The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027394	Escherichia coli O104:H4 strain FDAARGOS_349 chromosome, complete genome	5277316	96701	158168	5277316	head,integrase,tail,terminase,protease,capsid,portal,holin	Enterobacteria_phage(44.0%)	72	92517:92531	113456:113470
92517:92531	attL	AAACAAGAACACGGT	NA	NA	NA	NA
WP_000113686.1|96701_97832_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	4.4e-103
WP_000113189.1|97809_98058_-	excisionase	NA	NA	NA	NA	NA
WP_000048530.1|98122_100594_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.2	1.8e-56
WP_001090200.1|100686_100878_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|100874_101063_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_012601410.1|101557_101824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394541.1|101812_102151_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	51.0	2.5e-06
WP_000379548.1|102162_102315_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_000233320.1|102611_103031_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001072337.1|103110_103365_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000693888.1|103361_103787_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095671.1|103809_104772_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_001151211.1|104812_105238_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	1.3e-63
WP_000150294.1|105412_106078_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000018429.1|106258_106471_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_001329966.1|106638_106911_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_001265083.1|106912_107959_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	5.9e-110
WP_000904106.1|107971_108346_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.8e-36
WP_000762880.1|108342_109164_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000917746.1|109390_109588_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	96.9	1.4e-28
WP_000935536.1|109738_110788_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.7	8.8e-199
WP_001438304.1|111586_111718_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	96.4	1.1e-05
WP_000871291.1|111998_112334_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000874307.1|112594_114448_+	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.5	0.0e+00
113456:113470	attR	AAACAAGAACACGGT	NA	NA	NA	NA
WP_000284510.1|114598_114814_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000731197.1|114818_115625_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	94.8	3.3e-145
WP_001092853.1|115667_116201_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	8.7e-102
WP_032159578.1|116755_116842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001228710.1|117063_117270_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	95.6	2.9e-29
WP_001390467.1|117298_117451_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	98.0	2.8e-21
WP_000343118.1|117529_117817_+	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	58.9	4.0e-29
WP_000240372.1|118270_118675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000867569.1|119075_119624_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001390573.1|119595_121524_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.5	1.6e-262
WP_000259002.1|121507_121714_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001387697.1|121710_123303_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.8e-185
WP_000522596.1|125237_126266_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.4	2.8e-112
WP_000201506.1|126317_126686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204198.1|126678_127032_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	3.0e-42
WP_000974999.1|127046_127622_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.3	9.2e-49
WP_000683079.1|127618_128014_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235040.1|128021_128774_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.6	6.7e-132
WP_000479095.1|128787_129219_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_000533402.1|129245_129659_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082359.1|129639_132213_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.9	0.0e+00
WP_000847379.1|132209_132539_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152522.1|132538_133237_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000140761.1|133241_133985_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	1.8e-145
WP_000090879.1|133921_134524_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_001332187.1|134597_134936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000515776.1|135002_138482_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_001228314.1|138548_139148_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	97.0	9.1e-108
WP_000216502.1|139299_142134_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	59.1	5.7e-83
WP_000885576.1|142133_142718_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	1.7e-103
WP_000240999.1|142772_143441_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000926528.1|143497_143767_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	77.8	2.7e-19
WP_000251936.1|143881_144052_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001079509.1|144540_145047_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|145092_145593_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|145678_145858_-	general stress protein	NA	NA	NA	NA	NA
WP_000443069.1|146238_147045_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|147044_148238_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983912.1|148249_149611_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
WP_000763511.1|149611_151207_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194599.1|151206_152769_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001386774.1|152860_152905_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|153042_153924_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|153920_154541_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|154641_155514_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278904.1|155553_156144_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559283.1|156140_156899_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	8.8e-07
WP_000422045.1|157118_158168_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 2
NZ_CP027394	Escherichia coli O104:H4 strain FDAARGOS_349 chromosome, complete genome	5277316	446016	512988	5277316	integrase,tail,lysis,terminase,capsid,holin,portal	Shigella_phage(43.48%)	77	488479:488496	516529:516546
WP_000041536.1|446016_448443_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.3e-213
WP_001342404.1|448503_450927_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	9.8e-209
WP_000184488.1|451458_452094_+	phage antirepressor Ant	NA	A0A088CBR4	Shigella_phage	81.0	2.8e-91
WP_000763355.1|452141_452363_+	TraR/DksA family transcriptional regulator	NA	V5USD3	Shigella_phage	98.6	2.9e-35
WP_000020909.1|452359_452644_+	DUF4752 family protein	NA	A0A088CD82	Shigella_phage	98.9	6.1e-46
WP_001290012.1|452630_453467_+	ead/Ea22-like family protein	NA	A0A2I6TD51	Escherichia_phage	87.7	6.1e-126
WP_000628768.1|453980_454484_+	DUF551 domain-containing protein	NA	V5UT79	Shigella_phage	98.2	2.6e-95
WP_000481378.1|454485_454761_-	hypothetical protein	NA	A0A088CD78	Shigella_phage	89.3	4.0e-18
WP_000331660.1|454884_463236_-	hypothetical protein	NA	Q08J70	Stx2-converting_phage	95.8	0.0e+00
WP_000012439.1|463304_464570_-	hypothetical protein	NA	A0A2L1IV65	Escherichia_phage	95.0	1.5e-192
WP_000540395.1|464580_464832_-	hypothetical protein	NA	A0A0P0ZDW9	Stx2-converting_phage	97.5	7.9e-13
WP_000455643.1|464841_465288_-	hypothetical protein	NA	A0A2L1IV89	Escherichia_phage	100.0	4.0e-76
WP_000509022.1|465290_465947_-	hypothetical protein	NA	A0A0H4IPM7	Shigella_phage	99.1	7.4e-103
WP_001387532.1|466038_466440_-	hypothetical protein	NA	Q08J75	Stx2-converting_phage	98.5	5.0e-70
WP_000078908.1|466496_466637_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	97.8	2.0e-18
WP_000836186.1|466871_467609_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2L1IV31	Escherichia_phage	80.8	1.2e-109
WP_001390575.1|467688_468306_-	hypothetical protein	NA	A0A2L1IV83	Escherichia_phage	98.0	6.3e-120
WP_000455633.1|468311_468590_-	outer membrane protein	NA	A0A2L1IV69	Escherichia_phage	100.0	2.6e-49
WP_000038927.1|468604_469873_-	host specificity protein J	NA	A0A0N7C124	Escherichia_phage	94.3	1.6e-218
WP_001146337.1|469869_471495_-	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	96.7	0.0e+00
WP_000276176.1|471835_472063_-	hypothetical protein	NA	A0A088CBQ7	Shigella_phage	98.7	2.6e-39
WP_000537686.1|472075_472621_-	hypothetical protein	NA	A0A088CD67	Shigella_phage	99.4	2.0e-93
WP_000117962.1|472703_474611_-|tail	tail fiber protein	tail	V5USF3	Shigella_phage	66.0	4.2e-82
WP_000207910.1|474607_475258_-	hypothetical protein	NA	A0A2L1IV63	Escherichia_phage	99.1	1.5e-119
WP_000829400.1|475257_475821_-	hypothetical protein	NA	A0A2L1IV64	Escherichia_phage	99.5	8.3e-103
WP_001290749.1|475804_476266_-	hypothetical protein	NA	A0A2L1IV43	Escherichia_phage	99.3	6.9e-71
WP_001140435.1|476316_476706_-	hypothetical protein	NA	V5UT93	Shigella_phage	97.7	1.9e-61
