The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026673	Bacillus licheniformis strain 14ADL4 chromosome, complete genome	4332232	6062	14006	4332232		Bacillus_phage(100.0%)	13	NA	NA
WP_017474734.1|6062_6449_+	hypothetical protein	NA	A0A0S2MVH4	Bacillus_phage	44.6	1.2e-12
WP_105179692.1|7266_7707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105179693.1|7875_8124_+	hypothetical protein	NA	A0A1P8CX63	Bacillus_phage	52.4	7.8e-13
WP_017474728.1|9129_9492_+	hypothetical protein	NA	A0A1P8CX43	Bacillus_phage	45.8	2.9e-16
WP_017474727.1|9481_9712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474726.1|9726_10029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034291485.1|11192_11396_-	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	83.3	6.8e-23
WP_009328257.1|11493_11838_+	hypothetical protein	NA	O64111	Bacillus_phage	60.4	1.4e-31
WP_105179694.1|12101_12275_+	hypothetical protein	NA	O64190	Bacillus_phage	87.7	7.8e-20
WP_009328255.1|12271_12712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328254.1|12753_13203_+	NADAR family protein	NA	A0A172JI41	Bacillus_phage	66.2	6.7e-47
WP_034291480.1|13180_13378_+	hypothetical protein	NA	O64193	Bacillus_phage	50.9	4.3e-06
WP_009328253.1|13403_14006_+	hypothetical protein	NA	A0A1P8CX67	Bacillus_phage	83.5	1.4e-84
>prophage 2
NZ_CP026673	Bacillus licheniformis strain 14ADL4 chromosome, complete genome	4332232	23924	39556	4332232	holin,tail	Bacillus_phage(100.0%)	10	NA	NA
WP_009328417.1|23924_25031_+	hypothetical protein	NA	D6R410	Bacillus_phage	28.5	2.5e-34
WP_034291560.1|25876_26176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328416.1|26194_26449_-|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	77.1	2.3e-28
WP_021837858.1|26467_26854_-	hypothetical protein	NA	A0A1P8CWP1	Bacillus_phage	72.7	3.1e-40
WP_073411136.1|26985_28074_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	62.7	3.1e-106
WP_061576007.1|28229_30134_-	hypothetical protein	NA	U5PWM6	Bacillus_phage	35.3	2.3e-51
WP_017474511.1|30149_30947_-	hypothetical protein	NA	O64043	Bacillus_phage	59.0	2.8e-72
WP_105179695.1|30962_33602_-	hypothetical protein	NA	A0A1P8CWQ0	Bacillus_phage	50.3	1.5e-239
WP_026579433.1|33605_34367_-	hypothetical protein	NA	A0A1P8CWP8	Bacillus_phage	57.7	1.5e-78
WP_095303707.1|34423_39556_-|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	58.6	0.0e+00
>prophage 3
NZ_CP026673	Bacillus licheniformis strain 14ADL4 chromosome, complete genome	4332232	49724	70783	4332232	integrase	Bacillus_phage(90.48%)	25	46926:46941	54616:54631
46926:46941	attL	TTTTTAAATAAACAGC	NA	NA	NA	NA
WP_016886024.1|49724_50726_-|integrase	site-specific integrase	integrase	A0A1P8CWP6	Bacillus_phage	86.2	7.4e-171
WP_080618473.1|50739_51159_-	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	57.0	1.3e-39
WP_016886026.1|51160_51646_-	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	32.1	8.1e-14
WP_043928778.1|51684_51876_-	XkdX family protein	NA	NA	NA	NA	NA
WP_016886028.1|51872_52199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080618474.1|52211_53840_-	DNA-packaging protein	NA	A0A1P8CWR7	Bacillus_phage	50.3	1.3e-34
WP_016886030.1|53842_54208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328382.1|54316_54709_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	46.8	2.1e-12
54616:54631	attR	TTTTTAAATAAACAGC	NA	NA	NA	NA
WP_009328381.1|54748_55582_-	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	42.5	4.2e-26
WP_009328380.1|55613_56324_-	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	38.6	9.0e-38
WP_009328379.1|56320_56851_-	hypothetical protein	NA	O64060	Bacillus_phage	63.6	6.9e-59
WP_009328378.1|56847_57507_-	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	65.7	3.7e-78
WP_009328377.1|57493_57724_-	hypothetical protein	NA	A0A1P8CWS7	Bacillus_phage	52.8	6.3e-09
WP_009328376.1|57720_58119_-	hypothetical protein	NA	A0A1P8CWR5	Bacillus_phage	62.1	2.2e-41
WP_009328375.1|58130_58601_-	hypothetical protein	NA	A0A1P8CWS5	Bacillus_phage	80.8	1.3e-69
WP_009328373.1|59691_60294_-	hypothetical protein	NA	A0A1P8CWS2	Bacillus_phage	83.0	7.6e-78
WP_105179696.1|60317_61757_-	hypothetical protein	NA	A0A1P8CWR1	Bacillus_phage	65.5	9.3e-175
WP_105179697.1|61791_63312_-	hypothetical protein	NA	O64068	Bacillus_phage	82.8	3.3e-247
WP_021837896.1|63329_65099_-	hypothetical protein	NA	O64069	Bacillus_phage	91.9	0.0e+00
WP_021837897.1|65082_66015_-	hypothetical protein	NA	A0A1P8CWS6	Bacillus_phage	76.4	1.8e-139
WP_009328368.1|66295_66925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474486.1|67284_68478_-	metallophosphoesterase	NA	A0A0N9SK37	Staphylococcus_phage	38.2	8.3e-68
WP_017474485.1|68490_68682_-	hypothetical protein	NA	A0A1P8CWT3	Bacillus_phage	87.3	3.4e-24
WP_009328365.1|69200_69716_-	hypothetical protein	NA	A0A0A0PL66	Bacillus_phage	49.7	1.8e-35
WP_017474483.1|70507_70783_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	73.3	1.9e-28
>prophage 4
NZ_CP026673	Bacillus licheniformis strain 14ADL4 chromosome, complete genome	4332232	101450	109191	4332232	integrase	Bacillus_phage(100.0%)	12	96259:96272	105160:105173
