The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027134	Escherichia coli strain AR_0372 chromosome, complete genome	5211570	572657	641078	5211570	protease,transposase,tRNA	uncultured_Caudovirales_phage(17.65%)	57	NA	NA
WP_001162173.1|572657_574010_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232246.1|574193_574580_+	cytochrome b562	NA	NA	NA	NA	NA
WP_000212715.1|574771_575014_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	50.0	1.4e-14
WP_001105433.1|575003_575294_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	63.8	3.8e-27
WP_001009182.1|575294_575759_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	8.5e-53
WP_000187798.1|575943_578082_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_021523332.1|578475_580131_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_021523333.1|580180_581602_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181324.1|581720_582668_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|582852_582906_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471850.1|583046_585743_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.3	3.4e-45
WP_000047539.1|585948_586335_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|586407_586869_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|586881_587817_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_001296693.1|587820_587955_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230281.1|588235_588631_-	RidA family protein	NA	NA	NA	NA	NA
WP_000500687.1|588761_589475_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000256681.1|589545_590139_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001326836.1|590283_590736_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000036448.1|590858_592454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000012907.1|592509_593514_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|593675_594092_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001059412.1|594137_594641_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016245205.1|594833_596030_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_000416387.1|596085_598941_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786399.1|598940_599384_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|599737_601249_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|601515_602616_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|602615_603698_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_021523335.1|603858_605361_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	43.9	1.4e-83
WP_001309159.1|605438_606437_-	DNA-binding transcriptional regulator IdnR	NA	NA	NA	NA	NA
WP_001128347.1|606503_607823_-	gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
WP_000998695.1|607885_608650_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_001197411.1|608673_609705_-	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000896738.1|609921_610485_+	gluconokinase	NA	NA	NA	NA	NA
WP_001318460.1|610488_611508_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
WP_000547193.1|616065_617394_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000179691.1|618020_619238_+	MFS transporter	NA	NA	NA	NA	NA
WP_000611568.1|619249_620368_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000594405.1|620410_620536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000254999.1|620588_620846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948656.1|621159_622326_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.8e-184
WP_000625671.1|622261_622675_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001293436.1|622737_624735_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000336726.1|624888_625707_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_000088391.1|625742_626045_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000177057.1|626978_627236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|627792_628560_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684855.1|628560_629517_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	2.4e-17
WP_000125187.1|629513_630512_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000879164.1|630508_631411_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000188262.1|631455_633780_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_001068913.1|633866_634820_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_001283626.1|634816_635338_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_000555341.1|637087_637345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000823243.1|638095_639454_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_086352845.1|639692_641078_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.1	5.0e-258
>prophage 2
NZ_CP027134	Escherichia coli strain AR_0372 chromosome, complete genome	5211570	2000745	2078340	5211570	holin,terminase,head,portal,transposase,integrase,capsid,tRNA,lysis,tail	Escherichia_phage(32.76%)	92	2001873:2001888	2045188:2045203
WP_000526135.1|2000745_2001204_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_001300895.1|2001325_2002288_-	L,D-transpeptidase LdtC	NA	NA	NA	NA	NA
2001873:2001888	attL	GTCAGCGTGTCACCAC	NA	NA	NA	NA
WP_024166502.1|2002431_2005878_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_001522877.1|2006005_2007079_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_000284714.1|2007339_2008539_+	lipoprotein-releasing ABC transporter permease subunit LolC	NA	NA	NA	NA	NA
WP_001033689.1|2008531_2009233_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	39.8	5.4e-35
WP_001251363.1|2009232_2010477_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291248.1|2010505_2011417_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952736.1|2011432_2012254_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000720604.1|2012390_2013176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001522885.1|2013172_2013634_-	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_000759309.1|2013691_2014738_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|2014734_2015529_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074983.1|2015695_2016814_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
WP_000003742.1|2016782_2017052_-	excisionase	NA	NA	NA	NA	NA
WP_000102155.1|2017113_2019570_-	exonuclease	NA	V5UQJ3	Shigella_phage	42.6	3.3e-103
WP_001093951.1|2019647_2019851_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450218.1|2019847_2020036_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000935596.1|2020046_2020901_-	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
WP_000394557.1|2021431_2021806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379564.1|2021817_2021970_-	DUF1391 family protein	NA	NA	NA	NA	NA
WP_000787428.1|2022176_2022584_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912294.1|2022660_2022888_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705383.1|2022871_2023423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020541.1|2023394_2024435_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	1.0e-90
WP_001309414.1|2024346_2024889_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_000450706.1|2024922_2025693_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.4	1.1e-86
WP_001141099.1|2025708_2026101_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_001266130.1|2026097_2026394_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001209475.1|2026390_2026852_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	2.6e-38
WP_000403791.1|2026829_2027186_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.1e-57
WP_000137947.1|2027281_2027689_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	60.4	6.1e-23
WP_001229301.1|2027690_2028056_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	99.2	1.9e-68
WP_000208092.1|2028052_2029039_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	41.5	1.8e-44
WP_001336454.1|2029120_2029339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2029597_2029753_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980989.1|2029969_2030221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309417.1|2030287_2030566_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.3	6.3e-11
WP_001265256.1|2030567_2031626_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.3	1.8e-90
WP_000140038.1|2031626_2031995_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	2.4e-34
WP_001064909.1|2031987_2032677_+	antiterminator	NA	I6PDF8	Cronobacter_phage	48.1	7.1e-56
WP_001309418.1|2032889_2033087_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	93.8	1.7e-26
WP_157835956.1|2033062_2033176_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000871291.1|2033456_2033792_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_001309419.1|2034037_2034241_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	96.8	2.7e-27
