The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020009	Haemophilus influenzae strain 5P54H1 chromosome, complete genome	1886411	373040	440997	1886411	terminase,holin,tail,portal,tRNA	Haemophilus_phage(13.16%)	79	NA	NA
WP_005666644.1|373040_373781_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005632159.1|373865_374210_+	YggL family protein	NA	NA	NA	NA	NA
WP_005666641.1|374415_374946_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_005656333.1|374938_375220_+	chaperone NapD	NA	NA	NA	NA	NA
WP_041174733.1|375256_377740_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_005666637.1|377793_378633_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_011271996.1|378632_379496_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_005691774.1|379492_379945_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_005649107.1|379959_380562_+	cytochrome c3 family protein	NA	NA	NA	NA	NA
WP_005649108.1|380721_381366_-	adenylate kinase	NA	NA	NA	NA	NA
WP_011271997.1|381450_382728_-	MFS transporter	NA	NA	NA	NA	NA
WP_042599468.1|382869_383886_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	48.9	2.1e-88
WP_105182546.1|384058_384991_-	CMP-Neu5Ac--lipooligosaccharide alpha 2-3 sialyltransferase	NA	NA	NA	NA	NA
WP_005688947.1|385403_386126_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.5	1.5e-27
WP_005649115.1|386122_386860_+	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	24.5	2.8e-10
WP_011961725.1|386881_387826_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005654829.1|387835_388483_+	thiaminase II	NA	NA	NA	NA	NA
WP_005654831.1|388582_389398_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005654833.1|389390_390239_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005654835.1|390242_391163_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	25.4	1.0e-17
WP_105182547.1|391162_392044_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005659920.1|392409_393288_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_080316047.1|393513_394686_+|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_042611895.1|394786_395326_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_042611894.1|395397_396309_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011272008.1|396317_397424_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_038440737.1|397433_398705_+|tRNA	histidine--tRNA ligase	tRNA	A0A1V0SLE3	Klosneuvirus	26.2	2.0e-27
WP_011272010.1|398722_399337_+	YfgM family protein	NA	NA	NA	NA	NA
WP_005659903.1|399387_399582_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005656373.1|399581_399923_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_011272011.1|399962_401822_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	42.3	2.3e-109
WP_005669116.1|401839_402526_-	DUF2625 domain-containing protein	NA	NA	NA	NA	NA
WP_011272012.1|402576_403101_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005649164.1|403113_403437_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	46.7	4.4e-24
WP_005691745.1|403494_403911_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	80.6	2.0e-53
WP_005649169.1|403934_405149_-	IscS subfamily cysteine desulfurase	NA	H7BUW1	unidentified_phage	35.5	1.5e-32
WP_005654871.1|405215_405668_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_105182548.1|405720_406446_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_013525579.1|407094_407553_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	55.8	4.9e-45
WP_042611893.1|407549_408152_-	hypothetical protein	NA	Q94MX9	Haemophilus_virus	94.0	3.0e-98
WP_084999867.1|408163_409786_-|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	67.4	6.3e-220
WP_084999855.1|409982_413633_-|tail	phage tail protein	tail	A0A0R6PIC9	Moraxella_phage	37.4	2.0e-141
WP_080291956.1|413636_414356_-|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	40.2	6.1e-34
WP_042611836.1|414294_415002_-	C40 family peptidase	NA	A0A1B1IV85	uncultured_Mediterranean_phage	43.2	3.4e-53
WP_084999857.1|415003_415654_-|tail	phage minor tail protein L	tail	Q6JIL5	Burkholderia_virus	39.6	5.5e-34
WP_038440720.1|415697_416216_-	antirepressor	NA	Q0H8C7	Salmonella_phage	52.8	1.3e-33
WP_105182549.1|416632_417511_-	phage repressor protein/antirepressor Ant	NA	D0UIK6	Aggregatibacter_phage	78.4	4.7e-129