96259:96272	attL	CATAACAACATAAT	NA	NA	NA	NA
WP_105179716.1|101450_102827_+	hypothetical protein	NA	O64100	Bacillus_phage	42.4	1.6e-94
WP_105179717.1|102830_103832_+|integrase	site-specific integrase	integrase	O64101	Bacillus_phage	40.7	2.8e-61
WP_017474447.1|104199_104454_+	YopT family protein	NA	NA	NA	NA	NA
WP_017474446.1|104466_104661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474444.1|104964_105126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474443.1|105268_106423_+	AAA family ATPase	NA	A0A223LDI7	Bacillus_phage	39.6	8.0e-68
105160:105173	attR	ATTATGTTGTTATG	NA	NA	NA	NA
WP_073411081.1|106713_107382_+	DUF1273 family protein	NA	A0A1P8CWY2	Bacillus_phage	73.5	3.8e-94
WP_073411309.1|107401_107584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075223458.1|108114_108312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075223457.1|108358_108703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075223456.1|108729_108903_+	DNA strand exchange inhibitor protein	NA	A0A1B1P7C0	Bacillus_phage	71.9	2.9e-14
WP_075223455.1|108999_109191_+	hypothetical protein	NA	A0A142F1P8	Bacillus_phage	67.7	4.7e-18
>prophage 5
NZ_CP026673	Bacillus licheniformis strain 14ADL4 chromosome, complete genome	4332232	115877	123154	4332232		Bacillus_phage(100.0%)	7	NA	NA
WP_073411037.1|115877_116210_+	hypothetical protein	NA	A0A1P8CX10	Bacillus_phage	48.6	1.3e-15
WP_073411035.1|116293_117208_+	hypothetical protein	NA	A0A1P8CX09	Bacillus_phage	66.7	8.7e-110
WP_073411032.1|117261_118233_+	AAA family ATPase	NA	A0A1P8CX29	Bacillus_phage	85.0	2.9e-156
WP_073411029.1|118279_118750_+	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	69.9	3.4e-57
WP_073411027.1|118764_120279_+	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	81.3	3.7e-238
WP_105179719.1|120295_121429_+	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	69.4	1.4e-157
WP_075223449.1|121432_123154_+	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	64.2	2.9e-215
>prophage 6
NZ_CP026673	Bacillus licheniformis strain 14ADL4 chromosome, complete genome	4332232	128121	151699	4332232		Bacillus_phage(96.0%)	34	NA	NA
WP_105179720.1|128121_128838_+	3D domain-containing protein	NA	O64147	Bacillus_phage	43.9	1.0e-41
WP_009328285.1|128842_129058_+	YorP family protein	NA	NA	NA	NA	NA
WP_021837961.1|129381_129969_+	hypothetical protein	NA	A7KV03	Bacillus_phage	38.1	6.3e-29
WP_021837962.1|129989_130334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328280.1|131340_131811_+	hypothetical protein	NA	O64162	Bacillus_phage	91.7	1.4e-79
WP_095233959.1|131962_132352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474747.1|133255_133447_+	hypothetical protein	NA	S6BUY9	Bacillus_phage	51.6	7.3e-11
WP_105179790.1|133461_133674_+	DUF1653 domain-containing protein	NA	A0A1P8CX21	Bacillus_phage	80.0	1.1e-28
WP_095266724.1|133687_133822_+	hypothetical protein	NA	O64168	Bacillus_phage	79.5	1.6e-12
WP_105179721.1|134251_134512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474744.1|134564_134912_+	hypothetical protein	NA	O64171	Bacillus_phage	41.7	6.8e-15
WP_021837968.1|134911_135313_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	S6ANL8	Bacillus_phage	64.0	2.3e-38
WP_105179722.1|135269_135998_+	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A217ER63	Bacillus_phage	88.7	3.4e-117
WP_071583983.1|136241_138779_+	hypothetical protein	NA	A0A1P8CX40	Bacillus_phage	83.6	0.0e+00
WP_017474737.1|139430_140402_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4JMU8	Bacillus_phage	79.7	1.3e-143
WP_017474736.1|140391_141111_+	hypothetical protein	NA	A0A2I6UHL5	Bacillus_phage	60.3	1.1e-80
WP_026080849.1|141151_141403_+	NrdH-redoxin	NA	A0A1P8CX24	Bacillus_phage	69.7	9.0e-25
WP_017474734.1|141440_141827_+	hypothetical protein	NA	A0A0S2MVH4	Bacillus_phage	44.6	1.2e-12
WP_105179692.1|142643_143084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017474730.1|143214_143502_+	hypothetical protein	NA	A0A1P8CX63	Bacillus_phage	50.5	1.3e-14
WP_105179723.1|143503_144355_+	thymidylate synthase	NA	U5J9N5	Bacillus_phage	40.3	1.7e-51
WP_017474728.1|144508_144871_+	hypothetical protein	NA	A0A1P8CX43	Bacillus_phage	45.8	2.9e-16
WP_017474727.1|144860_145091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474726.1|145105_145408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034291485.1|146572_146776_-	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	83.3	6.8e-23
WP_009328257.1|146873_147218_+	hypothetical protein	NA	O64111	Bacillus_phage	60.4	1.4e-31
WP_105179694.1|147481_147655_+	hypothetical protein	NA	O64190	Bacillus_phage	87.7	7.8e-20
WP_009328255.1|147651_148092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328254.1|148133_148583_+	NADAR family protein	NA	A0A172JI41	Bacillus_phage	66.2	6.7e-47
WP_034291480.1|148560_148758_+	hypothetical protein	NA	O64193	Bacillus_phage	50.9	4.3e-06
WP_009328253.1|148783_149386_+	hypothetical protein	NA	A0A1P8CX67	Bacillus_phage	83.5	1.4e-84
