940417.1|3260675_3261842_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_023482876.1|3262181_3262964_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_077995858.1|3263520_3264123_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077995859.1|3264426_3265110_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	99.6	1.8e-123
WP_104932657.1|3265130_3266000_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	99.6	1.1e-135
>prophage 20
NZ_CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	3339485	3398925	4268596	capsid,holin,transposase,integrase,coat,portal,tRNA,terminase,tail	Paenibacillus_phage(60.78%)	78	3358511:3358527	3398933:3398949
WP_104932657.1|3339485_3340355_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	99.6	1.1e-135
WP_024094875.1|3340503_3341184_-	LrgB family protein	NA	NA	NA	NA	NA
WP_023483267.1|3341180_3341552_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_036654876.1|3341674_3342568_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_104932764.1|3342943_3343501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995895.1|3343611_3344760_-	transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_077995896.1|3344787_3345027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155116295.1|3345049_3345202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483263.1|3345320_3346463_+	MFS transporter	NA	NA	NA	NA	NA
WP_077995897.1|3346662_3347013_+	DNA primase	NA	NA	NA	NA	NA
WP_077995898.1|3347014_3347656_-	SCO family protein	NA	NA	NA	NA	NA
WP_096761322.1|3347746_3348673_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_024094881.1|3348917_3350930_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.3	3.2e-11
WP_023483257.1|3351537_3352017_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_077995899.1|3352055_3352334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036654885.1|3352421_3353405_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_023483255.1|3353541_3353766_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	47.8	5.6e-10
WP_042119744.1|3353892_3354078_+	DUF5325 family protein	NA	NA	NA	NA	NA
WP_036654887.1|3354270_3355257_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_077995900.1|3355635_3357099_-	cobyrinate a,c-diamide synthase	NA	NA	NA	NA	NA
WP_036654889.1|3357266_3357905_-	ribonuclease H	NA	NA	NA	NA	NA
3358511:3358527	attL	TGTGGGCAAAATGTGGG	NA	NA	NA	NA
WP_077995901.1|3358646_3359033_+	DUF3862 domain-containing protein	NA	NA	NA	NA	NA
WP_077584997.1|3359244_3359331_-|holin	putative holin-like toxin	holin	A0A0K2CZR6	Paenibacillus_phage	100.0	2.0e-05
WP_158672803.1|3359426_3359654_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CYV5	Paenibacillus_phage	85.1	3.0e-27
WP_077995903.1|3360123_3360309_+	hypothetical protein	NA	A0A0K2CZ26	Paenibacillus_phage	82.0	3.6e-23
WP_077995904.1|3360394_3360658_+	hypothetical protein	NA	A0A0K2CYM1	Paenibacillus_phage	97.7	1.4e-41
WP_104932621.1|3360786_3361656_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_036654509.1|3361676_3362360_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932814.1|3362512_3363148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995908.1|3363182_3363899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995909.1|3364034_3364277_-|transposase	transposase	transposase	A0A2I7SCT4	Paenibacillus_phage	96.2	1.1e-32
WP_077997545.1|3364286_3364955_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A2I7SD00	Paenibacillus_phage	96.4	2.5e-130
WP_024094328.1|3364954_3365194_-	hypothetical protein	NA	A0A0C5AEG8	Bacteriophage	100.0	2.8e-36
WP_077995910.1|3365373_3365706_-	hypothetical protein	NA	A0A2I7SBZ3	Paenibacillus_phage	87.2	8.2e-50
WP_077995911.1|3365715_3366468_-	hypothetical protein	NA	A0A0K2CZJ3	Paenibacillus_phage	98.0	4.8e-82
WP_077995912.1|3366470_3367943_-	hypothetical protein	NA	A0A1B2APX2	Phage_Wrath	53.9	1.2e-124
WP_077995913.1|3367942_3368644_-	hypothetical protein	NA	A0A1B2APY0	Phage_Wrath	42.1	2.9e-44
WP_155121055.1|3368646_3369990_-	hypothetical protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	65.1	1.3e-16
WP_077995249.1|3370138_3371359_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
WP_077995915.1|3371417_3373214_-	tape measure protein	NA	M1IEW1	Bacillus_virus	39.8	1.3e-53
WP_104932815.1|3373234_3373534_-	phenylalanine racemase	NA	A0A097PAX1	Streptococcus_pyogenes_phage	47.4	3.7e-17
