The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020089	Enterobacter cloacae strain PIMB10EC27 chromosome, complete genome	5272177	613679	646776	5272177	tRNA,integrase,capsid,transposase	Escherichia_phage(80.0%)	38	615340:615376	629022:629058
WP_058678887.1|613679_614438_+|tRNA	tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE	tRNA	NA	NA	NA	NA
WP_058678886.1|614468_615191_+	hypothetical protein	NA	NA	NA	NA	NA
615340:615376	attL	ACCGTAGAAATACGTGCCGGTTCGAGTCCGGCCTTCG	NA	NA	NA	NA
WP_029497222.1|615924_616293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058678885.1|616887_617496_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_159066724.1|619461_619617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100160586.1|619853_620456_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080347057.1|621019_621256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058678882.1|621245_621587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058678881.1|622144_622372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058678880.1|622376_622754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058678879.1|622772_623810_+|capsid	major capsid protein E	capsid	NA	NA	NA	NA
WP_045615232.1|623936_624131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058678878.1|624130_625996_+	hypothetical protein	NA	A0A291LB80	Escherichia_phage	29.5	7.6e-36
WP_105826554.1|625996_626674_+	hypothetical protein	NA	A0A1D7XFF4	Escherichia_phage	73.0	5.7e-74
WP_040117157.1|626707_627379_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_040118269.1|627671_628898_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_058679617.1|629061_629934_-	HNH endonuclease	NA	NA	NA	NA	NA
629022:629058	attR	ACCGTAGAAATACGTGCCGGTTCGAGTCCGGCCTTCG	NA	NA	NA	NA
WP_159066725.1|630956_631097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058679615.1|631226_632432_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	68.8	1.5e-162
WP_006797589.1|632428_633406_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.1	5.0e-87
WP_105826555.1|633561_634266_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	6.9e-139
WP_001752509.1|634520_635021_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_016947617.1|635337_636318_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_000780222.1|636595_636877_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_000493286.1|636857_637187_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2I6TCA4	Escherichia_phage	43.1	3.1e-17
WP_001166628.1|637389_637845_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294653.1|637916_638312_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000732275.1|638327_638603_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|638630_639056_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_058679484.1|639094_640780_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.9	5.1e-39
WP_058679485.1|640797_641163_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|641159_641396_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001446012.1|641379_641499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993245.1|641461_641674_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000118563.1|641682_642759_-	signal peptidase II	NA	NA	NA	NA	NA
WP_058679486.1|642755_645161_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	46.0	1.5e-140
WP_000405672.1|645246_645681_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000427623.1|645771_646776_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP020089	Enterobacter cloacae strain PIMB10EC27 chromosome, complete genome	5272177	1196582	1302320	5272177	tRNA,tail,terminase,portal,transposase,integrase,plate,head,protease,capsid	Enterobacteria_phage(41.46%)	104	1231092:1231114	1305807:1305829
WP_105826559.1|1196582_1197653_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_058679670.1|1198673_1199141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058679173.1|1200317_1201001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058679172.1|1201511_1202108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058679171.1|1202130_1202487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058679170.1|1202674_1204309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058679169.1|1204305_1205358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105578560.1|1205735_1206365_+	recombinase family protein	NA	NA	NA	NA	NA
WP_072205161.1|1206579_1206810_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	63.0	1.8e-16