WP_000214480.1|476760_477975_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2L1IV46	Escherichia_phage	99.0	1.8e-232
WP_000344999.1|477997_479005_-	hypothetical protein	NA	A0A2L1IV47	Escherichia_phage	93.4	1.2e-168
WP_000787512.1|479162_481307_-|portal	portal protein	portal	A0A088CE71	Shigella_phage	99.6	0.0e+00
WP_001387707.1|481306_483013_-|terminase	terminase	terminase	A0A2L1IV76	Escherichia_phage	99.1	0.0e+00
WP_001086085.1|482993_483809_-|terminase	terminase	terminase	A0A2L1IV66	Escherichia_phage	99.6	6.6e-125
WP_000934362.1|484411_484993_+	lipopolysaccharide core heptose(II)-phosphate phosphatase	NA	A0A2L1IV13	Escherichia_phage	100.0	6.7e-47
WP_001082713.1|485073_485532_-|lysis	lysis protein	lysis	A0A2L1IV55	Escherichia_phage	99.3	6.4e-77
WP_000675931.1|485533_485647_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_000087450.1|485867_486401_-	lysozyme	NA	A0A088CC28	Shigella_phage	91.5	5.6e-93
WP_000284506.1|486405_486621_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290236.1|486697_486943_-	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	87.7	1.1e-14
WP_000142783.1|486968_487151_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	91.7	1.6e-23
WP_000874468.1|487289_489200_-	SASA family carbohydrate esterase	NA	A0A0N7CGH9	Escherichia_phage	74.8	6.4e-280
488479:488496	attL	AACAGCACATTTTTCGGG	NA	NA	NA	NA
WP_001204886.1|489965_490400_-	antitermination protein	NA	G9L695	Escherichia_phage	98.6	2.4e-81
WP_000992060.1|490392_490587_-	protein ninH	NA	A0A088CC23	Shigella_phage	100.0	1.4e-30
WP_001008115.1|490586_490949_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A088CBJ1	Shigella_phage	98.3	9.2e-63
WP_000002252.1|490945_491236_-	DUF1364 domain-containing protein	NA	A0A088CE53	Shigella_phage	96.9	9.3e-50
WP_001254268.1|491259_491451_-	NinE family protein	NA	A0A0P0ZDL7	Stx2-converting_phage	87.7	8.9e-25
WP_001076834.1|491447_491858_-	recombination protein NinB	NA	A0A088CBP6	Shigella_phage	98.5	3.9e-70
WP_000211990.1|491912_492584_-	ORF6N domain-containing protein	NA	A0A088CD42	Shigella_phage	82.6	9.0e-96
WP_000042397.1|493290_493608_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000818160.1|493658_494144_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000119356.1|494162_494342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000887482.1|494551_494764_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	62.9	8.4e-16
WP_001278450.1|494952_495057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206792.1|495172_495757_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	83.5	5.5e-33
WP_001118163.1|495813_496209_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	52.9	2.0e-31
WP_000450864.1|496224_496995_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	82.4	8.1e-109
WP_000790392.1|497020_497761_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	87.4	2.3e-121
WP_001390256.1|497767_498850_-	hypothetical protein	NA	V5URT9	Shigella_phage	96.4	2.8e-200
WP_000438870.1|498870_499089_-	hypothetical protein	NA	A0A088CC17	Shigella_phage	100.0	1.1e-21
WP_000438525.1|499103_499400_-	hypothetical protein	NA	A0A088CBI6	Shigella_phage	98.0	3.4e-47
WP_000437871.1|499538_499739_-	Cro/Cl family transcriptional regulator	NA	A4KWT7	Enterobacteria_phage	97.0	1.3e-29
WP_001274758.1|499839_500553_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.6	4.1e-131
WP_001074607.1|500599_501142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528776.1|501129_501906_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_000198438.1|502400_502784_+	antitermination protein	NA	G9L671	Escherichia_phage	99.2	6.7e-64
WP_000211196.1|502787_503501_+	hypothetical protein	NA	A0A088CC14	Shigella_phage	98.7	1.8e-126
WP_001005963.1|503532_503892_+	hypothetical protein	NA	A0A088CBI5	Shigella_phage	72.6	2.3e-37
WP_000189936.1|503860_504070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560214.1|504526_504748_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	94.4	1.1e-34
WP_000660961.1|504831_505218_+	hypothetical protein	NA	V5USC5	Shigella_phage	78.9	9.5e-50
WP_001271588.1|505325_507398_+	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	87.4	0.0e+00
WP_000995032.1|507394_507691_+	host-nuclease inhibitor protein Gam	NA	V5URU8	Shigella_phage	93.9	5.8e-47
WP_000100829.1|507696_508482_+	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	97.3	9.4e-145
WP_000186868.1|508478_509159_+	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	98.2	1.5e-130
WP_000497813.1|509206_509458_+	DUF4222 domain-containing protein	NA	A0A088CBN9	Shigella_phage	100.0	1.3e-39
WP_001387389.1|509719_510883_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	99.7	3.8e-227
WP_000526492.1|511476_512331_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|512373_512988_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
516529:516546	attR	AACAGCACATTTTTCGGG	NA	NA	NA	NA
>prophage 3
NZ_CP027394	Escherichia coli O104:H4 strain FDAARGOS_349 chromosome, complete genome	5277316	640393	698973	5277316	head,integrase,tail,terminase,transposase,tRNA,capsid,holin,portal,plate	Enterobacteria_phage(77.55%)	71	636386:636402	688593:688609
636386:636402	attL	GAGCTGGCGCGCAAATT	NA	NA	NA	NA
WP_000029466.1|640393_641143_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154183.1|641142_641694_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956518.1|641756_642737_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_000416308.1|642926_643322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001247218.1|643332_644268_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	50.5	4.8e-79
WP_000094527.1|644356_644668_-	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	55.9	8.8e-22
WP_000163908.1|644759_645038_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000917807.1|645052_645391_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	85.3	2.2e-50
WP_000159452.1|645401_645689_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.9	2.7e-33
WP_000514277.1|645700_645943_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021658.1|645939_646053_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	1.4e-09
WP_001038613.1|646141_646462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985715.1|646451_646655_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	94.0	3.4e-30
WP_000153687.1|646651_646897_+	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	87.7	8.4e-36
WP_000104300.1|646893_647193_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	6.2e-41
WP_157847544.1|647204_647822_+	ash family protein	NA	S5MQL6	Escherichia_phage	49.4	1.5e-09
WP_000564228.1|647818_648208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001272076.1|648204_651045_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	89.4	0.0e+00
WP_000686540.1|651121_652081_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	1.3e-180
WP_000211292.1|652085_652400_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	51.9	3.5e-18
WP_000201251.1|652419_652851_+	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	43.3	4.7e-21
WP_000224219.1|652852_653116_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	1.1e-30
WP_000087812.1|653627_654674_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000613796.1|654673_656425_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.6	0.0e+00
WP_001262665.1|656579_657416_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	1.8e-149
WP_001055094.1|657439_658492_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	3.2e-188
WP_000632318.1|658537_659338_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
WP_000063103.1|659439_659934_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000864897.1|659933_660134_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_000104350.1|660136_660460_+|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072317.1|660456_660849_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	97.7	6.4e-70
WP_000780558.1|660845_661253_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	1.2e-63
WP_000202135.1|661391_663272_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	81.0	3.8e-301
WP_000921128.1|663295_663763_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	96.1	2.1e-83
WP_000356370.1|663755_664391_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	5.3e-114
WP_001342219.1|664402_664969_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.3	2.5e-99
WP_001067548.1|664986_665316_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001111965.1|665319_666216_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	5.7e-154
WP_000071739.1|666208_666739_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_000108557.1|666741_668874_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.4	1.2e-130
WP_000144016.1|668873_669452_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	7.7e-96
WP_000954195.1|669495_670068_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000979946.1|670224_670713_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	8.8e-85
WP_001390260.1|670725_673533_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.5	0.0e+00
WP_000333498.1|673519_673675_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	3.3e-22
WP_000665305.1|673683_674049_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	96.7	1.4e-55
WP_000290443.1|674103_674616_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.8	2.7e-92
