The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	0	12824	5022408		Tetraselmis_virus(20.0%)	11	NA	NA
WP_000494928.1|1236_2496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001173016.1|2624_4118_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	27.8	8.0e-28
WP_001274833.1|4138_4900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001181672.1|5456_5666_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	5.2e-18
WP_001118464.1|5769_6900_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000516135.1|6988_8905_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_000843689.1|9275_9680_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102393.1|9705_10419_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528533.1|10567_11134_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001094685.1|11168_11756_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130187.1|11870_12824_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
>prophage 2
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	20972	84144	5022408	transposase,tRNA,head,tail,plate,integrase	Burkholderia_virus(36.96%)	77	46487:46503	81163:81179
WP_001223200.1|20972_21659_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001295754.1|22058_22199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|22294_23011_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_000920358.1|23070_24423_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001219582.1|24480_25905_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.9	3.2e-10
WP_001188689.1|25904_26594_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_000875487.1|26606_27080_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|27290_28160_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942350.1|28156_28804_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_001531361.1|28855_29383_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000068677.1|29461_29788_-	trp operon repressor	NA	NA	NA	NA	NA
WP_000409419.1|29877_31815_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046754.1|32021_33689_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.7	1.0e-39
WP_000093834.1|33809_35042_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
WP_001295751.1|35062_36445_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132966.1|36493_37462_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_000124608.1|37567_38212_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_000105853.1|38239_39256_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_001293116.1|39256_40588_-	type II toxin-antitoxin system HipA family toxin YjjJ	NA	NA	NA	NA	NA
WP_000224879.1|40754_41474_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816460.1|41530_42754_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477800.1|42805_44128_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.5	1.5e-78
WP_001295412.1|44205_44985_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
46487:46503	attL	TTATTCCGGCATCAGCG	NA	NA	NA	NA
WP_000904922.1|46768_47341_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_063269479.1|47400_47925_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	48.6	1.8e-35
WP_001529037.1|47924_48539_+|tail	tail assembly chaperone	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
WP_001529038.1|48545_49019_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	52.4	8.1e-35
WP_074441576.1|49029_50952_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	44.8	6.9e-40
WP_000138756.1|50954_51533_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_001529034.1|51525_52629_-	hypothetical protein	NA	Q6QI99	Burkholderia_phage	55.0	1.4e-106
WP_000859116.1|52619_52967_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	61.5	1.7e-34
WP_000148265.1|53021_53618_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	5.4e-36
WP_001529032.1|53614_54787_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.1	7.3e-85
WP_012602373.1|54774_54990_-	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000458387.1|54986_55871_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_001529030.1|55870_59083_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	31.3	5.8e-84
WP_001202894.1|59158_59317_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084213.1|59240_59576_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000110114.1|59673_59955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000034294.1|59957_60479_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
WP_000729834.1|60478_61906_-|tail	tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_050008517.1|61895_62150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101804.1|62146_62611_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000271668.1|62610_63057_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_000537457.1|63058_63397_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286908.1|63406_64360_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_001273074.1|64374_65490_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_000135514.1|65704_66163_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_000117556.1|66165_66987_-|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.5	3.1e-98
WP_021512536.1|66967_68464_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.6	6.1e-169
WP_000137893.1|68463_69987_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.5	1.8e-184
WP_000533684.1|69983_70526_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	53.3	4.9e-44
WP_000227704.1|70528_70840_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	60.6	4.0e-30
WP_000175097.1|70839_71166_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_001299256.1|71162_71774_-	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	34.2	6.9e-10
WP_001104438.1|71802_72540_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.5	2.9e-63
WP_000793145.1|72542_72893_-	membrane protein	NA	A4JWP3	Burkholderia_virus	53.9	9.0e-23
WP_000194949.1|73023_73767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000972292.1|73742_74147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069609.1|74145_74361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001573937.1|74552_75317_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	4.0e-100
WP_000579778.1|75433_75772_-	helix-turn-helix domain-containing protein	NA	F6MII3	Haemophilus_phage	34.4	4.8e-05
WP_000123378.1|75872_76061_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000047758.1|76113_76422_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	3.5e-23
WP_000533819.1|76432_77344_+	hypothetical protein	NA	A4JWN3	Burkholderia_virus	55.3	2.0e-74
WP_001774059.1|77347_79117_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	68.3	4.8e-229
WP_000960680.1|79127_80294_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.7	9.7e-122
WP_000843445.1|80296_80566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001774058.1|80593_81124_+	hypothetical protein	NA	L7P7T1	Pseudomonas_phage	66.7	6.9e-59
WP_001381531.1|81411_81684_+	hypothetical protein	NA	NA	NA	NA	NA
81163:81179	attR	TTATTCCGGCATCAGCG	NA	NA	NA	NA
WP_001299260.1|81693_81990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763553.1|82004_82220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042069497.1|82216_82900_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.5	1.7e-33
WP_000631814.1|82896_83127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123379.1|83116_83332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000988473.1|83321_83774_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	46.6	1.6e-24
WP_001281696.1|83745_84144_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	55.9	3.9e-30
>prophage 3
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	88685	91561	5022408		Salmonella_phage(50.0%)	3	NA	NA
WP_000490275.1|88685_88847_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|88973_89579_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000175943.1|89971_91561_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
>prophage 4
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	99391	100671	5022408		Salmonella_phage(50.0%)	2	NA	NA
WP_000098818.1|99391_99931_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
WP_000799911.1|99933_100671_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 5
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	103898	109265	5022408		Tupanvirus(50.0%)	4	NA	NA
WP_000106049.1|103898_104921_-	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	27.1	2.1e-11
WP_000091573.1|105059_105974_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000410144.1|106190_107552_+	MFS transporter	NA	NA	NA	NA	NA
WP_000919544.1|107600_109265_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 6
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	115048	124597	5022408	transposase	Bodo_saltans_virus(33.33%)	6	NA	NA
WP_001029745.1|115048_116668_+	type I restriction-modification system subunit M	NA	A0A2H4UVW8	Bodo_saltans_virus	21.8	1.1e-06
WP_000058884.1|117785_121049_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	25.4	2.8e-49
WP_000132599.1|121263_121602_+	endoribonuclease SymE	NA	NA	NA	NA	NA
WP_000397910.1|121644_121809_-	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_000199304.1|121985_123398_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000181180.1|123640_124597_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	1.0e-60
>prophage 7
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	132098	132653	5022408		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151866.1|132098_132653_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 8
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	139176	140637	5022408		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208194.1|139176_140637_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
>prophage 9
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	150832	151429	5022408		Escherichia_phage(100.0%)	1	NA	NA
WP_000044711.1|150832_151429_-	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 10
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	157758	165181	5022408	transposase	Escherichia_phage(33.33%)	5	NA	NA
WP_000991462.1|157758_158739_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	H6WZJ9	Escherichia_phage	57.2	4.7e-101
WP_001363826.1|159321_160365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949154.1|160437_161585_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_000788354.1|161747_162002_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_000366620.1|163105_165181_+	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	33.8	7.7e-37
>prophage 11
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	168321	169512	5022408		Bacillus_phage(100.0%)	1	NA	NA
WP_001295727.1|168321_169512_-	DNA cytosine methyltransferase	NA	Q02778	Bacillus_phage	31.0	7.3e-16
>prophage 12
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	174391	176801	5022408		Klebsiella_phage(33.33%)	4	NA	NA
WP_000692345.1|174391_174613_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186775.1|174675_175152_-	RadC family protein	NA	NA	NA	NA	NA
WP_001350782.1|175167_175641_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	8.7e-13
WP_001234738.1|175982_176801_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	9.4e-47
>prophage 13
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	188042	190202	5022408	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_001171523.1|188042_188423_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|188419_188767_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998019.1|188816_190202_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
>prophage 14
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	199181	205962	5022408	transposase	uncultured_Caudovirales_phage(25.0%)	5	NA	NA
WP_000684856.1|199181_200138_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|200138_200906_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|201462_201720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947616.1|202653_203809_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001545177.1|203964_205962_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	4.4e-21
>prophage 15
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	214367	217358	5022408	transposase	Stx2-converting_phage(50.0%)	4	NA	NA
WP_000080195.1|214367_215981_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|216011_216362_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|216358_216784_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000239754.1|217121_217358_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	66.7	9.0e-19
>prophage 16
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	228376	238803	5022408	tRNA	Acanthamoeba_polyphaga_mimivirus(25.0%)	7	NA	NA
WP_001296699.1|228376_229396_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.9e-44
WP_001296698.1|229525_231028_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	4.6e-84
WP_001296697.1|231188_232271_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|232270_233371_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|233637_235149_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|235504_235948_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416407.1|235947_238803_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
>prophage 17
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	247071	253168	5022408		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_000013046.1|247071_248007_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|248019_248481_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|248553_248940_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000471866.1|249145_251842_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|251982_252036_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181324.1|252220_253168_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
>prophage 18
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	256806	259568	5022408		Vibrio_phage(50.0%)	2	NA	NA
WP_000187791.1|256806_258945_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
WP_001106238.1|259103_259568_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
>prophage 19
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	263878	270366	5022408		Klosneuvirus(33.33%)	6	NA	NA
WP_000853753.1|263878_264877_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000596015.1|264909_265905_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001296689.1|265891_266914_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205813.1|266927_268430_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_000265933.1|268569_269526_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|269835_270366_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
>prophage 20
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	313107	314271	5022408		Ralstonia_phage(100.0%)	1	NA	NA
WP_000944012.1|313107_314271_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.2	1.8e-80
>prophage 21
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	318113	331138	5022408	tRNA,protease	Lactococcus_phage(20.0%)	11	NA	NA
WP_000076322.1|318113_320555_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	4.9e-67
WP_001177639.1|320593_321019_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527954.1|321223_322522_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.4	1.7e-66
WP_001089295.1|322625_322823_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|322904_323909_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312479.1|323911_325171_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460357.1|325256_326537_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|326612_326921_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280359.1|327006_327957_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001296676.1|327949_329797_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	7.5e-60
WP_000990282.1|329806_331138_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	7.4e-17
>prophage 22
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	335053	335599	5022408		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|335053_335599_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 23
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	343319	344297	5022408		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|343319_344297_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 24
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	349217	349751	5022408		Morganella_phage(100.0%)	1	NA	NA
WP_001238369.1|349217_349751_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 25
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	353955	355939	5022408		Vibrio_phage(50.0%)	2	NA	NA
WP_000729117.1|353955_355602_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|355645_355939_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 26
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	370216	385410	5022408	tRNA	Enterobacteria_phage(50.0%)	8	NA	NA
WP_000856826.1|370216_371674_+	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	3.1e-48
WP_000003806.1|371910_373428_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_001173343.1|373546_373720_-	type V toxin-antitoxin system toxin GhoT	NA	NA	NA	NA	NA
WP_001312331.1|373747_374044_-	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_000405647.1|374271_374544_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_001080129.1|374757_378687_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	37.3	4.9e-218
WP_001088099.1|379842_380673_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001528154.1|381570_385410_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	45.2	0.0e+00
>prophage 27
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	409240	410743	5022408		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296659.1|409240_410743_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	1.4e-56
>prophage 28
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	415583	416372	5022408		Pithovirus(100.0%)	1	NA	NA
WP_001193415.1|415583_416372_+	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.2	2.5e-12
>prophage 29
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	421975	423525	5022408		Bacillus_virus(50.0%)	2	NA	NA
WP_001075531.1|421975_422734_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.3	1.6e-16
WP_000611411.1|422844_423525_+	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	1.1e-05
>prophage 30
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	429650	436019	5022408		Bacillus_virus(50.0%)	5	NA	NA
WP_000235245.1|429650_431183_+	D-allose ABC transporter ATP-binding protein AlsA	NA	G3M9Y6	Bacillus_virus	27.4	7.5e-13
WP_000507111.1|431161_432142_+	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_001296654.1|432152_432848_+	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_001171678.1|432831_433761_+	allose kinase	NA	NA	NA	NA	NA
WP_001296653.1|434033_436019_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.6	1.9e-149
>prophage 31
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	441264	443412	5022408		Escherichia_phage(100.0%)	1	NA	NA
WP_011076734.1|441264_443412_+	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	23.9	5.3e-33
>prophage 32
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	447329	448857	5022408		Planktothrix_phage(100.0%)	2	NA	NA
WP_000132446.1|447329_448166_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	8.8e-16
WP_000156927.1|448152_448857_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	2.6e-21
>prophage 33
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	458568	460527	5022408		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078193.1|458568_460527_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 34
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	466651	468001	5022408		Moraxella_phage(100.0%)	1	NA	NA
WP_000106892.1|466651_468001_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.4	3.0e-159
>prophage 35
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	471818	475432	5022408		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|471818_472355_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357755.1|472609_475432_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	0.0e+00
>prophage 36