WP_155761904.1|149382_149529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328252.1|149610_151302_+	recombinase family protein	NA	A0A0S2SXR4	Bacillus_phage	24.0	4.0e-15
WP_085537928.1|151291_151699_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	44.1	1.3e-17
>prophage 7
NZ_CP026673	Bacillus licheniformis strain 14ADL4 chromosome, complete genome	4332232	607545	619725	4332232		Staphylococcus_phage(55.56%)	15	NA	NA
WP_003183104.1|607545_608139_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	37.6	3.4e-14
WP_009327962.1|608128_608884_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.6	1.4e-07
WP_003183108.1|609066_609162_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003183111.1|609282_609804_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003183113.1|609814_610189_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003183115.1|610290_610755_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	70.7	1.7e-45
WP_003183117.1|610789_611986_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	53.9	2.1e-116
WP_003183118.1|612007_612655_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.5	7.4e-39
WP_011198083.1|612666_613755_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	38.1	5.1e-64
WP_003183123.1|614115_614460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003183125.1|614722_616909_-	AAA family ATPase	NA	A0A220BYT7	Staphylococcus_phage	41.3	1.4e-150
WP_003183127.1|617035_617473_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_003183128.1|617631_617937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009327959.1|617926_619057_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	43.3	1.4e-77
WP_003183133.1|619287_619725_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	44.6	5.4e-17
>prophage 8
NZ_CP026673	Bacillus licheniformis strain 14ADL4 chromosome, complete genome	4332232	1007059	1074123	4332232	integrase,coat,tRNA,protease,terminase	Bacillus_phage(35.71%)	65	1045202:1045219	1080802:1080819
WP_003184005.1|1007059_1008112_-|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_016885542.1|1008227_1009337_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_009327769.1|1009358_1010198_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_003184010.1|1010178_1011753_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_025808019.1|1011853_1013032_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A141ZJV0	Faustovirus	28.0	1.6e-31
WP_003184015.1|1013000_1013543_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_003184017.1|1013586_1014456_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_003184018.1|1014464_1014908_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_003184021.1|1015021_1016308_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_003184022.1|1016340_1016919_-	sporulation protein	NA	NA	NA	NA	NA
WP_003184023.1|1017144_1017426_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003184025.1|1017438_1017780_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003184027.1|1017792_1018101_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_003184028.1|1018257_1019124_-	stage IV sporulation protein FB	NA	NA	NA	NA	NA
WP_044789852.1|1019116_1019908_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_003184032.1|1020053_1020482_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_003184034.1|1020481_1020802_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003184035.1|1020846_1021653_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_011198163.1|1021655_1022336_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_003184039.1|1022390_1022909_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003184040.1|1022905_1023814_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003184042.1|1023844_1024855_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_003184045.1|1024942_1025617_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_003184048.1|1025671_1026244_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_003184050.1|1026397_1027429_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_003184052.1|1027632_1028382_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_003184054.1|1028524_1029829_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_003184055.1|1029904_1032547_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.3	2.8e-161
WP_003184058.1|1033008_1033200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003184059.1|1033219_1034242_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_063906779.1|1034269_1035727_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003184061.1|1035875_1037171_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_003184063.1|1037196_1038171_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_003184065.1|1038174_1038966_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_003184068.1|1038955_1039897_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003184070.1|1039936_1040767_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_017474375.1|1040772_1042134_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_003184074.1|1042322_1042808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003184076.1|1042855_1043443_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016885551.1|1043439_1045764_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	45.2	1.0e-186
