The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014033	Vibrio fluvialis strain FDAARGOS_100 chromosome 1, complete sequence	3150565	26454	38020	3150565		Vibrio_phage(90.91%)	13	NA	NA
WP_104966933.1|26454_28185_+	response regulator	NA	A0A1V0SGX0	Hokovirus	35.0	1.5e-49
WP_104965711.1|28294_29539_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_104965712.1|29708_30077_-	hypothetical protein	NA	Q858Q3	Vibrio_phage	51.2	5.9e-25
WP_104965713.1|30195_30402_+	hypothetical protein	NA	G8IRU4	Vibrio_phage	53.8	6.2e-16
WP_104966934.1|30470_31661_+	replication initiation factor domain-containing protein	NA	G8IRU5	Vibrio_phage	69.1	6.6e-166
WP_100268100.1|31653_31971_+	hypothetical protein	NA	G8IRU6	Vibrio_phage	70.2	2.2e-36
WP_100268099.1|31980_32205_+	hypothetical protein	NA	R9TMT7	Vibrio_phage	68.9	1.2e-20
WP_104965714.1|32239_32455_+	hypothetical protein	NA	R9TRU5	Vibrio_phage	64.6	3.0e-13
WP_146106754.1|32586_34050_+	hypothetical protein	NA	G8IRU9	Vibrio_phage	28.6	2.6e-23
WP_055453527.1|34058_34400_+	DUF2523 domain-containing protein	NA	R9TRT6	Vibrio_phage	75.2	1.8e-44
WP_104965716.1|34405_35776_+	toxin	NA	R9TQ09	Vibrio_phage	77.5	3.0e-207
WP_104965717.1|35855_36035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104965718.1|36544_38020_+	AAA family ATPase	NA	A0A2I7RNF1	Vibrio_phage	19.8	2.0e-07
>prophage 2
NZ_CP014033	Vibrio fluvialis strain FDAARGOS_100 chromosome 1, complete sequence	3150565	848506	855554	3150565		Megavirus(16.67%)	9	NA	NA
WP_020330651.1|848506_848938_-	nucleoside-diphosphate kinase	NA	K7YW26	Megavirus	39.8	2.6e-19
WP_020330650.1|849007_850300_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	40.7	4.5e-35
WP_020330649.1|850476_850671_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_020330648.1|850726_851065_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_104966048.1|851078_852932_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	40.8	3.8e-112
WP_104966049.1|852953_853469_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_020330645.1|853536_853860_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	5.5e-27
WP_020330644.1|853919_854303_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.4	9.1e-53
WP_104966050.1|854339_855554_-	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	30.5	1.4e-30
>prophage 3
NZ_CP014033	Vibrio fluvialis strain FDAARGOS_100 chromosome 1, complete sequence	3150565	1066841	1077947	3150565	tRNA	uncultured_Mediterranean_phage(25.0%)	9	NA	NA
WP_104966138.1|1066841_1069424_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.2	1.5e-77
WP_044365873.1|1069611_1070070_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_104966139.1|1070139_1071192_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	60.7	3.7e-112
WP_020330432.1|1071364_1071853_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	44.5	1.3e-24
WP_104966140.1|1071937_1074499_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.4	5.8e-34
WP_020429689.1|1074567_1075554_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.5	1.3e-34
WP_075988940.1|1075625_1076561_-	murein hydrolase activator NlpD	NA	I3PV79	Clostridium_phage	32.0	6.6e-12
WP_104966141.1|1076560_1077187_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	53.3	2.0e-36
WP_020330427.1|1077179_1077947_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.8	9.1e-68
>prophage 4
NZ_CP014033	Vibrio fluvialis strain FDAARGOS_100 chromosome 1, complete sequence	3150565	2252079	2258610	3150565		Staphylococcus_phage(66.67%)	7	NA	NA
WP_104966557.1|2252079_2253213_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.0	1.1e-64
WP_044363785.1|2253224_2254475_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.2	6.8e-97
WP_020331649.1|2254577_2255027_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_104966558.1|2255040_2256150_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.0	6.5e-43
WP_104966559.1|2256153_2256807_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	39.0	5.0e-35
WP_020431928.1|2256848_2257958_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.0	4.8e-62
WP_004724909.1|2258139_2258610_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.3	1.9e-31
>prophage 5
NZ_CP014033	Vibrio fluvialis strain FDAARGOS_100 chromosome 1, complete sequence	3150565	2321464	2330817	3150565	integrase,capsid	Vibrio_phage(33.33%)	16	2318650:2318696	2331889:2331935
2318650:2318696	attL	TGGCGCTCCCGACAGGATTCGAACCTGAGACCTGCCCCTTAGGAGGG	NA	NA	NA	NA
WP_104966581.1|2321464_2322454_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	47.2	2.3e-76
WP_104966991.1|2322450_2323173_-	peptidase	NA	L7TH81	Pseudomonas_virus	24.7	4.2e-06
WP_104966582.1|2323279_2323531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104966583.1|2323540_2323801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104966584.1|2323810_2324050_+	hypothetical protein	NA	A0A2I7RNH0	Vibrio_phage	42.4	1.2e-07
WP_104966585.1|2324075_2324360_+	hypothetical protein	NA	A0A2I7RNG7	Vibrio_phage	59.8	4.3e-23