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	485375	486794	5022408		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000103921.1|485375_486794_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	3.6e-38
>prophage 37
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	492193	496322	5022408		Cronobacter_phage(25.0%)	4	NA	NA
WP_001523669.1|492193_493198_-	AAA family ATPase	NA	K4F711	Cronobacter_phage	30.2	1.3e-26
WP_000122237.1|493194_493752_-	nicotinamide mononucleotide transporter	NA	I6W764	Vibriophage	28.8	2.2e-15
WP_001147314.1|493774_494854_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.6	3.4e-28
WP_001296639.1|494906_496322_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	3.7e-200
>prophage 38
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	508442	509051	5022408		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|508442_509051_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 39
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	516403	517519	5022408		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|516403_517519_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 40
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	541858	545542	5022408		Dickeya_phage(100.0%)	1	NA	NA
WP_000095941.1|541858_545542_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	88.5	2.9e-26
>prophage 41
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	559323	560913	5022408		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187526.1|559323_560913_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.0e-68
>prophage 42
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	566275	568039	5022408		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|566275_566548_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000940085.1|566734_567325_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362389.1|567367_568039_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	3.6e-20
>prophage 43
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	576335	584664	5022408		Vibrio_phage(50.0%)	2	NA	NA
WP_000653952.1|576335_580559_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.3	5.5e-66
WP_000263098.1|580635_584664_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 44
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	588659	591712	5022408		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|588659_589844_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023081.1|590761_591712_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 45
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	604612	605929	5022408		Burkholderia_virus(100.0%)	1	NA	NA
WP_000125467.1|604612_605929_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	35.2	2.0e-59
>prophage 46
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	621681	628928	5022408		Serratia_phage(33.33%)	5	NA	NA
WP_000184861.1|621681_623979_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|624029_624350_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004469.1|624364_625444_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001185130.1|625752_628254_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424857.1|628265_628928_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	1.6e-28
>prophage 47
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	635741	637295	5022408		Pandoravirus(100.0%)	1	NA	NA
WP_000694068.1|635741_637295_-	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	24.5	3.5e-10
>prophage 48
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	648917	653420	5022408		Erwinia_phage(50.0%)	5	NA	NA
WP_001293344.1|648917_650249_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_001305044.1|650315_651242_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|651334_651820_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|651904_652150_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|652574_653420_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 49
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	665030	669956	5022408		Feldmannia_irregularis_virus(33.33%)	5	NA	NA
WP_001033720.1|665030_665729_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|665725_667099_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270242.1|667269_667944_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166063.1|668092_669076_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001296619.1|669335_669956_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	5.4e-63
>prophage 50
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	680915	683966	5022408		Escherichia_phage(100.0%)	1	NA	NA
WP_077633686.1|680915_683966_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 51
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	698859	703590	5022408		Prochlorococcus_phage(33.33%)	5	NA	NA
WP_000357981.1|698859_699870_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	22.2	1.3e-05
WP_000094544.1|699902_700790_-	aldolase	NA	NA	NA	NA	NA
WP_000190782.1|700814_701693_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	73.6	2.0e-47
WP_000196715.1|701865_702762_+	sugar kinase	NA	NA	NA	NA	NA
WP_000022287.1|702801_703590_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.8	1.3e-21
>prophage 52
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	707476	709947	5022408		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000190574.1|707476_708526_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.6	5.0e-08
WP_001315107.1|708537_709947_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 53
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	714068	716855	5022408		uncultured_virus(100.0%)	1	NA	NA
WP_000249989.1|714068_716855_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 54
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	730452	731067	5022408		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295262.1|730452_731067_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 55
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	739846	743133	5022408		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109949.1|739846_740623_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
WP_000459601.1|740625_741141_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001295260.1|741144_741414_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187545.1|741492_743133_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	4.8e-42
>prophage 56
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	765127	766636	5022408		Vibrio_phage(100.0%)	1	NA	NA
WP_000037971.1|765127_766636_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	50.7	6.2e-12
>prophage 57
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	774488	777901	5022408	transposase	Sodalis_phage(50.0%)	3	NA	NA
WP_000133649.1|774488_775349_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	1.2e-65
WP_000928838.1|775386_776007_-	threonine export protein RhtC	NA	NA	NA	NA	NA
WP_001442069.1|776071_777901_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	1.3e-83
>prophage 58
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	784505	788364	5022408		Bacillus_phage(100.0%)	3	NA	NA
WP_000383407.1|784505_786668_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
WP_001213584.1|786751_787468_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000130676.1|787467_788364_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
>prophage 59
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	799259	800915	5022408		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000395838.1|799259_800915_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.0e-44
>prophage 60
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	808922	815066	5022408		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000612067.1|808922_810053_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	7.4e-18
WP_001145166.1|810057_810732_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000676056.1|810709_811591_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001226629.1|811609_812677_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	1.3e-101
WP_000006608.1|812676_813939_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	5.9e-24
WP_000866670.1|813935_815066_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
>prophage 61
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	819108	824522	5022408		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|819108_819438_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047499.1|819568_820834_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001296590.1|820969_822454_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001238869.1|822500_824522_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
>prophage 62
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	832118	833765	5022408		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012588.1|832118_833765_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	5.7e-67
>prophage 63
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	847164	853017	5022408		Enterobacteria_phage(33.33%)	5	NA	NA
WP_001056273.1|847164_848055_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
WP_000211858.1|848079_849045_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000387762.1|849049_850555_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_001296586.1|850562_850982_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000102319.1|851148_853017_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
>prophage 64
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	856185	857178	5022408		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845115.1|856185_857178_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 65
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	869133	876648	5022408		Chrysochromulina_ericina_virus(25.0%)	6	NA	NA
WP_000933735.1|869133_870504_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
WP_000334086.1|870665_872495_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	5.6e-132
WP_000867146.1|872808_873849_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000741620.1|873934_874894_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_001251986.1|874893_875784_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063125.1|875874_876648_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 66
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	887627	888965	5022408		Moraxella_phage(100.0%)	1	NA	NA
WP_001296582.1|887627_888965_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.9	1.2e-62
>prophage 67
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	899162	906531	5022408		Staphylococcus_phage(33.33%)	8	NA	NA
WP_001307474.1|899162_899420_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239730.1|899383_899743_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|899759_899900_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_122984430.1|900129_900210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000059111.1|900506_901910_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673464.1|901914_903015_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000060112.1|903014_904088_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000072072.1|904116_906531_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
>prophage 68
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	911139	912288	5022408		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705012.1|911139_912288_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	2.7e-52
>prophage 69
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	916717	928597	5022408		Cyanophage(20.0%)	11	NA	NA
WP_001243437.1|916717_917131_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_001243431.1|917242_917671_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001279774.1|917868_919530_+	putative transporter	NA	NA	NA	NA	NA
WP_001296571.1|919619_920486_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001087174.1|920652_922368_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.2	1.2e-40
WP_001296568.1|923918_924266_+	YidH family protein	NA	NA	NA	NA	NA
WP_001113432.1|924255_924618_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000148034.1|924614_925112_+	radical SAM protein	NA	NA	NA	NA	NA
WP_001296567.1|925119_926304_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	1.2e-13
WP_001312198.1|926704_926803_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000168502.1|926908_928597_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.6	1.6e-56
>prophage 70
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	937238	938573	5022408		Moraxella_phage(100.0%)	1	NA	NA
WP_001527950.1|937238_938573_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.9	1.1e-65
>prophage 71
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	944823	945861	5022408		Wolbachia_phage(100.0%)	1	NA	NA
WP_001280586.1|944823_945861_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	43.6	7.4e-73
>prophage 72
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	959122	960514	5022408		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|959122_960514_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 73
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	964815	969836	5022408		Bordetella_phage(33.33%)	4	NA	NA
WP_000280473.1|964815_966924_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|966942_967218_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001295237.1|967272_967896_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_001296534.1|968153_969836_+	NAD-dependent DNA ligase LigB	NA	A0A1Q2U2Q6	Vibrio_phage	23.0	5.7e-22
>prophage 74
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	973854	978417	5022408		Xanthomonas_phage(25.0%)	7	NA	NA
WP_001298007.1|973854_974310_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
WP_000050112.1|974290_975511_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	3.2e-43
WP_001296533.1|975682_976351_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000091955.1|976567_976804_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|976824_976992_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114533.1|977089_977899_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001171854.1|977937_978417_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	6.3e-27
>prophage 75
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	993317	1002822	5022408		Synechococcus_phage(16.67%)	9	NA	NA
WP_000587750.1|993317_994250_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
WP_001213854.1|994463_995660_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.0	1.4e-35
WP_000646014.1|995669_996695_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_000982097.1|996933_997968_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000483825.1|997954_998914_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214150.1|998917_1000201_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_001296527.1|1000210_1001755_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001156181.1|1001998_1002430_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024392.1|1002570_1002822_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 76
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1024530	1029142	5022408		Tupanvirus(50.0%)	3	NA	NA
WP_000587626.1|1024530_1026375_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	4.3e-15
WP_000741500.1|1026565_1027717_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_000985737.1|1027846_1029142_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	30.9	2.8e-21
>prophage 77
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1053190	1054732	5022408		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146503.1|1053190_1054732_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	1.1e-16
>prophage 78
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1060049	1061045	5022408		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182627.1|1060049_1061045_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.4	5.4e-12
>prophage 79
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1064901	1066924	5022408	transposase	Macacine_betaherpesvirus(50.0%)	3	NA	NA
WP_106023065.1|1064901_1066270_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_001135731.1|1066371_1066524_+	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_000014594.1|1066711_1066924_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 80
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1070578	1072912	5022408		Escherichia_phage(100.0%)	1	NA	NA
WP_000013977.1|1070578_1072912_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.5	2.4e-71
>prophage 81
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1082956	1084941	5022408		Planktothrix_phage(50.0%)	2	NA	NA
WP_001196477.1|1082956_1083940_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	6.7e-15
WP_000103571.1|1083936_1084941_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	8.6e-18
>prophage 82
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1131844	1133314	5022408		Bacillus_virus(50.0%)	2	NA	NA
WP_000123131.1|1131844_1132492_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	40.0	8.0e-17
WP_000622316.1|1132543_1133314_-	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.6	2.3e-18
>prophage 83
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1143987	1149396	5022408		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000065754.1|1143987_1144413_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	69.3	1.4e-49
WP_023363328.1|1144747_1144831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000160794.1|1144884_1146237_-	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_001296497.1|1146308_1147151_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_001296496.1|1147353_1149396_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.2	4.0e-46
>prophage 84
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1159083	1161819	5022408		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000972087.1|1159083_1161819_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 85
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1169257	1170064	5022408		Bacillus_virus(100.0%)	1	NA	NA
WP_000173684.1|1169257_1170064_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	28.7	7.6e-17
>prophage 86
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1177957	1182078	5022408		Dickeya_phage(50.0%)	4	NA	NA
WP_001100463.1|1177957_1178623_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	7.4e-58
WP_000130621.1|1178832_1179078_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_000106599.1|1179179_1181378_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.1	1.9e-118
WP_000964718.1|1181451_1182078_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 87
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1185084	1187903	5022408		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000617723.1|1185084_1185753_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
WP_001042013.1|1185745_1186804_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|1187048_1187903_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 88
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1194382	1195865	5022408		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000082099.1|1194382_1195150_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
WP_000416895.1|1195151_1195865_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
>prophage 89
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1199406	1201217	5022408		Planktothrix_phage(50.0%)	2	NA	NA
WP_000907823.1|1199406_1200477_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
WP_000073605.1|1200473_1201217_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	24.8	1.1e-09
>prophage 90
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1209473	1211570	5022408		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_001296481.1|1209473_1211570_+	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	34.7	6.1e-42
>prophage 91
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1221899	1224347	5022408		Dickeya_phage(100.0%)	1	NA	NA
WP_000993445.1|1221899_1224347_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 92
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1235321	1237715	5022408		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081885.1|1235321_1237715_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	41.4	7.3e-15
>prophage 93
