The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019980	Lysinibacillus sphaericus strain DSM 28 chromosome, complete genome	4681723	34317	46646	4681723		Enterococcus_phage(28.57%)	11	NA	NA
WP_024362948.1|34317_35226_-	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	51.7	4.6e-10
WP_029747256.1|35386_35917_-	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	38.0	5.2e-22
WP_024362947.1|36117_36786_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	35.8	1.1e-24
WP_024362946.1|36782_37421_-	deoxynucleoside kinase	NA	A0A1G5SAJ8	Enterococcus_phage	22.9	3.2e-10
WP_024362945.1|37802_40214_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	40.3	2.7e-126
WP_024362944.1|40295_40502_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_024362943.1|40559_40892_-	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_024362942.1|40968_41919_-	cation transporter	NA	NA	NA	NA	NA
WP_024362941.1|41950_42286_-	winged helix-turn-helix transcriptional regulator	NA	A0A218MNF3	uncultured_virus	39.7	4.7e-05
WP_036205262.1|42455_42941_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_024362939.1|43133_46646_+	peptidase S8	NA	A0A1B0T6A2	Bacillus_phage	36.9	1.8e-49
>prophage 2
NZ_CP019980	Lysinibacillus sphaericus strain DSM 28 chromosome, complete genome	4681723	595119	603664	4681723		Bacillus_virus(42.86%)	9	NA	NA
WP_024363972.1|595119_595836_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	77.0	9.1e-46
WP_024363973.1|596148_597123_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	51.5	6.9e-89
WP_024363974.1|597198_597951_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_024363975.1|597947_598679_-	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.5	4.8e-18
WP_024363976.1|598798_599299_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	48.7	3.2e-21
WP_024363977.1|599392_600688_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	40.3	2.8e-69
WP_024363978.1|600701_601043_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_024363979.1|601354_602824_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	46.1	7.2e-114
WP_024363980.1|602839_603664_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.2	5.9e-73
>prophage 3
NZ_CP019980	Lysinibacillus sphaericus strain DSM 28 chromosome, complete genome	4681723	627620	636126	4681723		Synechococcus_phage(50.0%)	8	NA	NA
WP_024364456.1|627620_628916_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	24.6	1.1e-17
WP_024364457.1|629044_629755_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HWF9	Synechococcus_phage	41.5	6.9e-46
WP_024364458.1|629757_630006_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_024364459.1|630008_630692_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_024364460.1|630678_632913_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	43.1	1.6e-157
WP_024364461.1|632888_634313_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	5.8e-52
WP_024364462.1|634501_635557_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	43.3	2.5e-60
WP_024364463.1|635556_636126_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.0	6.2e-21
>prophage 4
NZ_CP019980	Lysinibacillus sphaericus strain DSM 28 chromosome, complete genome	4681723	885869	948793	4681723	tail,integrase,coat,portal,head,plate,capsid,terminase,protease,holin	Bacillus_phage(23.08%)	79	912968:912983	948035:948050
WP_024363905.1|885869_886484_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_024363906.1|886641_887223_+	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	37.9	3.3e-22
WP_024363907.1|887222_887981_+	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_024363909.1|888208_890485_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_024363910.1|890651_890879_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_024363911.1|891617_892646_+	central glycolytic genes regulator	NA	NA	NA	NA	NA