1045202:1045219	attL	TTGACATCGATCGTTTCC	NA	NA	NA	NA
WP_003184080.1|1045982_1047638_-|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	35.7	1.4e-17
WP_003184083.1|1047820_1049086_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.5	7.2e-147
WP_003184085.1|1049354_1050629_-	trigger factor	NA	NA	NA	NA	NA
WP_017474376.1|1050855_1051863_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003184088.1|1051992_1052592_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_017474377.1|1052604_1054023_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_003184091.1|1054056_1055169_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_003184093.1|1055196_1056753_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.6	2.5e-08
WP_003184095.1|1056739_1057768_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_003184097.1|1057791_1058310_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003184100.1|1058306_1060031_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.2	1.5e-62
WP_003184102.1|1060453_1061368_-	branched-chain-amino-acid transaminase	NA	NA	NA	NA	NA
WP_003184104.1|1061824_1062052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003184106.1|1062094_1063477_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_009329319.1|1063889_1064144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003184110.1|1064187_1064679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017474379.1|1064692_1064893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025808006.1|1065114_1065330_-	hypothetical protein	NA	A0A1B1P7C8	Bacillus_phage	53.0	4.1e-10
WP_025808005.1|1066625_1067486_-|terminase	terminase	terminase	D2IYW0	Enterococcus_phage	39.3	3.8e-30
WP_003184119.1|1067532_1067781_-	hypothetical protein	NA	A8ATN7	Listeria_phage	39.7	3.2e-06
WP_003184124.1|1068945_1069302_-	hypothetical protein	NA	A0A1B1P7B5	Bacillus_phage	52.0	1.8e-23
WP_003184126.1|1069777_1070239_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_003184127.1|1070346_1070802_-	SMI1/KNR4 family protein	NA	A0A1P8CWJ1	Bacillus_phage	60.7	1.4e-44
WP_025808003.1|1070818_1072738_-|integrase	integrase	integrase	A0A1P8CWI7	Bacillus_phage	23.6	2.0e-15
WP_003184134.1|1072932_1074123_+	tetratricopeptide repeat protein	NA	D6R410	Bacillus_phage	29.0	1.6e-39
1080802:1080819	attR	TTGACATCGATCGTTTCC	NA	NA	NA	NA
>prophage 9
NZ_CP026673	Bacillus licheniformis strain 14ADL4 chromosome, complete genome	4332232	1388981	1427122	4332232	portal,plate,head,holin,integrase,coat,capsid,protease,terminase,tail	Bacillus_phage(86.05%)	50	1398820:1398834	1430126:1430140
WP_075213430.1|1388981_1389302_+	YolD-like family protein	NA	O64030	Bacillus_phage	35.0	3.2e-11
WP_011198296.1|1389325_1389556_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_105179730.1|1390106_1391216_+	DUF4917 family protein	NA	NA	NA	NA	NA
WP_157769126.1|1391316_1391463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105179731.1|1391470_1392550_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	52.7	2.3e-45
WP_105179732.1|1392601_1392865_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	77.0	3.0e-31
WP_043054567.1|1392880_1393150_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	60.7	6.2e-24
WP_105179733.1|1393212_1393395_-	XkdX family protein	NA	A0EWM9	Staphylococcus_virus	47.9	5.2e-06
WP_105179734.1|1393391_1393706_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	45.2	1.8e-14
WP_105179735.1|1393717_1395061_-|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	44.1	8.2e-48
WP_105179736.1|1395081_1397037_-	hypothetical protein	NA	Q9ZXE2	Bacillus_phage	43.3	1.6e-23
WP_105179737.1|1397072_1398782_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	69.8	1.9e-219
WP_017475032.1|1398793_1399630_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	72.2	1.4e-114
1398820:1398834	attL	ATATGATTTCAAAAT	NA	NA	NA	NA
WP_105179738.1|1399629_1403520_-|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	60.3	0.0e+00
WP_105179739.1|1403717_1404053_-	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	58.9	2.9e-31
WP_105179740.1|1404112_1404721_-|tail	phage tail protein	tail	Q9ZXE9	Bacillus_phage	55.1	1.3e-56
WP_105179741.1|1404720_1405101_-	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	55.6	2.0e-31
WP_105179742.1|1405097_1405481_-	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	72.4	3.7e-46
WP_105179743.1|1405473_1405848_-|head	phage head closure protein	head	Q9ZXF2	Bacillus_phage	62.3	2.6e-36
WP_105179744.1|1405777_1406128_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	61.7	4.3e-33
WP_105179745.1|1406143_1406593_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	53.8	1.8e-15
WP_026587168.1|1406618_1406912_-	hypothetical protein	NA	Q9ZXF5	Bacillus_phage	70.1	5.0e-27
WP_105179746.1|1406928_1408134_-|capsid	phage major capsid protein	capsid	Q9ZXF6	Bacillus_phage	66.6	1.4e-144