WP_000005414.1|674615_675800_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.0	3.8e-222
WP_000132828.1|675957_677067_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.8	3.7e-195
WP_000965749.1|677158_678241_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000019440.1|678585_679566_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
WP_000488099.1|679759_680020_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|680210_680351_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001229265.1|680652_680952_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672359.1|680956_683344_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|683358_684342_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|684624_684669_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|684791_685148_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|685200_685398_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|685494_686037_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144190.1|686040_687969_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	5.5e-130
WP_001142445.1|690566_690674_+	hypothetical protein	NA	NA	NA	NA	NA
688593:688609	attR	AATTTGCGCGCCAGCTC	NA	NA	NA	NA
WP_000771396.1|690726_691485_-	YdiY family protein	NA	NA	NA	NA	NA
WP_000251735.1|691771_692701_+	6-phosphofructokinase II	NA	NA	NA	NA	NA
WP_000146159.1|692801_693092_+	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_000267645.1|693197_694058_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_000222172.1|694098_694635_-	YniB family protein	NA	NA	NA	NA	NA
WP_000106834.1|694781_695450_+	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_001295408.1|695612_696203_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001010722.1|696335_697727_+	cystine/sulfocysteine:cation symporter	NA	NA	NA	NA	NA
WP_000019440.1|697992_698973_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
>prophage 4
NZ_CP027394	Escherichia coli O104:H4 strain FDAARGOS_349 chromosome, complete genome	5277316	800072	891088	5277316	head,tail,protease,tRNA,terminase,capsid,portal	Enterobacteria_phage(35.29%)	107	NA	NA
WP_000984517.1|800072_800954_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001315679.1|801145_803194_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000431370.1|803213_803912_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|804008_804506_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_001207283.1|804635_805919_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001297532.1|805887_808521_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_000057022.1|808600_810040_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|810157_810394_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|810498_810690_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812712.1|810690_811347_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	3.6e-57
WP_000976472.1|811742_812084_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879280.1|812096_812969_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|812972_813347_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|813485_813716_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|813817_814474_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|814497_815160_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000936951.1|815156_817217_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024745.1|817425_818085_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001295500.1|818411_818768_-	protein YebF	NA	NA	NA	NA	NA
WP_000257738.1|818834_819125_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_000173474.1|819258_820437_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800512.1|820492_821134_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001069467.1|821170_822982_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301720.1|823216_824692_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
WP_001056706.1|825029_825899_+	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000091176.1|826026_827469_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000448381.1|827599_828571_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|828690_830013_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|830028_830961_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|831039_831795_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571465.1|831791_832577_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|832723_833734_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|833742_834354_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|834492_834558_-	stress response small protein YobI	NA	NA	NA	NA	NA
WP_001024930.1|834628_835231_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|835232_835754_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|835788_836529_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_077221229.1|836557_837010_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258662.1|837002_838775_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891610.1|839084_839651_+	hydrolase	NA	NA	NA	NA	NA
WP_001217553.1|840005_840254_+	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_071827722.1|840389_840650_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000227779.1|840792_841401_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	44.7	2.2e-37
WP_001387718.1|841409_842948_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A2D1UII2	Escherichia_phage	92.2	8.8e-54
WP_001228314.1|843099_843699_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	97.0	9.1e-108
WP_000515718.1|843766_847162_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.6	0.0e+00
WP_000090891.1|847222_847855_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000140762.1|847791_848535_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.1e-146
WP_001152522.1|848539_849238_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000847391.1|849237_849567_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	90.8	8.7e-52
WP_000081812.1|849563_852176_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	87.1	0.0e+00
WP_000533444.1|852156_852570_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.2	2.1e-42
WP_000479035.1|852596_853019_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.1	1.1e-70
WP_000235108.1|853032_853785_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.5e-133
WP_000683079.1|853792_854188_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000975010.1|854184_854760_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	6.4e-50
WP_001204556.1|854774_855128_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.1e-41
WP_000201501.1|855120_855504_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522601.1|855555_856584_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.1e-113
WP_000256823.1|856641_856989_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_001253973.1|857025_858531_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	1.3e-99
WP_000831738.1|858520_860113_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	4.2e-184
WP_000259002.1|860109_860316_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001390579.1|860299_862228_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.6	7.4e-260
WP_000867568.1|862199_862748_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001329960.1|863142_863328_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000347013.1|863460_863601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071587457.1|864013_864199_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	9.9e-21
WP_001280932.1|864421_864553_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_001151822.1|864567_864750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092910.1|864906_865440_-	lysozyme	NA	Q08J98	Stx2-converting_phage	96.6	1.1e-101
WP_000551290.1|865568_865883_+	hypothetical protein	NA	Q08J99	Stx2-converting_phage	100.0	4.7e-55
WP_000731196.1|865892_866699_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	99.6	4.8e-152
WP_000874354.1|867067_868921_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	90.6	0.0e+00
WP_000935520.1|869712_870762_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	91.4	3.1e-188
WP_000917724.1|870913_871117_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000868396.1|871381_872308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001131905.1|872294_872843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205460.1|872855_873197_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001390267.1|873214_874204_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.4e-193
WP_001072672.1|874211_875027_-	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.6	2.2e-149
WP_000767110.1|875189_875585_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_000210143.1|875581_875908_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	2.7e-53
WP_000066917.1|875904_876558_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_001387484.1|876557_877052_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	96.3	1.5e-84
WP_000061508.1|877048_877867_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	88.1	2.8e-123
WP_000620687.1|877863_878088_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	95.9	2.4e-37