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1243752	1244163	5022408	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_023908544.1|1243752_1244163_-|transposase	transposase	transposase	Q2A0A7	Sodalis_phage	42.5	9.3e-11
>prophage 94
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1250753	1258134	5022408	transposase	Bacillus_phage(50.0%)	5	NA	NA
WP_106023066.1|1250753_1251473_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	5.9e-29
WP_001253709.1|1251469_1252822_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001265681.1|1252898_1254521_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
WP_000370859.1|1254898_1256623_+	DUF4153 domain-containing protein	NA	NA	NA	NA	NA
WP_000826444.1|1256925_1258134_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	4.9e-209
>prophage 95
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1272995	1273832	5022408		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|1272995_1273832_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 96
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1292746	1302287	5022408		Acinetobacter_phage(25.0%)	9	NA	NA
WP_000601853.1|1292746_1293310_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	7.1e-62
WP_000963794.1|1293395_1294616_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001296470.1|1294682_1296773_-	membrane protein	NA	H9YQA8	environmental_Halophage	99.3	2.9e-76
WP_000242755.1|1296823_1297456_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001148908.1|1297757_1298162_+	OsmC family protein	NA	NA	NA	NA	NA
WP_001274684.1|1298216_1299086_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_000907085.1|1299139_1299358_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_000057364.1|1299351_1300374_-	hydrolase	NA	NA	NA	NA	NA
WP_000634830.1|1300373_1302287_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
>prophage 97
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1307857	1316424	5022408		uncultured_Caudovirales_phage(40.0%)	8	NA	NA
WP_001209693.1|1307857_1308244_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	2.5e-18
WP_000820731.1|1308243_1308603_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_000903381.1|1308609_1308897_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|1309022_1309397_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|1309493_1309964_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|1310060_1312175_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_000031783.1|1312245_1313430_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000773180.1|1313721_1316424_+	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	35.7	2.0e-40
>prophage 98
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1325249	1327202	5022408		Vibrio_phage(100.0%)	1	NA	NA
WP_001525807.1|1325249_1327202_-	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	30.9	1.2e-31
>prophage 99
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1348426	1349898	5022408	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000004421.1|1348426_1349374_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
WP_000114984.1|1349388_1349898_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
>prophage 100
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1360238	1364392	5022408		Bacillus_virus(50.0%)	4	NA	NA
WP_000078344.1|1360238_1360997_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
WP_001296459.1|1361004_1362108_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001120549.1|1362117_1363299_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000738587.1|1363366_1364392_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	1.8e-71
>prophage 101
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1370896	1371781	5022408		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258951.1|1370896_1371781_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	9.2e-24
>prophage 102
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1377117	1381629	5022408		Escherichia_phage(50.0%)	4	NA	NA
WP_000843962.1|1377117_1377948_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.0	1.2e-09
WP_000275542.1|1378288_1379143_+	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_001296455.1|1379178_1380069_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000132912.1|1380129_1381629_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.8	1.4e-11
>prophage 103
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1390915	1391959	5022408		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|1390915_1391959_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 104
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1409604	1410972	5022408	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001296452.1|1409604_1410972_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.0	1.7e-21
>prophage 105
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1414939	1418950	5022408	protease	Pseudomonas_phage(50.0%)	4	NA	NA
WP_000366127.1|1414939_1415437_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
WP_000074796.1|1415544_1416336_+	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000224714.1|1416457_1417351_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000108477.1|1417459_1418950_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.9	4.9e-09
>prophage 106
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1427653	1442447	5022408		Staphylococcus_phage(25.0%)	17	NA	NA
WP_001296449.1|1427653_1428583_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_000809780.1|1428678_1431015_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_000719791.1|1431244_1431898_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000047069.1|1431894_1432623_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000620405.1|1432619_1433252_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|1433464_1433737_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|1433733_1434588_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000183674.1|1434633_1435125_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|1435242_1435530_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000809051.1|1435552_1436986_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|1437033_1437759_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000669785.1|1437765_1438323_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000030537.1|1438291_1438867_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030016.1|1438863_1439430_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_001295557.1|1439450_1440437_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000922880.1|1440450_1441428_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000438245.1|1441637_1442447_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 107
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1446515	1447998	5022408		Vibrio_phage(50.0%)	2	NA	NA
WP_000445413.1|1446515_1446794_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
WP_001047336.1|1447026_1447998_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 108
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1454627	1457500	5022408	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107467.1|1454627_1456562_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000764749.1|1456651_1457500_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.6	7.5e-23
>prophage 109
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1461580	1468219	5022408		Dickeya_phage(50.0%)	4	NA	NA
WP_000207680.1|1461580_1462924_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_001300397.1|1463554_1464007_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031057.1|1464034_1465522_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133040.1|1465546_1468219_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	3.3e-24
>prophage 110
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1473700	1475590	5022408		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|1473700_1475590_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 111
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1481292	1489088	5022408		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
WP_000189328.1|1481292_1481595_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
WP_000449450.1|1481645_1482089_+	YhbP family protein	NA	NA	NA	NA	NA
WP_001296439.1|1482068_1482587_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.6	4.4e-10
WP_001296438.1|1482714_1483350_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000147602.1|1483422_1484463_+	permease	NA	NA	NA	NA	NA
WP_000646033.1|1484575_1485151_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158035.1|1485160_1485751_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000246833.1|1485770_1486166_-	YraN family protein	NA	NA	NA	NA	NA
WP_000249175.1|1486123_1488160_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000809258.1|1488224_1489088_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.6e-50
>prophage 112
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1506708	1507854	5022408		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296434.1|1506708_1507854_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.7e-50
>prophage 113
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1514009	1516304	5022408		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861714.1|1514009_1516304_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.1	2.0e-158
>prophage 114
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1537366	1538332	5022408		Escherichia_phage(100.0%)	1	NA	NA
WP_001098827.1|1537366_1538332_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 115
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1550987	1567135	5022408	tRNA	Herpes_simplex_virus(16.67%)	12	NA	NA
WP_001082927.1|1550987_1554080_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.4	2.6e-158
WP_000212450.1|1554263_1555247_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_000450588.1|1555465_1555798_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000633381.1|1555839_1557330_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.8e-33
WP_000094714.1|1557636_1559157_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	51.5	4.0e-35
WP_000017999.1|1559263_1559887_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001066500.1|1560174_1560939_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000228937.1|1561192_1561699_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000437380.1|1561776_1563618_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000918810.1|1563812_1565558_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.9e-76
WP_001144069.1|1565668_1565884_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264377.1|1566121_1567135_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	9.7e-110
>prophage 116
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1573435	1574674	5022408	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708473.1|1573435_1574674_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.0	3.8e-92
>prophage 117
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1579811	1581245	5022408		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869177.1|1579811_1581245_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 118
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1585158	1585812	5022408		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001076989.1|1585158_1585812_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	8.3e-46
>prophage 119
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1597051	1609497	5022408		Ralstonia_phage(16.67%)	11	NA	NA
WP_000442882.1|1597051_1598212_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.9	7.7e-87
WP_000831543.1|1598217_1598889_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000735289.1|1599036_1600518_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917117.1|1600722_1601352_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000833393.1|1601352_1601775_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000444744.1|1601799_1602627_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000105733.1|1602626_1603208_+	esterase YqiA	NA	NA	NA	NA	NA
WP_000195275.1|1603236_1605129_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.2	4.5e-92
WP_001240664.1|1605192_1607334_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_000940874.1|1607707_1608517_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.4	2.7e-14
WP_000986428.1|1608513_1609497_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.6	1.4e-09
>prophage 120
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1617340	1622380	5022408		Stx_converting_phage(50.0%)	4	NA	NA
WP_000712658.1|1617340_1617733_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
WP_000183485.1|1617785_1618268_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296417.1|1618376_1619984_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001281848.1|1620121_1622380_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.9	3.1e-84
>prophage 121
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1629838	1637157	5022408		Ostreococcus_tauri_virus(33.33%)	6	NA	NA
WP_001296416.1|1629838_1631311_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	32.7	4.5e-47
WP_000438655.1|1631633_1632383_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095204.1|1632634_1634854_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000848528.1|1634895_1635153_-	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000691604.1|1635203_1636130_-	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000013152.1|1636329_1637157_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	1.6e-62
>prophage 122
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1643000	1643885	5022408		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018758.1|1643000_1643885_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 123
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1666060	1667233	5022408		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524942.1|1666060_1667233_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	31.0	7.2e-40
>prophage 124
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1694662	1695646	5022408		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001298261.1|1694662_1695646_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.4	1.4e-36
>prophage 125
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1700946	1703744	5022408		Pseudomonas_phage(50.0%)	5	NA	NA
WP_000094916.1|1700946_1701591_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.6	1.2e-25
WP_000692329.1|1701609_1701831_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186726.1|1701893_1702370_-	RadC family protein	NA	NA	NA	NA	NA
WP_000849565.1|1702385_1702871_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
WP_001234620.1|1702925_1703744_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
>prophage 126
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1717210	1773189	5022408	transposase,protease,integrase	Stx2-converting_phage(38.89%)	41	1771175:1771189	1779767:1779781
WP_000997995.1|1717210_1718749_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	93.9	1.2e-281
WP_000624646.1|1719876_1720227_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.1	5.4e-36
WP_000435655.1|1720223_1720649_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	74.2	3.6e-34
WP_085949591.1|1721020_1721158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001149834.1|1721309_1722227_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000629094.1|1722260_1723136_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000376547.1|1723184_1724657_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	22.7	2.2e-06
WP_000948500.1|1724660_1725491_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001296386.1|1725536_1726247_+	N-acetylneuraminic acid channel protein	NA	NA	NA	NA	NA
WP_000865295.1|1726259_1727369_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_001030790.1|1727430_1728354_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001282578.1|1728389_1729124_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000274668.1|1729223_1730210_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	57.7	4.0e-108
WP_096928816.1|1730361_1731589_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	7.2e-168
WP_001223344.1|1732089_1734180_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001305021.1|1735011_1735284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296382.1|1735574_1735934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266542.1|1735937_1736153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422741.1|1739471_1739897_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|1739893_1740244_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|1740274_1741888_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_089642281.1|1743473_1744625_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	3.4e-42
WP_001034083.1|1745221_1749109_-|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
WP_000973516.1|1750052_1752254_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000750130.1|1752335_1753613_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_023156963.1|1753609_1755352_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_001287500.1|1755351_1756299_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001296374.1|1756299_1758024_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000074472.1|1758159_1759353_+	MFS transporter	NA	NA	NA	NA	NA
WP_001296373.1|1760070_1760499_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_000109147.1|1760538_1761099_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001110186.1|1761140_1761401_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001513409.1|1763234_1763348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099156432.1|1763438_1764564_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	96.6	2.5e-146
WP_023146305.1|1764533_1764749_-	hypothetical protein	NA	A0A0N7C1Y0	Escherichia_phage	85.2	1.7e-27
WP_000006213.1|1765215_1765449_-	Major pilus subunit operon regulatory protein	NA	NA	NA	NA	NA
WP_000080195.1|1767138_1768752_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|1768782_1769133_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|1769129_1769555_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000147017.1|1770624_1771668_-	hypothetical protein	NA	NA	NA	NA	NA
1771175:1771189	attL	GCGCCAGTGCGTAAC	NA	NA	NA	NA
WP_001218869.1|1771923_1773189_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_001218869.1|1771923_1773189_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
1779767:1779781	attR	GCGCCAGTGCGTAAC	NA	NA	NA	NA
>prophage 127
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1798955	1800110	5022408		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|1798955_1800110_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 128
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1808477	1809386	5022408		Yersinia_phage(100.0%)	1	NA	NA
WP_000646924.1|1808477_1809386_-	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	55.7	4.4e-53
>prophage 129
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1815089	1815767	5022408		Bacillus_virus(100.0%)	1	NA	NA
WP_000956881.1|1815089_1815767_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.2	4.9e-09
>prophage 130
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1829274	1830507	5022408		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|1829274_1830507_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 131
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1838643	1843116	5022408		Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000195012.1|1838643_1841517_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	3.7e-263
WP_001296350.1|1841682_1843116_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.3	1.1e-31
>prophage 132
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1846921	1862313	5022408	tRNA	Brevibacillus_phage(14.29%)	14	NA	NA
WP_000806638.1|1846921_1847818_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
WP_000715230.1|1847842_1848553_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000813195.1|1848558_1850292_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	4.1e-60
WP_001701073.1|1850382_1851480_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003071.1|1851490_1853008_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001192798.1|1853050_1853599_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_120795390.1|1853653_1853725_+	protein YqfH	NA	NA	NA	NA	NA