WP_059231694.1|1408173_1408803_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	81.8	1.3e-93
WP_059231696.1|1408792_1410040_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	85.1	7.5e-213
WP_059231697.1|1410227_1411937_-|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	87.0	3.8e-300
WP_009330377.1|1411936_1412470_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	80.2	2.8e-68
WP_105179747.1|1412556_1412883_-	transglycosylase	NA	Q9T203	Bacillus_phage	56.5	4.9e-31
WP_105179748.1|1412851_1413226_-	HNH endonuclease	NA	Q38456	Bacillus_phage	82.3	3.1e-61
WP_061578527.1|1413395_1413623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006637235.1|1413843_1414068_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_105179749.1|1414818_1415199_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	82.1	1.5e-47
WP_020450344.1|1415346_1416156_-	DNA adenine methylase	NA	U5P0W8	Brevibacillus_phage	57.2	2.3e-85
WP_041817160.1|1416137_1417073_-	DNA (cytosine-5-)-methyltransferase	NA	A8YQM6	Lactobacillus_phage	47.2	4.2e-67
WP_059231709.1|1417095_1417620_-	hypothetical protein	NA	D6R425	Bacillus_phage	82.2	1.4e-80
WP_003185375.1|1417622_1417793_-	Fur-regulated basic protein FbpA	NA	A0A0S2SXY0	Bacillus_phage	54.7	8.8e-08
WP_035338258.1|1417789_1418329_-	nuclease	NA	Q9ZXC2	Bacillus_phage	90.5	1.7e-89
WP_105179750.1|1418325_1418763_-	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	75.2	1.2e-61
WP_105179751.1|1419003_1421430_-	DNA primase	NA	D6R422	Bacillus_phage	84.5	0.0e+00
WP_061578359.1|1421490_1421931_-	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	91.8	3.1e-73
WP_065643444.1|1421930_1422863_-	AAA family ATPase	NA	Q9ZXC7	Bacillus_phage	89.8	4.5e-154
WP_065643445.1|1422866_1423424_-	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	72.4	3.1e-70
WP_065643446.1|1423489_1423759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105179752.1|1423852_1424119_-	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	50.0	4.7e-16
WP_105179753.1|1424136_1424322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105179754.1|1424332_1424602_-	group-specific protein	NA	S5MC08	Brevibacillus_phage	48.3	1.1e-20
WP_026080864.1|1424607_1424793_-	helix-turn-helix transcriptional regulator	NA	A0A0M3ULF9	Bacillus_phage	70.5	5.2e-14
WP_105179755.1|1425069_1425498_+	helix-turn-helix transcriptional regulator	NA	Q5YAA4	Bacillus_phage	61.7	1.8e-41
WP_017474834.1|1425506_1425929_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	62.3	9.1e-46
WP_105179756.1|1425973_1427122_+|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	34.6	3.4e-50
1430126:1430140	attR	ATATGATTTCAAAAT	NA	NA	NA	NA
>prophage 10
NZ_CP026673	Bacillus licheniformis strain 14ADL4 chromosome, complete genome	4332232	1660646	1726587	4332232	portal,plate,holin,head,integrase,tRNA,coat,capsid,protease,terminase,tail	Bacillus_phage(58.54%)	85	1673187:1673206	1716773:1716792
WP_003185269.1|1660646_1661396_+|tRNA	tRNA-dependent cyclodipeptide synthase	tRNA	NA	NA	NA	NA
WP_003185271.1|1661392_1662613_+	cytochrome P450, cyclodipeptide synthase-associated	NA	NA	NA	NA	NA
WP_003185273.1|1662609_1663065_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_003185275.1|1663081_1663555_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021837694.1|1663677_1664856_-	amidase	NA	NA	NA	NA	NA
WP_017474573.1|1665045_1666095_+	oxidoreductase	NA	NA	NA	NA	NA
WP_003185281.1|1666126_1666762_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_003185283.1|1667062_1668031_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_003185286.1|1668226_1668436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003185288.1|1668419_1669001_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003185290.1|1669157_1669307_+	YvrJ family protein	NA	NA	NA	NA	NA
WP_003185292.1|1669400_1670555_+	oxalate decarboxylase family bicupin	NA	NA	NA	NA	NA
WP_003185294.1|1670627_1671026_+	peptidase	NA	NA	NA	NA	NA
WP_003185296.1|1671122_1671608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011198290.1|1671723_1672266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003185302.1|1672389_1672674_+	hypothetical protein	NA	NA	NA	NA	NA
1673187:1673206	attL	TGGAGACGGTGGGAGTCGAA	NA	NA	NA	NA
WP_017474571.1|1673496_1674309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025807648.1|1674532_1675030_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_025807650.1|1675033_1675681_-	SocA family protein	NA	A0A0N9SGM1	Paenibacillus_phage	42.9	3.8e-19
WP_025807652.1|1675930_1676161_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_025807654.1|1676751_1678368_+	ribonuclease YeeF family protein	NA	NA	NA	NA	NA
WP_006637262.1|1678380_1678797_+	hypothetical protein	NA	A0A2H4J4V0	uncultured_Caudovirales_phage	44.1	3.6e-26
WP_025807656.1|1678827_1679772_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A141HSE6	Bacillus_phage	44.0	2.8e-63
WP_061578561.1|1679819_1680083_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	73.6	2.2e-29
WP_061578562.1|1680098_1680368_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	59.6	3.8e-21