WP_042594865.1|418006_418546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038440713.1|419291_419624_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	38.5	2.7e-16
WP_042611832.1|419632_423025_-	tape measure protein	NA	A0A2P1CKJ3	Pantoea_phage	23.5	1.8e-35
WP_101494098.1|423076_423313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005651224.1|423328_423631_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_015701504.1|423614_423998_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_038440708.1|424066_424291_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_038440705.1|424335_424743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038440702.1|425017_425668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005651206.1|425670_426081_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_042593432.1|426098_426620_-|tail	tail protein	tail	K7PKQ5	Enterobacteria_phage	50.0	2.6e-18
WP_042611831.1|426622_426934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042593431.1|426914_427238_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_105182746.1|427316_429344_-	peptidase S14	NA	A0A1W6JT88	Pseudomonas_phage	56.7	4.8e-201
WP_005668565.1|429294_430818_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	57.7	2.7e-156
WP_005633930.1|430821_431040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042611829.1|431036_433160_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	66.8	1.7e-273
WP_048950255.1|433162_433636_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	53.6	4.9e-40
WP_042593427.1|433909_434191_-	hypothetical protein	NA	Q776X1	Haemophilus_phage	75.6	1.9e-31
WP_042593426.1|434102_434426_-	DUF2570 family protein	NA	Q7Y5U9	Haemophilus_phage	54.6	7.8e-21
WP_042593425.1|434418_435021_-	glycoside hydrolase family 19 protein	NA	Q7Y5V0	Haemophilus_phage	53.4	3.7e-56
WP_042593424.1|434989_435346_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_042593423.1|435585_436104_-	antitermination protein	NA	G8C7V7	Escherichia_phage	33.3	7.6e-18
WP_042593422.1|436104_436650_-	NinG recombination protein	NA	D0UIK8	Aggregatibacter_phage	69.1	1.7e-60
WP_042593421.1|436742_437159_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	85.4	9.6e-64
WP_005633909.1|437195_437420_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	47.9	1.1e-10
WP_042593364.1|437416_438052_-	replication P	NA	A0A1I9KFB0	Aeromonas_phage	25.5	9.0e-05
WP_042611846.1|438036_438795_-	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	67.3	1.6e-61
WP_042611845.1|438791_439466_-	antirepressor	NA	D0UIL6	Aggregatibacter_phage	55.1	4.2e-61
WP_005671478.1|439514_439955_-	hypothetical protein	NA	A0A0U4B0E3	Pseudomonas_phage	32.6	8.1e-13
WP_005662314.1|440003_440210_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LSY2	Mannheimia_phage	67.7	1.9e-17
WP_042611844.1|440340_440997_+	LexA family transcriptional regulator	NA	A0A0M3LSL8	Mannheimia_phage	58.4	7.2e-66
>prophage 2
NZ_CP020009	Haemophilus influenzae strain 5P54H1 chromosome, complete genome	1886411	445013	453203	1886411	integrase	Mannheimia_phage(42.86%)	13	439510:439524	456197:456211
439510:439524	attL	TTTTTTTATTTCTTG	NA	NA	NA	NA
WP_105182550.1|445013_445865_+	hypothetical protein	NA	D0UIK6	Aggregatibacter_phage	42.1	3.1e-53
WP_105182551.1|445948_446296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105182552.1|446292_446586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053521080.1|446597_447518_+	recombinase	NA	A0A0M3LNU3	Mannheimia_phage	70.9	4.1e-115
WP_042611920.1|447492_448143_+	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	72.5	4.8e-86
WP_013525617.1|448142_448577_+	single-stranded DNA-binding protein	NA	A0A059WRL7	Vibrio_phage	36.2	7.5e-19
WP_005688799.1|448678_449248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005688797.1|449244_449481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005647194.1|449477_449837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042611919.1|449844_451008_+	DNA cytosine methyltransferase	NA	A0A2I7RFJ9	Vibrio_phage	46.1	1.5e-90
WP_105182553.1|451026_451548_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	42.0	1.6e-23
WP_005668273.1|451551_451839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005641600.1|452177_453203_+|integrase	site-specific integrase	integrase	K7PKD7	Enterobacteria_phage	35.4	7.4e-57