WP_192945802.1|2324352_2324526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104966586.1|2324522_2324714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104966587.1|2324772_2325006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104966992.1|2325110_2327003_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	36.1	1.4e-53
WP_104966588.1|2327041_2327233_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_104966589.1|2327418_2328228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104966590.1|2328230_2328971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104966591.1|2329362_2329530_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_104966592.1|2329513_2329777_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_104966593.1|2329788_2330817_+|capsid	P2 family phage major capsid protein	capsid	A0A0U4K5I9	Pseudomonas_phage	34.7	4.5e-46
2331889:2331935	attR	TGGCGCTCCCGACAGGATTCGAACCTGAGACCTGCCCCTTAGGAGGG	NA	NA	NA	NA
>prophage 1
NZ_CP014032	Vibrio fluvialis strain FDAARGOS_100 chromosome 2, complete sequence	1716983	224015	259592	1716983	integrase,capsid,portal,head,terminase,plate,tail	Vibrio_phage(30.0%)	45	213423:213437	253777:253791
213423:213437	attL	TCGTCGGTGCTCTGA	NA	NA	NA	NA
WP_104964889.1|224015_225044_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A160DJR8	Vibrio_phage	59.8	2.0e-118
WP_104964890.1|225332_227024_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_104964891.1|227016_229350_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_104964892.1|229339_230503_+	protein-PII uridylyltransferase	NA	NA	NA	NA	NA
WP_146106750.1|230525_231236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104964894.1|231237_231732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104964895.1|231784_232492_-	helix-turn-helix domain-containing protein	NA	M4MB93	Vibrio_phage	35.7	2.0e-13
WP_104964896.1|232620_232803_+	helix-turn-helix domain-containing protein	NA	M4R204	Salicola_phage	56.6	9.4e-08
WP_104964897.1|232871_233030_+	regulator	NA	U3PFJ1	Vibrio_phage	70.0	5.5e-12
WP_004726786.1|233247_233787_+	phage regulatory CII family protein	NA	A0A2I7RNI1	Vibrio_phage	57.0	2.0e-53
WP_104964898.1|233796_234129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104964899.1|234201_234498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104964900.1|234494_235037_+	DNA methyltransferase	NA	U3PDF3	Vibrio_phage	83.4	4.4e-85
WP_104964901.1|235053_237684_+	replication endonuclease	NA	A0A166YHE2	Vibrio_phage	59.5	7.7e-300
WP_020329270.1|237693_237945_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_104964902.1|238190_238553_+	hypothetical protein	NA	A0A1S6KZW3	Salmonella_phage	35.2	1.8e-10
WP_104964903.1|238861_240052_+	DNA circularization N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_104964904.1|240048_240987_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_104964905.1|240979_241555_+|plate	phage baseplate assembly protein V	plate	B5TK73	Pseudomonas_phage	33.1	1.2e-11
WP_104964906.1|241551_241938_+	phage GP46 family protein	NA	NA	NA	NA	NA
WP_104964907.1|241934_242981_+|plate	baseplate J/gp47 family protein	plate	S5FM68	Shigella_phage	24.2	1.5e-12
WP_104964908.1|242962_243442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104964909.1|243438_244533_+|tail	phage tail protein	tail	E5FJ29	Escherichia_phage	37.4	3.9e-16
WP_192945778.1|244532_245462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104964910.1|245576_246578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104964911.1|246574_246982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104964912.1|247113_247530_+	glycoside hydrolase family protein	NA	A0A1Q1PW74	Pseudoalteromonas_phage	51.5	1.4e-27
WP_004726817.1|247540_247771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104964913.1|247761_248013_+	hypothetical protein	NA	A0A1D9C9R8	Salinivibrio_phage	45.2	9.0e-09
WP_104964914.1|248093_248792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104964915.1|248890_249415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104964916.1|249534_250002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104964917.1|250468_251434_-|portal	phage portal protein	portal	A0A0M3LS06	Mannheimia_phage	40.9	6.3e-58
WP_192945779.1|251444_253205_-|terminase	terminase	terminase	E5E3X0	Burkholderia_phage	41.4	7.3e-113
WP_104964919.1|253339_254152_+|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	37.3	1.7e-19
253777:253791	attR	TCAGAGCACCGACGA	NA	NA	NA	NA
WP_104964920.1|254194_255232_+|capsid	phage major capsid protein, P2 family	capsid	A0A0U4K5I9	Pseudomonas_phage	41.7	8.2e-64
WP_104964921.1|255340_255790_+|head	head completion/stabilization protein	head	NA	NA	NA	NA
WP_104964922.1|255789_256254_+|tail	phage tail protein	tail	A0A1S5NPS3	Burkholderia_phage	29.4	5.0e-05
WP_104964923.1|256250_256790_+	phage virion morphogenesis protein	NA	NA	NA	NA	NA
WP_055452432.1|256790_256973_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_104964924.1|256969_258103_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	38.7	1.5e-47