WP_017474870.1|1680430_1680616_-	XkdX family protein	NA	NA	NA	NA	NA
WP_025808190.1|1680612_1680927_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	44.1	3.4e-13
WP_095266825.1|1680938_1682303_-|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	50.0	4.3e-52
WP_095266827.1|1682323_1684279_-	hypothetical protein	NA	U5PWM6	Bacillus_phage	31.8	1.0e-43
WP_017474878.1|1684314_1686027_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	66.4	7.9e-221
WP_017474879.1|1686039_1686876_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	69.7	3.2e-111
WP_017474880.1|1686875_1691345_-|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	42.4	1.2e-71
WP_003185339.1|1691553_1691916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003185341.1|1691969_1692587_-|tail	tail protein	tail	NA	NA	NA	NA
WP_003185344.1|1692601_1692985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006637249.1|1692981_1693380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003185349.1|1693379_1693688_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_003185351.1|1693677_1693980_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	46.3	1.2e-12
WP_003185353.1|1694000_1694426_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	57.8	9.3e-14
WP_025807602.1|1694449_1695733_-|capsid	phage major capsid protein	capsid	A0A288WG01	Bacillus_phage	44.5	1.3e-79
WP_035317290.1|1695771_1696503_-|protease	Clp protease ClpP	protease	A0A2I7SCY8	Paenibacillus_phage	53.7	5.2e-57
WP_025807606.1|1696447_1697758_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	46.7	3.8e-106
WP_025807608.1|1697758_1697950_-	DUF1056 family protein	NA	NA	NA	NA	NA
WP_105179760.1|1697961_1699671_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	61.7	4.6e-205
WP_025807612.1|1699667_1700183_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	45.8	1.7e-33
WP_021837717.1|1700412_1700787_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	51.7	2.4e-29
WP_095266831.1|1700813_1701122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095266833.1|1701295_1701637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095266835.1|1701721_1702345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003185368.1|1702589_1702814_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_009329244.1|1703564_1703945_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	82.9	8.8e-48
WP_025807623.1|1704057_1704435_-	hypothetical protein	NA	R4JMS5	Bacillus_phage	57.9	4.3e-31
WP_073358632.1|1704450_1704966_-	hypothetical protein	NA	D6R425	Bacillus_phage	81.9	8.2e-81
WP_071583658.1|1704968_1705139_-	Fur-regulated basic protein FbpA	NA	A0A0S2SXY0	Bacillus_phage	56.6	3.0e-08
WP_025807627.1|1705135_1705675_-	nuclease	NA	Q9ZXC2	Bacillus_phage	90.5	1.3e-89
WP_025807629.1|1705671_1706109_-	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	75.2	3.6e-61
WP_025807631.1|1706086_1706350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095266837.1|1706625_1709058_-	DNA primase	NA	D6R422	Bacillus_phage	80.2	0.0e+00
WP_095266839.1|1709118_1709556_-	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	89.7	4.1e-73
WP_011198320.1|1709555_1710488_-	AAA family ATPase	NA	Q9ZXC7	Bacillus_phage	88.1	1.9e-152
WP_021837730.1|1710491_1711049_-	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	72.4	2.8e-71
WP_011198322.1|1711141_1711384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021837731.1|1711471_1711738_-	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	54.7	6.0e-19
WP_021837732.1|1711800_1712130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021837733.1|1712126_1712285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003185401.1|1712410_1712965_-	hypothetical protein	NA	A0A288WGQ2	Bacillus_phage	42.7	1.3e-31
WP_016886536.1|1713022_1713211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003185403.1|1713342_1713531_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_035317292.1|1713527_1714322_-	ORF6N domain-containing protein	NA	D7RWL7	Brochothrix_phage	61.4	9.0e-79
WP_134778800.1|1714324_1714462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025807640.1|1714430_1714664_-	helix-turn-helix transcriptional regulator	NA	A0A2I7SCT7	Paenibacillus_phage	58.1	1.9e-16
WP_025807642.1|1714829_1715525_+	XRE family transcriptional regulator	NA	A0A2I7SCV6	Paenibacillus_phage	53.8	5.3e-67
WP_025807644.1|1715595_1716690_+|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	53.9	4.9e-99
WP_009329604.1|1717241_1717715_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	61.1	1.0e-45
1716773:1716792	attR	TGGAGACGGTGGGAGTCGAA	NA	NA	NA	NA
WP_003185414.1|1717826_1720130_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	41.7	6.9e-95
WP_003185416.1|1720143_1720890_-	carboxylesterase	NA	NA	NA	NA	NA
WP_003185418.1|1721030_1721261_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_003185421.1|1721431_1721716_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	52.7	5.8e-12
WP_085959538.1|1721744_1721978_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_009329609.1|1722130_1722532_+	transcriptional regulator	NA	S6C481	Thermus_phage	45.3	4.2e-16