WP_001309421.1|2034237_2034399_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	89.1	1.6e-14
WP_000284506.1|2034548_2034764_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_060578251.1|2034768_2035659_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	70.6	3.6e-108
WP_001092864.1|2035695_2036229_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	3.3e-101
WP_000459345.1|2036388_2036526_+	hypothetical protein	NA	Q687G2	Enterobacteria_phage	97.8	1.3e-17
WP_001082562.1|2036527_2036995_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	77.9	7.0e-55
WP_000235436.1|2037443_2037953_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001309424.1|2037924_2039853_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.4e-261
WP_000258993.1|2039836_2040043_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_001322425.1|2040039_2041632_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	4.9e-185
WP_001253887.1|2041621_2043070_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	9.9e-100
WP_000256814.1|2043106_2043454_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	59.1	6.8e-23
WP_000522603.1|2043511_2044540_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.4e-116
WP_000201530.1|2044591_2044966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204533.1|2044958_2045312_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
2045188:2045203	attR	GTGGTGACACGCTGAC	NA	NA	NA	NA
WP_000974996.1|2045327_2045861_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	64.6	2.5e-56
WP_000683079.1|2045857_2046253_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235048.1|2046260_2047010_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.8	2.7e-125
WP_001309426.1|2047028_2047460_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	7.4e-43
WP_000533401.1|2047486_2047900_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.8	4.6e-42
WP_000082417.1|2047880_2050442_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.5	0.0e+00
WP_000847291.1|2050438_2050768_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001309428.1|2050767_2051466_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.6	3.2e-128
WP_000194723.1|2051476_2052220_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_122991350.1|2052165_2052798_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	96.7	1.2e-102
WP_000514742.1|2053141_2056834_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.7	0.0e+00
WP_001233148.1|2056901_2057501_+	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
WP_000216486.1|2057652_2060679_+	membrane protein	NA	A0A0K2FIZ6	Escherichia_phage	54.6	1.4e-55
WP_000885577.1|2060678_2061263_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_000240999.1|2061317_2061986_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937481.1|2062042_2062309_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.8	1.5e-17
WP_000799406.1|2062540_2063404_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|2063387_2064524_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_001522887.1|2064773_2066000_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|2066048_2067170_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000735412.1|2067245_2068706_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|2068705_2069377_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|2069546_2070917_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|2070920_2071562_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000004751.1|2071597_2072704_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_105375189.1|2072757_2073219_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_000873387.1|2073228_2073867_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_012602377.1|2074199_2074550_-	DUF1493 family protein	NA	NA	NA	NA	NA
WP_000381622.1|2074534_2074984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001522898.1|2075566_2076817_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	6.5e-23
WP_020232865.1|2076919_2077243_-	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	62.6	6.3e-39
WP_000526135.1|2077881_2078340_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP027134	Escherichia coli strain AR_0372 chromosome, complete genome	5211570	2295307	2353499	5211570	holin,terminase,integrase,tRNA,lysis,tail	Escherichia_phage(49.09%)	69	2286203:2286218	2329187:2329202
2286203:2286218	attL	ATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_100190652.1|2295307_2296255_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	2.4e-17
WP_000387388.1|2297571_2298555_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123748.1|2299032_2300406_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001523172.1|2300534_2301470_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040839.1|2301521_2302757_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_000079604.1|2302758_2302974_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|2303073_2303262_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001443846.1|2303299_2303449_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_000166313.1|2303504_2304314_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_000105140.1|2304306_2306907_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_001344816.1|2307008_2307284_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_001352098.1|2307358_2307529_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|2307528_2307750_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|2308191_2308680_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|2308676_2308832_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001326317.1|2308842_2309022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233319.1|2309264_2309684_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|2309763_2310018_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693803.1|2310014_2310437_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001396581.1|2310514_2311303_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_020233967.1|2311309_2312056_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	1.1e-110
WP_123876605.1|2312078_2312840_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.0	1.7e-114
WP_029702111.1|2312855_2313278_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	7.4e-64
WP_000137958.1|2313439_2313943_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	39.7	4.3e-18
WP_000200358.1|2314063_2314837_-	KilA-N domain-containing protein	NA	A0A1L2BWW1	Bacteriophage	42.6	9.6e-09
WP_001445775.1|2315359_2315485_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	90.2	4.0e-10
WP_001445776.1|2315567_2315909_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000940344.1|2316776_2317376_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	2.9e-106
WP_000228032.1|2317375_2317666_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	7.4e-47
WP_000640106.1|2317662_2318205_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	76.3	5.8e-77
WP_001208722.1|2318426_2318996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001328752.1|2318964_2319267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000781775.1|2319343_2319685_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	90.1	6.2e-53
WP_023153991.1|2319688_2320165_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	5.0e-85
WP_001228696.1|2320381_2320567_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|2320763_2322221_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001291105.1|2322358_2323150_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_020233805.1|2323142_2324075_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.1e-83
WP_000126788.1|2324052_2324262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089448.1|2324265_2325360_+	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	80.5	4.5e-113
WP_000625348.1|2325340_2326642_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_000763701.1|2326644_2328051_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	3.0e-186
WP_001363932.1|2328034_2329147_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	7.1e-114
WP_000770042.1|2329251_2330016_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
2329187:2329202	attR	TTTTTATTGCTGCGAT	NA	NA	NA	NA
WP_020233804.1|2330114_2331254_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	9.7e-159
WP_000908084.1|2331296_2331473_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
WP_057950804.1|2331476_2331872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000524260.1|2331871_2332255_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_042002565.1|2332255_2332636_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	43.6	1.5e-18