WP_001050745.1|1853721_1853847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296348.1|1853848_1855297_-	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	2.1e-25
WP_001363023.1|1855732_1857652_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_000838415.1|1857651_1858140_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000012167.1|1858175_1859543_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	9.5e-161
WP_001296347.1|1859578_1860895_-	guanine deaminase	NA	NA	NA	NA	NA
WP_001280189.1|1860912_1862313_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 133
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1886591	1887347	5022408		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|1886591_1887347_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 134
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1891633	1894128	5022408		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000603518.1|1891633_1892395_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
WP_000256426.1|1892709_1894128_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
>prophage 135
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1903759	1910532	5022408		Moraxella_phage(33.33%)	6	NA	NA
WP_000895624.1|1903759_1904473_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_000082183.1|1904541_1905231_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564489.1|1905915_1906446_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957911.1|1906458_1908705_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000204658.1|1908855_1909731_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816232.1|1909737_1910532_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 136
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1916009	1927157	5022408		Klosneuvirus(25.0%)	5	NA	NA
WP_001138102.1|1916009_1918898_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.5	1.2e-67
WP_001296343.1|1918890_1922433_+	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.6	5.2e-09
WP_000775933.1|1922432_1924259_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	3.0e-24
WP_000237953.1|1924340_1925672_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000016907.1|1925903_1927157_+	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
>prophage 137
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1931028	1932644	5022408		Tetraselmis_virus(50.0%)	2	NA	NA
WP_001066226.1|1931028_1931625_+	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	33.5	1.8e-23
WP_001296341.1|1931696_1932644_+	phosphoglycerate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	25.2	5.8e-16
>prophage 138
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1943926	1946229	5022408	transposase	Enterobacteria_phage(50.0%)	2	NA	NA
WP_001016257.1|1943926_1944673_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|1944687_1946229_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
>prophage 139
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1950516	1953030	5022408		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000354273.1|1950516_1953030_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	45.3	4.1e-08
>prophage 140
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1956395	1961416	5022408		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_032270009.1|1956395_1958768_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.0	1.9e-15
WP_000147344.1|1958779_1961416_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.4	3.2e-96
>prophage 141
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1970249	1972755	5022408	tRNA	Pandoravirus(50.0%)	3	NA	NA
WP_000117716.1|1970249_1971056_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.9e-16
WP_000184272.1|1971106_1971550_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_001296332.1|1971549_1972755_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.2	4.6e-74
>prophage 142
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1984331	1985087	5022408		Bacillus_phage(100.0%)	1	NA	NA
WP_001296330.1|1984331_1985087_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	1.1e-09
>prophage 143
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1989945	1990794	5022408		Vibrio_phage(100.0%)	1	NA	NA
WP_000100405.1|1989945_1990794_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	6.1e-41
>prophage 144
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	1998326	2002441	5022408		Hokovirus(50.0%)	2	NA	NA
WP_000186432.1|1998326_2001083_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	1.4e-54
WP_000046817.1|2001139_2002441_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	29.8	2.0e-38
>prophage 145
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2005837	2013285	5022408		Only_Syngen_Nebraska_virus(25.0%)	6	NA	NA
WP_000210878.1|2005837_2007475_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_000036723.1|2007562_2008861_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_106023073.1|2008920_2009793_-	YgcG family protein	NA	NA	NA	NA	NA
WP_001199974.1|2010086_2010758_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	3.0e-14
WP_001232702.1|2010842_2011850_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_012896831.1|2011875_2013285_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	22.9	1.9e-15
>prophage 146
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2020586	2021372	5022408		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021342.1|2020586_2021372_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	6.5e-21
>prophage 147
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2036023	2038056	5022408		Hokovirus(50.0%)	2	NA	NA
WP_001090370.1|2036023_2037451_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
WP_001173651.1|2037450_2038056_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	1.9e-28
>prophage 148
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2041166	2044882	5022408		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_001295182.1|2041166_2041928_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|2041921_2042548_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272593.1|2042687_2043827_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|2043889_2044882_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
>prophage 149
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2049248	2056388	5022408		Escherichia_phage(83.33%)	6	NA	NA
WP_001279004.1|2049248_2049887_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
WP_000590411.1|2049883_2051146_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_000847996.1|2051142_2052051_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_001296319.1|2052246_2053014_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_001141293.1|2053064_2053721_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_000103863.1|2053826_2056388_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
>prophage 150
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2080402	2081368	5022408		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287403.1|2080402_2081368_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.6	2.7e-37
>prophage 151
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2087151	2092538	5022408	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_000140273.1|2087151_2087649_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	9.8e-31
WP_000963143.1|2087728_2088790_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000140501.1|2088858_2089359_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000047157.1|2089487_2092118_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.4	9.3e-80
WP_000906486.1|2092352_2092538_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 152
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2107279	2112576	5022408		Bacillus_virus(20.0%)	5	NA	NA
WP_000985509.1|2107279_2108482_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777934.1|2108837_2109797_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	72.4	1.4e-134
WP_000246582.1|2109806_2111951_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	2.9e-196
WP_000080947.1|2111923_2112334_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001223227.1|2112330_2112576_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 153
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2116510	2120561	5022408		Clostridium_phage(50.0%)	4	NA	NA
WP_000522415.1|2116510_2116960_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156817.1|2116960_2117623_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001296312.1|2117643_2119044_-	GABA permease	NA	NA	NA	NA	NA
WP_000625041.1|2119280_2120561_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.3	3.8e-34
>prophage 154
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2125104	2213879	5022408	tRNA,tail,terminase,portal,protease,lysis	Enterobacteria_phage(37.7%)	93	NA	NA
WP_000457798.1|2125104_2125923_-	hypothetical protein	NA	I6PD67	Cronobacter_phage	79.2	1.3e-117
WP_001293201.1|2125926_2126175_-	hypothetical protein	NA	I6PCV4	Cronobacter_phage	80.5	3.3e-27
WP_000531797.1|2126470_2127646_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.4	2.7e-148
WP_001331174.1|2127606_2127813_-	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_001331173.1|2127872_2128088_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	65.1	1.2e-14
WP_001242962.1|2128084_2128447_-	hypothetical protein	NA	K7PH61	Enterobacteria_phage	96.7	2.6e-65
WP_000008210.1|2128437_2128974_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	99.4	9.7e-101
WP_000081297.1|2129101_2129926_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	99.6	4.6e-150
WP_000135680.1|2129991_2130354_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000859460.1|2131022_2131697_-	LexA family transcriptional regulator	NA	Q8SBF6	Shigella_phage	99.1	1.7e-131
WP_000649477.1|2131787_2131988_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000521508.1|2132031_2132583_+	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
WP_089516032.1|2132579_2133416_+	ash family protein	NA	Q8SBF3	Shigella_phage	98.6	1.5e-148
WP_024179079.1|2133420_2133645_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	97.3	9.1e-37
WP_021527492.1|2133641_2134460_+	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	99.6	3.1e-122
WP_072147590.1|2134456_2134951_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.1	4.3e-87
WP_001442792.1|2134950_2135604_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	4.7e-126
WP_000210170.1|2135600_2135927_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000767103.1|2135923_2136313_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
WP_015967850.1|2136332_2137142_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	100.0	6.0e-155
WP_001439745.1|2137149_2138139_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	9.5e-195
WP_001547994.1|2138152_2138905_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	100.0	2.8e-138
WP_000217632.1|2139185_2139611_+	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	100.0	3.6e-74
WP_023307629.1|2139834_2140038_+	phage protein	NA	A0A291AWX6	Escherichia_phage	98.5	2.3e-31
WP_000799656.1|2140188_2141241_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000839596.1|2141307_2141523_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_106023074.1|2141522_2142020_+	lysozyme	NA	A5LH83	Enterobacteria_phage	99.4	4.9e-91
WP_001228685.1|2142236_2142422_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_000232224.1|2142505_2142868_+	hypothetical protein	NA	A5LH85	Enterobacteria_phage	99.2	8.9e-66
WP_000373425.1|2143321_2143816_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_023307630.1|2143815_2145918_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.9	0.0e+00
WP_001072975.1|2145914_2146127_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_016243798.1|2146126_2147635_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.6	3.5e-289
WP_016243797.1|2147579_2149607_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.8	0.0e+00
WP_001097050.1|2149693_2150017_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|2150009_2150285_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677102.1|2150296_2150875_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
WP_001079398.1|2150871_2151273_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211129.1|2151283_2152027_+|tail	tail protein	tail	A5LH35	Enterobacteria_phage	99.6	1.0e-132
WP_001300035.1|2152087_2152474_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_001161009.1|2152482_2152812_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_106023075.1|2152783_2155849_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.6	0.0e+00
WP_000447253.1|2155848_2156178_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_023307632.1|2156187_2156886_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	8.6e-134
WP_032153133.1|2156891_2157635_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.1	4.7e-146
WP_021538849.1|2157532_2158180_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.8	9.5e-111
WP_023307636.1|2158240_2161738_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.2	0.0e+00
WP_001233071.1|2161808_2162408_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
WP_106023101.1|2162472_2165565_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	92.4	1.6e-54
WP_106023076.1|2165564_2166149_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.3	3.0e-103
WP_000355482.1|2166218_2166992_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	37.7	4.1e-36
WP_001288444.1|2167398_2168832_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.1	4.1e-106
WP_012602456.1|2168866_2170081_-	type II restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	7.9e-34
WP_000162574.1|2170886_2171369_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600193.1|2171500_2171977_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117834.1|2171966_2172257_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|2172318_2172660_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880939.1|2172808_2174470_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059176.1|2174555_2175434_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|2175556_2176150_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|2176203_2177490_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001314062.1|2177510_2178302_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|2178468_2179830_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|2179966_2180215_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|2180233_2180782_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264790.1|2180812_2181580_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|2181621_2181969_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589791.1|2182045_2182528_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969008.1|2182543_2183770_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212400.1|2183759_2184278_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001296308.1|2184424_2184790_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168045.1|2184999_2186070_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225212.1|2186080_2187202_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200140.1|2187244_2188405_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|2188503_2188551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|2188654_2188996_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|2189265_2190003_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079111.1|2190137_2191118_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040156.1|2191114_2191846_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|2191975_2194549_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000852119.1|2200335_2201634_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.5	2.4e-44
WP_001467872.1|2201630_2201954_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_001312028.1|2201999_2203355_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082935.1|2203468_2206129_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001296305.1|2206160_2206859_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|2206927_2207347_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997384.1|2207553_2208591_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262723.1|2208638_2209328_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000627804.1|2209632_2210016_+	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_000189207.1|2210071_2210659_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001296304.1|2210761_2211643_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|2211675_2213010_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000083664.1|2213141_2213879_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
>prophage 155
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2218781	2222523	5022408		Tupanvirus(50.0%)	3	NA	NA
WP_001531895.1|2218781_2220581_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|2220596_2221571_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|2221842_2222523_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 156
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2225982	2226243	5022408		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196297.1|2225982_2226243_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	3.8e-18
>prophage 157
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2230362	2241671	5022408		Bacillus_phage(50.0%)	7	NA	NA
WP_001531893.1|2230362_2234250_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	1.1e-129
WP_001296299.1|2234825_2236253_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.9e-16
WP_001215903.1|2236417_2237131_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001296298.1|2237120_2238455_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717694.1|2238515_2238854_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000883165.1|2238898_2240089_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919159.1|2240417_2241671_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 158
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2247429	2248959	5022408		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493440.1|2247429_2248959_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	22.6	7.0e-11
>prophage 159
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2259721	2266059	5022408		Faustovirus(20.0%)	8	NA	NA
WP_001295373.1|2259721_2260936_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|2260963_2261350_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|2261366_2261690_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000384413.1|2261785_2262301_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196613.1|2262317_2264168_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_001124471.1|2264169_2264505_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523612.1|2264516_2264717_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000133610.1|2264775_2266059_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.9e-34
>prophage 160
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2275944	2276376	5022408		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963841.1|2275944_2276376_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	4.8e-18
>prophage 161
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2296869	2303152	5022408		Escherichia_phage(60.0%)	6	NA	NA
WP_000937876.1|2296869_2298237_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	41.2	2.3e-45
WP_001296289.1|2298398_2299865_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
WP_000138282.1|2299933_2301511_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_000755178.1|2301603_2302143_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
WP_000669398.1|2302158_2302674_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_001344399.1|2302978_2303152_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
>prophage 162
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2309587	2313589	5022408		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_001028626.1|2309587_2310226_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
WP_001296287.1|2310225_2311263_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.8e-71