WP_011201739.1|1722695_1723100_+	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	49.5	2.1e-15
WP_003185432.1|1723147_1723825_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_009329611.1|1723841_1724759_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_009329612.1|1724772_1725426_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003185439.1|1725447_1726587_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y1V5	Organic_Lake_phycodnavirus	30.6	8.6e-14
>prophage 11
NZ_CP026673	Bacillus licheniformis strain 14ADL4 chromosome, complete genome	4332232	3145972	3155896	4332232		Synechococcus_phage(50.0%)	9	NA	NA
WP_003179530.1|3145972_3147268_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.1	5.9e-19
WP_003179531.1|3147342_3148059_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	42.4	2.4e-46
WP_003179532.1|3148060_3148315_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	8.0e-05
WP_003179533.1|3148311_3148995_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003179534.1|3148978_3151207_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.5	4.2e-158
WP_003179536.1|3151182_3152613_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	4.5e-52
WP_011197613.1|3152736_3153777_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	46.3	2.7e-62
WP_003179538.1|3153773_3154361_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.1	1.4e-28
WP_003179539.1|3154357_3155896_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.0	4.3e-77
>prophage 12
NZ_CP026673	Bacillus licheniformis strain 14ADL4 chromosome, complete genome	4332232	3727659	3798684	4332232	portal,plate,holin,coat,terminase,tail	Bacillus_phage(27.78%)	85	NA	NA
WP_009328811.1|3727659_3728109_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_011197778.1|3728259_3728748_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_009328809.1|3728879_3729392_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_009328808.1|3729462_3729861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328807.1|3729909_3730296_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_011197779.1|3730442_3730799_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_009328806.1|3731085_3731295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197781.1|3731374_3731506_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_009328805.1|3731635_3731893_+	sporulation protein	NA	NA	NA	NA	NA
WP_073426297.1|3731931_3734214_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	35.6	7.8e-91
WP_009328802.1|3734335_3734593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328801.1|3734632_3735220_-	DedA family protein	NA	NA	NA	NA	NA
WP_011197784.1|3735319_3736306_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	1.6e-53
WP_009328799.1|3736302_3737193_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	55.6	1.2e-84
WP_009328798.1|3737215_3737611_-	GtrA family protein	NA	NA	NA	NA	NA
WP_009328797.1|3737775_3738195_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_009328796.1|3738204_3738714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021837284.1|3738778_3739501_-	esterase family protein	NA	NA	NA	NA	NA
WP_011197786.1|3739491_3739824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025808330.1|3740017_3740506_-	damage-inducible protein DinB	NA	NA	NA	NA	NA
WP_009328787.1|3740586_3741534_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_009328785.1|3741842_3742967_+	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	25.6	5.3e-16
WP_009328782.1|3742956_3744132_+	cystathionine beta-lyase	NA	A0A0B5JD48	Pandoravirus	29.3	6.7e-22
WP_011197789.1|3744177_3745368_-	DUF819 domain-containing protein	NA	NA	NA	NA	NA
WP_009328776.1|3745540_3746110_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009328774.1|3746099_3746384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155266214.1|3747981_3748143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025808333.1|3748224_3749211_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_016885898.1|3749813_3749897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180752.1|3750335_3750515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180754.1|3750548_3751127_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_016885896.1|3751218_3751506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180759.1|3751713_3752604_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095266775.1|3752924_3754754_+	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_003180762.1|3754781_3756500_+	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_003180765.1|3756557_3757445_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095266777.1|3757536_3758409_+	DMT family transporter	NA	NA	NA	NA	NA
WP_003180768.1|3758456_3758834_+	glyoxalase	NA	NA	NA	NA	NA
WP_003180770.1|3758877_3759426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180772.1|3759878_3760613_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A217ER34	Bacillus_phage	60.8	4.2e-30