WP_020686138.1|1207299_1207551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013095877.1|1207547_1207763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058679168.1|1207841_1209263_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_013095879.1|1209348_1209960_+	membrane protein	NA	NA	NA	NA	NA
WP_058679167.1|1210037_1211108_+	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	53.7	3.1e-90
WP_058679166.1|1211211_1214277_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	66.2	0.0e+00
WP_045292924.1|1214310_1215132_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_014830896.1|1215266_1215542_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_058679165.1|1215522_1217100_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_006176933.1|1217331_1217592_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_003859006.1|1217594_1217735_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_023620096.1|1217731_1218442_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_058679164.1|1218543_1220004_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.5	5.5e-13
WP_058679163.1|1219975_1220443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013095888.1|1220558_1221110_-	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_013095889.1|1221319_1221538_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_008499288.1|1221565_1221940_-	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
WP_013095890.1|1222452_1225599_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.5	6.8e-53
WP_023620093.1|1225621_1226815_-	multidrug efflux RND transporter periplasmic adaptor subunit AcrA	NA	NA	NA	NA	NA
WP_013095892.1|1226956_1227610_+	multidrug efflux transporter transcriptional repressor AcrR	NA	NA	NA	NA	NA
WP_038418817.1|1227723_1231071_+	mechanosensitive channel MscK	NA	NA	NA	NA	NA
WP_058679162.1|1231072_1231258_-	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
1231092:1231114	attL	GGGAGAGGGTTAGGGTGAGGGCA	NA	NA	NA	NA
WP_020685008.1|1231270_1231798_-	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_013095896.1|1231848_1232226_+	DUF454 family protein	NA	NA	NA	NA	NA
WP_000127359.1|1232377_1232929_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.9	1.6e-29
WP_058679161.1|1233017_1234946_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	42.9	6.0e-44
WP_003858972.1|1234999_1235332_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_013095898.1|1235331_1235937_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_058679160.1|1236047_1237922_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.9	1.6e-113
WP_006809841.1|1238117_1238762_+	adenylate kinase	NA	NA	NA	NA	NA
WP_013095900.1|1238886_1239849_+	ferrochelatase	NA	NA	NA	NA	NA
WP_020685011.1|1239911_1241216_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_040021505.1|1241306_1242983_-	Kef family K(+) transporter	NA	NA	NA	NA	NA
WP_013095903.1|1243211_1244432_-	MFS transporter	NA	NA	NA	NA	NA
WP_058679159.1|1244595_1246248_+	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_010428207.1|1246370_1246850_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_013095905.1|1247049_1247844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038982812.1|1247992_1250491_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	37.4	1.5e-111
WP_080396561.1|1250766_1250877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001575870.1|1250963_1251944_+|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	98.5	1.2e-184
WP_010428212.1|1252854_1253187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045346406.1|1253299_1253548_-	hypothetical protein	NA	Q858U4	Yersinia_virus	50.0	4.0e-09
WP_058678844.1|1253587_1254724_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	75.5	3.0e-160
WP_058678845.1|1254876_1256058_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	76.5	3.8e-174
WP_058678846.1|1256058_1256574_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	64.7	1.4e-59
WP_058678847.1|1256622_1256940_+|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	56.1	2.6e-21
WP_032424037.1|1256945_1257101_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	2.7e-11
WP_058678876.1|1257087_1260054_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	53.6	1.2e-261
WP_058678848.1|1260068_1260557_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	74.1	5.4e-66
WP_058678849.1|1260988_1261504_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	42.4	2.1e-12
WP_058678850.1|1263704_1264232_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	75.0	7.6e-74
WP_058678851.1|1264224_1265121_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	67.4	7.0e-104
WP_058678852.1|1265107_1265476_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	64.3	1.3e-35