WP_000673077.1|2332632_2333025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001328756.1|2333051_2334014_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	38.6	8.4e-55
WP_122452218.1|2334164_2334524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032139919.1|2334631_2334832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023153989.1|2334995_2338229_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.0	7.4e-103
WP_000024051.1|2338221_2338560_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_001152432.1|2338559_2339258_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
WP_001351716.1|2339263_2340007_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	1.0e-145
WP_049286672.1|2339943_2340546_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	8.1e-88
WP_021523093.1|2340606_2344086_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_001542091.1|2344153_2344753_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
WP_032152843.1|2344817_2347217_+|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	55.3	3.9e-133
WP_000654154.1|2347213_2347495_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.2e-17
WP_000235967.1|2347504_2348209_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
WP_000355609.1|2348219_2348513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086527.1|2348740_2349331_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2349647_2349881_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2349949_2350063_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001523332.1|2350666_2351950_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527786.1|2352038_2353499_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.7	5.1e-43
>prophage 4
NZ_CP027134	Escherichia coli strain AR_0372 chromosome, complete genome	5211570	2502100	2612529	5211570	terminase,head,portal,transposase,capsid,integrase,tail,lysis	Enterobacteria_phage(42.59%)	115	2557317:2557332	2606531:2606546
WP_000526135.1|2502100_2502559_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_001261003.1|2502736_2503405_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586719.1|2503707_2504301_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001296725.1|2504297_2505290_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_042002675.1|2505413_2506394_+	LbetaH domain-containing protein	NA	NA	NA	NA	NA
WP_057950846.1|2506385_2506925_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|2506987_2507212_-	YdcH family protein	NA	NA	NA	NA	NA
WP_048265110.1|2507351_2509007_-	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_001523218.1|2509231_2510575_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414564.1|2510791_2511715_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001523216.1|2511752_2513393_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_001309484.1|2513791_2513941_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731851.1|2514012_2514186_-	hypothetical protein	NA	A0A0R6PI25	Moraxella_phage	59.6	4.4e-07
WP_001390056.1|2514430_2514961_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	43.9	2.0e-18
WP_000048645.1|2515149_2516151_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000115969.1|2516192_2517632_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001027943.1|2517828_2518629_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000343026.1|2518744_2519122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001314706.1|2519241_2519691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001523214.1|2519677_2520016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021517100.1|2520300_2524203_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048963.1|2524403_2525009_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_020233384.1|2525062_2526379_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_021523075.1|2526368_2528126_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000177498.1|2529037_2529643_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_001523206.1|2529813_2532120_-	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_021523074.1|2532183_2533044_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_059321765.1|2533251_2535660_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001523200.1|2539733_2540057_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698145.1|2540064_2540250_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_023153685.1|2540246_2542886_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762229.1|2543093_2544083_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001523197.1|2544193_2544616_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|2544612_2544879_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_021517097.1|2545152_2548677_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837924.1|2549043_2550177_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_057950810.1|2550317_2550752_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	3.0e-28
WP_113328759.1|2551360_2552251_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000983718.1|2552250_2553078_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	G9BWD6	Planktothrix_phage	28.5	3.8e-11
WP_001101728.1|2553074_2553932_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968125.1|2553928_2554786_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_000354607.1|2555258_2556053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001405873.1|2556598_2556892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001314683.1|2556934_2557975_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.9	2.9e-125
2557317:2557332	attL	GCATGACATGCACCAT	NA	NA	NA	NA
WP_000654155.1|2557984_2558266_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	1.4e-18
WP_042099016.1|2558265_2560641_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.0	1.8e-167
WP_000526135.1|2560761_2561220_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_001542091.1|2561416_2562016_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
WP_021523093.1|2562083_2565563_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_049286672.1|2565623_2566226_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	8.1e-88
WP_032153655.1|2566162_2566906_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	9.5e-147
WP_001551186.1|2566911_2567610_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	8.9e-131
WP_000847345.1|2567609_2567939_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_032153656.1|2567935_2570497_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.9	0.0e+00
WP_000459457.1|2570489_2570924_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|2570905_2571328_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001349920.1|2571343_2572084_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000683128.1|2572091_2572487_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_000752979.1|2573074_2573428_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_020233914.1|2573439_2573838_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	2.3e-62
WP_000063277.1|2573879_2574905_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.7	2.7e-192
WP_001708751.1|2574959_2575292_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_020233915.1|2575301_2576621_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	2.2e-231
WP_001356819.1|2576601_2578203_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
WP_000198149.1|2578199_2578406_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027269.1|2578402_2580328_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000453587.1|2580302_2580848_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001368374.1|2581236_2581470_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|2581527_2581938_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|2582089_2582263_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|2582434_2582590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|2582669_2582735_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|2582737_2582926_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2582936_2583149_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|2583511_2584009_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|2584005_2584539_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|2584535_2584847_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|2584851_2585067_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|2585820_2586036_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|2586336_2586549_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|2586603_2586693_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|2586970_2587723_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265199.1|2587736_2588786_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