WP_104964925.1|258106_258472_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_104964926.1|258482_259178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020432125.1|259161_259449_+|tail	phage tail assembly protein	tail	E5FFG7	Burkholderia_phage	40.4	9.7e-07
WP_075990070.1|259484_259592_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
>prophage 2
NZ_CP014032	Vibrio fluvialis strain FDAARGOS_100 chromosome 2, complete sequence	1716983	920066	957049	1716983	integrase,capsid,head,portal,terminase,plate,tail	Vibrio_phage(27.27%)	50	918055:918075	957169:957189
918055:918075	attL	AAAAACCCGCCATTGGGCGGG	NA	NA	NA	NA
WP_075990070.1|920066_920174_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_104965232.1|920209_920497_-|tail	phage tail assembly protein	tail	E5FFG7	Burkholderia_phage	41.6	5.7e-07
WP_104965233.1|920480_921188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004726844.1|921198_921564_-|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_104965234.1|921567_922701_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	38.7	1.5e-47
WP_104965235.1|922697_922880_-	DUF2635 domain-containing protein	NA	A0A0C4UR31	Shigella_phage	46.4	7.5e-05
WP_104965236.1|922880_923420_-	phage virion morphogenesis protein	NA	NA	NA	NA	NA
WP_104965237.1|923416_923881_-|tail	phage tail protein	tail	A0A1S5NPS3	Burkholderia_phage	29.8	8.6e-05
WP_104965238.1|923880_924330_-|head	head completion/stabilization protein	head	NA	NA	NA	NA
WP_104965239.1|924438_925476_-|capsid	phage major capsid protein, P2 family	capsid	A0A0U4K5I9	Pseudomonas_phage	42.0	3.7e-64
WP_104965240.1|925518_926337_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MZ5	Haemophilus_virus	32.4	1.7e-16
WP_192945760.1|926471_928232_+|terminase	terminase	terminase	E5E3X0	Burkholderia_phage	41.4	1.6e-112
WP_104965242.1|928242_929208_+|portal	phage portal protein	portal	A0A0M3LS06	Mannheimia_phage	40.9	6.3e-58
WP_104965243.1|929695_930532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104965244.1|930668_931352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146106751.1|931426_931690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104965245.1|931948_932566_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	59.8	1.6e-22
WP_192945761.1|933100_933442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104965247.1|933590_934130_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_081381516.1|934164_934596_+	GFA family protein	NA	NA	NA	NA	NA
WP_055452445.1|934746_935181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104965249.1|935257_935509_-	hypothetical protein	NA	A0A1D9C9R8	Salinivibrio_phage	43.8	3.4e-08
WP_004726817.1|935499_935730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104965250.1|935740_936157_-	glycoside hydrolase family protein	NA	A0A1Q1PW74	Pseudoalteromonas_phage	53.0	2.9e-28
WP_104965666.1|936390_936966_+	acyltransferase	NA	A0A1V0SJ47	Klosneuvirus	43.4	2.8e-05
WP_104965251.1|937049_937613_-	hypothetical protein	NA	R9TMQ2	Vibrio_phage	59.3	1.5e-56
WP_104965252.1|937605_938616_-	hypothetical protein	NA	R9TNR5	Vibrio_phage	72.1	1.4e-71
WP_104965253.1|938612_939143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104965254.1|939124_940171_-|plate	baseplate J/gp47 family protein	plate	S5FM68	Shigella_phage	24.2	1.1e-12
WP_104965255.1|940167_940554_-	phage GP46 family protein	NA	NA	NA	NA	NA
WP_104965256.1|940550_941126_-|plate	phage baseplate assembly protein V	plate	B5TK73	Pseudomonas_phage	30.5	5.8e-11
WP_104965257.1|941118_942057_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_104965258.1|942053_943244_-	DNA circularization N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_038151570.1|944029_944389_-	hypothetical protein	NA	A0A1S6KZW3	Salmonella_phage	37.0	1.5e-12
WP_004726797.1|944634_944886_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_104965259.1|944895_947526_-	replication endonuclease	NA	A0A166YHE2	Vibrio_phage	59.2	4.6e-297
WP_104965260.1|947542_948085_-	DNA methyltransferase	NA	U3PDF3	Vibrio_phage	82.3	4.9e-84
WP_044362472.1|948081_948378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104965261.1|948450_948783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014257423.1|948792_949332_-	phage regulatory CII family protein	NA	A0A2I7RNI1	Vibrio_phage	57.0	3.4e-53
WP_004726785.1|949389_949848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171934179.1|949998_950724_+	peptidase	NA	M4MB93	Vibrio_phage	29.6	3.4e-24
WP_192945762.1|950800_951835_+	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_104965263.1|951837_953373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_192945763.1|953543_954356_-	DUF1016 family protein	NA	NA	NA	NA	NA
WP_104965667.1|954412_954514_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_104965265.1|954514_954934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_192945764.1|955000_955093_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_104965267.1|955123_955762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104965668.1|956080_957049_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	49.7	2.7e-85
957169:957189	attR	AAAAACCCGCCATTGGGCGGG	NA	NA	NA	NA
