The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027165	Pseudomonas aeruginosa strain AR_0360 chromosome, complete genome	6463575	233911	242940	6463575		Bacillus_phage(33.33%)	8	NA	NA
WP_078451413.1|233911_234547_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.3e-40
WP_031639387.1|234592_235486_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003113871.1|235590_236595_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003092272.1|237021_237345_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_003113873.1|237411_239979_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	3.2e-24
WP_003163274.1|240104_241112_-	TolB family protein	NA	NA	NA	NA	NA
WP_003092262.1|241259_241766_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
WP_003092260.1|241899_242940_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
>prophage 2
NZ_CP027165	Pseudomonas aeruginosa strain AR_0360 chromosome, complete genome	6463575	1332233	1339127	6463575	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_003097631.1|1332233_1333514_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
WP_003162145.1|1333515_1334913_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003097628.1|1334917_1335892_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003097625.1|1335979_1336963_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.0	3.5e-141
WP_003119979.1|1336959_1337295_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	1.5e-38
WP_003090391.1|1337291_1337597_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090389.1|1337596_1337956_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_003090387.1|1337952_1338348_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	72.1	2.7e-47
WP_003090386.1|1338458_1339127_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
>prophage 3
NZ_CP027165	Pseudomonas aeruginosa strain AR_0360 chromosome, complete genome	6463575	3577140	3584821	6463575	coat,integrase	Pseudomonas_phage(100.0%)	12	3576086:3576119	3588613:3588646
3576086:3576119	attL	AGGGTTCGATTCCCTTCGCCCGCTCCAGATCCCA	NA	NA	NA	NA
WP_105412576.1|3577140_3578145_-|integrase	tyrosine-type recombinase/integrase	integrase	Q56VN7	Pseudomonas_phage	52.1	1.8e-92
WP_023088869.1|3578144_3579437_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	93.8	2.4e-246
WP_105412577.1|3579666_3580941_-	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	88.0	7.4e-200
WP_003114150.1|3580944_3581301_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	100.0	7.9e-59
WP_105412578.1|3581305_3582583_-	attachment protein	NA	Q56VP1	Pseudomonas_phage	87.6	8.1e-45
WP_003125072.1|3582730_3582979_-|coat	phage coat protein B	coat	Q56VP2	Pseudomonas_phage	92.7	2.0e-32
WP_003115979.1|3582991_3583243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003115130.1|3583255_3583348_-	hypothetical protein	NA	Q56VP4	Pseudomonas_phage	100.0	7.3e-09
WP_009875803.1|3583364_3583799_-	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	97.2	1.0e-60
WP_105412579.1|3583933_3584311_-	hypothetical protein	NA	Q56VP6	Pseudomonas_phage	96.8	1.7e-59
WP_023119949.1|3584314_3584605_-	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	97.9	4.3e-55
WP_003112698.1|3584608_3584821_-	hypothetical protein	NA	Q56VP8	Pseudomonas_phage	95.7	7.6e-33
3588613:3588646	attR	AGGGTTCGATTCCCTTCGCCCGCTCCAGATCCCA	NA	NA	NA	NA
>prophage 4
NZ_CP027165	Pseudomonas aeruginosa strain AR_0360 chromosome, complete genome	6463575	4174410	4209256	6463575	coat,tRNA,integrase	Pseudomonas_phage(61.54%)	38	4201376:4201435	4213317:4213398
WP_003117437.1|4174410_4174959_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_003123421.1|4174989_4175523_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_004352708.1|4175522_4176065_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_033942332.1|4176083_4176872_+	molecular chaperone	NA	NA	NA	NA	NA
WP_033942329.1|4176888_4179261_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_003099330.1|4179257_4180205_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_003099328.1|4180206_4181580_-	MFS transporter	NA	NA	NA	NA	NA
WP_003099324.1|4181859_4182882_-	ferrochelatase	NA	NA	NA	NA	NA
WP_003114699.1|4182878_4183796_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_003099318.1|4184209_4185193_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003099314.1|4185345_4186302_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_003094990.1|4186311_4187211_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	39.1	8.5e-17
WP_003121048.1|4187207_4188653_+	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	27.8	1.8e-45
WP_003099307.1|4188778_4189300_-	acyloxyacyl hydrolase	NA	A0A2H4J0I5	uncultured_Caudovirales_phage	69.8	1.4e-59
WP_003099300.1|4189433_4190231_-	glutamate racemase	NA	NA	NA	NA	NA