WP_011197798.1|3760668_3762093_-	DHA2 family efflux MFS transporter permease subunit	NA	A0A0M3UL24	Mycobacterium_phage	24.6	5.1e-16
WP_003180775.1|3762108_3762687_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003180778.1|3762699_3763035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095266779.1|3763063_3763477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180781.1|3763851_3764334_-	DUF600 family protein	NA	NA	NA	NA	NA
WP_003180784.1|3766605_3767253_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	47.5	4.1e-45
WP_003180785.1|3767266_3767923_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	49.7	4.0e-40
WP_003180787.1|3768111_3768465_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	49.6	2.7e-19
WP_003180788.1|3768637_3768898_+	helix-turn-helix transcriptional regulator	NA	S5MA07	Brevibacillus_phage	41.2	7.9e-08
WP_035317445.1|3768887_3769184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180792.1|3769184_3770015_+	hypothetical protein	NA	S6BFM4	Thermus_phage	31.0	1.3e-27
WP_035317447.1|3769914_3770715_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	48.1	6.1e-59
WP_003180798.1|3770985_3771327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180800.1|3771323_3771527_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	54.7	1.9e-12
WP_003180803.1|3771647_3772151_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	38.7	1.4e-21
WP_003180804.1|3772293_3773094_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	51.4	5.7e-65
WP_009328741.1|3773090_3774389_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	60.2	7.2e-150
WP_003180808.1|3774392_3775907_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.5	3.4e-143
WP_009328740.1|3775914_3776763_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	62.8	2.1e-57
WP_009328739.1|3776780_3777716_+|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	64.1	1.1e-102
WP_011201613.1|3777803_3778184_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_009328738.1|3778180_3778537_+	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_003180822.1|3778533_3779022_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	44.6	1.9e-34
WP_017474400.1|3779034_3779475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180826.1|3779475_3779700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197804.1|3779699_3781046_+|portal	phage portal protein	portal	S5MNC1	Brevibacillus_phage	40.2	1.5e-78
WP_003180830.1|3781047_3781491_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	44.7	2.1e-24
WP_003180832.1|3781673_3782123_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	38.7	4.1e-12
WP_003180833.1|3782164_3782302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061876347.1|3782305_3786088_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	45.3	1.7e-42
WP_003180838.1|3786080_3786737_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	32.6	4.0e-24
WP_003180841.1|3786793_3787774_+	hypothetical protein	NA	H7BV96	unidentified_phage	32.3	9.2e-41
WP_003180843.1|3787770_3788079_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	37.3	1.0e-06
WP_095266786.1|3788097_3788526_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	38.7	9.3e-14
WP_009328732.1|3788518_3789562_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	9.7e-73
WP_003180850.1|3790482_3790869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180851.1|3790884_3792090_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	48.3	9.3e-27
WP_003180853.1|3792127_3793159_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	48.2	1.0e-18
WP_003180856.1|3793261_3793531_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.0	1.6e-24
WP_003180859.1|3793545_3793809_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	67.8	5.3e-28
WP_003180861.1|3793859_3794924_+	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	50.8	1.1e-44
WP_003180863.1|3795025_3795703_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003180865.1|3795725_3796742_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003180867.1|3796762_3797860_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_003180869.1|3797835_3798684_+	SDR family oxidoreductase	NA	M1NMS3	Moumouvirus	33.3	5.6e-10
>prophage 13
NZ_CP026673	Bacillus licheniformis strain 14ADL4 chromosome, complete genome	4332232	4321931	4331609	4332232	holin	Bacillus_phage(100.0%)	8	NA	NA
WP_009328417.1|4321931_4323038_+	hypothetical protein	NA	D6R410	Bacillus_phage	28.5	2.5e-34
WP_034291560.1|4323883_4324183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328416.1|4324201_4324456_-|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	77.1	2.3e-28
WP_021837858.1|4324474_4324861_-	hypothetical protein	NA	A0A1P8CWP1	Bacillus_phage	72.7	3.1e-40
WP_073411136.1|4324992_4326081_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	62.7	3.1e-106
WP_061576007.1|4326236_4328141_-	hypothetical protein	NA	U5PWM6	Bacillus_phage	35.3	2.3e-51
WP_017474511.1|4328156_4328954_-	hypothetical protein	NA	O64043	Bacillus_phage	59.0	2.8e-72
WP_105179695.1|4328969_4331609_-	hypothetical protein	NA	A0A1P8CWQ0	Bacillus_phage	50.3	1.5e-239