WP_077997546.1|3373647_3373950_-	segregation and condensation protein B	NA	NA	NA	NA	NA
WP_077995917.1|3373952_3374471_-|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	71.6	1.0e-51
WP_077995918.1|3374484_3374895_-	DUF5072 family protein	NA	A0A097PAW5	Streptococcus_pyogenes_phage	44.1	1.7e-33
WP_036658585.1|3374899_3375235_-	hypothetical protein	NA	A0A097PAT9	Streptococcus_pyogenes_phage	37.2	2.4e-09
WP_077995919.1|3375240_3375546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995920.1|3375542_3375863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995921.1|3375865_3376414_-	hypothetical protein	NA	A7J297	Streptococcus_phage	49.2	7.2e-35
WP_077995249.1|3376492_3377713_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
WP_077995922.1|3377754_3378120_-	hypothetical protein	NA	A7J297	Streptococcus_phage	55.3	1.2e-25
WP_077995923.1|3378132_3378723_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_077995924.1|3378809_3379703_-|capsid	minor capsid protein	capsid	S5MTV5	Brevibacillus_phage	33.9	8.7e-38
WP_077995925.1|3379611_3381024_-|portal	phage portal protein	portal	A0A1P8BLJ1	Lactococcus_phage	49.3	7.4e-116
WP_077997547.1|3381024_3382443_-|terminase	phage terminase large subunit	terminase	A0A090EUA8	Clostridium_phage	69.4	2.9e-189
WP_077997548.1|3382438_3382936_-|transposase	transposase	transposase	A0A0E3U2Q7	Fusobacterium_phage	65.2	6.7e-40
WP_077995926.1|3383151_3383775_-	RNA polymerase subunit sigma-24	NA	NA	NA	NA	NA
WP_077995927.1|3383740_3383980_-	hypothetical protein	NA	A0A0K2CZP1	Paenibacillus_phage	75.4	9.8e-21
WP_158672804.1|3384097_3385201_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2I7SC33	Paenibacillus_phage	89.6	4.2e-183
WP_077995929.1|3385217_3385439_-	hypothetical protein	NA	A0A0K2CZG3	Paenibacillus_phage	94.5	5.5e-34
WP_077995930.1|3385442_3385838_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A2I7SC39	Paenibacillus_phage	97.7	6.9e-72
WP_079940424.1|3385827_3386106_-	hypothetical protein	NA	A0A0K2CZH7	Paenibacillus_phage	98.9	1.4e-47
WP_077995932.1|3386392_3388645_-	AAA family ATPase	NA	A0A2I7SC35	Paenibacillus_phage	99.9	0.0e+00
WP_077995933.1|3388649_3388979_-	hypothetical protein	NA	A0A2I7SC50	Paenibacillus_phage	99.1	1.9e-62
WP_077995934.1|3388975_3390565_-	DEAD/DEAH box helicase	NA	A0A2I7SC38	Paenibacillus_phage	98.9	1.4e-301
WP_023485397.1|3390574_3391075_-	hypothetical protein	NA	A0A2I7SC41	Paenibacillus_phage	100.0	3.1e-93
WP_051427849.1|3391099_3391798_-	hypothetical protein	NA	A0A2I7SC26	Paenibacillus_phage	100.0	5.2e-139
WP_077995935.1|3391829_3392933_-	ATP-binding protein	NA	A0A2I7SC30	Paenibacillus_phage	99.2	7.6e-209
WP_077995936.1|3392932_3394243_-	AAA family ATPase	NA	A0A2I7SC23	Paenibacillus_phage	76.4	2.5e-174
WP_077995937.1|3394303_3395014_-	hypothetical protein	NA	A0A2I7SC22	Paenibacillus_phage	98.3	5.7e-125
WP_023484471.1|3395063_3395435_-	hypothetical protein	NA	A0A2I7SC29	Paenibacillus_phage	100.0	3.4e-60
WP_051427850.1|3395464_3395749_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	100.0	3.8e-48
WP_079940425.1|3395752_3395986_-	hypothetical protein	NA	A0A0K2CZM7	Paenibacillus_phage	84.1	4.3e-21
WP_077995939.1|3396001_3396256_-	hypothetical protein	NA	A0A0K2CYH1	Paenibacillus_phage	43.4	2.8e-10
WP_077995940.1|3396227_3396449_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077995941.1|3396533_3396776_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CZL1	Paenibacillus_phage	69.3	2.4e-22
WP_077995942.1|3396900_3397233_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CZS1	Paenibacillus_phage	55.8	2.7e-16
WP_077995943.1|3397242_3397704_+	ImmA/IrrE family metallo-endopeptidase	NA	R9TQI1	Paenibacillus_phage	64.1	8.7e-50
WP_077995944.1|3397785_3398925_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	39.6	4.2e-61
3398933:3398949	attR	TGTGGGCAAAATGTGGG	NA	NA	NA	NA
>prophage 21
NZ_CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	3477960	3602446	4268596	integrase,transposase,protease,holin	Paenibacillus_phage(24.14%)	108	3479826:3479840	3609693:3609707
WP_077995988.1|3477960_3478506_-|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	37.4	7.0e-22
WP_079940438.1|3478939_3479644_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
3479826:3479840	attL	GATTATATTTCATTT	NA	NA	NA	NA