WP_024363912.1|892683_893700_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_024363913.1|894121_895306_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_024363914.1|895361_896123_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_024363915.1|896115_897657_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_024363916.1|897659_898952_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	70.1	5.8e-168
WP_024363917.1|899210_899438_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_024363918.1|899642_900389_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_024363919.1|900426_902874_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	37.9	4.9e-83
WP_024363920.1|902935_903403_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	56.9	1.5e-44
WP_024363921.1|903672_904212_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_024363922.1|904192_905557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024364786.1|906226_907309_-|integrase	site-specific integrase	integrase	H0UST3	Bacillus_phage	53.4	5.3e-98
WP_105928943.1|907390_907768_-	ImmA/IrrE family metallo-endopeptidase	NA	D2XR38	Bacillus_phage	50.0	2.5e-26
WP_024364784.1|907860_908316_-	helix-turn-helix transcriptional regulator	NA	A0A0S2SXM8	Bacillus_phage	65.2	5.4e-44
WP_024364783.1|908493_908739_+	hypothetical protein	NA	A0A0S2SXX9	Bacillus_phage	83.5	2.5e-32
WP_024364782.1|908791_908980_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_158694843.1|909198_909342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024364781.1|909338_909575_+	hypothetical protein	NA	A0A2H4J246	uncultured_Caudovirales_phage	61.5	3.1e-11
WP_024364780.1|909571_909796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024364779.1|909814_910075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024364778.1|910086_910344_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	72.0	4.3e-14
WP_105928886.1|910616_910775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024364776.1|910860_911331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024364775.1|911327_912503_+	DUF2800 domain-containing protein	NA	H7BVP9	unidentified_phage	50.5	2.8e-100
WP_024364774.1|912529_913342_+	DUF2815 family protein	NA	I1TLG4	Bacillus_phage	39.6	1.1e-26
912968:912983	attL	GCAGGTAAAAAGGGTG	NA	NA	NA	NA
WP_024364773.1|913341_915309_+	DNA polymerase	NA	H7BVQ1	unidentified_phage	58.3	7.2e-218
WP_024364772.1|915321_915747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024364771.1|915765_918180_+	virulence-associated protein E	NA	A0A1S7FZ15	Listeria_phage	42.7	6.6e-189
WP_024364770.1|918493_918769_+	VRR-NUC domain-containing protein	NA	A0A1B0RXC4	Streptococcus_phage	44.4	4.9e-16
WP_024364769.1|918771_920148_+	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	54.3	3.0e-146
WP_024364768.1|920161_920692_+	hypothetical protein	NA	S5MNT8	Brevibacillus_phage	32.0	3.2e-11
WP_024364767.1|920913_921834_+	DUF4868 domain-containing protein	NA	Q24LC1	Clostridium_phage	47.1	2.3e-65
WP_024364766.1|921852_922410_+	hypothetical protein	NA	A0A1Q1PW40	Staphylococcus_phage	26.2	1.8e-12
WP_024364765.1|922492_922882_+	hypothetical protein	NA	U3PD10	Staphylococcus_phage	40.7	7.0e-08
WP_024364764.1|922966_923428_+|terminase	P27 family phage terminase small subunit	terminase	A0A0A7RUQ4	Clostridium_phage	64.2	2.1e-48
WP_105928887.1|923424_925104_+|terminase	terminase	terminase	A0A0A7RUM0	Clostridium_phage	43.3	4.3e-123
WP_105928888.1|925116_926370_+|portal	phage portal protein	portal	U3PFW0	Lactobacillus_phage	48.7	3.9e-100
WP_024360935.1|926359_926965_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4J861	uncultured_Caudovirales_phage	68.5	1.3e-64
WP_024360936.1|926966_928136_+|capsid	phage major capsid protein	capsid	F7V9A6	Lactobacillus_virus	50.6	5.0e-102
WP_158694844.1|928174_928330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024360937.1|928319_928610_+|head,tail	phage gp6-like head-tail connector protein	head,tail	F7V9A8	Lactobacillus_virus	38.9	1.4e-08