WP_012304870.1|2588787_2589066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|2589132_2589384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2589600_2589756_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|2589827_2590115_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|2590114_2590354_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|2590378_2590684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|2590886_2591219_+	protein FlxA	NA	NA	NA	NA	NA
WP_000589005.1|2591655_2592969_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000915483.1|2593452_2594475_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_001265627.1|2594477_2595092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021523102.1|2595300_2595966_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001151242.1|2596168_2596567_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.9	7.7e-63
WP_000054487.1|2596607_2597573_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_000705355.1|2597553_2598075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000921596.1|2598058_2598286_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000381212.1|2598366_2598774_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000379575.1|2598942_2599098_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000344950.1|2599099_2599675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|2600161_2600350_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083276.1|2600346_2600538_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048363.1|2600631_2603103_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	1.2e-57
WP_000005552.1|2603175_2603427_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_021523105.1|2603461_2604742_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	3.9e-156
WP_001389342.1|2604743_2604872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836037.1|2604929_2605949_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|2605960_2607175_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
2606531:2606546	attR	ATGGTGCATGTCATGC	NA	NA	NA	NA
WP_001314753.1|2607380_2607707_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.2e-23
WP_000705205.1|2607841_2608183_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|2608217_2608778_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001445899.1|2608780_2609491_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|2609598_2609904_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001551145.1|2610102_2612529_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
>prophage 5
NZ_CP027134	Escherichia coli strain AR_0372 chromosome, complete genome	5211570	2862239	2960625	5211570	holin,terminase,head,protease,portal,capsid,integrase,tRNA,tail,lysis	Enterobacteria_phage(47.06%)	108	2939222:2939237	2958886:2958901
WP_000984502.1|2862239_2863121_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_057950751.1|2863312_2865361_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	3.0e-86
WP_000431370.1|2865380_2866079_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|2866175_2866673_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_001520702.1|2866802_2868086_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001306757.1|2868054_2870688_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_024166480.1|2870767_2872207_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|2872324_2872561_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000929530.1|2872581_2872857_+	YebW family protein	NA	NA	NA	NA	NA
WP_001520704.1|2872857_2873514_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	2.8e-57
WP_001520705.1|2873909_2874251_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879330.1|2874263_2875136_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204705.1|2875139_2875514_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|2875652_2875883_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_105375192.1|2875984_2876641_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|2876664_2877327_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_020233070.1|2877323_2879384_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_001520710.1|2879592_2880252_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001295500.1|2880578_2880935_-	protein YebF	NA	NA	NA	NA	NA
WP_000257738.1|2881001_2881292_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_021517157.1|2881425_2882604_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800512.1|2882658_2883300_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001069467.1|2883336_2885148_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301727.1|2885382_2886858_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
WP_001056694.1|2887195_2888065_+	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000091148.1|2888192_2889635_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000448381.1|2889766_2890738_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|2890856_2892179_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_011076428.1|2892194_2893127_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202987.1|2893205_2893961_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001520716.1|2893957_2894743_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568522.1|2894892_2895903_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|2895911_2896523_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072146566.1|2896661_2896727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001520719.1|2896797_2897400_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|2897401_2897923_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|2897957_2898698_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001308712.1|2898726_2899179_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258662.1|2899296_2901069_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891630.1|2901378_2901945_+	hydrolase	NA	NA	NA	NA	NA
WP_001217553.1|2902299_2902548_+	DinI family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000885577.1|2902663_2903248_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_000216487.1|2903247_2906274_-	membrane protein	NA	A0A0K2FIZ6	Escherichia_phage	54.5	7.0e-55
WP_001228316.1|2906425_2907025_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	2.0e-107
WP_105375193.1|2907092_2910566_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.5	0.0e+00
WP_032300536.1|2910909_2911542_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	4.2e-103
WP_001542192.1|2911487_2912231_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	2.1e-146
WP_001335877.1|2912241_2912940_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_000847298.1|2912939_2913269_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001542191.1|2913265_2915839_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.3	0.0e+00
WP_000533402.1|2915819_2916233_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001542190.1|2916259_2916691_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	4.8e-42
WP_000235110.1|2916704_2917457_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000683079.1|2917464_2917860_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000975010.1|2917856_2918432_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	6.4e-50
WP_000752997.1|2918447_2918801_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	4.9e-61
WP_000158858.1|2918812_2919199_-	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	90.2	1.2e-52
WP_000063261.1|2919240_2920266_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	2.5e-190
WP_001299443.1|2920322_2920655_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_016248240.1|2920664_2921984_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.9	2.8e-234
WP_016248239.1|2921964_2923566_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	7.2e-309
WP_000198149.1|2923562_2923769_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_016248238.1|2923765_2925691_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.4	0.0e+00
WP_000867489.1|2925665_2926211_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	1.2e-79
WP_001082562.1|2926652_2927120_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	77.9	7.0e-55
WP_000459345.1|2927121_2927259_-	hypothetical protein	NA	Q687G2	Enterobacteria_phage	97.8	1.3e-17
WP_024239084.1|2927418_2927952_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	7.4e-101
WP_000731267.1|2928002_2928347_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	97.4	7.2e-57
WP_000284510.1|2928351_2928567_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000874341.1|2928717_2930571_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	91.1	0.0e+00
WP_021519715.1|2931359_2932409_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	91.4	3.1e-188