WP_001087340.1|878084_879230_-	Rha family transcriptional regulator	NA	A5LH69	Enterobacteria_phage	83.5	3.1e-173
WP_000526669.1|879226_879784_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	94.1	5.3e-94
WP_001191669.1|879776_880037_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_001387485.1|880134_880827_+	helix-turn-helix domain-containing protein	NA	S5FUZ3	Shigella_phage	96.1	6.4e-121
WP_000179185.1|881529_881892_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	94.2	7.5e-57
WP_000081306.1|881957_882782_+	DUF2303 family protein	NA	K7PJQ6	Enterobacteria_phage	98.9	1.1e-148
WP_000008178.1|882909_883446_+	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	99.4	2.2e-100
WP_001242713.1|883436_883799_+	phage protein	NA	K7PH61	Enterobacteria_phage	97.5	6.8e-66
WP_000111289.1|883795_883999_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	1.0e-31
WP_000476208.1|883991_884231_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	94.9	1.6e-34
WP_000065512.1|884227_884776_+	ead/Ea22-like family protein	NA	A0A1I9LJM5	Stx_converting_phage	97.5	1.4e-59
WP_000628772.1|885289_886048_+	phage protein	NA	A0A1U9AJ59	Stx1_converting_phage	82.0	2.7e-109
WP_000457723.1|886132_886375_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_001030156.1|886378_886525_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.8	1.6e-21
WP_000528718.1|886533_886770_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	6.4e-41
WP_000362003.1|886825_888136_+	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	95.4	3.0e-244
WP_044713004.1|888117_888888_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_000252979.1|888940_889336_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|889376_890120_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564745.1|890116_891088_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP027394	Escherichia coli O104:H4 strain FDAARGOS_349 chromosome, complete genome	5277316	1189050	1198492	5277316		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292767.1|1189050_1190187_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
WP_001351453.1|1190183_1192184_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001295429.1|1192308_1192770_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|1192810_1193281_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|1193327_1194047_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1194043_1195729_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|1195950_1196682_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|1196741_1196849_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|1196829_1197561_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569326.1|1197565_1198492_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 6
NZ_CP027394	Escherichia coli O104:H4 strain FDAARGOS_349 chromosome, complete genome	5277316	1399220	1464252	5277316	head,integrase,transposase,tRNA,terminase,protease,portal	Enterobacteria_phage(45.95%)	68	1429025:1429041	1466705:1466721
WP_001283590.1|1399220_1400033_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289162.1|1400032_1401046_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699126.1|1401111_1402248_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	2.6e-23
WP_000615821.1|1402346_1403342_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127781.1|1403338_1404517_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|1404800_1406021_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683791.1|1406179_1408186_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|1408306_1408585_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089235.1|1408618_1409167_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|1409166_1409976_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043820.1|1409975_1410800_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|1410803_1411889_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001295704.1|1411923_1412856_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730807.1|1413021_1413573_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_000399648.1|1413766_1414747_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001387754.1|1414973_1415846_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730291.1|1415832_1416357_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000822649.1|1416353_1416824_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000842082.1|1416820_1417369_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001281615.1|1417343_1418096_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001112829.1|1418115_1420758_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033328.1|1420839_1421403_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|1422077_1422563_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426166.1|1422765_1424910_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531990.1|1424909_1426220_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|1426399_1426684_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|1427055_1428396_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000937848.1|1428761_1429820_+	hypothetical protein	NA	NA	NA	NA	NA
1429025:1429041	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000776768.1|1430001_1430757_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|1431050_1431983_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958672.1|1432294_1433452_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.3e-221
WP_000178979.1|1433680_1435591_+	acyltransferase	NA	C6ZR20	Salmonella_phage	32.6	4.7e-57
WP_000129924.1|1435661_1437641_-|head	phage head-binding domain-containing protein	head	A5VW57	Enterobacteria_phage	93.5	6.2e-60
WP_000835342.1|1437741_1438620_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	78.1	5.8e-95
WP_000865490.1|1438852_1438993_-	Arc family DNA-binding protein	NA	A0A0M4S6R9	Salmonella_phage	56.8	7.5e-05
WP_001283829.1|1439098_1439350_+	Arc family DNA-binding protein	NA	A5VW59	Enterobacteria_phage	93.9	1.5e-35
WP_000820795.1|1439346_1439661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000749286.1|1439686_1440172_+	lipoprotein	NA	NA	NA	NA	NA
WP_001387755.1|1440186_1442031_-	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	73.8	4.0e-247
WP_000246924.1|1442030_1443497_-	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	62.0	8.4e-139
WP_000964882.1|1443506_1444199_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
WP_000614045.1|1444201_1444657_-	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.7	5.7e-86
WP_000785547.1|1444656_1445505_-	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	97.5	3.4e-100
WP_001122379.1|1445504_1446923_-	packaged DNA stabilization protein gp10	NA	Q9AYZ4	Salmonella_phage	98.9	3.9e-274
WP_000246749.1|1446931_1447414_-	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	99.4	8.4e-88
WP_000375637.1|1447388_1447574_-	hypothetical protein	NA	Q716G9	Shigella_phage	100.0	2.7e-26
WP_001133485.1|1447616_1448888_-|head	head protein	head	Q9AYZ7	Salmonella_phage	99.5	1.2e-239
WP_000426730.1|1448899_1449784_-	hypothetical protein	NA	Q716H1	Shigella_phage	99.0	2.0e-143
WP_000852341.1|1449797_1451924_-|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	99.0	0.0e+00
WP_000200769.1|1451926_1453339_-|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.8	9.8e-278
WP_000113732.1|1453335_1453776_-	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	99.3	1.7e-79
WP_000807788.1|1453778_1454021_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000638547.1|1455067_1455199_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243355.1|1455183_1455336_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000050554.1|1455411_1455582_+	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	100.0	3.0e-24
WP_000031367.1|1455592_1456198_+	ERF family protein	NA	K7P6W7	Enterobacteria_phage	100.0	4.1e-108
WP_000951329.1|1456197_1456581_+	hypothetical protein	NA	K7P7R8	Enterobacteria_phage	97.6	1.2e-65
WP_001111299.1|1456604_1456901_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	99.0	3.9e-51
WP_032159494.1|1456920_1457202_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	98.9	9.7e-44
WP_001214454.1|1457198_1457366_+	DUF2737 family protein	NA	Q716F2	Shigella_phage	98.2	8.6e-24
WP_000034245.1|1457362_1458034_+	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	73.2	3.0e-83
WP_000951713.1|1458396_1458606_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	91.2	1.3e-32
WP_000208008.1|1458602_1459232_+	DUF550 domain-containing protein	NA	K7P7E3	Enterobacteria_phage	58.6	1.1e-55
WP_001277767.1|1459328_1459508_+	Eag protein	NA	K7PL40	Enterobacteria_phage	100.0	2.5e-29
WP_001163428.1|1459639_1459840_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001197025.1|1460369_1461617_-	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001274887.1|1461688_1462603_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000194515.1|1462818_1464252_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
1466705:1466721	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 7
NZ_CP027394	Escherichia coli O104:H4 strain FDAARGOS_349 chromosome, complete genome	5277316	2063815	2121909	5277316	tRNA,integrase,transposase,protease	Staphylococcus_phage(20.0%)	44	2064800:2064817	2109738:2109755