WP_003099296.1|4190220_4190979_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_003099293.1|4190972_4191803_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_003099290.1|4191804_4192887_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	48.3	5.6e-07
WP_003095001.1|4192904_4194173_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_004352693.1|4194316_4196089_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003095005.1|4196093_4196711_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_003099284.1|4196712_4197561_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003099281.1|4197727_4198669_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	4.1e-46
WP_003099279.1|4198785_4199400_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_033942324.1|4199441_4200026_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_033942321.1|4200066_4201167_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
4201376:4201435	attL	ATTCATAATGCTGATGTCCCAGGTTCAAGTCCCGGTGTAGCCACCATATTTTTCAAGGGG	NA	NA	NA	NA
WP_124014480.1|4201560_4201971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105412589.1|4201951_4202953_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	46.8	7.6e-75
WP_004352686.1|4202949_4204242_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	92.3	1.8e-241
WP_023088521.1|4204500_4205763_-	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	56.0	3.5e-117
WP_003159569.1|4205764_4206115_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	41.1	5.5e-20
WP_164688961.1|4206124_4207261_-|coat	coat protein A	coat	NA	NA	NA	NA
WP_003124953.1|4207388_4207607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003124954.1|4207620_4207872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003115130.1|4207883_4207976_-	hypothetical protein	NA	Q56VP4	Pseudomonas_phage	100.0	7.3e-09
WP_031635504.1|4207992_4208427_-	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	97.9	7.9e-61
WP_060962098.1|4208629_4208962_-	hypothetical protein	NA	Q56VP6	Pseudomonas_phage	96.6	3.2e-38
WP_023083237.1|4208965_4209256_-	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	97.9	4.3e-55
4213317:4213398	attR	ATTCATAATGCTGATGTCCCAGGTTCAAGTCCCGGTGTAGCCACCATATTTTTCAAGGGGTTAGCGCAAGCTAACCCCTTTT	NA	NA	NA	NA
>prophage 5
NZ_CP027165	Pseudomonas aeruginosa strain AR_0360 chromosome, complete genome	6463575	5865226	5945754	6463575	plate,tRNA,tail	Pseudomonas_phage(35.9%)	84	NA	NA
WP_003099590.1|5865226_5866252_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	1.4e-108
WP_003085061.1|5866330_5866900_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|5866983_5867337_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003142783.1|5867327_5867870_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003142784.1|5867842_5869075_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	2.6e-77
WP_003085071.1|5869118_5869625_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003099581.1|5869719_5871273_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003142785.1|5871269_5872541_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|5872641_5874564_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003099577.1|5874842_5875175_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003121837.1|5875218_5876070_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	33.3	1.1e-08
WP_003121838.1|5876069_5876450_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003161932.1|5876486_5877293_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003099567.1|5877408_5878395_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003109024.1|5878391_5879684_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_029610110.1|5879664_5882457_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_105412603.1|5882583_5883600_+	phosphotransferase	NA	NA	NA	NA	NA
WP_003099549.1|5883596_5884271_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003099547.1|5884272_5885031_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_003099546.1|5885031_5886093_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_003142788.1|5886244_5888638_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003099542.1|5888686_5889316_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003085106.1|5889444_5890479_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|5890712_5891822_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003099539.1|5891877_5892924_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003113206.1|5893038_5894286_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003099535.1|5894391_5895222_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|5895345_5896020_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003099532.1|5896019_5896838_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003085126.1|5896910_5898389_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003121843.1|5898705_5899020_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_003113202.1|5899119_5899890_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.1	1.4e-71