WP_001295473.1|2311587_2312214_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198327.1|2312299_2313589_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	8.6e-63
>prophage 163
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2321067	2321781	5022408		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|2321067_2321781_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 164
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2339022	2339973	5022408		Cyanophage(100.0%)	1	NA	NA
WP_001554214.1|2339022_2339973_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 165
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2358627	2380355	5022408		Streptococcus_phage(25.0%)	22	NA	NA
WP_000102910.1|2358627_2359497_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	3.2e-13
WP_000406012.1|2359710_2360136_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_001296281.1|2360122_2360572_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000838953.1|2360632_2361208_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000084590.1|2361303_2362203_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_001040496.1|2362380_2363805_-	PTS N-acetylmuramic acid transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001175628.1|2363808_2364705_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000517443.1|2364984_2365776_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	6.8e-18
WP_000290263.1|2365933_2366950_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000458408.1|2366949_2367783_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000852686.1|2367782_2368658_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000021034.1|2368647_2369745_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_000105467.1|2369879_2370791_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	1.6e-58
WP_000719965.1|2370793_2371162_-	YfeK family protein	NA	NA	NA	NA	NA
WP_000096640.1|2371266_2372118_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000522247.1|2372160_2372670_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000623108.1|2372710_2374438_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000487600.1|2374482_2374740_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034402.1|2375123_2376095_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000254839.1|2376279_2377041_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_001296279.1|2377270_2378269_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000443709.1|2378339_2380355_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	5.0e-150
>prophage 166
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2405893	2406628	5022408		Clostridioides_phage(100.0%)	1	NA	NA
WP_001296275.1|2405893_2406628_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	2.7e-13
>prophage 167
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2410447	2411368	5022408		Morganella_phage(100.0%)	1	NA	NA
WP_000484018.1|2410447_2411368_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	55.2	2.2e-76
>prophage 168
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2415057	2422634	5022408		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_001283510.1|2415057_2416752_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
WP_000955028.1|2416821_2417766_+	transporter YfdV	NA	NA	NA	NA	NA
WP_001296273.1|2417839_2418985_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_001531852.1|2419040_2422634_-	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	6.2e-10
>prophage 169
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2430883	2444054	5022408	integrase	Enterobacteria_phage(42.86%)	13	2430413:2430432	2442971:2442990
2430413:2430432	attL	ATGGTGTCCCCTGCAGGAAT	NA	NA	NA	NA
WP_000055089.1|2430883_2431111_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	56.1	2.3e-11
WP_023156863.1|2431128_2431974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000270796.1|2432788_2433793_+	oxidoreductase	NA	F1BUM2	Cronobacter_phage	48.3	1.1e-81
WP_001111085.1|2433880_2434471_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	49.2	4.4e-22
WP_000839713.1|2434467_2434704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158701883.1|2434696_2434849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106023079.1|2435572_2435884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000856856.1|2435880_2438568_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	35.0	4.2e-112
WP_000783295.1|2438850_2439123_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	50.0	3.2e-20
WP_000019149.1|2439802_2440684_+	sce7726 family protein	NA	NA	NA	NA	NA
WP_000287253.1|2440705_2441656_+	sce7725 family protein	NA	NA	NA	NA	NA
WP_000926944.1|2441635_2442811_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	63.0	2.8e-145
WP_000368123.1|2443121_2444054_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.6e-167
2442971:2442990	attR	ATGGTGTCCCCTGCAGGAAT	NA	NA	NA	NA
>prophage 170
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2460187	2461273	5022408		Pandoravirus(100.0%)	1	NA	NA
WP_001296258.1|2460187_2461273_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
>prophage 171
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2469809	2470946	5022408		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699128.1|2469809_2470946_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.3	8.5e-22
>prophage 172
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2477604	2479122	5022408		Mollivirus(100.0%)	1	NA	NA
WP_000334229.1|2477604_2479122_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.2	1.6e-87
>prophage 173
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2483333	2484107	5022408		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_001293592.1|2483333_2484107_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 174
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2494777	2498005	5022408		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001203415.1|2494777_2495428_+	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	3.6e-09
WP_001012895.1|2495514_2497347_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000813854.1|2497405_2498005_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 175
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2532971	2537975	5022408		Tupanvirus(50.0%)	4	NA	NA
WP_000860311.1|2532971_2534954_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	3.1e-19
WP_000461638.1|2534953_2535922_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	1.5e-35
WP_000012638.1|2535925_2537065_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	29.8	4.2e-29
WP_000879110.1|2537372_2537975_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	41.7	7.5e-09
>prophage 176
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2541578	2546221	5022408	transposase	Oenococcus_phage(50.0%)	5	NA	NA
WP_001296250.1|2541578_2542784_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	2.7e-26
WP_001296249.1|2542840_2544130_+	MFS transporter	NA	NA	NA	NA	NA
WP_000992982.1|2544147_2544951_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_000150331.1|2544991_2545213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000140602.1|2545225_2546221_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	56.1	1.8e-68
>prophage 177
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2552113	2565931	5022408		Pseudomonas_phage(33.33%)	8	NA	NA
WP_000779086.1|2552113_2553190_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_000301031.1|2553392_2554043_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000135040.1|2554096_2554351_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_106023080.1|2554350_2555481_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	3.3e-175
WP_001075170.1|2555569_2557855_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_012896818.1|2558536_2562295_+	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	26.6	1.3e-21
WP_000990769.1|2562434_2563157_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001281226.1|2563303_2565931_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
>prophage 178
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2580854	2585697	5022408		Bacillus_phage(50.0%)	2	NA	NA
WP_001296244.1|2580854_2582681_-	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	26.5	2.9e-19
WP_000876055.1|2582847_2585697_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.1e-41
>prophage 179
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2589974	2595770	5022408		Enterobacteria_phage(25.0%)	5	NA	NA
WP_000865587.1|2589974_2591096_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.8	2.0e-116
WP_000406076.1|2591207_2592263_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000872491.1|2592336_2593401_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	3.1e-18
WP_000884927.1|2593400_2594051_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.4	1.1e-05
WP_000422200.1|2594126_2595770_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	1.6e-13
>prophage 180
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2604538	2605156	5022408		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|2604538_2605156_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 181
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2615214	2622864	5022408		Vibrio_phage(50.0%)	7	NA	NA
WP_000050789.1|2615214_2616222_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
WP_000494186.1|2616360_2616645_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000578064.1|2616769_2618530_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.0	4.9e-101
WP_001234850.1|2618679_2619375_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213379.1|2619402_2620593_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	3.8e-20
WP_000202798.1|2620926_2621271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194884.1|2621274_2622864_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	2.5e-19
>prophage 182
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2628618	2632919	5022408		Clostridioides_phage(50.0%)	4	NA	NA
WP_000241011.1|2628618_2629185_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_001296239.1|2629596_2630310_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000198798.1|2630348_2631335_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_001296238.1|2631452_2632919_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	2.3e-43
>prophage 183
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2646307	2647165	5022408		Catovirus(100.0%)	1	NA	NA
WP_000873880.1|2646307_2647165_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	35.0	3.1e-24
>prophage 184
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2651233	2655019	5022408		Acinetobacter_phage(50.0%)	3	NA	NA
WP_097768411.1|2651233_2653225_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	35.9	9.7e-13
WP_000425450.1|2653256_2654093_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001139613.1|2654350_2655019_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 185
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2658713	2660234	5022408		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255034.1|2658713_2660234_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 186
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2680594	2690039	5022408		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569347.1|2680594_2681521_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
WP_000783109.1|2681525_2682257_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|2682237_2682345_-	protein YohO	NA	NA	NA	NA	NA
WP_001240408.1|2682404_2683136_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001295431.1|2683357_2685043_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|2685039_2685759_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|2685805_2686276_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|2686316_2686778_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001296230.1|2686902_2688906_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001292786.1|2688902_2690039_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
>prophage 187
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2705845	2707879	5022408	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001296226.1|2705845_2707879_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	2.3e-54
>prophage 188
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2718528	2722085	5022408		Paenibacillus_phage(50.0%)	4	NA	NA
WP_001296225.1|2718528_2719347_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	2.5e-23
WP_000434047.1|2719398_2720145_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011972.1|2720118_2721084_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846228.1|2721080_2722085_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
>prophage 189
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2731223	2737497	5022408	tRNA	Bacillus_phage(50.0%)	6	NA	NA
WP_000807341.1|2731223_2732123_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.5	5.7e-13
WP_001531820.1|2732537_2732855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476014.1|2733354_2734716_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_000929408.1|2734862_2735195_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|2735374_2736097_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675176.1|2736093_2737497_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
>prophage 190
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2750604	2751957	5022408		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469704.1|2750604_2751957_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.2e-06
>prophage 191
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2756680	2768815	5022408		Enterobacteria_phage(50.0%)	9	NA	NA
WP_001295424.1|2756680_2757322_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234767.1|2757413_2757995_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001252365.1|2758016_2759870_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001296218.1|2760321_2761905_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_000183040.1|2764081_2764975_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
WP_000699407.1|2765347_2766433_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
WP_001023641.1|2766432_2767332_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000857525.1|2767389_2768268_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001100793.1|2768272_2768815_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
>prophage 192
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2776096	2778916	5022408		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000043486.1|2776096_2777503_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	2.3e-37
WP_000704867.1|2777749_2778916_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	2.2e-110
>prophage 193
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2786358	2787258	5022408		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|2786358_2787258_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 194
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2791962	2795334	5022408	transposase	Saccharomonospora_phage(50.0%)	3	NA	NA
WP_001531805.1|2791962_2792421_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.2e-11
WP_000980556.1|2792531_2793959_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_001296209.1|2794167_2795334_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
>prophage 195
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2799618	2806070	5022408	transposase	Pseudomonas_phage(16.67%)	9	NA	NA
WP_000086752.1|2799618_2800263_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
WP_000692345.1|2800281_2800503_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186200.1|2800565_2801042_-	RadC family protein	NA	NA	NA	NA	NA
WP_001542276.1|2801057_2801531_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
WP_001164966.1|2801624_2801870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001542275.1|2801869_2802688_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
WP_000846703.1|2802908_2803319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001016257.1|2803767_2804514_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|2804528_2806070_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
>prophage 196
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2816406	2817174	5022408		Bacillus_virus(100.0%)	1	NA	NA
WP_000016207.1|2816406_2817174_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	7.5e-14
>prophage 197
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2820685	2822400	5022408	transposase	Escherichia_phage(100.0%)	2	NA	NA
WP_000255956.1|2820685_2821708_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_072093906.1|2821704_2822400_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	88.4	2.3e-118
>prophage 198
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2840437	2842290	5022408		Mycobacterium_phage(50.0%)	2	NA	NA
WP_001542270.1|2840437_2841661_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.5	2.0e-61
WP_000502870.1|2841645_2842290_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.5	8.2e-54
>prophage 199
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2869216	2912921	5022408	transposase,integrase	Bacillus_phage(41.67%)	26	2856472:2856486	2895429:2895443
2856472:2856486	attL	CAGTTCCCGCCAGCA	NA	NA	NA	NA
WP_000369500.1|2869216_2878708_-	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
WP_000623045.1|2878795_2884903_-	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	1.8e-33
WP_000140402.1|2885093_2886053_-	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_000098394.1|2886219_2888022_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.6	6.5e-32
WP_000654452.1|2888008_2889811_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
WP_001286284.1|2889803_2891084_+	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_000703040.1|2891111_2892416_+	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_000060157.1|2892609_2893872_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.5	2.6e-72
WP_001311896.1|2894209_2895007_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001007778.1|2895859_2896510_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
2895429:2895443	attR	TGCTGGCGGGAACTG	NA	NA	NA	NA
WP_099156434.1|2896770_2898118_+|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_106023083.1|2898202_2898838_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_000740067.1|2898838_2899843_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_000920127.1|2899951_2900365_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_001347103.1|2900497_2901169_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826711.1|2901168_2902527_+	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_000218217.1|2902634_2903486_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000824383.1|2904078_2905194_-	outer membrane protein F	NA	Q1MVN1	Enterobacteria_phage	47.4	2.9e-91
WP_001330593.1|2905759_2906125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296176.1|2906164_2906860_+	phosphohydrolase	NA	S4W232	Pandoravirus	28.7	1.6e-07
WP_001157265.1|2906926_2908345_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
WP_000228686.1|2908325_2908796_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	5.2e-34
WP_001212226.1|2908784_2909705_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922683.1|2909877_2910795_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009307.1|2910873_2911056_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001531784.1|2911226_2912921_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
>prophage 200
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	2928902	3044416	5022408	transposase,capsid,tRNA,tail,terminase,portal,plate,holin,integrase	Escherichia_phage(19.23%)	134	2950026:2950085	2994530:2994654
WP_001347174.1|2928902_2929427_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.0	2.2e-33
WP_023142167.1|2929449_2929779_+	helix-turn-helix domain-containing protein	NA	A0A1B0VCD8	Salmonella_phage	85.6	4.0e-41
WP_077791361.1|2929660_2930146_-	hypothetical protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	70.2	5.6e-47
WP_000422741.1|2930207_2930633_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|2930629_2930980_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|2931010_2932624_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000790504.1|2932806_2933040_-	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000118897.1|2933036_2934242_-	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_001296171.1|2934428_2934842_+	lipoprotein	NA	NA	NA	NA	NA