WP_001420470.1|2932558_2932756_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_021553036.1|2932918_2933716_-	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	32.3	3.4e-25
WP_001127354.1|2933722_2933950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001064901.1|2934222_2934912_-	antiterminator	NA	I6PDF8	Cronobacter_phage	47.2	2.7e-55
WP_000904158.1|2934908_2935268_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	4.6e-38
WP_021553035.1|2935280_2936270_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	94.5	2.1e-186
WP_021553034.1|2936322_2936580_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	68.8	4.7e-21
WP_021553033.1|2936576_2937977_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	91.8	3.2e-244
WP_000988266.1|2937973_2938873_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	94.8	2.3e-139
WP_032301910.1|2938883_2939870_-	hypothetical protein	NA	Q8W642	Enterobacteria_phage	96.3	1.7e-55
2939222:2939237	attL	ATTCCGGTGAATATTC	NA	NA	NA	NA
WP_000618007.1|2940162_2940387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000626793.1|2940383_2940578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024226990.1|2940574_2941426_-	hypothetical protein	NA	A0A1C9IHV9	Salmonella_phage	66.5	3.1e-93
WP_001090258.1|2941534_2942242_-	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	91.1	3.9e-118
WP_000838344.1|2942577_2943234_+	helix-turn-helix domain-containing protein	NA	Q8W648	Enterobacteria_phage	97.7	3.1e-125
WP_021556323.1|2943337_2943838_+	helix-turn-helix domain-containing protein	NA	Q8W649	Enterobacteria_phage	96.2	1.8e-64
WP_000141093.1|2944128_2944335_+	hypothetical protein	NA	Q8W651	Enterobacteria_phage	94.1	1.3e-29
WP_021556324.1|2944529_2944718_+	hypothetical protein	NA	Q8W652	Enterobacteria_phage	50.9	1.8e-09
WP_001199104.1|2944723_2945305_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	65.1	1.9e-70
WP_000179800.1|2945553_2945871_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	82.6	5.2e-38
WP_001300189.1|2945824_2946139_+	hypothetical protein	NA	B1GS43	Salmonella_phage	86.0	2.8e-39
WP_001289973.1|2946806_2947292_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	86.1	1.1e-42
WP_021556325.1|2947805_2947991_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	88.7	3.5e-18
WP_000206826.1|2947987_2948332_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	99.1	3.8e-58
WP_000457723.1|2948416_2948659_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_105375194.1|2948662_2948809_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.8	2.4e-22
WP_000528718.1|2948817_2949054_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	6.4e-41
WP_000362005.1|2949109_2950423_+|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	95.6	4.1e-246
WP_042196262.1|2950404_2951175_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	96.9	5.7e-70
WP_000252980.1|2951227_2951623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019591.1|2951663_2952407_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564730.1|2952403_2953375_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_001578498.1|2953409_2955839_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_020233068.1|2955863_2956964_-	cytochrome c	NA	NA	NA	NA	NA
WP_020233067.1|2957349_2958096_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001304291.1|2958109_2958676_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025322.1|2958891_2960625_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
2958886:2958901	attR	ATTCCGGTGAATATTC	NA	NA	NA	NA
>prophage 6
NZ_CP027134	Escherichia coli strain AR_0372 chromosome, complete genome	5211570	3146770	3154288	5211570		Escherichia_phage(42.86%)	7	NA	NA
WP_021523155.1|3146770_3147319_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	4.4e-48
WP_021523156.1|3147323_3148202_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	64.5	1.9e-106
WP_021523157.1|3148259_3149159_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.1	1.7e-28
WP_001515524.1|3149158_3150244_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.3e-101
WP_105375195.1|3150615_3151509_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_021523159.1|3151740_3152736_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.0	2.5e-09
WP_021523160.1|3152893_3154288_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	9.8e-20
>prophage 7
NZ_CP027134	Escherichia coli strain AR_0372 chromosome, complete genome	5211570	3201693	3253681	5211570	holin,terminase,head,portal,transposase,capsid,integrase,plate,tRNA,lysis,tail	Escherichia_phage(33.33%)	64	3205982:3206008	3238880:3238906
WP_000675148.1|3201693_3203097_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	2.7e-33
WP_000137877.1|3203093_3203816_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|3203995_3204328_+	YegP family protein	NA	NA	NA	NA	NA
WP_001520824.1|3204475_3205837_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.2	1.6e-216
3205982:3206008	attL	AATCTCCCTTACACGGGCTTATTTTTT	NA	NA	NA	NA
WP_000468308.1|3206109_3206328_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_042002646.1|3206409_3207573_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.7	1.0e-203
WP_000978914.1|3207572_3208052_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	99.4	4.3e-84
WP_000785970.1|3210506_3210626_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031307.1|3210658_3210934_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001554312.1|3210990_3211509_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	3.2e-93
WP_042002647.1|3211521_3212712_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	1.8e-224
WP_042002648.1|3212971_3213664_-	hypothetical protein	NA	Q858R9	Enterobacteria_phage	98.3	1.4e-123
WP_001406733.1|3214155_3214335_+	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
WP_000002748.1|3214387_3214666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001695638.1|3214869_3215397_-|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	95.4	1.2e-90
WP_060578154.1|3215400_3217719_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	68.1	6.3e-213
WP_028985810.1|3217729_3218260_-|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	99.4	3.9e-102
WP_001121497.1|3218252_3219161_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	100.0	1.5e-162
WP_000127164.1|3219165_3219513_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_021525814.1|3219509_3220145_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	8.5e-112
WP_042002650.1|3220228_3221014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042002651.1|3221085_3221538_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	97.3	1.7e-74
WP_021517192.1|3221530_3221998_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	97.4	7.4e-81
WP_001695628.1|3222105_3222531_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	97.2	1.0e-65
WP_021548484.1|3222518_3222944_-	hypothetical protein	NA	Q858W1	Yersinia_virus	89.4	1.5e-59
WP_042002652.1|3222958_3223456_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.5e-92
WP_000123123.1|3223455_3223737_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846409.1|3223740_3223944_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000988633.1|3223943_3224453_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_021548483.1|3224552_3225296_-|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	98.8	4.6e-125
WP_042002653.1|3225299_3226373_-|capsid	phage major capsid protein, P2 family	capsid	Q94MC7	Enterobacteria_phage	99.4	1.9e-201
WP_001607695.1|3226431_3227286_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0F7LA11	Escherichia_phage	100.0	1.7e-139
WP_000156844.1|3227459_3229232_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.8	0.0e+00
WP_000038161.1|3229231_3230266_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_042002654.1|3230583_3231240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042002655.1|3231323_3232055_-	hypothetical protein	NA	A0A218M4H5	Erwinia_phage	78.6	1.0e-108
WP_042002656.1|3232206_3232419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042002657.1|3232490_3232943_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.0	3.0e-79
WP_042002658.1|3232942_3235228_-	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	98.3	0.0e+00
WP_000027664.1|3235217_3235493_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113264.1|3235489_3235714_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_042002659.1|3235716_3236016_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	98.0	3.5e-44