WP_000701841.1|2063815_2064574_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105559.1|2064779_2065700_-	agmatinase	NA	NA	NA	NA	NA
2064800:2064817	attL	CCTGAATATACAGCATCT	NA	NA	NA	NA
WP_000758915.1|2065835_2066567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|2066712_2068689_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|2068697_2068829_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001303650.1|2068964_2069180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|2069483_2070638_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|2071073_2072468_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_000858396.1|2072544_2073042_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|2073136_2073844_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222508.1|2073923_2074655_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|2074667_2075618_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|2075726_2076290_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017106.1|2076289_2076706_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001349546.1|2076881_2077862_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|2077879_2078584_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|2078601_2079168_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|2079164_2079455_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174743.1|2079462_2080056_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239939.1|2080048_2081185_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745217.1|2081339_2082347_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394125.1|2082463_2083510_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|2083685_2084405_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|2084588_2084915_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|2084914_2085634_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001297399.1|2085794_2086847_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|2086874_2087150_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001298916.1|2087214_2088294_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|2088495_2089752_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839766.1|2089801_2091937_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234526.1|2092334_2093042_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218809.1|2093420_2094683_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	6.9e-81
WP_001387038.1|2095933_2096197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000286652.1|2097666_2100516_+	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	39.6	2.2e-183
WP_001273465.1|2100541_2101522_+	ATP-binding protein	NA	A0A1B2RW50	Lymphocystis_disease_virus	30.2	4.2e-17
WP_000126413.1|2101531_2103919_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_000105162.1|2103928_2105557_+	site-specific DNA-methyltransferase	NA	A0A0K1LNZ9	Escherichia_phage	42.6	4.6e-85
WP_000081335.1|2105559_2108430_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_001091149.1|2108518_2108812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001254936.1|2109151_2110303_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	3.4e-42
2109738:2109755	attR	AGATGCTGTATATTCAGG	NA	NA	NA	NA
WP_001189118.1|2111465_2112974_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_001309734.1|2118789_2119224_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_000080172.1|2119600_2121214_+|transposase	IS66-like element ISEc43 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	8.3e-172
WP_077577697.1|2121546_2121909_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	62.5	6.4e-40
>prophage 8
NZ_CP027394	Escherichia coli O104:H4 strain FDAARGOS_349 chromosome, complete genome	5277316	2933212	2963298	5277316	tRNA,integrase,transposase	Escherichia_phage(27.27%)	24	2947476:2947505	2969350:2969379
WP_001070193.1|2933212_2933902_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_000678443.1|2933907_2935989_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_000468836.1|2936154_2937360_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_001295238.1|2937639_2939031_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
WP_001307467.1|2939151_2940861_+	AsmA family protein	NA	NA	NA	NA	NA
WP_000702903.1|2940913_2943232_-	alpha-xylosidase	NA	NA	NA	NA	NA
WP_000834439.1|2943241_2944624_-	glycoside-pentoside-hexuronide family transporter	NA	NA	NA	NA	NA
WP_001218908.1|2945310_2946495_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	3.4e-162
WP_000656307.1|2947344_2947434_-	acetyltransferase	NA	NA	NA	NA	NA
2947476:2947505	attL	CTCAGAAAACGGAAAATAAAGCACGCTAAG	NA	NA	NA	NA
WP_001138064.1|2947500_2950467_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|2950469_2951030_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|2951155_2951506_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|2951708_2952722_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000703418.1|2952879_2953353_+	trimethoprim-resistant dihydrofolate reductase DfrA7	NA	A0A1B2IBQ4	Erwinia_phage	32.0	8.4e-16
WP_000679427.1|2953582_2953930_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259029.1|2953923_2954703_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_001067855.1|2954736_2955441_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|2955940_2956801_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|2957398_2958103_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240536.1|2958858_2959710_+	replication protein	NA	NA	NA	NA	NA
WP_001043265.1|2960017_2960833_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|2960893_2961697_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|2961696_2962533_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067855.1|2962593_2963298_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
2969350:2969379	attR	CTTAGCGTGCTTTATTTTCCGTTTTCTGAG	NA	NA	NA	NA
>prophage 9
NZ_CP027394	Escherichia coli O104:H4 strain FDAARGOS_349 chromosome, complete genome	5277316	3542005	3618605	5277316	tRNA,integrase,protease,transposase	Enterobacteria_phage(21.43%)	55	3550074:3550089	3590803:3590818
WP_001390760.1|3542005_3543130_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.3e-199
WP_162886171.1|3543707_3544920_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.3	6.0e-167
WP_000555385.1|3544960_3546103_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001387604.1|3546842_3547769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074478.1|3547718_3548912_-	MFS transporter	NA	NA	NA	NA	NA
WP_001387605.1|3549047_3550772_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
3550074:3550089	attL	CTGTTTGCCCTGCGTG	NA	NA	NA	NA
WP_001287497.1|3550772_3551720_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015710.1|3551719_3553462_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750143.1|3553458_3554796_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001387241.1|3554801_3556997_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_001189118.1|3557961_3559470_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_000422750.1|3561155_3561581_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	97.9	4.4e-48
WP_000291751.1|3565478_3566060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001034110.1|3566106_3569964_-|protease	serine protease autotransporter toxin SigA	protease	Q9LA58	Enterobacterial_phage	38.3	2.4e-225
WP_001218804.1|3576403_3577666_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	9.3e-78
WP_001387262.1|3578045_3578621_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000068978.1|3578657_3580355_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883400.1|3580330_3580669_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000961957.1|3580784_3582086_-	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000069437.1|3582203_3583640_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267448.1|3583976_3584453_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000015837.1|3584468_3585725_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001026276.1|3586000_3586294_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|3586337_3587984_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_000558209.1|3588121_3588475_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_001008073.1|3588677_3589547_-	YjeJ family protein	NA	NA	NA	NA	NA
WP_000940530.1|3589936_3590965_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
3590803:3590818	attR	CACGCAGGGCAAACAG	NA	NA	NA	NA
WP_000257278.1|3591006_3591573_+	elongation factor P	NA	NA	NA	NA	NA
WP_000977757.1|3591624_3591750_+	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000239596.1|3591860_3592007_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000118482.1|3592181_3592499_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001238378.1|3592495_3593029_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_001367937.1|3593117_3594251_-	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001299198.1|3594313_3594673_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_000208757.1|3594683_3595079_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000829498.1|3595089_3595824_-	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_001192973.1|3595816_3597625_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000004771.1|3597949_3598927_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001346081.1|3599145_3600648_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000342867.1|3600699_3601014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276180.1|3601010_3601325_+	YjeO family protein	NA	NA	NA	NA	NA