WP_001245699.1|2934875_2936363_-	alpha-amylase	NA	NA	NA	NA	NA
WP_001057839.1|2936440_2936806_-	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000270663.1|2936805_2937216_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000146831.1|2937231_2938647_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000079759.1|2938894_2939944_+	flagellin FliC	NA	NA	NA	NA	NA
WP_001087463.1|2940107_2940827_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_001296169.1|2940872_2941424_+	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
WP_001296168.1|2941511_2942312_+	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001128232.1|2942416_2943403_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_001158220.1|2943417_2944086_+	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_001273000.1|2944082_2944835_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	2.9e-26
WP_001154255.1|2945064_2945787_+	transcriptional regulator SdiA	NA	NA	NA	NA	NA
WP_000106474.1|2945854_2946079_-	DUF2594 family protein	NA	NA	NA	NA	NA
WP_001307856.1|2946065_2946242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611328.1|2946537_2947194_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_001283421.1|2947190_2949023_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_001160187.1|2949079_2949628_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
2950026:2950085	attL	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGG	NA	NA	NA	NA
WP_001531780.1|2950211_2951228_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
WP_000833838.1|2951196_2951460_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_000916334.1|2951669_2951852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000100753.1|2951851_2952421_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
WP_000151806.1|2952417_2954634_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000388260.1|2954664_2954985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296165.1|2955995_2956409_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000360804.1|2956507_2956738_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_000431205.1|2956796_2957273_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000943914.1|2957312_2957537_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_001023813.1|2957533_2958289_+	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000609322.1|2958278_2959694_+	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
WP_000214056.1|2959732_2960143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000918616.1|2960144_2960381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|2960377_2960689_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000661082.1|2960685_2960910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531776.1|2961590_2962379_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_001237642.1|2962553_2963477_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000536231.1|2964665_2965364_+	hypothetical protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
WP_001138663.1|2965826_2966432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|2966441_2966930_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_000536919.1|2967328_2967562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847617.1|2967805_2968447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343765.1|2968600_2969821_-|transposase	ISL3-like element ISEc53 family transposase	transposase	NA	NA	NA	NA
WP_000115885.1|2969839_2970358_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_001025459.1|2970491_2970671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000057010.1|2970748_2971345_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_000717783.1|2971341_2971635_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000064384.1|2971634_2972306_+	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_001294589.1|2972418_2972802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000172496.1|2972801_2973074_+|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_000131873.1|2973073_2973553_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000734931.1|2973560_2973755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531775.1|2973814_2974060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000168117.1|2974428_2974995_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_000148195.1|2974981_2976844_+|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000203897.1|2976843_2977077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126513.1|2977073_2978648_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_001145892.1|2978647_2979955_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_000206292.1|2979954_2980284_+	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001283997.1|2980342_2981377_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_000105179.1|2981411_2981831_+	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001531773.1|2981827_2982208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|2982239_2982920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015612.1|2982916_2983453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000079174.1|2983433_2984336_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000901289.1|2984338_2984680_+|plate	phage baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000633314.1|2984676_2985597_+|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
WP_000203868.1|2985599_2986226_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_000829621.1|2986218_2987403_+|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000626358.1|2987402_2987792_+	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_000117510.1|2987788_2989291_+|tail	tail sheath protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000785563.1|2989308_2989821_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000444667.1|2989833_2990115_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001018353.1|2990223_2991864_+	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_001531768.1|2991899_2992289_+|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001531767.1|2992450_2992675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296152.1|2993889_2994309_+	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_000847882.1|2994780_2995446_+	UPF0149 family protein YecA	NA	NA	NA	NA	NA
2994530:2994654	attR	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTTTGT	NA	NA	NA	NA
WP_000797555.1|2995496_2996708_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000377224.1|2996898_2997138_+	YecH family protein	NA	NA	NA	NA	NA
WP_000917208.1|2997175_2997673_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_001237881.1|2997844_2998168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723106.1|2998431_2998518_+	stress response protein AzuC	NA	NA	NA	NA	NA
WP_000082127.1|2998632_2998884_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_000179469.1|2998961_2999465_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000548680.1|3000259_3001249_+	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001187827.1|3001318_3002833_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
WP_000100203.1|3002847_3003834_+	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001296149.1|3004000_3004801_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001296148.1|3004775_3006200_+	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_000122413.1|3006206_3006635_-	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295647.1|3007414_3007765_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_001291603.1|3007767_3008346_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_000906342.1|3008472_3009360_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_000795641.1|3009356_3010283_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_001531763.1|3010287_3012252_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000147302.1|3012272_3012776_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001296146.1|3012920_3014582_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000204320.1|3014872_3015733_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036371.1|3015735_3016785_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|3016799_3017189_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000983600.1|3017199_3017844_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_001278946.1|3018032_3019181_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000066973.1|3019173_3021252_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001202076.1|3021251_3021644_+	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_001025326.1|3021696_3023430_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001490174.1|3023645_3024212_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185734.1|3024225_3024972_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214293.1|3025359_3026460_+	cytochrome c	NA	NA	NA	NA	NA
WP_000176764.1|3026484_3028914_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_000564759.1|3028949_3029921_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|3029917_3030661_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|3030701_3031097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000639277.1|3031149_3031968_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000891625.1|3031964_3032531_-	hydrolase	NA	NA	NA	NA	NA
WP_001258676.1|3032840_3034613_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_077249130.1|3034605_3035058_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907234.1|3035086_3035827_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295503.1|3035861_3036383_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024911.1|3036384_3036987_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_072093883.1|3037057_3037123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|3037261_3037873_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568520.1|3037881_3038892_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571478.1|3040529_3041315_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|3041311_3042067_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001347089.1|3042145_3043078_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|3043093_3044416_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 201
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3048414	3049890	5022408		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|3048414_3049890_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 202
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3057946	3062415	5022408		Klebsiella_phage(33.33%)	7	NA	NA
WP_000944256.1|3057946_3058609_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011664.1|3058632_3059289_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|3059390_3059621_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168747.1|3059759_3060134_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879317.1|3060137_3061010_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976472.1|3061022_3061364_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812745.1|3061758_3062415_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	2.3e-56
>prophage 203
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3069910	3071959	5022408		Moraxella_phage(100.0%)	1	NA	NA
WP_001055794.1|3069910_3071959_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 204
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3077291	3077501	5022408		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|3077291_3077501_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 205
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3083142	3084699	5022408		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|3083142_3084699_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 206
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3088561	3089923	5022408		Pandoravirus(100.0%)	1	NA	NA
WP_000854961.1|3088561_3089923_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	1.7e-40
>prophage 207
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3094971	3096657	5022408		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000758422.1|3094971_3096657_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
>prophage 208
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3105624	3110201	5022408		Bacillus_phage(100.0%)	3	NA	NA
WP_001296127.1|3105624_3107115_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
WP_000621382.1|3107295_3108771_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000219684.1|3108917_3110201_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 209
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3113519	3114374	5022408		Indivirus(100.0%)	1	NA	NA
WP_001296125.1|3113519_3114374_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 210
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3123187	3127273	5022408		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000723696.1|3123187_3124168_+	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	3.0e-07
WP_000719098.1|3124304_3125063_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_001524794.1|3125180_3126539_+	MFS transporter	NA	NA	NA	NA	NA
WP_001135068.1|3126631_3127273_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	36.0	2.9e-19
>prophage 211
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3132990	3134946	5022408		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235830.1|3132990_3134946_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.1e-40
>prophage 212
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3139336	3139990	5022408		Bacillus_phage(100.0%)	1	NA	NA
WP_001296116.1|3139336_3139990_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	8.7e-11
>prophage 213
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3146753	3147974	5022408		Klosneuvirus(100.0%)	1	NA	NA
WP_000082031.1|3146753_3147974_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	3.2e-27
>prophage 214
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3155450	3156278	5022408		Bacillus_virus(100.0%)	1	NA	NA
WP_000175016.1|3155450_3156278_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.2	3.5e-73
>prophage 215
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3162403	3164665	5022408		Tupanvirus(100.0%)	1	NA	NA
WP_000077883.1|3162403_3164665_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	5.1e-143
>prophage 216
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3174813	3194408	5022408	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_001144199.1|3174813_3176742_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	1.6e-129
WP_001700733.1|3176745_3177288_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|3177384_3177582_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|3177634_3177991_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|3178113_3178158_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018588.1|3178441_3179425_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_000672320.1|3179439_3181827_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|3181831_3182131_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000956533.1|3182231_3183212_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154187.1|3183274_3183826_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029460.1|3183825_3184575_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001209785.1|3184652_3185117_+	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_001296111.1|3185364_3186078_+	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_000175632.1|3186140_3187577_+	YdiU family protein	NA	NA	NA	NA	NA
WP_001270810.1|3187580_3187772_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082226.1|3187903_3188950_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_000368046.1|3189106_3189940_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_000069403.1|3190272_3192651_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	5.5e-172
WP_000553669.1|3192707_3194408_-	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.7	1.8e-31
>prophage 217
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3212827	3217911	5022408		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_000367158.1|3212827_3213196_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	38.5	5.6e-15
WP_001296103.1|3213204_3214692_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000948882.1|3214701_3215448_+	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.0	5.1e-07
WP_000907957.1|3215422_3216694_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000144583.1|3216690_3217911_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.7	4.4e-93
>prophage 218
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3226199	3228466	5022408		Escherichia_phage(50.0%)	3	NA	NA
WP_001296101.1|3226199_3226868_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.7e-22
WP_001070015.1|3226864_3227650_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_000587585.1|3227653_3228466_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 219
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3234748	3243552	5022408		Orpheovirus(20.0%)	9	NA	NA
WP_000493947.1|3234748_3235390_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
WP_000098896.1|3235429_3236578_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_001182336.1|3236868_3238080_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000269498.1|3238192_3239125_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190985.1|3239121_3240147_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	2.8e-32
WP_000102278.1|3240445_3240535_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000701057.1|3240700_3241870_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007273.1|3242015_3242597_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	44.8	3.1e-44
WP_000101207.1|3242724_3243552_-	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 220
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3247967	3249466	5022408		Indivirus(50.0%)	2	NA	NA
WP_000250634.1|3247967_3248864_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	2.1e-07
WP_001296099.1|3248944_3249466_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	1.7e-46
>prophage 221
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3256377	3257652	5022408	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|3256377_3257652_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 222
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3277734	3279546	5022408		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945867.1|3277734_3279546_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.5	0.0e+00
>prophage 223
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3289441	3290743	5022408		Bacillus_phage(100.0%)	1	NA	NA
WP_000732519.1|3289441_3290743_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.6	2.5e-17
>prophage 224
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3308506	3323090	5022408		Escherichia_phage(37.5%)	14	NA	NA
WP_000148693.1|3308506_3309121_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526467.1|3309163_3310018_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|3310019_3310637_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000041660.1|3312277_3314704_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
WP_001296085.1|3314902_3315208_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001296084.1|3315315_3316026_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|3316028_3316589_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705204.1|3316623_3316965_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|3317099_3317426_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001296083.1|3317631_3318846_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.2	8.2e-47
WP_000836081.1|3318857_3319877_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.3	3.7e-16
WP_000151247.1|3319934_3321302_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000526709.1|3321390_3322851_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	1.3e-43
WP_000214712.1|3322886_3323090_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 225
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3327476	3328367	5022408		Bacillus_phage(100.0%)	1	NA	NA