WP_077995989.1|3480199_3483427_+	lantibiotic dehydratase	NA	A0A2H4PQG8	Staphylococcus_phage	24.4	1.1e-77
3479826:3479840	attL	GATTATATTTCATTT	NA	NA	NA	NA
WP_158672808.1|3483419_3484775_+	lanthionine synthetase C family protein	NA	NA	NA	NA	NA
WP_077995991.1|3485063_3486380_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_077995992.1|3486668_3487652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940439.1|3487999_3490018_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_036658223.1|3490057_3490336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995995.1|3491131_3491929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094946.1|3492146_3493604_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_149867718.1|3493797_3494826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158672809.1|3495128_3495518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997553.1|3495493_3496246_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077995998.1|3496342_3497536_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_036658210.1|3497561_3499121_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_024094951.1|3499886_3500135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036658206.1|3500141_3500405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094953.1|3500588_3501530_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023484418.1|3501711_3502326_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_077997554.1|3502548_3503739_-	MFS transporter	NA	NA	NA	NA	NA
WP_023484416.1|3503774_3504464_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_149867719.1|3504663_3504978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996002.1|3505429_3506701_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.0	1.4e-09
WP_077996004.1|3506938_3507433_-	DUF4261 domain-containing protein	NA	NA	NA	NA	NA
WP_077996005.1|3507795_3508326_+	lysoplasmalogenase	NA	NA	NA	NA	NA
WP_149867720.1|3508320_3509085_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_104932770.1|3509355_3510096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996008.1|3510277_3510502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996009.1|3510600_3511215_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_077996010.1|3511246_3513163_-	AAA family ATPase	NA	Q331U3	Clostridium_botulinum_C_phage	35.2	3.2e-05
WP_077996011.1|3513422_3514709_+	MFS transporter	NA	NA	NA	NA	NA
WP_077996012.1|3514936_3515269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036658190.1|3515587_3515857_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_077997555.1|3515889_3516183_+	mRNA-degrading endonuclease	NA	NA	NA	NA	NA
WP_023483432.1|3516434_3516725_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077996013.1|3516721_3519232_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_036658187.1|3519336_3519633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995375.1|3520735_3521959_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_079940440.1|3522114_3523563_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.9	2.2e-123
WP_023483464.1|3523697_3524084_-	DUF1878 family protein	NA	NA	NA	NA	NA
WP_077996015.1|3524105_3524564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155121056.1|3525255_3525405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149867721.1|3525394_3526603_-	DNA-binding protein	NA	A0A0K2CP77	Brevibacillus_phage	36.5	1.7e-68
WP_077996017.1|3526850_3527012_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155121057.1|3527476_3527629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996018.1|3527618_3528227_-	hypothetical protein	NA	A0A0K2CP77	Brevibacillus_phage	34.5	1.1e-31
WP_077996019.1|3528269_3528974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996021.1|3529919_3530360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996022.1|3530492_3530864_-	3'-5' exonuclease	NA	A2I2Z6	Vibrio_virus	42.0	1.8e-13
WP_077996023.1|3531131_3531431_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_104932771.1|3531464_3531698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155121058.1|3531684_3532035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996025.1|3532335_3533865_-	alkyl hydroperoxide reductase subunit F	NA	A0A2I2L5E1	Orpheovirus	32.4	5.7e-37