WP_000557698.1|3236015_3236240_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_000217677.1|3236303_3236804_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_001005162.1|3236800_3236971_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000043869.1|3236981_3237257_-	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001306384.1|3237371_3237671_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000985262.1|3237786_3238800_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	98.8	2.4e-193
WP_001303579.1|3239076_3239394_-	hypothetical protein	NA	NA	NA	NA	NA
3238880:3238906	attR	AATCTCCCTTACACGGGCTTATTTTTT	NA	NA	NA	NA
WP_000807371.1|3239808_3240708_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	4.8e-12
WP_000178552.1|3240789_3241569_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_001520826.1|3241668_3242709_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_033550567.1|3242756_3243014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001352368.1|3243086_3244295_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000599533.1|3244660_3245866_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_000562370.1|3246309_3246630_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000460651.1|3246622_3247009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284954.1|3247016_3247703_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088605.1|3247680_3248304_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089068.1|3248385_3249591_+	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_000428546.1|3249703_3250297_-	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_000422741.1|3251264_3251690_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|3251686_3252037_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|3252067_3253681_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
>prophage 8
NZ_CP027134	Escherichia coli strain AR_0372 chromosome, complete genome	5211570	3289223	3298666	5211570		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001520842.1|3289223_3290360_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	2.5e-162
WP_021523183.1|3290356_3292357_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001295429.1|3292481_3292943_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|3292984_3293455_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|3293501_3294221_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001309587.1|3294217_3295903_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
WP_001240398.1|3296124_3296856_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001216963.1|3296915_3297023_+	protein YohO	NA	NA	NA	NA	NA
WP_000783145.1|3297003_3297735_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569374.1|3297739_3298666_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 9
NZ_CP027134	Escherichia coli strain AR_0372 chromosome, complete genome	5211570	3701897	3743811	5211570	holin,terminase,integrase	Escherichia_phage(58.0%)	54	3703736:3703752	3744002:3744018
WP_000017552.1|3701897_3702050_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
WP_000076001.1|3702067_3702259_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_014639259.1|3702569_3703088_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_001521044.1|3703103_3703643_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	96.6	1.6e-42
3703736:3703752	attL	AATCATTCCCACTCAAT	NA	NA	NA	NA
WP_021523198.1|3703839_3704337_-	DUF2514 domain-containing protein	NA	A0A193GYU6	Enterobacter_phage	66.5	6.7e-48
WP_021523199.1|3704333_3704963_-	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	96.7	2.9e-112
WP_000256098.1|3704952_3705261_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	100.0	1.3e-49
WP_021523200.1|3705247_3705652_-	hypothetical protein	NA	G9L6E6	Escherichia_phage	94.8	2.3e-62
WP_021523201.1|3705827_3708434_-	SGNH/GDSL hydrolase family protein	NA	G9L6E4	Escherichia_phage	65.2	2.7e-79
WP_001546908.1|3708629_3708887_+	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	97.6	3.7e-42
WP_001546909.1|3709024_3709156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001546910.1|3709201_3709894_+	hypothetical protein	NA	G9L6E2	Escherichia_phage	80.2	2.2e-97
WP_000163644.1|3710023_3710350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000479990.1|3710336_3710849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708858.1|3710930_3711092_+	hypothetical protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
WP_001147904.1|3711123_3711420_-	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	100.0	2.5e-50
WP_021523202.1|3711615_3714090_-	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	99.3	0.0e+00
WP_021523203.1|3714095_3715898_-	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	98.0	0.0e+00
WP_021523204.1|3715894_3718408_-	hypothetical protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	97.4	0.0e+00
WP_021523205.1|3718407_3718953_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	93.9	1.8e-86
WP_021523206.1|3718952_3719417_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	99.4	1.9e-84
WP_021523207.1|3719416_3721888_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	98.7	0.0e+00
WP_000179265.1|3721887_3722493_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	99.5	4.7e-112
WP_000424495.1|3722492_3722816_-	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	98.1	2.6e-53
WP_001546919.1|3722866_3723202_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	99.1	8.5e-55
WP_001546921.1|3723212_3723650_-	hypothetical protein	NA	A0A0F6R7N9	Escherichia_coli_O157_typing_phage	95.2	1.4e-70
WP_021523208.1|3723701_3724688_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	99.4	5.6e-187
WP_001546923.1|3724702_3725398_-	hypothetical protein	NA	G9L6C4	Escherichia_phage	100.0	6.0e-95
WP_000133160.1|3725400_3725697_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
WP_021523209.1|3725693_3727373_-	hypothetical protein	NA	G9L6C2	Escherichia_phage	99.3	8.0e-303
WP_000335899.1|3727387_3727594_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_057950734.1|3728345_3729047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021523211.1|3729258_3730728_-	hypothetical protein	NA	G9L6B8	Escherichia_phage	97.8	6.8e-290
WP_024166494.1|3730724_3731435_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	85.2	1.0e-105
WP_021523213.1|3731475_3731814_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	96.4	3.5e-56
WP_021523214.1|3731928_3732588_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	61.9	1.4e-53
WP_021523215.1|3732598_3733354_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	93.2	6.5e-143
WP_021523216.1|3733355_3734252_-	ead/Ea22-like family protein	NA	A0A088CC42	Shigella_phage	88.9	2.9e-158
WP_021523217.1|3734248_3734725_-	hypothetical protein	NA	A0A2I6TCH0	Escherichia_phage	68.8	9.4e-31
WP_016235747.1|3734786_3735131_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	97.4	8.2e-61
WP_001406039.1|3735248_3736034_-	hypothetical protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	100.0	9.3e-153
WP_021523218.1|3736030_3736846_-	hypothetical protein	NA	Q286X4	Escherichia_phage	95.6	1.7e-117
WP_000402896.1|3736861_3737062_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	1.0e-31
WP_001282459.1|3737212_3737443_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_000836290.1|3737597_3738182_+	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_001198620.1|3738335_3738488_+	hypothetical protein	NA	G9L6A5	Escherichia_phage	100.0	5.4e-25
WP_021523219.1|3738490_3738790_+	hypothetical protein	NA	G9L6A4	Escherichia_phage	99.0	5.8e-47
WP_021523220.1|3738786_3739608_+	hypothetical protein	NA	A0A2R9YJH7	Escherichia_phage	98.5	1.5e-161
WP_001617197.1|3739604_3740546_+	recombinase RecT	NA	A0A0F6TJP0	Escherichia_coli_O157_typing_phage	99.7	1.0e-177
WP_000675390.1|3740595_3740844_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_021523221.1|3740953_3741253_+	PerC family transcriptional regulator	NA	A0A2R9YJK3	Escherichia_phage	98.0	1.3e-49
WP_023153950.1|3741245_3741896_+	MT-A70 protein	NA	G9L699	Escherichia_phage	96.3	5.2e-125
WP_001055435.1|3741892_3742552_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	79.5	4.4e-103
WP_021523223.1|3742554_3743811_-|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.0	4.4e-237
3744002:3744018	attR	AATCATTCCCACTCAAT	NA	NA	NA	NA
>prophage 10
NZ_CP027134	Escherichia coli strain AR_0372 chromosome, complete genome	5211570	3964065	3971205	5211570		Escherichia_phage(83.33%)	6	NA	NA
WP_001272917.1|3964065_3966627_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	9.2e-32
WP_001141345.1|3966732_3967389_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
WP_001295181.1|3967439_3968207_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_000847993.1|3968402_3969311_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.1e-117
WP_001521147.1|3969307_3970570_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|3970566_3971205_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 11