456197:456211	attR	TTTTTTTATTTCTTG	NA	NA	NA	NA
>prophage 3
NZ_CP020009	Haemophilus influenzae strain 5P54H1 chromosome, complete genome	1886411	635063	642795	1886411	transposase	Macacine_betaherpesvirus(50.0%)	10	NA	NA
WP_005649541.1|635063_636056_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	38.9	2.0e-51
WP_105182582.1|636118_636472_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	58.3	1.5e-30
WP_105197409.1|637070_637319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105197410.1|637272_637944_+	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_105182584.1|637948_638056_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	65.6	3.3e-05
WP_105197411.1|638059_638161_-|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	71.9	2.8e-06
WP_042593284.1|638384_638738_-	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	34.5	1.2e-06
WP_005657931.1|638828_639503_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_042593283.1|639548_640223_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_005690204.1|640374_642795_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	35.1	8.5e-120
>prophage 4
NZ_CP020009	Haemophilus influenzae strain 5P54H1 chromosome, complete genome	1886411	1286303	1294812	1886411		Planktothrix_phage(16.67%)	8	NA	NA
WP_038441344.1|1286303_1287287_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	1.4e-20
WP_005694258.1|1287289_1288282_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.0e-14
WP_005653671.1|1288291_1289179_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_105182749.1|1289193_1290165_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_080317064.1|1290284_1292468_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.7	3.9e-116
WP_005686506.1|1293074_1293710_-	7-carboxy-7-deazaguanine synthase QueE	NA	S4TZT1	uncultured_phage	30.3	8.7e-16
WP_011272433.1|1293710_1294136_-	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	42.0	2.3e-20
WP_011272434.1|1294128_1294812_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	50.7	2.3e-54
>prophage 5
NZ_CP020009	Haemophilus influenzae strain 5P54H1 chromosome, complete genome	1886411	1526337	1547988	1886411	integrase	Mannheimia_phage(23.81%)	31	1520118:1520134	1535904:1535920
1520118:1520134	attL	GGTTGTTGATGAAGCCA	NA	NA	NA	NA
WP_105182752.1|1526337_1527225_+|integrase	site-specific integrase	integrase	A0A0M3LQN1	Mannheimia_phage	54.2	2.7e-84
WP_005650488.1|1527296_1527500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042593413.1|1527541_1527814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042593414.1|1527806_1528130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042599527.1|1528119_1528608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042593416.1|1528687_1529104_-	hypothetical protein	NA	W0B4E9	Acinetobacter_phage	39.2	3.5e-05
WP_005668260.1|1529107_1529755_-	hypothetical protein	NA	A0A0M3LNU4	Mannheimia_phage	40.0	1.0e-08
WP_042599526.1|1529765_1530554_-	DNA methyltransferase	NA	U4KJA1	Streptococcus_phage	56.7	4.0e-79
WP_042593417.1|1530550_1530910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005668254.1|1530906_1531152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038440649.1|1531148_1532045_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	43.7	8.4e-57
WP_105182722.1|1532169_1533462_-	hypothetical protein	NA	A0A0U3TGV3	Pseudomonas_phage	61.9	8.8e-07
WP_042602779.1|1533524_1533959_-	single-stranded DNA-binding protein	NA	A0A059WRL7	Vibrio_phage	36.2	1.3e-18
WP_042602780.1|1533958_1534603_-	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	71.4	6.8e-85
WP_080317036.1|1534813_1535425_-	Bro-N domain-containing protein	NA	Q7Y5X0	Haemophilus_phage	60.6	5.8e-33
WP_042593269.1|1535769_1536681_-	recombinase	NA	A0A0M3LNU3	Mannheimia_phage	70.7	2.4e-115
1535904:1535920	attR	TGGCTTCATCAACAACC	NA	NA	NA	NA
WP_042593270.1|1536692_1536986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042599368.1|1536982_1537333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042599513.1|1537422_1538043_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	46.4	3.7e-19
WP_042593356.1|1538547_1539378_-	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	52.2	3.4e-76