WP_058678853.1|1265472_1266054_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	67.9	3.2e-73
WP_058678854.1|1266050_1266689_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	53.1	3.5e-57
WP_058678855.1|1266681_1267152_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	68.0	2.9e-61
WP_072189927.1|1267253_1267466_-	peptidase	NA	NA	NA	NA	NA
WP_058678856.1|1267362_1267800_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_058678857.1|1267796_1268342_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	41.7	1.2e-29
WP_058678858.1|1268325_1268628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058678859.1|1268618_1268819_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	75.4	3.7e-21
WP_058678860.1|1268818_1269343_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	53.5	1.4e-43
WP_058678861.1|1269441_1270299_-|terminase	terminase	terminase	B9A7B6	Serratia_phage	61.4	1.2e-68
WP_058651655.1|1270344_1271394_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	53.0	5.1e-106
WP_058678862.1|1271417_1272254_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	68.3	1.4e-101
WP_058678863.1|1272413_1274144_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	75.5	4.0e-265
WP_058678864.1|1274143_1275202_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.8	1.2e-142
WP_058678865.1|1275880_1278103_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_058678866.1|1278114_1279254_-	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	27.4	4.1e-16
WP_080396552.1|1279387_1281802_-	replication endonuclease	NA	F1BUS0	Erwinia_phage	40.7	3.9e-133
WP_058678867.1|1282011_1282998_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	46.8	2.2e-66
WP_155738256.1|1282990_1283158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127353156.1|1283238_1283520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045347041.1|1283733_1284069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045346978.1|1284317_1284617_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	59.6	8.5e-30
WP_045346979.1|1284686_1285709_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LA05	Escherichia_phage	50.2	4.9e-93
WP_013095907.1|1285795_1286206_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_020685017.1|1286202_1286655_-	NfeD family protein	NA	NA	NA	NA	NA
WP_008499312.1|1286651_1287566_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_013095909.1|1287728_1288400_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	35.7	1.7e-25
WP_013095910.1|1288392_1289175_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_013095911.1|1289223_1290078_-	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_013095912.1|1290136_1290907_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_013095913.1|1290935_1291559_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_013095914.1|1291529_1292216_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	2.2e-33
WP_038982818.1|1292212_1294627_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013095916.1|1294809_1295955_+	porin	NA	NA	NA	NA	NA
WP_058678868.1|1296038_1297109_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_013095918.1|1297204_1298272_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_058678869.1|1298268_1298778_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_020685024.1|1298938_1299124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045902393.1|1299189_1299399_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_023620084.1|1299539_1300262_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_020685026.1|1300265_1300760_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_058678870.1|1300934_1302320_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	1.1e-44
1305807:1305829	attR	GGGAGAGGGTTAGGGTGAGGGCA	NA	NA	NA	NA
>prophage 3
NZ_CP020089	Enterobacter cloacae strain PIMB10EC27 chromosome, complete genome	5272177	1774433	1866388	5272177	tRNA,tail,terminase,portal,integrase,holin,head,protease,capsid	Enterobacteria_phage(32.69%)	94	1768426:1768441	1827296:1827311
1768426:1768441	attL	GCGCTGATGCGTCCGC	NA	NA	NA	NA
WP_013097296.1|1774433_1775213_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_013097295.1|1775216_1776539_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_013097294.1|1776519_1777224_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_020689707.1|1777223_1781672_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_058679356.1|1781851_1783675_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_013097290.1|1783849_1784401_+	YcbK family protein	NA	NA	NA	NA	NA
WP_058679357.1|1784421_1785069_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_029882979.1|1785126_1786317_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_058679358.1|1786501_1787590_-	porin	NA	Q1MVN1	Enterobacteria_phage	53.1	1.0e-101