WP_042118705.1|3533876_3534440_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_036658506.1|3534583_3534748_-	FeoB-associated Cys-rich membrane protein	NA	NA	NA	NA	NA
WP_077996026.1|3534764_3536753_-	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_036658128.1|3536749_3536977_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_077996027.1|3538556_3539714_+	MFS transporter	NA	NA	NA	NA	NA
3538633:3538647	attR	AAATGAAATATAATC	NA	NA	NA	NA
WP_036658123.1|3539972_3540485_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
3538633:3538647	attR	AAATGAAATATAATC	NA	NA	NA	NA
WP_077996028.1|3540502_3540775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997556.1|3540918_3541842_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.6	1.4e-30
WP_077996029.1|3542356_3542719_-	hypothetical protein	NA	A0A2I7SCG2	Paenibacillus_phage	80.0	9.9e-49
WP_104932772.1|3542733_3543183_-	hypothetical protein	NA	A0A2I7SCF1	Paenibacillus_phage	80.8	5.0e-58
WP_077996030.1|3543763_3544738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996031.1|3544689_3545505_+	S8 family peptidase	NA	A0A127AWU5	Bacillus_phage	37.4	1.1e-36
WP_079940442.1|3545749_3547015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995375.1|3547047_3548271_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_077997558.1|3548385_3548574_-	hypothetical protein	NA	A0A1V0E026	Clostridioides_phage	58.9	6.5e-12
WP_051428085.1|3548557_3548749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996034.1|3548801_3549548_-	hypothetical protein	NA	Q331X8	Clostridium_botulinum_C_phage	40.9	1.7e-31
WP_079940443.1|3549814_3552262_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_077996035.1|3552273_3553320_-	aminomethyl transferase family protein	NA	NA	NA	NA	NA
WP_077996036.1|3553322_3556115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996037.1|3556111_3556600_-	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_024093465.1|3556606_3556894_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_023484175.1|3557016_3557763_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	46.1	4.9e-10
WP_077996038.1|3557755_3558706_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_036655264.1|3558702_3559122_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_024093462.1|3559127_3560282_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_077996039.1|3560457_3561405_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.4	1.5e-24
WP_042118638.1|3561797_3562850_+	Fic family protein	NA	NA	NA	NA	NA
WP_024093460.1|3563285_3565169_-	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	34.4	3.6e-94
WP_158672810.1|3565887_3566685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996042.1|3566689_3567568_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_077996043.1|3570336_3571236_-	DUF91 domain-containing protein	NA	NA	NA	NA	NA
WP_077996044.1|3571385_3574604_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_104932817.1|3574610_3575237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996045.1|3575364_3576825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940444.1|3576809_3578114_-	DUF2399 domain-containing protein	NA	NA	NA	NA	NA
WP_155121059.1|3578339_3578477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996048.1|3578765_3582116_-	DEAD/DEAH box helicase family protein	NA	Q5YA94	Bacillus_phage	22.9	2.0e-18
WP_158676627.1|3582126_3582627_-	hypothetical protein	NA	A0A2I7SCM7	Paenibacillus_phage	93.2	1.2e-17
WP_077995375.1|3582618_3583842_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_158672812.1|3583834_3584719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996051.1|3584725_3586183_-	SAM-dependent DNA methyltransferase	NA	A0A1W6JNK1	Staphylococcus_phage	28.6	4.2e-21
WP_077584997.1|3586733_3586820_-|holin	putative holin-like toxin	holin	A0A0K2CZR6	Paenibacillus_phage	100.0	2.0e-05
WP_149867724.1|3586993_3587503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996053.1|3588199_3591373_-	type 2 lantipeptide synthetase LanM	NA	NA	NA	NA	NA
WP_077996054.1|3591474_3591696_-	mersacidin/lichenicidin family type 2 lantibiotic	NA	NA	NA	NA	NA
WP_077996055.1|3591796_3592951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996056.1|3592956_3593655_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	3.1e-14
WP_077996057.1|3593670_3594681_-	S8 family serine peptidase	NA	A0A2H4PQH1	Staphylococcus_phage	28.9	1.2e-22