WP_158672356.1|1539542_1539713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005662013.1|1540388_1541420_+	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	66.4	2.8e-128
WP_042593357.1|1541376_1542036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042593358.1|1542035_1543130_-	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	36.2	2.0e-60
WP_042599512.1|1543145_1544051_-	helix-turn-helix transcriptional regulator	NA	B6SCU0	Bacteriophage	40.8	3.0e-38
WP_005662003.1|1544185_1544413_+	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	50.8	1.5e-10
WP_042593361.1|1545013_1545256_+	hypothetical protein	NA	M4NJW2	Sulfitobacter_phage	41.4	4.0e-06
WP_042599516.1|1546010_1546634_+	replication P	NA	D0UIL4	Aggregatibacter_phage	42.2	6.9e-34
WP_005633909.1|1546630_1546855_+	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	47.9	1.1e-10
WP_042594054.1|1546891_1547308_+	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	86.1	1.9e-64
WP_042594011.1|1547400_1547988_+	recombinase NinG	NA	A0A2I7RAC0	Vibrio_phage	48.0	8.3e-37
>prophage 6
NZ_CP020009	Haemophilus influenzae strain 5P54H1 chromosome, complete genome	1886411	1551547	1557958	1886411	terminase,head	Haemophilus_phage(55.56%)	9	NA	NA
WP_042594014.1|1551547_1552090_+	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	52.0	3.1e-46
WP_042594015.1|1552062_1552398_+	DUF2570 family protein	NA	Q7Y5U9	Haemophilus_phage	52.1	9.8e-19
WP_042594016.1|1552309_1552591_+	hypothetical protein	NA	Q776X1	Haemophilus_phage	70.0	8.8e-29
WP_042594017.1|1552592_1552940_-	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	56.1	1.2e-22
WP_005643377.1|1552923_1553175_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	52.9	9.9e-16
WP_011272619.1|1553252_1553765_+|terminase	terminase small subunit	terminase	A0A1X9SFE5	Acinetobacter_phage	39.2	1.0e-19
WP_105182721.1|1555096_1556431_+	DUF1073 domain-containing protein	NA	Q7Y5U6	Haemophilus_phage	84.0	4.7e-213
WP_075913359.1|1556330_1557641_+|head	phage head morphogenesis protein	head	Q7Y5U5	Haemophilus_phage	78.3	5.3e-108
WP_005650554.1|1557781_1557958_+	DUF2213 domain-containing protein	NA	Q7Y5U2	Haemophilus_phage	93.1	8.5e-22
>prophage 7
NZ_CP020009	Haemophilus influenzae strain 5P54H1 chromosome, complete genome	1886411	1566226	1578307	1886411	tRNA	Acinetobacter_phage(42.86%)	11	NA	NA
WP_105182720.1|1566226_1569091_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.7	4.2e-150
WP_042599505.1|1569125_1569401_-	hydrogenase maturation factor HybG	NA	NA	NA	NA	NA
WP_042599504.1|1569532_1570963_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	38.3	2.1e-33
WP_042599503.1|1570993_1571995_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	36.8	1.2e-48
WP_048941027.1|1572047_1572434_-	tautomerase family protein	NA	NA	NA	NA	NA
WP_042599501.1|1572482_1573064_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	39.4	3.8e-34
WP_105182719.1|1573075_1574632_-	anthranilate synthase component I	NA	A0A0B5J984	Pandoravirus	32.1	2.4e-22
WP_042599515.1|1574733_1575498_-	glycosyltransferase	NA	A7IW34	Paramecium_bursaria_Chlorella_virus	29.1	1.2e-14
WP_042599499.1|1575783_1576281_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_005650594.1|1576296_1576785_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_080003751.1|1577302_1578307_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A222YW41	Synechococcus_phage	40.5	9.1e-52
>prophage 8
NZ_CP020009	Haemophilus influenzae strain 5P54H1 chromosome, complete genome	1886411	1625334	1726131	1886411	terminase,tail,head,lysis,portal,plate,protease,integrase,capsid,tRNA	Mannheimia_phage(40.48%)	99	1647826:1647849	1714379:1714402
WP_075913380.1|1625334_1627008_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	76.3	1.5e-253
WP_005631834.1|1627544_1629020_-	ribonuclease G	NA	NA	NA	NA	NA
WP_042594045.1|1629134_1630646_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_042594046.1|1630642_1631608_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_042594047.1|1631651_1632530_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_005650692.1|1632803_1633286_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_038439878.1|1633762_1635001_-	peptidase T	NA	NA	NA	NA	NA