WP_024360938.1|928619_928949_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_024360939.1|928945_929374_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_105928889.1|929370_929868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105928890.1|929871_930930_+|tail	phage tail sheath protein	tail	A0A0A7S0D2	Clostridium_phage	44.5	4.6e-70
WP_105928891.1|930944_931379_+|tail	phage tail tube protein	tail	A0A0A8WF55	Clostridium_phage	41.0	7.7e-16
WP_105928892.1|931403_931799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105928894.1|932008_934132_+	hypothetical protein	NA	A0A0S2SXL7	Bacillus_phage	44.8	4.0e-73
WP_024364819.1|934145_934568_+	hypothetical protein	NA	A0A0N7ACL7	Bacillus_phage	27.2	4.6e-05
WP_137034887.1|934564_935545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024364821.1|935546_935906_+	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
WP_051147789.1|935905_936352_+	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_024364678.1|936352_937393_+|plate	baseplate J/gp47 family protein	plate	A0A0A7RUN3	Clostridium_phage	35.2	1.0e-50
WP_024364677.1|937389_937737_+	hypothetical protein	NA	A0A1B1INQ1	uncultured_Mediterranean_phage	34.2	2.0e-06
WP_024364676.1|937747_938566_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_024364675.1|938565_938898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024364935.1|938898_939504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024364936.1|939500_939725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158694845.1|939726_939888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024364937.1|939968_940268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024364938.1|940339_940654_+	hypothetical protein	NA	A0A0S2GM64	Bacillus_phage	41.3	1.7e-12
WP_024364939.1|940643_940904_+|holin	phage holin	holin	A0A1Q1PW49	Staphylococcus_phage	54.7	2.4e-20
WP_024364940.1|940900_941569_+	M15 family metallopeptidase	NA	A0A2D1GQ84	Lysinibacillus_phage	53.4	2.5e-58
WP_024364941.1|941613_942075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024364942.1|942094_942616_-	SHOCT domain-containing protein	NA	Q4ZA70	Staphylococcus_virus	28.2	6.0e-07
WP_024364943.1|942709_943201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024364944.1|943218_943431_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_158694846.1|943603_943780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024364945.1|943801_944692_+	helix-turn-helix domain-containing protein	NA	A0A288WFZ2	Bacillus_phage	27.1	6.1e-07
WP_158694847.1|944706_944874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024364166.1|945188_946352_-|integrase	site-specific integrase	integrase	A5GYP9	Lactococcus_phage	35.9	4.6e-55
WP_024364167.1|946783_947098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029747390.1|947482_948793_+	DNA (cytosine-5-)-methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	43.2	3.0e-79
948035:948050	attR	GCAGGTAAAAAGGGTG	NA	NA	NA	NA
>prophage 5
NZ_CP019980	Lysinibacillus sphaericus strain DSM 28 chromosome, complete genome	4681723	2103716	2149274	4681723	tail,integrase,coat,portal,head,terminase,holin	uncultured_Caudovirales_phage(17.65%)	62	2099515:2099536	2134018:2134039
2099515:2099536	attL	TTCAACAATCGGGCCAGATTGT	NA	NA	NA	NA
WP_024364754.1|2103716_2104133_+|holin	phage holin family protein	holin	S6AVT9	Thermus_phage	55.9	2.1e-31
WP_024364753.1|2104129_2104819_+	M15 family metallopeptidase	NA	A0A2D1GQ84	Lysinibacillus_phage	47.2	2.0e-50
WP_029747467.1|2104948_2105137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024364750.1|2107125_2108274_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	37.9	5.3e-56
WP_024364749.1|2108332_2108824_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	41.9	2.9e-27
WP_024364748.1|2108880_2109615_-	phage Gp37/Gp68 family protein	NA	A0A088F7U1	Mycobacterium_phage	46.0	7.6e-56
WP_024364747.1|2109662_2110835_-	three-Cys-motif partner protein TcmP	NA	NA	NA	NA	NA