NZ_CP027134	Escherichia coli strain AR_0372 chromosome, complete genome	5211570	4219105	4262603	5211570	integrase,protease,transposase,tRNA	Staphylococcus_phage(25.0%)	43	4234979:4234993	4250608:4250622
WP_001319878.1|4219105_4219864_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105566.1|4220069_4220990_-	agmatinase	NA	NA	NA	NA	NA
WP_001556203.1|4221127_4223104_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|4223112_4223244_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001303650.1|4223379_4223595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|4223898_4225053_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|4225488_4226883_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_032142436.1|4226959_4227457_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286517.1|4227551_4228259_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|4228338_4229070_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|4229082_4230033_+	glutathione synthase	NA	NA	NA	NA	NA
WP_000126441.1|4230069_4230705_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|4230704_4231121_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001389259.1|4231295_4232276_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|4232293_4232998_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|4233015_4233582_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|4233578_4233869_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174735.1|4233876_4234470_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239928.1|4234462_4235599_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
4234979:4234993	attL	CTGGAAGAGGCGCTT	NA	NA	NA	NA
WP_000745217.1|4235753_4236761_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394125.1|4236877_4237924_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|4238099_4238819_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|4239002_4239329_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|4239328_4240048_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001295382.1|4240208_4241261_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|4241288_4241564_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001298916.1|4241628_4242708_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|4242909_4244166_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839790.1|4244214_4246350_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234533.1|4246742_4247450_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_005761259.1|4247828_4249094_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	37.6	3.3e-75
WP_000612632.1|4251357_4251705_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	98.3	1.4e-60
4250608:4250622	attR	AAGCGCCTCTTCCAG	NA	NA	NA	NA
WP_001221615.1|4252436_4252871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000270971.1|4252858_4253260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221530.1|4253519_4254089_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000840364.1|4255208_4255475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001329787.1|4255543_4255822_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000813456.1|4255916_4256519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000250228.1|4257721_4258639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057950850.1|4258723_4259596_+	GTPase family protein	NA	NA	NA	NA	NA
WP_004020235.1|4259981_4260803_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_089541817.1|4260930_4262158_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_088561087.1|4262342_4262603_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP027130	Escherichia coli strain AR_0372 plasmid unnamed1, complete sequence	170292	4210	64270	170292	transposase,integrase	Escherichia_phage(47.06%)	55	6648:6707	52888:53708
WP_000255956.1|4210_5233_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_024193849.1|6312_6687_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	9.8e-60
6648:6707	attL	GGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
WP_001067855.1|6711_7416_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000108589.1|8132_8690_+	OsmC family protein	NA	NA	NA	NA	NA
WP_000210409.1|8831_9413_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000888080.1|9417_9756_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002431133.1|9785_10115_-	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	34.7	1.3e-10
WP_000039982.1|10328_11435_+	alkene reductase	NA	NA	NA	NA	NA
WP_001194013.1|11500_12202_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_032152933.1|12267_13041_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000872613.1|13226_14450_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_000090196.1|14580_15453_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000734115.1|15694_16447_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_021546935.1|16886_17891_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000874189.1|19176_19662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001267176.1|19686_20172_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000117262.1|20158_20854_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_000729219.1|20858_21989_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000964653.1|21978_23262_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000119836.1|23264_24644_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000178050.1|24747_25275_-	iron transporter	NA	NA	NA	NA	NA
WP_000118029.1|25315_27202_-	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_012372823.1|27548_28364_-	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_000949452.1|28546_29053_-	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_000449408.1|29042_29201_-	copper-sensitivity suppressor C	NA	NA	NA	NA	NA
WP_000428546.1|32052_32646_+	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001089068.1|32758_33964_-	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_000088605.1|34045_34669_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001284954.1|34646_35333_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000460651.1|35340_35727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049802299.1|35719_35983_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_001067855.1|36865_37570_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001137892.1|38623_39208_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|39207_40446_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|40442_41348_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067858.1|41469_42174_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_004883563.1|42514_42787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|42914_43754_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|43747_44095_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|44300_45089_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|45219_45693_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000845048.1|45850_46864_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_032152941.1|47066_47357_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001067858.1|47393_48098_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000239590.1|49375_50251_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|50297_50630_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001067855.1|52951_53656_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002063889.1|54849_55392_-	AAA family ATPase	NA	NA	NA	NA	NA
52888:53708	attR	GGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
WP_000557452.1|55404_56265_-	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
WP_001067855.1|56371_57076_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001334766.1|57707_58538_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|58668_59223_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|59366_60071_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000509965.1|60672_61278_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
WP_001553819.1|61372_64270_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
>prophage 1
NZ_CP027133	Escherichia coli strain AR_0372 plasmid unnamed4	97167	737	91688	97167	integrase,transposase,head,tail	Escherichia_phage(63.22%)	90	12276:12292	61176:61192
WP_086352859.1|737_3725_+	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	98.9	0.0e+00
WP_001165937.1|3714_4023_+	hypothetical protein	NA	Q1MVN0	Enterobacteria_phage	94.1	2.4e-48
WP_099368671.1|4226_4598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148486.1|4805_6161_-	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_000068872.1|6409_6898_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	79.0	1.3e-64