WP_051428052.1|3594677_3594926_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_077997560.1|3597771_3599709_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.2	1.0e-11
WP_158672813.1|3600025_3600310_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_077996060.1|3600323_3600995_-|transposase	IS3 family transposase	transposase	O48391	Streptococcus_phage	68.8	9.8e-18
WP_149867726.1|3601781_3602153_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158672814.1|3602278_3602446_-|transposase	transposase	transposase	NA	NA	NA	NA
3609693:3609707	attR	GTCGGTAAAGTACAG	NA	NA	NA	NA
>prophage 22
NZ_CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	3618998	3629655	4268596		Prochlorococcus_phage(25.0%)	9	NA	NA
WP_079940447.1|3618998_3620546_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.8	7.7e-74
WP_077996072.1|3620756_3621380_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.9	1.8e-26
WP_077996073.1|3621376_3622423_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.7	1.5e-68
WP_077996074.1|3622516_3624091_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.6	8.7e-49
WP_079940448.1|3624075_3626319_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	44.5	4.5e-168
WP_023485275.1|3626296_3626992_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_023485276.1|3627064_3627307_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FJ99	Synechococcus_phage	35.4	4.3e-08
WP_077996075.1|3627401_3628286_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	33.6	9.5e-37
WP_036655290.1|3628359_3629655_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	34.3	6.3e-21
>prophage 23
NZ_CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	3697601	3751586	4268596	holin,transposase	Paenibacillus_phage(40.0%)	60	NA	NA
WP_036657132.1|3697601_3698750_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	33.6	8.9e-27
WP_077996099.1|3699173_3700475_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_104932776.1|3700480_3701455_-	ATPase	NA	NA	NA	NA	NA
WP_077996100.1|3701500_3702508_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_024093340.1|3703172_3703787_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	62.6	7.5e-73
WP_077996101.1|3703904_3706523_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077996102.1|3706583_3707570_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024093337.1|3707566_3708343_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_077996103.1|3708358_3709306_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	3.8e-23
WP_079940453.1|3709465_3709675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077585258.1|3710023_3710179_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	46.0	9.8e-06
WP_036655317.1|3710490_3710793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036657135.1|3710901_3712062_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_077996105.1|3712220_3712562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023485170.1|3712786_3713179_-	holo-[acyl-carrier-protein] synthase	NA	NA	NA	NA	NA
WP_036655319.1|3713273_3714179_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_077996106.1|3714171_3715098_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.9	1.0e-36
WP_023485173.1|3715302_3716109_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	45.2	1.3e-53
WP_077585259.1|3716555_3716984_-	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_023485175.1|3717128_3717482_-	DUF3905 domain-containing protein	NA	NA	NA	NA	NA
WP_077996107.1|3717485_3718352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996108.1|3718469_3719192_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_023485178.1|3719194_3719713_-	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_077996109.1|3719719_3720385_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_077996110.1|3720439_3720730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023485180.1|3720988_3721675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996111.1|3721814_3722837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940454.1|3722870_3723371_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_155121060.1|3723666_3723837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104932657.1|3724000_3724870_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	99.6	1.1e-135