WP_005694012.1|1635266_1636415_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	37.1	1.9e-29
WP_005650698.1|1636398_1637259_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.2	4.5e-15
WP_105182713.1|1637258_1638029_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_005659551.1|1638101_1639241_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_105182712.1|1639321_1641265_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	29.8	5.5e-53
WP_005659555.1|1641358_1642744_-	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_005659557.1|1642836_1643532_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_005650310.1|1643550_1643973_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_005659560.1|1644108_1644570_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	47.0	6.9e-31
WP_011272654.1|1644571_1645771_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	32.0	2.0e-61
WP_005631781.1|1645767_1646148_+	SufE family protein	NA	NA	NA	NA	NA
WP_011272655.1|1646138_1646936_+	Zn-ribbon-containing protein	NA	NA	NA	NA	NA
WP_042593909.1|1646979_1647819_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	39.3	1.0e-40
1647826:1647849	attL	GCGGTGAAATTTCACCGCACTTTT	NA	NA	NA	NA
WP_105182711.1|1647851_1648985_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_005628626.1|1650116_1650503_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_105182710.1|1650667_1652347_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	30.5	1.4e-49
WP_042593906.1|1652336_1653704_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_080317069.1|1653700_1654342_+	abortive infection family protein	NA	NA	NA	NA	NA
WP_105182709.1|1654411_1657594_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	31.4	3.9e-80
WP_042599664.1|1657672_1660162_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	26.0	2.7e-28
WP_005691699.1|1660173_1661661_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_005650281.1|1661677_1662133_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_042593903.1|1663378_1664710_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	33.0	9.3e-44
WP_005652916.1|1664690_1664858_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042593902.1|1664857_1665379_-	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	42.4	4.3e-29
WP_042599665.1|1665433_1667620_-	replication endonuclease	NA	Q94N00	Haemophilus_virus	42.7	5.4e-166
WP_005663355.1|1667629_1667938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005663359.1|1668062_1668305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042593899.1|1668308_1668689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042593898.1|1668706_1668970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042593897.1|1669061_1669349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042593896.1|1669541_1669898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042593895.1|1670350_1670644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005642278.1|1670681_1670924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042593894.1|1670986_1671406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089503506.1|1671574_1672225_+	transcriptional regulator	NA	Q76H56	Enterobacteria_phage	36.1	5.8e-23
WP_042593892.1|1672229_1672991_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_042593891.1|1673235_1674996_+	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_005672606.1|1675055_1675445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075913145.1|1675462_1676683_-	phage late control D family protein	NA	R9QBT3	Mannheimia_phage	57.7	7.0e-123
WP_042593889.1|1676682_1677120_-|tail	phage tail protein	tail	A0A0M3LQ18	Mannheimia_phage	57.3	9.1e-41
WP_005633772.1|1677448_1677595_-|tail	GpE family phage tail protein	tail	E5E3Q0	Burkholderia_phage	65.0	2.2e-07
WP_005655095.1|1677594_1677894_-|tail	phage tail assembly protein	tail	E5E3Q1	Burkholderia_phage	42.9	1.2e-12
WP_005655097.1|1677959_1678466_-|tail	phage major tail tube protein	tail	Q19UP8	Mannheimia_phage	59.5	5.4e-53
WP_042593888.1|1678469_1679654_-|tail	tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	48.2	2.3e-102
WP_105182708.1|1679912_1680515_-	hypothetical protein	NA	Q94MX9	Haemophilus_virus	86.0	3.6e-88
WP_105182707.1|1680526_1683052_-|tail	phage tail protein	tail	Q94MY0	Haemophilus_virus	65.5	8.0e-246