WP_001236813.1|3601353_3604677_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_000934933.1|3604698_3605667_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_000041970.1|3605763_3606816_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_001295188.1|3606910_3607456_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_010723271.1|3608198_3608252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294219.1|3608234_3609374_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_001307537.1|3609372_3610920_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|3610891_3611353_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_000990321.1|3611371_3612709_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122523.1|3612718_3614566_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.6	2.6e-60
WP_001280345.1|3614558_3615509_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|3615594_3615903_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|3615979_3617260_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312490.1|3617345_3618605_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 10
NZ_CP027394	Escherichia coli O104:H4 strain FDAARGOS_349 chromosome, complete genome	5277316	3687160	3749094	5277316	tRNA,integrase,holin,transposase	Enterobacteria_phage(25.0%)	56	3679282:3679297	3718756:3718771
3679282:3679297	attL	AGAACAGGTTATCCAC	NA	NA	NA	NA
WP_000399648.1|3687160_3688141_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000047539.1|3688417_3688804_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|3688876_3689338_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013042.1|3689350_3690286_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	3.8e-52
WP_001296693.1|3690289_3690424_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230281.1|3690704_3691100_-	RidA family protein	NA	NA	NA	NA	NA
WP_000500725.1|3691230_3691944_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000256656.1|3692014_3692608_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000583470.1|3692752_3693205_+	toxin-antitoxin biofilm protein TabA	NA	NA	NA	NA	NA
WP_001387612.1|3693327_3694647_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001387613.1|3694658_3694889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000012907.1|3694989_3695994_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|3696155_3696572_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001059422.1|3696617_3697121_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000079641.1|3697313_3698510_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_000416381.1|3698565_3701421_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.0e-140
WP_000786399.1|3701420_3701864_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|3701997_3703509_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|3703775_3704876_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|3704875_3705958_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001294559.1|3706076_3707579_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	3.0e-83
WP_001349989.1|3707656_3708655_-	DNA-binding transcriptional regulator IdnR	NA	NA	NA	NA	NA
WP_001128335.1|3708721_3710041_-	gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
WP_000998695.1|3710105_3710870_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_001197416.1|3710893_3711925_-	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000896735.1|3712141_3712705_+	gluconokinase	NA	NA	NA	NA	NA
WP_000061766.1|3712708_3713728_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.4e-44
WP_000142493.1|3714157_3715084_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001223819.1|3715073_3716693_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_001143292.1|3717993_3718287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000202281.1|3718654_3719527_-	HNH endonuclease	NA	NA	NA	NA	NA
3718756:3718771	attR	AGAACAGGTTATCCAC	NA	NA	NA	NA
WP_001178761.1|3719771_3720152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001099275.1|3721822_3722119_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001104341.1|3722748_3723825_+	Fic family protein	NA	NA	NA	NA	NA
WP_000729465.1|3723875_3724505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001114712.1|3725415_3726240_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001351184.1|3726405_3727962_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000859648.1|3727961_3728651_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_001215044.1|3728762_3728927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000416151.1|3730896_3731928_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	1.4e-18
WP_000916805.1|3732198_3732642_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000705930.1|3732657_3732945_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000345347.1|3732957_3734214_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001327567.1|3734460_3734715_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	62.2	8.0e-21
WP_000107474.1|3735136_3736150_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000998350.1|3736161_3737478_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000350265.1|3737505_3738426_-	ribokinase	NA	NA	NA	NA	NA
WP_001295538.1|3738731_3739514_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000080200.1|3740697_3742311_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	1.8e-182
WP_000624722.1|3742341_3742692_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|3742688_3743114_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_001422798.1|3743252_3743381_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000145474.1|3743561_3744218_-	TetR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000625669.1|3744463_3745741_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001293435.1|3745803_3747801_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000088357.1|3747954_3749094_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.5e-68
>prophage 11
NZ_CP027394	Escherichia coli O104:H4 strain FDAARGOS_349 chromosome, complete genome	5277316	4059267	4121590	5277316	tRNA,transposase,plate,protease	Emiliania_huxleyi_virus(12.5%)	51	NA	NA
WP_001346129.1|4059267_4060620_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|4060649_4063082_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|4063203_4063689_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|4063692_4064718_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|4064822_4065278_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|4065281_4066070_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139667.1|4066069_4067218_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|4067214_4067811_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|4067847_4071330_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|4071342_4072302_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|4072400_4074542_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|4074598_4074988_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176578.1|4075052_4076351_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|4076399_4076660_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|4076646_4076847_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|4077012_4077558_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|4077554_4077977_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239154.1|4077990_4078701_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000399648.1|4078950_4079931_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001260716.1|4081010_4082729_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|4082840_4083548_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|4083544_4083949_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|4084066_4084882_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|4084921_4085575_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|4085567_4086599_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140174.1|4086786_4087359_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997043.1|4093253_4094057_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	3.2e-39
WP_000648601.1|4094053_4094968_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|4095208_4096009_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211710.1|4096086_4096857_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|4096904_4098263_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052751.1|4098334_4099090_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001298887.1|4099123_4099846_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917888.1|4099842_4100310_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|4100374_4101106_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086142.1|4101641_4102427_+	aminopeptidase	NA	NA	NA	NA	NA