WP_029882977.1|1788971_1790372_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.2	1.1e-79
WP_058679235.1|1790537_1791740_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.6	4.9e-44
WP_058679236.1|1791924_1793217_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	95.8	1.7e-244
WP_058657756.1|1793261_1793519_-	excisionase family protein	NA	S4TND0	Salmonella_phage	91.2	1.4e-36
WP_058679237.1|1793502_1793889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058679238.1|1793876_1794626_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	88.0	4.8e-122
WP_042889584.1|1794671_1795499_-|protease	serine protease	protease	Q8W654	Enterobacteria_phage	85.1	2.2e-112
WP_032635101.1|1795495_1795690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032635102.1|1795689_1796097_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	47.1	1.2e-23
WP_058679239.1|1796286_1796697_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	88.3	9.5e-48
WP_058679240.1|1796677_1796881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044901833.1|1796996_1797383_-	S24 family peptidase	NA	F1C5A0	Cronobacter_phage	59.1	1.1e-37
WP_058679241.1|1797449_1797881_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023150198.1|1798082_1798781_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	62.5	3.0e-78
WP_024176468.1|1798893_1799118_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	59.7	1.3e-19
WP_058679242.1|1799143_1799440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058679243.1|1799436_1800348_+	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	59.2	4.5e-90
WP_058679244.1|1800363_1801242_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	61.8	8.2e-81
WP_058679245.1|1801238_1802618_+	AAA family ATPase	NA	Q8W640	Enterobacteria_phage	68.4	1.2e-174
WP_058679246.1|1802645_1803482_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	80.7	1.4e-122
WP_045407358.1|1803593_1804514_-	hypothetical protein	NA	A0A1B5FPA3	Escherichia_phage	72.9	1.7e-57
WP_001283165.1|1804658_1805045_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	93.8	7.3e-58
WP_065187067.1|1805031_1805313_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	46.2	1.7e-19
WP_023315880.1|1805312_1805855_+	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	73.2	5.2e-78
WP_058679247.1|1805851_1806121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072205166.1|1806130_1806751_+	hypothetical protein	NA	A0A1B0VMI8	Pseudomonas_phage	42.7	9.6e-44
WP_080339756.1|1807510_1808035_+	DUF1983 domain-containing protein	NA	G8C7Q4	Escherichia_phage	68.7	4.8e-52
WP_058679248.1|1808045_1808270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058679249.1|1808290_1809748_+	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	92.0	2.6e-273
WP_072205167.1|1809791_1810310_+	hypothetical protein	NA	K7PJS8	Enterobacterial_phage	53.8	1.7e-46
WP_058679250.1|1810290_1810881_+	hypothetical protein	NA	S4TR53	Salmonella_phage	80.5	1.9e-94
WP_072205168.1|1810880_1811231_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.9	1.6e-51
WP_058679251.1|1811388_1811862_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	98.1	6.6e-85
WP_058679252.1|1811861_1813598_+|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	98.8	0.0e+00
WP_058679253.1|1813597_1814902_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	92.9	6.8e-233
WP_058679254.1|1814915_1815764_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	91.4	2.0e-137
WP_058679255.1|1815773_1816985_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	86.5	1.5e-194
WP_058679256.1|1817027_1817354_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	86.1	1.2e-50
WP_045326823.1|1817350_1817695_+|head	phage head closure protein	head	Q7Y406	Yersinia_phage	54.5	9.4e-25
WP_058679257.1|1817675_1818065_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	57.4	1.9e-42
WP_058679258.1|1818061_1818466_+	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	72.7	2.2e-44
WP_045326819.1|1818498_1818954_+|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	78.1	8.9e-63
WP_045326818.1|1819018_1819381_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	53.4	4.0e-26
WP_058679259.1|1819619_1822949_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	66.6	0.0e+00
WP_058679260.1|1822951_1823290_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	75.9	4.6e-48
WP_058679261.1|1823286_1824042_+|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	94.8	1.5e-139
WP_058679262.1|1824043_1824754_+	peptidase P60	NA	K7PGV2	Enterobacterial_phage	97.9	2.2e-145