WP_024364746.1|2111046_2112150_-	endonuclease	NA	A0A1S5SAB0	Streptococcus_phage	50.5	3.4e-100
WP_024364745.1|2112278_2112641_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	52.5	2.1e-19
WP_024364744.1|2112750_2113122_-	helix-turn-helix transcriptional regulator	NA	A0A1L2BY72	Clostridium_phage	39.0	1.3e-08
WP_024364743.1|2113211_2113574_-	helix-turn-helix transcriptional regulator	NA	O03970	Lactobacillus_phage	52.1	2.8e-11
WP_024364742.1|2113734_2113929_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024364741.1|2114069_2114801_+	hypothetical protein	NA	A0A2I7SCV5	Paenibacillus_phage	60.4	2.2e-39
WP_105928949.1|2114843_2115161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024364739.1|2115273_2115540_+	helix-turn-helix transcriptional regulator	NA	S5MNZ7	Brevibacillus_phage	50.7	8.4e-13
WP_024364738.1|2115527_2115755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024364736.1|2116142_2116367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024364735.1|2116436_2117366_+	hypothetical protein	NA	A0A0A7RWR9	Clostridium_phage	46.7	6.2e-79
WP_024364734.1|2117368_2118175_+	DNA recombination protein RecT	NA	S6AVW6	Thermus_phage	48.4	6.2e-59
WP_024364733.1|2118384_2118789_-	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_024364732.1|2118915_2119731_+	DnaD domain protein	NA	A0A1C8E9B4	Bacillus_phage	64.3	8.5e-32
WP_051147793.1|2119660_2120497_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	42.9	1.6e-49
WP_024364731.1|2120531_2120867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024364730.1|2120935_2121127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024364729.1|2121119_2121344_+	hypothetical protein	NA	A0A2D1GQB9	Lysinibacillus_phage	58.0	1.2e-12
WP_024364728.1|2121325_2121514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024364727.1|2121756_2122176_-	DUF3888 domain-containing protein	NA	NA	NA	NA	NA
WP_024364726.1|2122294_2122531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024364725.1|2122614_2122806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024364724.1|2122944_2123382_+	hypothetical protein	NA	A0A2P1JTX0	Anoxybacillus_phage	28.6	3.7e-10
WP_024364723.1|2123564_2125094_+	caspase family protein	NA	NA	NA	NA	NA
WP_162832726.1|2125537_2125705_-	hypothetical protein	NA	A0A2H4J2N9	uncultured_Caudovirales_phage	60.0	2.1e-09
WP_024364722.1|2125918_2126656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024364721.1|2126822_2127005_+	sporulation protein Cse60	NA	NA	NA	NA	NA
WP_024364720.1|2127078_2127402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024364719.1|2127432_2127963_+	ParB N-terminal domain-containing protein	NA	A0A1B1P7B5	Bacillus_phage	50.6	4.1e-43
WP_024364718.1|2127959_2128985_+	DNA cytosine methyltransferase	NA	A0A1B1P7C6	Bacillus_phage	65.5	3.1e-132
WP_024364717.1|2129116_2129350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024364716.1|2129395_2130244_+	hypothetical protein	NA	C9E2I6	Enterococcus_phage	34.8	6.8e-24
WP_029747456.1|2130243_2131452_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4J8B0	uncultured_Caudovirales_phage	70.5	3.6e-172
WP_024364714.1|2131464_2132868_+|portal	phage portal protein	portal	A0A2H4J4Q7	uncultured_Caudovirales_phage	52.6	1.0e-133
WP_024364713.1|2132864_2133875_+|head	phage minor head protein	head	A0A1Q1PVS0	Bacillus_phage	41.1	9.2e-52
WP_024364712.1|2134096_2134552_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
2134018:2134039	attR	TTCAACAATCGGGCCAGATTGT	NA	NA	NA	NA
WP_024364711.1|2134836_2135361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024364710.1|2135541_2136027_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_024364709.1|2136192_2136564_-	helix-turn-helix transcriptional regulator	NA	A0A290GJU0	Caldibacillus_phage	43.6	5.4e-18
WP_024364708.1|2136756_2136966_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024364707.1|2136962_2137745_+	hypothetical protein	NA	A0A0N7BS22	Escherichia_phage	37.8	1.1e-12