WP_036654509.1|3724890_3725574_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_077996114.1|3725640_3725901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996115.1|3725990_3726476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996116.1|3726632_3727901_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	60.2	1.4e-28
WP_042118522.1|3727999_3728362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996117.1|3728440_3728773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149867728.1|3728757_3729222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996119.1|3730222_3730816_+	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
WP_158672815.1|3730922_3731159_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	98.3	2.6e-26
WP_077995375.1|3731223_3732447_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_077996122.1|3733208_3733892_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	96.9	1.7e-118
WP_024093255.1|3734079_3734781_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.1	7.3e-32
WP_077996123.1|3734770_3736150_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	31.9	1.7e-19
WP_024093253.1|3736307_3736829_+	C40 family peptidase	NA	NA	NA	NA	NA
WP_077996124.1|3736902_3737385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996125.1|3737435_3738167_-	VOC family protein	NA	NA	NA	NA	NA
WP_077996126.1|3738566_3739358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996127.1|3739354_3740257_-	EamA family transporter	NA	NA	NA	NA	NA
WP_051427941.1|3740588_3741572_-	phosphotransferase	NA	NA	NA	NA	NA
WP_036655338.1|3741829_3743047_-	MFS transporter	NA	NA	NA	NA	NA
WP_024093246.1|3743112_3743703_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077996128.1|3743827_3744889_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_077996129.1|3745165_3746206_-	oxidoreductase	NA	NA	NA	NA	NA
WP_149867729.1|3746290_3746590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655344.1|3747114_3747597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024093241.1|3748006_3748492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042119436.1|3749448_3749763_-	MGMT family protein	NA	NA	NA	NA	NA
WP_024093237.1|3750026_3750398_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077996131.1|3750399_3750825_-	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_077996132.1|3751181_3751586_-|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	55.3	5.1e-30
>prophage 24
NZ_CP019659	Paenibacillus larvae subsp. larvae strain Eric_IV chromosome, complete genome	4268596	3811965	3819661	4268596	tRNA	Pneumococcus_phage(33.33%)	6	NA	NA
WP_077996172.1|3811965_3812484_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	63.1	2.2e-49
WP_024093191.1|3812510_3813248_-	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	41.8	4.2e-54
WP_077996173.1|3813240_3813726_-	6-carboxytetrahydropterin synthase QueD	NA	J9PV91	Bacillus_phage	68.2	7.7e-57
WP_077996174.1|3813722_3814394_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	58.3	1.4e-67
WP_077996175.1|3814942_3816646_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.3	4.0e-76
WP_077996177.1|3817678_3819661_+	acyltransferase family protein	NA	B5WZU0	Pseudomonas_phage	32.7	2.0e-42
>prophage 1
NZ_CP019660	Paenibacillus larvae subsp. larvae strain Eric_IV plasmid unnamed1, complete sequence	60865	23576	29972	60865	integrase	Bacillus_phage(50.0%)	8	25759:25772	31069:31082
WP_077997741.1|23576_23816_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A0N9S804	Paenibacillus_phage	50.0	3.3e-08
WP_077997739.1|23812_24142_+	mRNA-degrading endonuclease	NA	NA	NA	NA	NA
25759:25772	attL	CATCTTTATTTTTT	NA	NA	NA	NA
WP_077997683.1|25791_26070_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	51.7	1.4e-15
WP_077997684.1|26179_26386_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	1.6e-19
WP_077996502.1|26742_27426_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	96.9	1.4e-117
WP_077997687.1|28430_29348_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A7AR08	Bacillus_phage	57.0	2.6e-93
WP_077997688.1|29494_29746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997689.1|29711_29972_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A125RQ76	Bacillus_phage	54.7	2.4e-20
31069:31082	attR	CATCTTTATTTTTT	NA	NA	NA	NA