WP_058679263.1|1824782_1825130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058679264.1|1825156_1825747_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	84.7	1.7e-90
WP_058679265.1|1825800_1829631_+	DUF1983 domain-containing protein	NA	Q9MCR7	Enterobacteria_phage	83.5	0.0e+00
1827296:1827311	attR	GCGGACGCATCAGCGC	NA	NA	NA	NA
WP_058679266.1|1829635_1830601_+	hypothetical protein	NA	G1CSU0	Cronobacter_virus	40.5	9.7e-59
WP_105826562.1|1830661_1831999_+|tail	tail fiber domain-containing protein	tail	K7PGY2	Enterobacteria_phage	40.3	3.3e-65
WP_023292714.1|1832117_1832384_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	96.6	2.1e-40
WP_058651223.1|1832811_1835424_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.4	2.4e-19
WP_038985600.1|1835475_1836246_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	1.2e-30
WP_029883221.1|1836242_1837034_-	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_058651224.1|1837043_1838189_-	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_023619891.1|1838185_1839148_-	sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023619892.1|1839140_1839716_-	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_058651226.1|1839965_1840976_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_013097268.1|1841141_1841684_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_058678402.1|1841680_1842790_-	MOSC domain-containing protein	NA	V5UTY8	Synechococcus_phage	42.0	8.4e-06
WP_058678401.1|1842890_1844999_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_058678400.1|1845011_1846919_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	5.6e-50
WP_028027912.1|1846932_1848186_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_013097263.1|1848190_1849831_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_013097262.1|1849827_1850394_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_013097261.1|1850650_1850818_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227926.1|1850890_1851409_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_013097259.1|1851477_1853238_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_013097258.1|1853424_1853877_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_044158562.1|1853940_1854996_-	porin OmpA	NA	NA	NA	NA	NA
WP_013097256.1|1855350_1855860_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_013097255.1|1856077_1856704_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_058678399.1|1856660_1858823_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_013097253.1|1858842_1859289_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_057072035.1|1859411_1861466_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.1	1.6e-18
WP_013097251.1|1861549_1862008_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_023619904.1|1862088_1862751_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_020689684.1|1862922_1863339_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_013097248.1|1863372_1863690_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_013097247.1|1863750_1864941_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_058678398.1|1865033_1865315_+	acylphosphatase	NA	NA	NA	NA	NA
WP_013097245.1|1865311_1865641_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_013097244.1|1865728_1866388_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	8.9e-48
>prophage 4
NZ_CP020089	Enterobacter cloacae strain PIMB10EC27 chromosome, complete genome	5272177	3245365	3296530	5272177	lysis,tail,terminase,transposase,integrase,holin,head	Salmonella_phage(43.55%)	69	3288050:3288064	3305139:3305153
WP_029881831.1|3245365_3246532_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	86.0	1.1e-197
WP_058679660.1|3246874_3247264_-	hypothetical protein	NA	G8C7R9	Escherichia_phage	92.2	2.4e-64
WP_058679661.1|3247346_3247613_+	DinI family protein	NA	K7PKM2	Enterobacterial_phage	97.7	1.2e-40
WP_072205148.1|3249026_3252884_-|tail	phage tail protein	tail	H6WRW4	Salmonella_phage	85.5	0.0e+00
WP_058679064.1|3252893_3253427_-|tail	tail assembly protein	tail	H6WRW3	Salmonella_phage	67.6	1.0e-54
WP_058679066.1|3253369_3254089_-	C40 family peptidase	NA	A0A1V0E5M9	Salmonella_phage	81.9	4.3e-120
WP_058679063.1|3254088_3254793_-|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	96.6	4.3e-133
WP_058679062.1|3254829_3255177_-|tail	phage tail protein	tail	H6WRV8	Salmonella_phage	93.9	2.7e-59
WP_058679061.1|3255176_3258386_-	tape measure protein	NA	R9TMK1	Aeromonas_phage	44.7	1.5e-119
WP_058679060.1|3258442_3258757_-	hypothetical protein	NA	H6WRV4	Salmonella_phage	73.1	2.0e-37
WP_017384095.1|3258858_3259212_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	100.0	4.2e-60