WP_024364706.1|2137891_2138179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024364705.1|2138462_2139983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051147792.1|2140276_2140942_+	DUF4355 domain-containing protein	NA	A0A1L2K2N1	Aeribacillus_phage	53.0	2.1e-52
WP_024364703.1|2140971_2141838_+|coat	coat protein	coat	A0A1L2JY55	Aeribacillus_phage	73.7	1.2e-121
WP_158694854.1|2141852_2142005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024364702.1|2142014_2142341_+	hypothetical protein	NA	A0A2H4JHC4	uncultured_Caudovirales_phage	33.3	3.4e-08
WP_024364701.1|2142327_2142651_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_024364700.1|2142650_2143076_+	HK97 gp10 family phage protein	NA	Q4ZCE4	Staphylococcus_virus	44.4	6.6e-28
WP_024364699.1|2143072_2143516_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_080653402.1|2143876_2144338_+	Ig-like domain-containing protein	NA	B8QTT6	Erwinia_phage	54.7	5.5e-12
WP_024364697.1|2144398_2144869_+	hypothetical protein	NA	Q4ZBQ7	Staphylococcus_phage	34.3	3.4e-17
WP_051147791.1|2144919_2145213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137034892.1|2145218_2148362_+	hypothetical protein	NA	Q4ZC60	Staphylococcus_virus	26.1	5.6e-47
WP_024364694.1|2148365_2149274_+|tail	phage tail family protein	tail	A0A0U4B037	Exiguobacterium_phage	31.7	2.0e-26
>prophage 6
NZ_CP019980	Lysinibacillus sphaericus strain DSM 28 chromosome, complete genome	4681723	4308988	4358764	4681723	tail,transposase,integrase,portal,head,plate,capsid,terminase,protease,holin	uncultured_Caudovirales_phage(23.53%)	62	4321533:4321592	4358922:4359060
WP_105928880.1|4308988_4310138_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	64.5	1.1e-40
WP_024364655.1|4310408_4310966_-	superoxide dismutase family protein	NA	A0A0D3QVZ9	Lymantria_dispar_multicapsid_nuclear_polyhedrosis_virus	38.3	1.7e-15
WP_024364657.1|4311935_4312727_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A217ER34	Bacillus_phage	68.0	3.7e-32
WP_024364658.1|4313273_4314401_+	response regulator	NA	NA	NA	NA	NA
WP_024364659.1|4314453_4315470_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.9	3.9e-18
WP_024364660.1|4315774_4318798_+	response regulator	NA	Q9EYF3	Enterobacteria_phage	31.3	8.4e-16
WP_024364661.1|4318905_4319346_-	DUF2269 family protein	NA	NA	NA	NA	NA
WP_024364662.1|4319527_4320160_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_024364663.1|4320255_4320762_+	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_024364664.1|4320814_4321153_-	phnA family protein	NA	NA	NA	NA	NA
4321533:4321592	attL	TTTGAGGAGTGGTGGTTTAAAACTTTCTATAATAACTACGGCATACGCGGCTTTTAACTT	NA	NA	NA	NA
WP_158694867.1|4321722_4321890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024364665.1|4322025_4322913_-	helix-turn-helix domain-containing protein	NA	A0A288WFZ2	Bacillus_phage	24.8	6.7e-06
WP_024364666.1|4323089_4323299_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024364667.1|4323396_4323918_+	SHOCT domain-containing protein	NA	Q4ZA70	Staphylococcus_virus	27.0	1.8e-06
WP_024364668.1|4324074_4324629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024364669.1|4324672_4325416_-	hypothetical protein	NA	A0A1L2JY70	Aeribacillus_phage	44.5	6.5e-47
WP_024364670.1|4325415_4325676_-|holin	phage holin	holin	A0A1Q1PW49	Staphylococcus_phage	51.2	2.0e-19
WP_024364671.1|4325665_4325935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024364672.1|4326005_4326188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024364673.1|4326200_4326476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024364674.1|4326488_4327319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024364934.1|4327318_4327651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024364933.1|4327650_4328469_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_024364932.1|4328479_4328827_-	hypothetical protein	NA	A0A1B1INQ1	uncultured_Mediterranean_phage	35.1	9.0e-07