WP_000592832.1|3327476_3328367_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-20
>prophage 226
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3331369	3331753	5022408		Streptococcus_phage(100.0%)	1	NA	NA
WP_000091198.1|3331369_3331753_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 227
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3338496	3339915	5022408		Bacillus_phage(100.0%)	1	NA	NA
WP_000558459.1|3338496_3339915_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 228
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3366980	3369380	5022408		Klosneuvirus(100.0%)	1	NA	NA
WP_001296069.1|3366980_3369380_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	21.5	3.5e-09
>prophage 229
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3372784	3374542	5022408		Tupanvirus(50.0%)	2	NA	NA
WP_000642417.1|3372784_3373795_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.6	3.3e-25
WP_000781370.1|3374257_3374542_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 230
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3385787	3387332	5022408		Escherichia_phage(100.0%)	1	NA	NA
WP_000702528.1|3385787_3387332_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 231
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3396295	3398398	5022408		Salmonella_phage(100.0%)	1	NA	NA
WP_000689332.1|3396295_3398398_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	66.8	1.9e-136
>prophage 232
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3403895	3404909	5022408		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000220422.1|3403895_3404909_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.4	4.6e-27
>prophage 233
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3408538	3410500	5022408		Phage_TP(100.0%)	1	NA	NA
WP_012896797.1|3408538_3410500_-	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.6	3.5e-23
>prophage 234
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3422350	3423299	5022408		Moraxella_phage(50.0%)	2	NA	NA
WP_000731859.1|3422350_3422524_-	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001531678.1|3422768_3423299_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
>prophage 235
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3427252	3431155	5022408		Klosneuvirus(100.0%)	1	NA	NA
WP_000139528.1|3427252_3431155_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	1.7e-53
>prophage 236
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3446043	3447033	5022408		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|3446043_3447033_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 237
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3451992	3461411	5022408	tRNA	Enterobacteria_phage(20.0%)	6	NA	NA
WP_000837933.1|3451992_3453126_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	54.1	1.5e-103
WP_001295593.1|3453266_3453701_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001157412.1|3456026_3456962_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	2.2e-145
WP_000123789.1|3457089_3458463_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	1.5e-52
WP_000387388.1|3458940_3459924_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001296045.1|3460178_3461411_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 238
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3466183	3466699	5022408		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945011.1|3466183_3466699_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 239
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3483923	3485006	5022408		Planktothrix_phage(100.0%)	1	NA	NA
WP_000068009.1|3483923_3485006_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	1.6e-22
>prophage 240
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3504347	3506365	5022408		Bacillus_virus(50.0%)	2	NA	NA
WP_000573407.1|3504347_3505154_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_000135013.1|3505201_3506365_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	27.2	5.6e-29
>prophage 241
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3515299	3517234	5022408		Lactococcus_phage(100.0%)	1	NA	NA
WP_000485012.1|3515299_3517234_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	28.1	2.8e-33
>prophage 242
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3525046	3525637	5022408		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176294.1|3525046_3525637_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 243
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3530547	3603526	5022408	transposase,capsid,head,tail,terminase,portal,protease,holin,integrase	Stx2-converting_phage(24.56%)	81	3562697:3562711	3604490:3604504
WP_001304419.1|3530547_3533145_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
WP_001031530.1|3533524_3533776_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422062.1|3533811_3534861_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559273.1|3535080_3535839_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_001278898.1|3535835_3536426_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001000715.1|3536482_3536791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023141019.1|3536800_3537787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001291206.1|3537992_3538868_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001296033.1|3539080_3540976_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|3541003_3541624_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285702.1|3541620_3542502_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|3542639_3542684_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194644.1|3542775_3544338_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763535.1|3544337_3545933_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001195273.1|3545936_3547295_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000209513.1|3547306_3548500_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443082.1|3548499_3549306_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_001296031.1|3549681_3549957_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
WP_001348267.1|3549953_3550511_+	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
WP_000937495.1|3550922_3551192_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000240999.1|3551248_3551917_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001421220.1|3552115_3552298_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
WP_022645053.1|3552525_3553311_+	hypothetical protein	NA	Q858V4	Yersinia_virus	77.8	1.3e-109
WP_000972097.1|3553312_3553846_+|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
WP_001164137.1|3553876_3554404_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
WP_071550361.1|3554419_3557326_-	hypothetical protein	NA	A0A0F7LDR4	Escherichia_phage	45.9	1.1e-118
WP_001016257.1|3557787_3558534_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|3558548_3560090_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_000514710.1|3560730_3564204_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
3562697:3562711	attL	CGGGTGGCAGCATCA	NA	NA	NA	NA
WP_061089814.1|3564546_3565179_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	3.0e-101
WP_000194730.1|3565124_3565868_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
WP_001296027.1|3565878_3566577_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
WP_000807937.1|3566576_3566918_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
WP_000212991.1|3566910_3570153_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.6	0.0e+00
WP_001513217.1|3570200_3570410_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000710949.1|3570505_3570880_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001275441.1|3570894_3571611_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000133388.1|3571677_3572022_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3572018_3572465_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3572461_3572812_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|3572821_3573148_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_000267294.1|3573144_3575730_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_001063099.1|3575675_3575897_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173031.1|3575941_3577879_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001296023.1|3577942_3579604_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_000958366.1|3579600_3580164_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
WP_000829185.1|3580454_3580820_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_000095741.1|3580861_3581062_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000736382.1|3581260_3581476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|3581561_3581747_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_032140280.1|3581968_3582055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992071.1|3582609_3583143_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_000369850.1|3583248_3583521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193278.1|3583486_3583831_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000284510.1|3583835_3584051_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_016230612.1|3584201_3586055_-	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_000871291.1|3586315_3586651_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_023142244.1|3586931_3587063_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
WP_000024331.1|3587864_3588914_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
WP_000917751.1|3589065_3589263_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_001513213.1|3589489_3590311_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
WP_000140014.1|3590307_3590688_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
WP_001265085.1|3590688_3591744_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_001329966.1|3591745_3592018_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_000018429.1|3592185_3592398_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_000150294.1|3592578_3593244_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001151161.1|3593418_3593844_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_000450998.1|3593859_3594630_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_000788950.1|3594651_3595398_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000095675.1|3595404_3596367_-	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000693845.1|3596389_3596815_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000471549.1|3596811_3597027_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000103687.1|3597076_3597793_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
WP_000379589.1|3598065_3598221_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171951.1|3598380_3598599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023142248.1|3598647_3598815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449179.1|3599164_3599353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001090200.1|3599349_3599541_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_016230610.1|3599633_3602105_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
WP_000113189.1|3602169_3602418_+	excisionase	NA	NA	NA	NA	NA
WP_000113700.1|3602395_3603526_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
3604490:3604504	attR	TGATGCTGCCACCCG	NA	NA	NA	NA
>prophage 244
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3611457	3613472	5022408		Bacillus_virus(50.0%)	2	NA	NA
WP_000994905.1|3611457_3612462_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_000110940.1|3612458_3613472_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 245
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3623038	3629401	5022408		Citrobacter_phage(33.33%)	7	NA	NA
WP_000068069.1|3623038_3623656_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.1	1.7e-53
WP_001287378.1|3624259_3624673_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718995.1|3624817_3625726_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_000193451.1|3625927_3626941_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_001226476.1|3627032_3627938_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_001311640.1|3628050_3628509_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555842.1|3628558_3629401_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
>prophage 246
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3638054	3639593	5022408		Escherichia_phage(100.0%)	1	NA	NA
WP_000702647.1|3638054_3639593_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.7	4.8e-20
>prophage 247
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3650715	3656993	5022408		Spodoptera_litura_granulovirus(33.33%)	8	NA	NA
WP_000120702.1|3650715_3650955_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	39.0	2.6e-05
WP_000063608.1|3651224_3652325_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_001531632.1|3652729_3652837_+	small toxic polypeptide ldrA/ldrC	NA	NA	NA	NA	NA
WP_000811065.1|3652985_3653840_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_001257044.1|3653875_3654685_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000200375.1|3654688_3655081_-	SirB family protein	NA	NA	NA	NA	NA
WP_000456450.1|3655077_3655911_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000804726.1|3655910_3656993_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 248
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3660129	3667920	5022408	transposase,tRNA,integrase	Tupanvirus(25.0%)	8	3655305:3655319	3674598:3674612
3655305:3655319	attL	GCTCAAAGCGGACAT	NA	NA	NA	NA
WP_001298109.1|3660129_3661077_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033350.1|3661201_3662881_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	6.0e-24
WP_000823885.1|3662935_3663214_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152940.1|3663491_3664076_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505872.1|3664192_3665284_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000954595.1|3665498_3666674_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	39.4	1.7e-73
WP_000537155.1|3666784_3667069_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077249438.1|3667065_3667920_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.2	1.6e-81
3674598:3674612	attR	GCTCAAAGCGGACAT	NA	NA	NA	NA
>prophage 249
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3678106	3685305	5022408	transposase,integrase	Stx2-converting_phage(33.33%)	11	3664284:3664297	3684347:3684360
3664284:3664297	attL	ACTTTCCATTCTGC	NA	NA	NA	NA
WP_001095671.1|3678106_3678304_-	AlpA family phage regulatory protein	NA	A0A1V0E888	Vibrio_phage	43.9	7.3e-06
WP_000580009.1|3678526_3679141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023141324.1|3679127_3680057_-|integrase	site-specific integrase	integrase	A0A1B1P7C7	Bacillus_phage	28.5	4.4e-08
WP_000177770.1|3680103_3680556_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_024195553.1|3680554_3680782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422741.1|3680796_3681222_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|3681218_3681569_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|3681599_3683213_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_063270541.1|3683678_3684071_-	DUF2787 family protein	NA	NA	NA	NA	NA
WP_006324788.1|3684425_3684782_-	hypothetical protein	NA	NA	NA	NA	NA
3684347:3684360	attR	ACTTTCCATTCTGC	NA	NA	NA	NA
WP_001531625.1|3685035_3685305_+	transcriptional regulator	NA	A0A0C4UQU0	Shigella_phage	58.7	3.4e-14
>prophage 250
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3703921	3704680	5022408		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000173310.1|3703921_3704680_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.5e-14
>prophage 251
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3720597	3722285	5022408		Salmonella_phage(50.0%)	2	NA	NA
WP_000457596.1|3720597_3721866_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.5	9.6e-208
WP_000897376.1|3721865_3722285_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	61.3	6.9e-38
>prophage 252
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3736481	3738252	5022408		Enterobacteria_phage(50.0%)	4	NA	NA
WP_000332288.1|3736481_3737213_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	51.0	2.1e-53
WP_000373104.1|3737433_3737838_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_023146274.1|3737890_3738016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000539892.1|3738099_3738252_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
>prophage 253
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3741871	3792564	5022408	capsid,head,tail,tRNA,terminase,portal,holin,lysis,integrase	Enterobacteria_phage(53.85%)	64	3736218:3736233	3797863:3797878
3736218:3736233	attL	CTGTTTTCCAAAGCTA	NA	NA	NA	NA
WP_000983716.1|3741871_3742699_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	29.0	1.9e-07
WP_001101732.1|3742695_3743553_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968127.1|3743549_3744407_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_000355360.1|3744498_3744792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000654172.1|3744804_3745083_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
WP_000290538.1|3745079_3747101_-	hypothetical protein	NA	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
WP_001531667.1|3747159_3750642_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_023149564.1|3750702_3751305_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	2.1e-88
WP_023146277.1|3751241_3751985_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_001152626.1|3751989_3752688_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_000847375.1|3752687_3753017_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_000840216.1|3753013_3755575_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
WP_000459457.1|3755567_3756002_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479203.1|3755983_3756406_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
WP_001295979.1|3756421_3757162_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
WP_000683150.1|3757169_3757565_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
WP_000985120.1|3757561_3758140_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.7	5.9e-80
WP_000753018.1|3758151_3758505_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
WP_000158908.1|3758516_3758915_-	DNA packaging protein from bacteriophage origin	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
WP_000063293.1|3758956_3759982_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
WP_001295978.1|3760037_3760370_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123268.1|3760379_3761699_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
WP_001295977.1|3761679_3763281_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
WP_000198149.1|3763277_3763484_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027261.1|3763480_3765406_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453620.1|3765380_3765926_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_000881610.1|3766489_3766672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|3766878_3767205_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001298464.1|3767685_3767979_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_001228695.1|3768069_3768252_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001180486.1|3768468_3768945_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
WP_000544528.1|3768931_3769237_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097224.1|3769558_3770248_-	antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
WP_000971096.1|3770244_3770385_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
WP_001099488.1|3770381_3770744_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_000774479.1|3770740_3771031_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_000224914.1|3771023_3771194_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053005.1|3771193_3771649_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
WP_072147164.1|3771645_3771747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000700202.1|3772096_3773140_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_022645049.1|3773176_3777442_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000788794.1|3777691_3778393_-	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