WP_005689797.1|1683060_1683597_-|tail	phage tail protein I	tail	M1T2R2	Escherichia_phage	53.1	7.0e-51
WP_105182706.1|1683586_1684501_-|plate	baseplate assembly protein	plate	Q19UQ5	Mannheimia_phage	58.6	1.3e-92
WP_005689801.1|1684497_1684836_-	hypothetical protein	NA	Q19UQ6	Mannheimia_phage	56.6	4.5e-19
WP_005668437.1|1684837_1685437_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	66.0	7.1e-44
WP_005653088.1|1685540_1685969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011272674.1|1685977_1686535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006995348.1|1686632_1687085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042593957.1|1690182_1690443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075913143.1|1690420_1690594_-	hypothetical protein	NA	Q19UR2	Mannheimia_phage	53.3	3.2e-05
WP_011272678.1|1690669_1691008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011272679.1|1691018_1691201_-	hypothetical protein	NA	Q19UR2	Mannheimia_phage	47.8	8.8e-06
WP_005653079.1|1691304_1691652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011272680.1|1691652_1692114_-	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	48.2	5.7e-25
WP_038441089.1|1692113_1692584_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	45.3	7.3e-28
WP_038441087.1|1692549_1692813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105182705.1|1692809_1693079_-	molecular chaperone DnaK	NA	A0A0M3LS11	Mannheimia_phage	37.4	7.7e-06
WP_011272684.1|1693253_1693604_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_005668462.1|1693588_1694107_-	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	46.6	9.5e-37
WP_005668464.1|1694099_1694321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005668467.1|1694322_1694532_-|tail	tail protein	tail	NA	NA	NA	NA
WP_005668469.1|1694531_1695038_-|head	head completion/stabilization protein	head	A0A0M3LNL8	Mannheimia_phage	51.0	2.8e-33
WP_011272685.1|1695331_1695982_-|terminase	terminase	terminase	Q19US0	Mannheimia_phage	46.0	4.1e-45
WP_042593955.1|1695993_1697043_-|capsid	phage major capsid protein, P2 family	capsid	Q19UT3	Mannheimia_phage	51.3	1.7e-88
WP_011272686.1|1697063_1697879_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0M3LNM2	Mannheimia_phage	60.5	6.9e-66
WP_038441084.1|1698043_1699825_+|terminase	terminase	terminase	A0A0M3LRV4	Mannheimia_phage	65.4	5.0e-218
WP_011272688.1|1699834_1700845_+|portal	phage portal protein	portal	Q19UT6	Mannheimia_phage	60.4	1.8e-116
WP_154231901.1|1701326_1701482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080316015.1|1701553_1702237_-	acylneuraminate cytidylyltransferase	NA	NA	NA	NA	NA
WP_042593953.1|1702341_1703004_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_042593952.1|1703050_1704163_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_042593951.1|1704313_1706362_+|tRNA	methionine--tRNA ligase	tRNA	A0A2K9V939	Bandra_megavirus	29.3	2.2e-60
WP_005659606.1|1706474_1707335_+	SAM-dependent methyltransferase TehB	NA	NA	NA	NA	NA
WP_005659609.1|1707378_1708080_-	hydroxyacylglutathione hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	29.1	3.3e-08
WP_005687296.1|1708131_1708938_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048942349.1|1709257_1709650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005687300.1|1709786_1711550_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_005689853.1|1711715_1714358_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	32.3	2.1e-103
WP_005689855.1|1714412_1715489_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
1714379:1714402	attR	GCGGTGAAATTTCACCGCACTTTT	NA	NA	NA	NA
WP_005689857.1|1715646_1716327_+	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
WP_011272697.1|1716614_1717928_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_005694317.1|1717920_1718811_-	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_011272698.1|1719004_1720396_+|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	31.2	7.2e-23
WP_105182703.1|1720448_1723889_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_011272700.1|1723990_1724164_-	DUF5363 domain-containing protein	NA	NA	NA	NA	NA
WP_011961904.1|1724160_1726131_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