WP_024364931.1|4328823_4329864_-|plate	baseplate J/gp47 family protein	plate	A0A0A7RUN3	Clostridium_phage	34.9	4.0e-50
WP_051147789.1|4329864_4330311_-	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_024364928.1|4330310_4330670_-	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
WP_137034886.1|4330670_4331651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024364930.1|4331647_4332070_-	hypothetical protein	NA	A0A0N7ACL7	Bacillus_phage	28.1	2.7e-05
WP_105928930.1|4332083_4334207_-	hypothetical protein	NA	A0A0S2SXL7	Bacillus_phage	45.1	5.2e-73
WP_024364817.1|4334416_4334812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024364816.1|4334840_4335275_-|tail	phage tail tube protein	tail	A0A0A8WF55	Clostridium_phage	41.5	1.0e-15
WP_024364815.1|4335291_4336350_-|terminase	terminase	terminase	A0A0A7S0D2	Clostridium_phage	44.2	2.3e-69
WP_105928931.1|4336353_4336851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105928932.1|4336847_4337276_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_105928933.1|4337272_4337602_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_024360937.1|4337611_4337902_-|head,tail	phage gp6-like head-tail connector protein	head,tail	F7V9A8	Lactobacillus_virus	38.9	1.4e-08
WP_158694844.1|4337891_4338047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105928934.1|4338086_4339256_-|capsid	phage major capsid protein	capsid	F7V9A6	Lactobacillus_virus	50.6	6.6e-102
WP_024364822.1|4339257_4339863_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4J861	uncultured_Caudovirales_phage	71.5	6.9e-63
WP_105928935.1|4339852_4341106_-|portal	phage portal protein	portal	U3PFW0	Lactobacillus_phage	48.7	3.0e-100
WP_105928936.1|4341118_4342798_-|terminase	terminase	terminase	A0A0A7RUM0	Clostridium_phage	42.8	2.4e-121
WP_024360931.1|4342794_4343256_-|terminase	P27 family phage terminase small subunit	terminase	A0A0A7RUQ4	Clostridium_phage	64.7	3.3e-49
WP_105928937.1|4343340_4343736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024360929.1|4343797_4345087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080653266.1|4345656_4346091_-	hypothetical protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	57.6	1.4e-36
WP_024360927.1|4346444_4348316_-	DNA primase	NA	A0A060ADU2	Enterococcus_phage	29.0	1.8e-08
WP_024360926.1|4348558_4348921_-	hypothetical protein	NA	A0A2H4JBP0	uncultured_Caudovirales_phage	57.5	1.4e-31
WP_024360925.1|4348991_4350710_-	hypothetical protein	NA	A0A1B1P7M5	Bacillus_phage	31.8	3.8e-74
WP_024360924.1|4350711_4351509_-	DUF669 domain-containing protein	NA	E5KY11	Escherichia_phage	44.1	3.3e-20
WP_024360923.1|4351505_4352582_-	AAA family ATPase	NA	A0A1B0YEB5	Lactobacillus_phage	46.3	1.1e-58
WP_024360922.1|4352584_4353496_-	endonuclease	NA	A0A2H4JA52	uncultured_Caudovirales_phage	22.8	9.9e-05
WP_024360921.1|4353496_4353796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024360920.1|4353801_4355010_-	DEAD/DEAH box helicase	NA	A0A2H4J064	uncultured_Caudovirales_phage	30.5	3.3e-40
WP_024360919.1|4354999_4355296_-	VRR-NUC domain-containing protein	NA	A0A2H4J095	uncultured_Caudovirales_phage	51.3	3.8e-14
WP_024360918.1|4355524_4355788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024360917.1|4355788_4356019_-	hypothetical protein	NA	A0A2H4J246	uncultured_Caudovirales_phage	61.5	4.0e-11
WP_024360916.1|4356015_4356198_-	helix-turn-helix domain-containing protein	NA	U5P0W4	Brevibacillus_phage	48.2	1.2e-07
WP_024360915.1|4356215_4356431_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_080653265.1|4356615_4357017_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JDE4	uncultured_Caudovirales_phage	58.0	4.6e-15
WP_024360913.1|4357153_4357372_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024360912.1|4357570_4358764_+|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	41.6	7.0e-75
4358922:4359060	attR	TTTGAGGAGTGGTGGTTTAAAACTTTCTATAATAACTACGGCATACGCGGCTTTTAACTTTACCATTAGAGCCTCAAGGCTTCAAAGCGACTCACCCTTCTTTATTGGAGGGTGAGTTTTTTATGTAAAAAACAACGTT	NA	NA	NA	NA