WP_058679059.1|3259302_3259833_-	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	85.2	2.2e-81
WP_058679058.1|3260015_3260669_-	hypothetical protein	NA	I6R0Q2	Salmonella_phage	90.3	3.0e-112
WP_017384092.1|3260710_3261445_-	hypothetical protein	NA	A0A1V0E5P2	Salmonella_phage	87.2	2.2e-116
WP_058679057.1|3261460_3261847_-	hypothetical protein	NA	I6R9A6	Salmonella_phage	95.3	2.3e-64
WP_058679056.1|3261843_3262281_-	hypothetical protein	NA	A0A1V0E5P5	Salmonella_phage	97.9	7.4e-75
WP_058679055.1|3262288_3262651_-	hypothetical protein	NA	A0A1V0E5P3	Salmonella_phage	90.8	3.0e-61
WP_058679054.1|3262643_3262823_-	DUF551 domain-containing protein	NA	Q5G8X7	Enterobacteria_phage	96.6	1.6e-28
WP_058679053.1|3262822_3263224_-	hypothetical protein	NA	I6S619	Salmonella_phage	81.2	4.7e-60
WP_058679052.1|3263286_3263571_-	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	74.2	1.1e-31
WP_058679051.1|3263581_3264679_-	hypothetical protein	NA	G0ZND9	Cronobacter_phage	84.7	7.9e-182
WP_020838514.1|3264691_3265153_-	hypothetical protein	NA	G0ZND8	Cronobacter_phage	81.1	2.6e-62
WP_058679050.1|3265165_3266431_-	hypothetical protein	NA	H6WRT2	Salmonella_phage	94.5	7.8e-226
WP_058679049.1|3266434_3267364_-|head	phage head morphogenesis protein	head	H6WRT1	Salmonella_phage	83.5	4.5e-138
WP_058679048.1|3267317_3268670_-	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	77.1	2.1e-205
WP_058679047.1|3268867_3270121_-|terminase	terminase	terminase	I6RSK1	Salmonella_phage	97.0	1.2e-213
WP_045281509.1|3270117_3270552_-	hypothetical protein	NA	Q716H4	Shigella_phage	74.8	2.2e-47
WP_058679046.1|3270559_3270778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058679045.1|3270848_3271112_-	hypothetical protein	NA	A0A1V0E5Q1	Salmonella_phage	84.7	5.5e-33
WP_058679065.1|3271897_3272338_-|lysis	lysis protein	lysis	A0A2H4FNE5	Salmonella_phage	76.4	6.6e-55
WP_157843662.1|3272370_3272847_-	HNH endonuclease	NA	A0A0K1YA40	Cronobacter_phage	41.5	2.5e-23
WP_105826603.1|3272855_3273302_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	75.7	7.9e-56
WP_058679043.1|3273285_3273627_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	54.2	6.3e-29
WP_058679042.1|3273928_3274618_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.5	7.1e-56
WP_058679041.1|3274727_3275339_-	protein ninG	NA	M9NYX8	Enterobacteria_phage	51.2	3.4e-41
WP_058679040.1|3275331_3275502_-	NinE family protein	NA	G8C7V4	Escherichia_phage	85.7	2.6e-20
WP_032647533.1|3275494_3275944_-	recombination protein NinB	NA	I6R9D0	Salmonella_phage	47.2	2.5e-33
WP_125387033.1|3276190_3276433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058679039.1|3276429_3276795_-	DUF551 domain-containing protein	NA	A0A1V0E5M5	Salmonella_phage	41.7	7.7e-09
WP_080396558.1|3276791_3277052_-	hypothetical protein	NA	S4TNP2	Salmonella_phage	68.9	2.9e-10
WP_058679037.1|3277489_3277912_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	85.2	6.7e-65
WP_017693170.1|3278440_3278737_-	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	63.0	7.1e-29
WP_058679036.1|3278978_3279323_-	helix-turn-helix transcriptional regulator	NA	G8C7U7	Escherichia_phage	92.9	7.4e-54
WP_058679035.1|3279324_3280014_-	phage replication protein	NA	G8C7U6	Escherichia_phage	96.1	4.2e-125
WP_058679034.1|3280010_3280874_-	hypothetical protein	NA	G8C7U5	Escherichia_phage	91.6	2.9e-147
WP_049012403.1|3280873_3281566_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_058679033.1|3281651_3282194_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	77.2	1.2e-71
WP_016042179.1|3282223_3282451_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	100.0	4.1e-37
WP_016042178.1|3282561_3283251_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	100.0	2.2e-126
WP_032655965.1|3283439_3284387_+	hypothetical protein	NA	A9YX09	Burkholderia_phage	42.3	2.0e-61
WP_015386429.1|3284475_3285684_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	1.6e-47
WP_058679032.1|3285739_3285937_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	95.3	9.2e-25
WP_058679031.1|3286283_3286475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058679030.1|3286500_3286977_+	hypothetical protein	NA	A0A0B4SK56	Proteus_phage	33.7	4.2e-07
WP_058679029.1|3287023_3287662_+	hypothetical protein	NA	L0AQZ0	Klebsiella_phage	43.7	7.8e-49
WP_058679028.1|3287796_3288036_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	43.0	1.5e-05
3288050:3288064	attL	CGGCAAGCTGACGCT	NA	NA	NA	NA
WP_017383253.1|3288118_3288349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058679027.1|3288348_3288579_+	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	95.5	7.7e-31