WP_001236649.1|4102563_4103043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908057.1|4103052_4103967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284200.1|4104010_4104493_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087741.1|4104516_4105869_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_122987046.1|4105879_4109314_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240544.1|4109422_4110838_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088873.1|4110842_4111586_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614396.1|4111582_4114342_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.6	9.4e-83
WP_000343303.1|4114350_4115112_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246421.1|4115116_4116448_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|4116450_4116975_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113725.1|4116971_4118252_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|4118276_4119359_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393853.1|4119322_4121173_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611748.1|4121176_4121590_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 12
NZ_CP027394	Escherichia coli O104:H4 strain FDAARGOS_349 chromosome, complete genome	5277316	4689659	4732093	5277316	head,integrase,tail,lysis,capsid,portal	Enterobacteria_phage(58.82%)	55	4687937:4687952	4711088:4711103
4687937:4687952	attL	CTGACTGCTGAAGAGC	NA	NA	NA	NA
WP_000533642.1|4689659_4690730_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
WP_001303849.1|4690707_4690926_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545745.1|4690965_4691133_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_000120064.1|4691375_4691978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763367.1|4692188_4692410_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_000188870.1|4692508_4692724_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000548541.1|4692800_4692992_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	4.7e-26
WP_000682318.1|4692964_4693147_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000186833.1|4693143_4693824_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000100847.1|4693820_4694606_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995433.1|4694611_4694908_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000233576.1|4694983_4695190_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000858975.1|4695787_4696477_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|4696582_4696813_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182903.1|4696882_4697422_+	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_000147903.1|4697418_4698438_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	9.7e-110
WP_000788812.1|4698434_4699136_+	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	98.7	1.4e-128
WP_000145901.1|4699132_4699435_+	protein ren	NA	M1FPD5	Enterobacteria_phage	97.8	6.1e-44
WP_000338663.1|4700586_4700826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001391403.1|4701402_4701654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072147432.1|4701750_4701852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053034.1|4701848_4702304_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	4.9e-61
WP_000224912.1|4702303_4702474_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	1.4e-13
WP_000774504.1|4702466_4702757_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000971074.1|4703111_4703252_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001204791.1|4703337_4703721_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737263.1|4703909_4704992_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	78.7	4.4e-161
WP_000839596.1|4705580_4705796_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135297.1|4705795_4706293_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	3.2e-90
WP_000092234.1|4706289_4706727_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	94.5	3.0e-68
WP_001028465.1|4706931_4707453_+	KilA-N domain-containing protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
WP_000079508.1|4707802_4708213_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_000105084.1|4708269_4708503_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000453580.1|4708891_4709437_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_000198149.1|4711332_4711539_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
4711088:4711103	attR	CTGACTGCTGAAGAGC	NA	NA	NA	NA
WP_001316944.1|4711535_4713137_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.8	1.2e-311
WP_000123216.1|4713117_4714437_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.4e-230
WP_001299443.1|4714446_4714779_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000063238.1|4714834_4715860_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	4.7e-189
WP_000158875.1|4715901_4716297_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000785282.1|4716308_4716662_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000975081.1|4716673_4717252_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683129.1|4717248_4717644_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_001390429.1|4717651_4718392_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	6.8e-129
WP_000479200.1|4718407_4718830_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.0	1.4e-59
WP_000459457.1|4718811_4719246_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840297.1|4719238_4721800_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	97.8	0.0e+00
WP_000847379.1|4721796_4722126_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152576.1|4722125_4722824_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	4.7e-132
WP_000140717.1|4722829_4723573_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.1e-146
WP_000090917.1|4723509_4724142_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000515639.1|4724202_4727700_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.6	0.0e+00
WP_001233090.1|4727770_4728370_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_001387657.1|4728434_4731509_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_000885623.1|4731508_4732093_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	9.2e-105
>prophage 13
NZ_CP027394	Escherichia coli O104:H4 strain FDAARGOS_349 chromosome, complete genome	5277316	4997011	5059874	5277316	tail,bacteriocin,lysis,terminase,capsid,holin,portal	Escherichia_phage(94.29%)	71	NA	NA
WP_000013658.1|4997011_4998322_-	DUF3596 domain-containing protein	NA	A0A0P0ZGA8	Escherichia_phage	100.0	9.2e-254
WP_001208773.1|4998374_4998659_-	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_000497815.1|4998704_4998956_-	DUF4222 domain-containing protein	NA	G9L6F5	Escherichia_phage	100.0	8.4e-39
WP_000994790.1|4999320_4999674_-	DUF1627 domain-containing protein	NA	A0A0P0ZH73	Escherichia_phage	100.0	3.5e-59
WP_001291842.1|4999709_4999922_-	DUF1382 family protein	NA	A0A0P0ZG72	Escherichia_phage	100.0	2.7e-30
WP_000163446.1|4999881_5000508_-	adenine methylase	NA	A0A0P0ZG10	Escherichia_phage	100.0	8.0e-123
WP_000809302.1|5000504_5000936_-	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000203831.1|5000991_5001630_-	phage antirepressor Ant	NA	A0A0P0ZG08	Escherichia_phage	100.0	4.2e-119
WP_000206786.1|5001985_5002882_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	100.0	5.4e-173
WP_001014298.1|5002884_5003076_-	hypothetical protein	NA	A0A0P0ZG45	Escherichia_phage	100.0	3.3e-27
WP_000034212.1|5003077_5003485_-	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	100.0	1.3e-70
WP_000206047.1|5003481_5004207_-	ead/Ea22-like family protein	NA	A0A0P0ZFU9	Escherichia_phage	100.0	3.3e-128
WP_001159715.1|5004357_5004753_-	hypothetical protein	NA	A0A0P0ZG44	Escherichia_phage	100.0	1.1e-69
WP_000080417.1|5004829_5005651_-	DUF2303 family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_001071603.1|5005714_5006062_-	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
WP_000344637.1|5006136_5006724_-	hypothetical protein	NA	A0A0N7KZV4	Escherichia_phage	100.0	1.2e-107
WP_000187063.1|5006723_5007413_-	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	100.0	3.5e-135
WP_000459721.1|5007409_5008360_-	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	100.0	1.1e-179
WP_000995345.1|5008376_5008658_-	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_000934197.1|5008678_5008960_-	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	100.0	3.0e-45
WP_001369605.1|5009254_5009929_-	ORF6N domain-containing protein	NA	A0A0P0ZGP9	Escherichia_phage	100.0	1.3e-123
WP_016051777.1|5010184_5010970_-	Rha family transcriptional regulator	NA	A0A0P0ZG86	Escherichia_phage	100.0	9.4e-145
WP_001064714.1|5011586_5012540_-	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_000939558.1|5012536_5014006_-	Eco57I restriction-modification methylase domain-containing protein	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
WP_001056250.1|5014100_5014814_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_001240876.1|5014909_5015113_+	Cro/Cl family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001369601.1|5015283_5015478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001271433.1|5015644_5016022_+	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_000913116.1|5016015_5017536_+	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	100.0	1.4e-306
WP_001260358.1|5017525_5018497_+	toprim domain-containing protein	NA	A0A0P0ZFY3	Escherichia_phage	100.0	6.5e-196