>prophage 7
NZ_CP019980	Lysinibacillus sphaericus strain DSM 28 chromosome, complete genome	4681723	4566217	4613149	4681723	tRNA,integrase,portal,plate,capsid,terminase	uncultured_Caudovirales_phage(27.91%)	78	4567733:4567751	4610059:4610077
WP_024362690.1|4566217_4567711_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	39.3	3.9e-91
4567733:4567751	attL	TGTCCGCGTTTACGTCCAT	NA	NA	NA	NA
WP_024362689.1|4567964_4568615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024362688.1|4568675_4568954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024362687.1|4568934_4569303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024362686.1|4569295_4569634_-	YolD-like family protein	NA	A0A2H4JAP8	uncultured_Caudovirales_phage	35.9	6.2e-05
WP_024362685.1|4569652_4569922_-	hypothetical protein	NA	A0A2I7SCS8	Paenibacillus_phage	43.2	1.2e-11
WP_024362684.1|4570041_4570725_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A2H4IZS3	uncultured_Caudovirales_phage	85.8	8.3e-81
WP_158694870.1|4570721_4571126_-	hypothetical protein	NA	A0A2K5B2A2	Erysipelothrix_phage	32.6	5.0e-09
WP_158694871.1|4571258_4571420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024362682.1|4571421_4571646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024362681.1|4571642_4572248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024362680.1|4572248_4572572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024362679.1|4572587_4573229_-	DUF2612 domain-containing protein	NA	A0A1L2JZ80	Aeribacillus_phage	50.2	3.6e-54
WP_029747236.1|4573221_4574403_-|plate	baseplate J/gp47 family protein	plate	E5DV64	Deep-sea_thermophilic_phage	49.1	1.4e-96
WP_024362677.1|4574389_4574743_-	hypothetical protein	NA	A0A2H4J4S8	uncultured_Caudovirales_phage	36.2	6.1e-11
WP_024362676.1|4574742_4575207_-	hypothetical protein	NA	A0A1L2JY64	Aeribacillus_phage	30.7	7.3e-12
WP_024362675.1|4575203_4576004_-	hypothetical protein	NA	E5DV61	Deep-sea_thermophilic_phage	45.6	8.6e-61
WP_024362674.1|4575996_4576320_-	hypothetical protein	NA	E5DV60	Deep-sea_thermophilic_phage	53.1	1.6e-21
WP_024362673.1|4576322_4576919_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2H4JD33	uncultured_Caudovirales_phage	38.9	2.1e-27
WP_024362672.1|4576922_4579058_-	hypothetical protein	NA	A0A2P1JUK2	Bacillus_phage	29.9	3.7e-26
WP_162832717.1|4579054_4579192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137034875.1|4579238_4579523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024362670.1|4579623_4580028_-	hypothetical protein	NA	A0A1L2K2P1	Aeribacillus_phage	50.0	4.1e-27
WP_024362669.1|4580041_4581052_-	DUF3383 family protein	NA	A0A2H4J8B9	uncultured_Caudovirales_phage	50.6	1.1e-81
WP_024362668.1|4581051_4581558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024362667.1|4581550_4581898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024362666.1|4581894_4582404_-	hypothetical protein	NA	A0A2H4J4S5	uncultured_Caudovirales_phage	49.1	1.2e-39
WP_024362665.1|4582407_4582752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024362664.1|4582705_4583011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024362663.1|4583067_4583988_-|capsid	phage major capsid protein	capsid	A0A2H4JCG0	uncultured_Caudovirales_phage	62.0	3.3e-101
WP_024362662.1|4584072_4584663_-	DUF4355 domain-containing protein	NA	A0A1L2K2N1	Aeribacillus_phage	38.8	2.4e-12
WP_051147738.1|4584802_4585711_-	hypothetical protein	NA	E5DV54	Deep-sea_thermophilic_phage	40.8	6.3e-52
WP_024362660.1|4585646_4587083_-|portal	phage portal protein	portal	A0A2H4J4Q7	uncultured_Caudovirales_phage	53.9	3.0e-133
WP_036205164.1|4587093_4588260_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4J8B0	uncultured_Caudovirales_phage	75.6	6.0e-180
WP_024362658.1|4588292_4589081_-	hypothetical protein	NA	A0A2H4J4R0	uncultured_Caudovirales_phage	36.8	2.4e-31