WP_058679026.1|3288565_3289012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058679025.1|3289082_3290051_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	98.8	2.7e-85
WP_058679024.1|3290058_3290343_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	92.6	9.4e-47
WP_058679023.1|3290361_3291207_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	61.6	9.6e-71
WP_058679022.1|3291203_3291884_+	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	98.7	1.6e-129
WP_058679020.1|3292347_3292989_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	90.4	3.0e-109
WP_159066728.1|3292978_3293575_+	HNH endonuclease	NA	A0A142IF90	Pseudomonas_phage	42.3	4.8e-24
WP_058679018.1|3293571_3294666_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	66.1	4.6e-142
WP_058679017.1|3294662_3294881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045346713.1|3295179_3295371_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	93.7	5.4e-30
WP_058679016.1|3295351_3296530_-|integrase	site-specific integrase	integrase	K7P703	Enterobacteria_phage	93.6	4.9e-222
3305139:3305153	attR	AGCGTCAGCTTGCCG	NA	NA	NA	NA
>prophage 5
NZ_CP020089	Enterobacter cloacae strain PIMB10EC27 chromosome, complete genome	5272177	3320663	3332476	5272177		Enterobacteria_phage(37.5%)	12	NA	NA
WP_058678688.1|3320663_3321773_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	29.8	2.1e-33
WP_058678687.1|3321782_3322193_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_058678686.1|3322192_3322741_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	51.9	5.7e-48
WP_058678685.1|3322780_3323587_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_058678684.1|3323719_3324601_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	1.6e-108
WP_058678683.1|3324653_3325553_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.0	1.6e-26
WP_058678682.1|3325552_3326638_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.8	2.2e-99
WP_058678681.1|3326739_3328626_-	polysaccharide biosynthesis protein	NA	L7Y3T9	Megavirus	27.9	5.7e-23
WP_058678680.1|3328664_3329225_-	sugar O-acyltransferase	NA	NA	NA	NA	NA
WP_058678679.1|3329217_3330261_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_058678678.1|3330260_3331205_-	NAD-dependent epimerase/dehydratase family protein	NA	K7QJG5	Escherichia_phage	29.7	5.4e-06
WP_013097865.1|3331579_3332476_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.9	9.0e-43
>prophage 6
NZ_CP020089	Enterobacter cloacae strain PIMB10EC27 chromosome, complete genome	5272177	3535608	3544691	5272177	holin	Pseudomonas_phage(33.33%)	7	NA	NA
WP_020690664.1|3535608_3537894_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	64.0	1.0e-284
WP_013098012.1|3538001_3539132_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.4	6.0e-177
WP_013098013.1|3539131_3539386_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	67.9	5.1e-28
WP_058678186.1|3539505_3541197_+|holin	glucose-methanol-choline oxidoreductase	holin	A0A1V0S9J5	Catovirus	30.3	6.1e-24
WP_058678187.1|3541090_3542647_+|holin	glucose-methanol-choline oxidoreductase	holin	A0A1V0SI18	Klosneuvirus	28.0	2.9e-36
WP_058678188.1|3542678_3543608_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013098017.1|3543632_3544691_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	50.9	7.7e-09
>prophage 7
NZ_CP020089	Enterobacter cloacae strain PIMB10EC27 chromosome, complete genome	5272177	4336223	4374276	5272177	integrase,transposase	Stx2-converting_phage(22.22%)	26	4371270:4371284	4376893:4376907
WP_000227969.1|4336223_4337300_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_016151369.1|4338839_4339190_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	9.6e-41
WP_007901308.1|4342724_4343648_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	97.4	1.5e-173
WP_001101446.1|4343987_4345013_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_007896426.1|4345220_4346546_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	48.1	6.5e-114
WP_016151347.1|4347789_4348311_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_023304425.1|4348307_4349261_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_022652364.1|4349347_4351672_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_007898890.1|4351716_4352619_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_004118243.1|4352615_4353614_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004118246.1|4353610_4354567_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	5.3e-17
WP_004152282.1|4354567_4355335_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_007898888.1|4355433_4355727_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.9	4.7e-49