WP_000402092.1|5018496_5018946_+	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_000813671.1|5018953_5019517_+	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
WP_000144767.1|5019513_5019708_+	phage NinH family protein	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_001204859.1|5019700_5020135_+	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_001356551.1|5020383_5020536_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000649753.1|5020918_5021878_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738068.1|5021889_5022159_+	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000874432.1|5022644_5024582_+	SASA family carbohydrate esterase	NA	A0A0P0ZGE0	Escherichia_phage	100.0	0.0e+00
WP_000143458.1|5024718_5024898_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|5024938_5025184_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|5025261_5025477_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_000087737.1|5025481_5026015_+	lysozyme	NA	A0A0P0ZGA2	Escherichia_phage	100.0	5.1e-102
WP_001056879.1|5026288_5026858_+	hypothetical protein	NA	A0A0N7KZV8	Escherichia_phage	100.0	1.8e-105
WP_000455397.1|5026857_5027007_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	100.0	4.8e-18
WP_024017835.1|5027009_5027447_+|lysis	lysis protein	lysis	A0A0P0ZFH2	Escherichia_phage	100.0	1.4e-70
WP_001109019.1|5027649_5028201_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	100.0	4.5e-101
WP_001086073.1|5028493_5029300_+|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_000143988.1|5029280_5030987_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_000787034.1|5030986_5033131_+|portal	portal protein	portal	A0A0P0ZG74	Escherichia_phage	100.0	0.0e+00
WP_000345010.1|5033288_5034296_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000214474.1|5034319_5035534_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140442.1|5035589_5035979_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_001367376.1|5036028_5036490_+	hypothetical protein	NA	A0A0P0ZG73	Escherichia_phage	100.0	6.0e-75
WP_000829200.1|5036473_5037037_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_000207927.1|5037036_5037687_+	hypothetical protein	NA	A0A0P0ZGL1	Escherichia_phage	100.0	4.6e-121
WP_000117967.1|5037683_5039876_+|tail	tail fiber protein	tail	A0A0H4IU95	Shigella_phage	98.0	1.9e-86
WP_000513231.1|5039962_5040475_+	receptor recognizing protein Gp38	NA	A0A0P0ZFL3	Escherichia_phage	100.0	1.2e-92
WP_001391593.1|5040708_5042334_+	hypothetical protein	NA	A0A0P0ZG21	Escherichia_phage	100.0	0.0e+00
WP_000197192.1|5042330_5043599_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455634.1|5043613_5043892_+	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_096849982.1|5043897_5044515_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	99.5	3.3e-121
WP_000835360.1|5044605_5045340_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_000078907.1|5045572_5045713_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035558.1|5045769_5046171_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000509489.1|5046264_5046921_+	hypothetical protein	NA	A0A0P0ZGB7	Escherichia_phage	100.0	2.4e-109
WP_000455649.1|5046923_5047370_+	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
WP_000540391.1|5047379_5047631_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012452.1|5047641_5048907_+	hypothetical protein	NA	A0A0P0ZFI5	Escherichia_phage	100.0	2.4e-206
WP_000331685.1|5048976_5057358_+	hypothetical protein	NA	A0A0P0ZFK4	Escherichia_phage	100.0	0.0e+00
WP_001273658.1|5058289_5058463_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001326838.1|5058545_5059874_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	3.7e-234
>prophage 1
NZ_CP027395	Escherichia coli O104:H4 strain FDAARGOS_349 plasmid unnamed1	117229	53039	63337	117229	transposase	Salmonella_phage(22.22%)	12	NA	NA
WP_000239590.1|53039_53915_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_000608644.1|54170_55433_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_001235713.1|55996_56554_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|56736_57597_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001245884.1|57865_58168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000587689.1|58164_58791_-	ParA family plasmid-partitioning AAA ATPase	NA	E5FFJ3	Burkholderia_phage	31.1	2.0e-17
WP_000457515.1|58994_60266_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.4	2.2e-143
WP_000109071.1|60265_60703_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000618110.1|60699_60948_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_023383827.1|61366_62269_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_001310011.1|62265_62577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086153.1|62653_63337_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	5.1e-30
>prophage 1
NZ_CP027392	Escherichia coli O104:H4 strain FDAARGOS_349 plasmid unnamed2, complete sequence	75562	0	5690	75562	transposase	Bacillus_phage(50.0%)	5	NA	NA
WP_000033204.1|1387_1888_-|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	28.2	2.4e-08
WP_000869859.1|2323_3352_+	class 1 isoprenoid biosynthesis enzyme	NA	NA	NA	NA	NA
WP_001387337.1|3355_3895_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000565591.1|4397_4550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019427.1|4709_5690_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	3.4e-184
>prophage 2
NZ_CP027392	Escherichia coli O104:H4 strain FDAARGOS_349 plasmid unnamed2, complete sequence	75562	14895	15876	75562	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_000019440.1|14895_15876_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
>prophage 3
NZ_CP027392	Escherichia coli O104:H4 strain FDAARGOS_349 plasmid unnamed2, complete sequence	75562	19956	20193	75562	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
WP_000239755.1|19956_20193_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	63.8	2.0e-18
>prophage 4
NZ_CP027392	Escherichia coli O104:H4 strain FDAARGOS_349 plasmid unnamed2, complete sequence	75562	24039	24669	75562		Planktothrix_phage(100.0%)	1	NA	NA
WP_000621743.1|24039_24669_+	dispersin export ABC transporter ATP-binding protein AatC	NA	G9BWD6	Planktothrix_phage	35.4	1.2e-20
>prophage 5
NZ_CP027392	Escherichia coli O104:H4 strain FDAARGOS_349 plasmid unnamed2, complete sequence	75562	29713	30495	75562		Stx2-converting_phage(50.0%)	2	NA	NA
WP_000624736.1|29713_30064_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	3.6e-40
WP_001387845.1|30060_30495_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	3.4e-19
>prophage 6
NZ_CP027392	Escherichia coli O104:H4 strain FDAARGOS_349 plasmid unnamed2, complete sequence	75562	36755	37556	75562		Yersinia_phage(100.0%)	1	NA	NA
WP_001234427.1|36755_37556_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	37.5	2.8e-43
>prophage 7
NZ_CP027392	Escherichia coli O104:H4 strain FDAARGOS_349 plasmid unnamed2, complete sequence	75562	45280	52233	75562	transposase	Stx2-converting_phage(66.67%)	7	NA	NA
WP_000205736.1|45280_46027_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	3.2e-09
WP_000139330.1|46081_46642_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000624689.1|47300_47597_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	64.4	3.4e-31
WP_000381397.1|47909_49481_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	2.2e-169
WP_000624622.1|49500_49848_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|49847_50525_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000019440.1|51252_52233_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
>prophage 8
NZ_CP027392	Escherichia coli O104:H4 strain FDAARGOS_349 plasmid unnamed2, complete sequence	75562	56350	58347	75562	integrase	Macacine_betaherpesvirus(50.0%)	2	54810:54823	64944:64957
54810:54823	attL	TGCAAATGAAAAAC	NA	NA	NA	NA
WP_001066951.1|56350_57091_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_001387465.1|57369_58347_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	8.8e-100
64944:64957	attR	TGCAAATGAAAAAC	NA	NA	NA	NA
>prophage 9
NZ_CP027392	Escherichia coli O104:H4 strain FDAARGOS_349 plasmid unnamed2, complete sequence	75562	61446	67624	75562	integrase	Enterobacteria_phage(50.0%)	7	54810:54823	64944:64957
54810:54823	attL	TGCAAATGAAAAAC	NA	NA	NA	NA
WP_000016961.1|61446_62253_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	93.9	2.7e-54
WP_001144032.1|62431_63076_+	ParA family protein	NA	NA	NA	NA	NA
WP_000030204.1|63162_63471_+	molecular chaperone GroEL	NA	NA	NA	NA	NA
WP_000688504.1|63884_64865_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	2.2e-79
WP_001278815.1|64857_65274_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
64944:64957	attR	TGCAAATGAAAAAC	NA	NA	NA	NA
WP_000457137.1|66548_66926_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	47.2	6.1e-25
WP_032159540.1|67057_67624_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	45.6	4.8e-34
>prophage 10
NZ_CP027392	Escherichia coli O104:H4 strain FDAARGOS_349 plasmid unnamed2, complete sequence	75562	73621	74346	75562		Stx2-converting_phage(100.0%)	2	NA	NA
WP_001401984.1|73621_74002_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	98.4	2.7e-65
WP_000612591.1|73998_74346_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
