The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026515	Helicobacter pylori strain dRdM2addM2 chromosome, complete genome	1668735	1020505	1072430	1668735	integrase,transposase,tRNA	Helicobacter_phage(50.0%)	45	1031012:1031031	1082353:1082372
WP_001150920.1|1020505_1021417_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_000401714.1|1021430_1022369_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001862971.1|1022500_1022962_-	acyl carrier protein	NA	M4QDG5	Prochlorococcus_phage	47.1	1.3e-05
WP_001862974.1|1022954_1024298_-	dynamin-like GTPase family protein	NA	NA	NA	NA	NA
WP_010875568.1|1024294_1025386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010875569.1|1025295_1026627_-	dynamin-like GTPase family protein	NA	NA	NA	NA	NA
WP_010875570.1|1026623_1028273_-	GTPase	NA	NA	NA	NA	NA
WP_000271456.1|1028493_1028781_-	endoribonuclease VapD	NA	NA	NA	NA	NA
WP_000880322.1|1028850_1029132_-	DUF3240 family protein	NA	NA	NA	NA	NA
WP_000978968.1|1029147_1032210_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	25.7	2.8e-83
1031012:1031031	attL	ATGAGCATGCCTATAGCGAT	NA	NA	NA	NA
WP_000816822.1|1032206_1033286_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_010875571.1|1033282_1034524_-	TolC family protein	NA	NA	NA	NA	NA
WP_000555186.1|1034573_1036679_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000682021.1|1036790_1037852_+	hypothetical protein	NA	A0A2D1GN01	Pseudoalteromonas_phage	30.1	2.0e-09
WP_000057737.1|1037864_1039340_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001165207.1|1039354_1039636_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_001010809.1|1039755_1041066_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	NA	NA	NA	NA
WP_000574070.1|1041194_1042658_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_000400290.1|1042673_1044152_+	cell division protein FtsA	NA	NA	NA	NA	NA
WP_000233600.1|1044282_1045440_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_001863015.1|1046597_1046900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049794234.1|1046910_1047183_+	exonuclease VII large subunit	NA	NA	NA	NA	NA
WP_010875573.1|1047554_1048250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001169565.1|1048250_1048541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343415.1|1049099_1049924_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_010875574.1|1050133_1050457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000923190.1|1050576_1050720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010875575.1|1050759_1051473_-	DUF1887 family protein	NA	NA	NA	NA	NA
WP_000886948.1|1052856_1053090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010875484.1|1053096_1053525_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RG71	Helicobacter_phage	97.9	8.6e-76
WP_000930565.1|1053594_1054878_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1S5REX3	Helicobacter_phage	85.0	2.6e-200
WP_010875578.1|1055026_1056829_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_001120382.1|1057978_1059046_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	26.7	1.7e-08
WP_000009099.1|1059362_1060166_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_000006537.1|1060137_1060389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010875576.1|1060974_1061604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080012132.1|1061608_1062322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000930564.1|1062370_1063654_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1S5REX3	Helicobacter_phage	85.2	1.2e-200
WP_010875484.1|1063723_1064152_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RG71	Helicobacter_phage	97.9	8.6e-76
WP_000587397.1|1064733_1065390_+	ParA family protein	NA	A2I303	Vibrio_virus	23.4	7.1e-05
WP_000394638.1|1065474_1065759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000665511.1|1065802_1066987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000065304.1|1069202_1069517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000254056.1|1070067_1070601_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_001862466.1|1072013_1072430_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	96.4	4.6e-74
1082353:1082372	attR	ATCGCTATAGGCATGCTCAT	NA	NA	NA	NA