WP_003085132.1|5900347_5900548_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003118907.1|5900595_5900955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118908.1|5901317_5901767_+	hypothetical protein	NA	B5TK61	Pseudomonas_phage	53.3	5.0e-26
WP_003101620.1|5901788_5902304_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	43.4	1.8e-32
WP_033980702.1|5902300_5902858_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	70.3	4.6e-45
WP_003121845.1|5903010_5903337_+	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	59.3	9.2e-30
WP_003161928.1|5903333_5904221_+	bacteriophage protein	NA	S4TNY7	Salmonella_phage	59.8	4.1e-88
WP_003118911.1|5904213_5904747_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.6	3.9e-62
WP_003161927.1|5904748_5906854_+|tail	phage tail fiber protein	tail	Q9ZXK6	Pseudomonas_virus	52.7	3.0e-222
WP_016852415.1|5906861_5907302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003121848.1|5907344_5908505_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.4	1.2e-188
WP_003085175.1|5908517_5909021_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	8.0e-65
WP_003085178.1|5909035_5909380_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_031638514.1|5909549_5911787_+|tail	phage tail length tape measure protein	tail	NA	NA	NA	NA
WP_003121850.1|5911796_5912669_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	52.1	4.6e-76
WP_003101635.1|5912643_5912850_+	hypothetical protein	NA	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_003161925.1|5912907_5913897_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.8	1.7e-106
WP_003161924.1|5913929_5914559_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.5	5.5e-87
WP_003121852.1|5914555_5914918_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	47.9	4.2e-15
WP_003118919.1|5914914_5915172_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_003113190.1|5915487_5915982_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	56.5	1.4e-45
WP_003113189.1|5915993_5916341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003113188.1|5916370_5916625_+	hypothetical protein	NA	A0A2H4PI34	Pseudomonas_phage	38.4	6.3e-10
WP_003161921.1|5916671_5918510_+|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	35.8	3.4e-28
WP_003113186.1|5918502_5918844_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	40.0	1.4e-17
WP_003118922.1|5918851_5919547_+|tail	phage minor tail protein L	tail	A0A1B0VNE0	Pseudomonas_phage	50.2	1.5e-69
WP_003161919.1|5919549_5920320_+|tail	phage tail assembly protein	tail	A0A2D1GNP8	Pseudomonas_phage	55.6	5.5e-81
WP_003161918.1|5920374_5920977_+|tail	tail assembly protein	tail	A0A1V0E8A0	Vibrio_phage	57.3	6.5e-53
WP_003161917.1|5921035_5924689_+|tail	phage tail protein	tail	A0A0S2SYC5	Pseudomonas_phage	57.0	0.0e+00
WP_031638511.1|5925674_5926727_+	hypothetical protein	NA	A0A0H5AXZ9	Pseudomonas_phage	50.6	2.4e-63
WP_003113177.1|5926726_5927029_+	hypothetical protein	NA	A0A0H5B141	Pseudomonas_phage	71.0	4.4e-34
WP_003161916.1|5927025_5927256_+	hypothetical protein	NA	C8ZKF3	Pseudomonas_phage	70.3	1.4e-24
WP_003117978.1|5927674_5928280_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	66.3	2.1e-75
WP_003161915.1|5928281_5929328_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	3.1e-111
WP_003161914.1|5929327_5930164_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.5	4.7e-70
WP_003085214.1|5930225_5930870_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_003161913.1|5931141_5931564_+	OsmC family protein	NA	NA	NA	NA	NA
WP_003101641.1|5931883_5932678_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_003085224.1|5932732_5933380_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_003085225.1|5933479_5933818_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_003121853.1|5933896_5935378_+	AAA family ATPase	NA	U5XJW0	Phormidium_phage	33.8	3.9e-67
WP_003161912.1|5935417_5936218_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003161911.1|5936278_5937355_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_003117983.1|5937476_5938445_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_003085245.1|5938461_5938884_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_003085247.1|5939174_5940209_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_003085249.1|5940208_5940928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003120826.1|5940928_5941351_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_003085254.1|5941428_5941779_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	3.0e-26
WP_003161908.1|5941832_5942924_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_003161907.1|5942926_5944270_-	peptidoglycan DD-metalloendopeptidase family protein	NA	O03937	Lactobacillus_phage	44.1	2.3e-18
WP_003101660.1|5944554_5945754_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