WP_024362657.1|4589391_4589679_-	DUF2829 domain-containing protein	NA	A0A1X9HVT2	Ruegeria_phage	50.0	5.5e-18
WP_024362656.1|4590599_4591370_-	hypothetical protein	NA	A0A0A7S0U2	Clostridium_phage	29.0	3.6e-16
WP_051147737.1|4591371_4591665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024362655.1|4591648_4592785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024362654.1|4592921_4593335_-	hypothetical protein	NA	A0A290FZR5	Caldibacillus_phage	48.4	9.3e-27
WP_024362653.1|4593635_4593848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024362652.1|4594042_4594297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024362651.1|4594281_4594704_-	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	51.1	7.5e-32
WP_024362650.1|4594700_4595351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024362649.1|4595428_4595668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024362647.1|4595903_4596413_-	single-stranded DNA-binding protein	NA	A0A059T5E0	Listeria_phage	51.7	7.4e-42
WP_024362646.1|4596409_4596685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024362645.1|4596681_4596978_-	hypothetical protein	NA	R4JMS5	Bacillus_phage	55.7	1.6e-17
WP_024362644.1|4597057_4597246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137034874.1|4597238_4597667_-	hypothetical protein	NA	A0A2H4J6U7	uncultured_Caudovirales_phage	33.5	4.6e-05
WP_024362642.1|4597670_4598228_-	hypothetical protein	NA	A0A0A7AR03	Bacillus_phage	55.2	6.2e-10
WP_024362641.1|4598244_4598430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080653322.1|4598465_4599284_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	43.9	5.2e-45
WP_024362639.1|4599219_4600011_-	DnaD domain protein	NA	A0A1C8E9B4	Bacillus_phage	60.8	1.9e-28
WP_024362638.1|4600026_4600395_-	hypothetical protein	NA	A0A2H4J4P5	uncultured_Caudovirales_phage	48.8	2.5e-15
WP_024362637.1|4600444_4600972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024362636.1|4601027_4601231_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_105928940.1|4601406_4602225_-	recombinase RecT	NA	S6AVW6	Thermus_phage	45.3	1.5e-52
WP_024362634.1|4602221_4602401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029747222.1|4602403_4603345_-	hypothetical protein	NA	A8ATY5	Listeria_phage	50.8	3.0e-81
WP_024362632.1|4603414_4603693_-	hypothetical protein	NA	A0A2D1GQ57	Lysinibacillus_phage	57.7	9.3e-15
WP_024362631.1|4603704_4604010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024362630.1|4604296_4604548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024362629.1|4604544_4605063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024362628.1|4605229_4605526_-	hypothetical protein	NA	A0A0B5CYM2	Listeria_phage	45.9	2.8e-09
WP_024362627.1|4605548_4605788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036205146.1|4605787_4606543_-	Rha family transcriptional regulator	NA	A0A2I7SDG8	Paenibacillus_phage	44.6	1.4e-44
WP_024362625.1|4606613_4606859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024362624.1|4606909_4607215_+	hypothetical protein	NA	S6B1N1	Thermus_phage	39.4	2.4e-11
WP_158694872.1|4607195_4607360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024362623.1|4607411_4607633_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024362622.1|4607797_4608262_+	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	38.2	3.0e-18
WP_024362621.1|4608287_4608728_+	ImmA/IrrE family metallo-endopeptidase	NA	S6B1N5	Thermus_phage	47.5	8.9e-28
WP_024362620.1|4608772_4609972_+|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	42.9	2.9e-81
WP_024362619.1|4610261_4611302_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
4610059:4610077	attR	TGTCCGCGTTTACGTCCAT	NA	NA	NA	NA
WP_024362618.1|4611408_4611930_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_024362617.1|4611929_4612295_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_024362616.1|4612294_4613149_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	30.8	3.1e-24