WP_001345478.1|7067_7625_+	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
WP_024187336.1|7617_7866_+	hypothetical protein	NA	Q71TF4	Escherichia_phage	100.0	1.0e-36
WP_000526135.1|8048_8507_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_000132937.1|8621_9641_-|head	head processing protein	head	Q71TR6	Escherichia_phage	96.8	4.4e-179
WP_001312284.1|9753_10884_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	84.5	9.2e-186
WP_025210446.1|10916_12638_-	hypothetical protein	NA	Q1MVN6	Enterobacteria_phage	99.5	0.0e+00
12276:12292	attL	GGTCTTCTTATCGAAAG	NA	NA	NA	NA
WP_060578233.1|12713_19481_+	N-6 DNA methylase	NA	Q1MVN7	Enterobacteria_phage	98.8	0.0e+00
WP_000224043.1|19514_19955_+	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_000747846.1|19951_20200_+	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_000526244.1|20236_21364_-	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	74.1	7.6e-156
WP_023351534.1|21466_22108_-	hypothetical protein	NA	A0A077SK30	Escherichia_phage	96.7	1.2e-110
WP_023356281.1|22297_22858_-	Ref family protein	NA	Q5QBN4	Enterobacteria_phage	98.9	1.5e-99
WP_001224234.1|23104_23416_-	hypothetical protein	NA	A0A077SK03	Escherichia_phage	100.0	1.0e-46
WP_000067530.1|23466_24498_-|integrase	tyrosine-type recombinase/integrase	integrase	Q71TG5	Escherichia_phage	100.0	9.9e-195
WP_000542336.1|24505_24727_-	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	100.0	4.5e-36
WP_000874156.1|25323_25533_+	hypothetical protein	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
WP_000611664.1|25643_26495_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	100.0	1.2e-158
WP_032246984.1|26527_27646_-	antirepressor	NA	A0A077SLR9	Escherichia_phage	88.7	3.7e-179
WP_071528000.1|27642_28002_-	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	80.3	2.6e-25
WP_000124159.1|28203_29688_-	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	99.8	4.3e-292
WP_060578234.1|29687_30881_-	hypothetical protein	NA	A0A077SL59	Escherichia_phage	99.0	9.8e-178
WP_001326849.1|30966_31419_-	late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
WP_029393260.1|31507_32551_-	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	99.4	1.7e-205
WP_000113018.1|32578_32758_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	1.2e-23
WP_001216045.1|32762_33143_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
WP_001190712.1|33142_33364_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_060578235.1|33546_35103_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	1.4e-104
WP_072196859.1|35099_36356_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_072650946.1|36477_39594_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	8.3e-27
WP_060578216.1|39859_40366_-	hypothetical protein	NA	A0A1B0VAK0	Salmonella_phage	98.8	1.2e-92
WP_001774489.1|40438_41701_-	hypothetical protein	NA	Q1MVG4	Enterobacteria_phage	99.8	2.7e-234
WP_032162337.1|42002_42704_-	hypothetical protein	NA	Q1MVG6	Enterobacteria_phage	99.6	1.3e-142
WP_001354545.1|42700_43378_-	calcineurin phosphoesterase	NA	A0A077SLQ6	Escherichia_phage	100.0	7.6e-135
WP_000484107.1|43374_44001_-	hypothetical protein	NA	A0A077SK52	Escherichia_phage	99.5	2.3e-122
WP_012817939.1|43898_44561_-	hypothetical protein	NA	Q71T83	Escherichia_phage	100.0	4.5e-124
WP_000095380.1|44502_44658_-	hypothetical protein	NA	A0A077SK20	Escherichia_phage	100.0	1.2e-19
WP_060578240.1|44724_45303_-	VRR-NUC domain-containing protein	NA	A0A077SLK0	Escherichia_phage	96.9	2.0e-104
WP_000840930.1|45305_45551_-	hypothetical protein	NA	A0A1B0VDU5	Salmonella_phage	100.0	1.5e-40
WP_000235786.1|45697_46075_+	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_001141901.1|46084_47302_+	hypothetical protein	NA	A0A077SL53	Escherichia_phage	99.8	1.9e-224
WP_000896801.1|47305_48034_+	hypothetical protein	NA	A0A077SK19	Escherichia_phage	100.0	9.3e-139
WP_060578241.1|48020_48806_+	hypothetical protein	NA	A0A1B0V7N6	Salmonella_phage	99.2	7.9e-144
WP_000212025.1|48807_49824_+	hypothetical protein	NA	Q1MVH7	Enterobacteria_phage	100.0	3.5e-192
WP_000535203.1|49816_50449_+	hypothetical protein	NA	A0A077SK50	Escherichia_phage	100.0	6.9e-90
WP_060578242.1|50495_51494_-	hypothetical protein	NA	A0A1B0VCH7	Salmonella_phage	97.6	3.4e-192
WP_001276599.1|51493_52858_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	100.0	2.1e-253
WP_000234831.1|53330_53495_-	DUF3927 family protein	NA	Q71T96	Escherichia_phage	100.0	7.6e-17
WP_000900640.1|53494_53920_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	100.0	1.8e-70
WP_000660972.1|55477_57742_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	68.5	0.0e+00
WP_000472529.1|57738_58644_-	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
WP_001177860.1|58636_58921_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	100.0	3.5e-49
WP_001569402.1|59383_60172_+	hypothetical protein	NA	Q71TL4	Escherichia_phage	100.0	1.0e-119
WP_000007765.1|60211_60634_+	hypothetical protein	NA	Q71TL5	Escherichia_phage	100.0	5.0e-60
WP_000336812.1|60659_60800_+	hypothetical protein	NA	Q71TL6	Escherichia_phage	100.0	6.3e-20
WP_001281115.1|60809_61202_+	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	97.7	7.6e-71
61176:61192	attR	GGTCTTCTTATCGAAAG	NA	NA	NA	NA
WP_001113742.1|61537_62422_+	RepB family plasmid replication initiator protein	NA	A0A077SLP3	Escherichia_phage	100.0	2.1e-161
WP_001154687.1|62714_63524_+	GIY-YIG nuclease family protein	NA	A0A077SK46	Escherichia_phage	97.8	7.1e-156
WP_001285362.1|63692_64889_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_000038866.1|64905_65907_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
WP_023153705.1|66133_67840_+	hypothetical protein	NA	Q1MVJ5	Enterobacteria_phage	94.4	4.7e-311
WP_000085137.1|67900_69490_+	hypothetical protein	NA	Q71TB2	Escherichia_phage	98.9	2.9e-302
WP_000041757.1|69499_70315_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.3	2.6e-113
WP_000035302.1|70350_70932_+	hypothetical protein	NA	A0A077SL48	Escherichia_phage	100.0	4.5e-104
WP_000509939.1|70943_71453_+	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
WP_000268409.1|71624_72221_+	hypothetical protein	NA	A0A077SLI4	Escherichia_phage	99.5	5.3e-108
WP_001426344.1|72403_72649_-	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	45.0	3.5e-13
WP_024188253.1|72699_73545_-	hypothetical protein	NA	Q1MVK3	Enterobacteria_phage	98.2	9.4e-151
WP_001187875.1|73574_74375_-	protein kilA	NA	Q1MVK4	Enterobacteria_phage	100.0	1.9e-148
WP_023154138.1|74539_75583_-	phage antirepressor protein	NA	Q71TN2	Escherichia_phage	97.7	1.9e-185
WP_000245712.1|75579_75801_-	host cell division inhibitor Icd-like protein	NA	A0A077SLM6	Escherichia_phage	100.0	1.3e-38
WP_000908460.1|76381_76699_+	hypothetical protein	NA	Q71TC5	Escherichia_phage	100.0	2.9e-28
WP_024166536.1|76706_77486_+	hypothetical protein	NA	Q71TC6	Escherichia_phage	96.1	9.3e-145
WP_023153778.1|77733_78300_+	hypothetical protein	NA	Q1MVL0	Enterobacteria_phage	99.5	1.1e-99
WP_000523980.1|78310_78922_+	hypothetical protein	NA	Q71TN8	Escherichia_phage	99.5	2.9e-109
WP_000926342.1|78936_79818_+	hypothetical protein	NA	Q71TC9	Escherichia_phage	98.6	2.7e-172
WP_089477381.1|79899_83595_+	transglycosylase SLT domain-containing protein	NA	A0A1B0VDM8	Salmonella_phage	85.8	0.0e+00
WP_000002800.1|83594_83951_+	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_000047924.1|83947_85381_+	bleomycin hydrolase	NA	A0A1B0VAD6	Salmonella_phage	99.8	1.1e-271
WP_001189832.1|85380_86217_+	hypothetical protein	NA	A0A1B0V7F2	Salmonella_phage	100.0	1.4e-154
WP_001286325.1|86295_86730_+	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	99.3	7.4e-75
WP_105375182.1|86741_89666_+|tail	phage tail protein	tail	A0A1B0V7G4	Salmonella_phage	44.7	3.8e-13
WP_023156927.1|89676_90105_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	54.9	1.3e-39
WP_071961623.1|90115_90574_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.4	1.4e-44
WP_000367942.1|90573_91185_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	78.6	3.6e-83
WP_072196854.1|91190_91688_-|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	57.3	2.9e-43
>prophage 1
NZ_CP027129	Escherichia coli strain AR_0372 plasmid unnamed5	5193	1447	4700	5193	tail,holin	Escherichia_phage(66.67%)	6	NA	NA
WP_064764636.1|1447_1924_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	59.4	2.4e-47
WP_001165547.1|1995_2568_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.0	4.4e-83
WP_000145199.1|3003_3267_+	hypothetical protein	NA	Q71TD9	Escherichia_phage	67.1	1.1e-22
WP_000887652.1|3341_3671_+|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_000580776.1|3667_4111_+	hypothetical protein	NA	A0A077SK09	Escherichia_phage	100.0	1.3e-82
WP_001345482.1|4097_4700_+	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