WP_007898884.1|4356057_4356336_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000427614.1|4356597_4357602_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_032435706.1|4358005_4358998_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_007851507.1|4359367_4360450_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	98.1	6.5e-189
WP_058679570.1|4360571_4363646_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
WP_003846917.1|4363697_4364951_+	lactose permease	NA	NA	NA	NA	NA
WP_003846919.1|4365007_4365178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017384068.1|4366032_4367166_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_085949497.1|4367500_4368648_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_017384060.1|4368738_4369167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017384059.1|4369170_4371288_-	hypothetical protein	NA	NA	NA	NA	NA
4371270:4371284	attL	TTTTCTTCAAATCTG	NA	NA	NA	NA
WP_007897920.1|4371275_4373042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007897923.1|4373028_4374276_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
4376893:4376907	attR	CAGATTTGAAGAAAA	NA	NA	NA	NA
>prophage 1
NZ_CP020090	Enterobacter cloacae strain PIMB10EC27 plasmid pEC27-1, complete sequence	62470	17353	45227	62470	transposase	Escherichia_phage(40.0%)	26	NA	NA
WP_032723026.1|17353_20341_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.6	9.9e-296
WP_000470624.1|20507_21143_+	recombinase family protein	NA	NA	NA	NA	NA
WP_009652884.1|21170_22007_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000235177.1|22072_22471_-	VOC family protein	NA	NA	NA	NA	NA
WP_000842086.1|22512_23622_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.1	3.7e-30
WP_001141270.1|23652_23928_-	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_000510385.1|24765_25020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000557557.1|25037_25313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004221700.1|25375_25588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004221702.1|25545_25731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199413.1|27395_30413_+|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
WP_004201164.1|30804_31617_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|31620_31986_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201168.1|31990_32629_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201169.1|32639_33671_-	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_004201171.1|33675_34005_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_004201172.1|34198_34489_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
WP_004201176.1|34544_36185_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	62.1	8.2e-175
WP_015056392.1|36373_37903_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_032723058.1|38113_38389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|38418_39123_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002210513.1|39574_40336_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|40356_41217_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_001067855.1|42568_43273_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001549892.1|43665_43905_-	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
WP_000343760.1|44006_45227_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP020091	Enterobacter cloacae strain PIMB10EC27 plasmid pEC27-2, complete sequence	84602	68052	79295	84602	transposase,integrase	Escherichia_phage(37.5%)	11	68001:68060	75948:76767
68001:68060	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCGTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067855.1|68052_68757_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_071549088.1|68781_69294_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_001749967.1|69298_69505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001288432.1|69886_71320_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_004098817.1|71353_72568_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001389365.1|72828_73593_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001144737.1|73735_74002_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_004201280.1|74222_74696_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_000845048.1|74851_75865_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067855.1|75999_76704_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001000602.1|78143_79295_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.7	6.7e-99
75948:76767	attR	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCGTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCC	NA	NA	NA	NA