WP_001435464.1|3778389_3779319_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	6.1e-111
WP_001182900.1|3779405_3779945_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_001067458.1|3780014_3780245_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|3780349_3781039_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000233576.1|3781634_3781841_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995418.1|3781916_3782213_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
WP_000100847.1|3782218_3783004_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186848.1|3783000_3783681_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000149537.1|3783677_3783860_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000548516.1|3783832_3784024_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_021533932.1|3784034_3784316_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
WP_000763374.1|3784414_3784636_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000002139.1|3784635_3784962_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000490213.1|3784945_3785185_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000088653.1|3785324_3785561_+	excisionase	NA	NA	NA	NA	NA
WP_000741335.1|3785550_3786693_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000444487.1|3786806_3788057_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248677.1|3788228_3788882_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3788891_3789353_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001295972.1|3789406_3790513_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001295971.1|3790548_3791190_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423736.1|3791193_3792564_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	7.9e-107
3797863:3797878	attR	CTGTTTTCCAAAGCTA	NA	NA	NA	NA
>prophage 254
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3797585	3799563	5022408		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000531594.1|3797585_3798722_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799382.1|3798705_3799563_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	26.2	4.3e-10
>prophage 255
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3802838	3806561	5022408		Vibrio_phage(50.0%)	4	NA	NA
WP_000952746.1|3802838_3803660_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000291272.1|3803675_3804587_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_001251354.1|3804615_3805860_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001033695.1|3805859_3806561_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
>prophage 256
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3813847	3814105	5022408		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|3813847_3814105_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 257
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3826427	3828070	5022408		Streptococcus_virus(50.0%)	2	NA	NA
WP_001267919.1|3826427_3827432_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
WP_001257002.1|3827428_3828070_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 258
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3831342	3832524	5022408		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|3831342_3831579_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_001008535.1|3831789_3832524_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
>prophage 259
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3844880	3845822	5022408		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295961.1|3844880_3845822_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 260
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3861702	3861948	5022408		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|3861702_3861948_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 261
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3866609	3867530	5022408		Morganella_phage(100.0%)	1	NA	NA
WP_001295958.1|3866609_3867530_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.9	3.9e-57
>prophage 262
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3876837	3877371	5022408		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|3876837_3877371_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 263
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3881508	3882342	5022408		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189322.1|3881508_3882342_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 264
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3885733	3887101	5022408		Bacillus_phage(100.0%)	1	NA	NA
WP_000409838.1|3885733_3887101_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	2.5e-20
>prophage 265
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3893919	3894984	5022408		Cronobacter_phage(100.0%)	1	NA	NA
WP_000258777.1|3893919_3894984_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	3.6e-91
>prophage 266
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3909305	3911405	5022408		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001028098.1|3909305_3909800_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
WP_001295943.1|3909820_3911149_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	5.3e-233
WP_001273658.1|3911231_3911405_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
>prophage 267
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3914435	3926852	5022408		Klosneuvirus(20.0%)	13	NA	NA
WP_000420625.1|3914435_3915356_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
WP_000024569.1|3915355_3915661_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209903.1|3915915_3916515_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001063148.1|3916511_3919058_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.8	1.5e-71
WP_001230247.1|3919057_3920230_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120112.1|3920359_3921052_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264949.1|3921024_3922053_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001054734.1|3922135_3924868_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.5	1.8e-38
WP_000818460.1|3924950_3926024_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|3926072_3926246_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309400.1|3926235_3926466_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|3926440_3926629_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|3926639_3926852_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
>prophage 268
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3937849	3938509	5022408	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|3937849_3938509_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 269
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3942743	3944798	5022408		Bacillus_phage(100.0%)	1	NA	NA
WP_001295938.1|3942743_3944798_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
>prophage 270
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3957408	3959316	5022408		Tupanvirus(100.0%)	1	NA	NA
WP_000053085.1|3957408_3959316_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
>prophage 271
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3967283	3978869	5022408	tRNA	Bacillus_virus(33.33%)	9	NA	NA
WP_023363144.1|3967283_3968075_+	aliphatic sulfonate ABC transporter permease SsuC	NA	G3M9Y4	Bacillus_virus	24.5	1.4e-15
WP_001090493.1|3968071_3968839_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	7.5e-30
WP_000193867.1|3968881_3971494_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	5.3e-19
WP_001295933.1|3971759_3972962_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117888.1|3973130_3974531_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	6.9e-82
WP_000977908.1|3975133_3976222_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	2.8e-99
WP_000462681.1|3976406_3977597_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_001109456.1|3977646_3978294_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|3978320_3978869_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 272
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	3987621	4148765	5022408	transposase,tRNA,head,tail,capsid,plate,terminase,portal,protease,holin,lysis,integrase	Enterobacteria_phage(37.76%)	192	4061941:4061960	4115783:4115802
WP_001295930.1|3987621_3988407_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899600.1|3988542_3989322_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436917.1|3989298_3990192_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011610.1|3990345_3991092_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350057.1|3991088_3991271_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056492.1|3991322_3992555_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000570547.1|3992591_3993578_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551259.1|3993574_3995323_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
WP_000705731.1|3995359_3997624_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|3997829_3998114_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|3998273_3999947_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|4000057_4000741_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_029364556.1|4000913_4001696_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_001281701.1|4001839_4002229_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
WP_001170114.1|4002200_4002650_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
WP_000206212.1|4002651_4002858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000631813.1|4002847_4003078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000132039.1|4003074_4003758_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
WP_000763554.1|4003754_4003970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295929.1|4003984_4004281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000632576.1|4004290_4004563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|4004851_4005382_-	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000843446.1|4005409_4005679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960679.1|4005681_4006848_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
WP_000186588.1|4006858_4008628_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
WP_001095645.1|4008643_4008961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000533817.1|4008960_4009881_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
WP_000047759.1|4009891_4010200_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
WP_000123378.1|4010252_4010441_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000031013.1|4010534_4010891_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000783854.1|4011007_4011772_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_001069611.1|4011962_4012178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000972294.1|4012176_4012581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194951.1|4012556_4013285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000793146.1|4013415_4013766_+	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_001104440.1|4013768_4014509_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000264665.1|4014492_4015143_+	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
WP_000175099.1|4015139_4015466_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
WP_000227701.1|4015465_4015777_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000124060.1|4015776_4016322_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
WP_000167500.1|4016318_4017914_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.5e-185
WP_000090684.1|4017913_4019410_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
WP_000117548.1|4019390_4020212_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
WP_000135514.1|4020214_4020673_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_001273074.1|4020887_4022003_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_001286908.1|4022017_4022971_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_000537457.1|4022980_4023319_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_000271668.1|4023320_4023767_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_001101804.1|4023766_4024231_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_012602372.1|4024227_4024482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729834.1|4024471_4025899_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_000034294.1|4025898_4026420_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
WP_000110114.1|4026422_4026704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084213.1|4026801_4027137_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001202894.1|4027060_4027219_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000016538.1|4027294_4030246_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
WP_000458387.1|4030245_4031130_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_012602373.1|4031126_4031342_+	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000808007.1|4031329_4032484_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
WP_000148266.1|4032480_4033077_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
WP_000859111.1|4033131_4033479_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_001219098.1|4033469_4034573_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
WP_000138756.1|4034565_4035144_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_023363137.1|4035146_4036394_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	43.7	2.0e-40
WP_023142129.1|4036404_4036866_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.0	3.9e-34
WP_000072165.1|4036872_4037487_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
WP_063269479.1|4037486_4038011_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	48.6	1.8e-35
WP_000904922.1|4038070_4038643_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_000445240.1|4038898_4040182_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057158.1|4040252_4041341_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
WP_000642852.1|4041539_4042232_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000194832.1|4042361_4044122_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_001295917.1|4044527_4045385_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292822.1|4045439_4047722_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000468308.1|4048041_4048260_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_075591691.1|4048341_4049505_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.1e-205
WP_000978914.1|4049504_4049984_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	99.4	4.3e-84
WP_106023102.1|4049998_4050886_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	88.8	2.1e-124
WP_001298859.1|4051129_4052671_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|4052685_4053432_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_106023089.1|4053502_4055032_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	93.5	9.7e-247
WP_024193776.1|4055024_4055180_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	98.0	2.0e-22
WP_021540560.1|4055176_4055452_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	94.5	1.2e-38
WP_001251408.1|4055508_4056027_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286725.1|4056039_4057230_-|tail	phage tail sheath protein	tail	Q858V1	Yersinia_virus	99.7	2.8e-225
WP_048266375.1|4057601_4058093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071598983.1|4058102_4058510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106023090.1|4058766_4059345_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	65.4	5.2e-68
WP_106023091.1|4059344_4061969_-|tail	phage tail protein	tail	Q858V4	Yersinia_virus	95.9	0.0e+00
4061941:4061960	attL	GTGATAACGGTTTTAAATTT	NA	NA	NA	NA
WP_001285320.1|4061979_4062510_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	98.9	1.1e-101
WP_048266373.1|4062502_4063411_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.3	4.4e-162
WP_048266372.1|4063415_4063763_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	98.3	1.5e-57
WP_048266371.1|4063759_4064401_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	90.7	1.1e-98
WP_048266370.1|4064467_4064920_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	1.4e-76
WP_000917145.1|4064912_4065380_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	8.7e-82
WP_001300730.1|4065342_4065516_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_048266368.1|4065487_4065913_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	96.5	2.1e-66
WP_048266367.1|4065900_4066326_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	95.7	1.0e-57
WP_048266366.1|4066340_4066838_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	9.0e-93
WP_000123124.1|4066837_4067119_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_000846409.1|4067122_4067326_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_048266365.1|4067325_4067835_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	4.3e-90
WP_048266364.1|4067934_4068678_-|terminase	terminase endonuclease subunit	terminase	Q94MK1	Enterobacteria_phage	98.4	2.6e-120
WP_048266363.1|4068681_4069755_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK7	Enterobacteria_phage	99.2	7.4e-201
WP_001085948.1|4069813_4070668_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_006678250.1|4070841_4072614_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_097314642.1|4072613_4073648_+|portal	phage portal protein	portal	U5N087	Enterobacteria_phage	99.1	1.2e-200
WP_048266361.1|4073978_4074677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048266360.1|4074881_4075613_-	hypothetical protein	NA	A0A218M4H5	Erwinia_phage	79.8	4.1e-110
WP_048266359.1|4075842_4076049_-	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	94.0	2.6e-30
WP_048266410.1|4076048_4076501_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	97.3	1.2e-80
WP_106023092.1|4076500_4078786_-	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	97.9	0.0e+00
WP_048266357.1|4078775_4079051_-	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	98.9	3.3e-44
WP_001113264.1|4079047_4079272_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_048266356.1|4079271_4079574_-	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	94.0	7.2e-45
WP_000557701.1|4079573_4079798_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
WP_000217684.1|4079861_4080362_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	99.4	3.8e-91
WP_042109903.1|4080539_4080911_-	hypothetical protein	NA	Q1JS28	Enterobacteria_phage	99.2	1.0e-64
WP_001389238.1|4081004_4081304_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	100.0	3.0e-51
WP_000023390.1|4081397_4082393_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	100.0	5.4e-190
WP_000067979.1|4082424_4083222_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000109283.1|4083318_4084467_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165876.1|4084780_4085407_+	hydrolase	NA	NA	NA	NA	NA
WP_000534666.1|4085442_4086306_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213098.1|4086307_4086925_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850306.1|4086935_4089380_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000023739.1|4089679_4090672_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.2	1.3e-103
WP_001368591.1|4090741_4091083_-	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
WP_001204236.1|4091187_4091709_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000856387.1|4091713_4092136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287828.1|4092142_4092334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000776267.1|4092471_4092822_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	8.1e-56
WP_000159455.1|4092832_4093111_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_000514277.1|4093122_4093365_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021715.1|4093361_4093475_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	1.8e-09
WP_000543036.1|4093568_4093979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|4094002_4094206_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153700.1|4094202_4094469_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000104290.1|4094465_4094765_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
WP_023142408.1|4094776_4095394_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	42.0	1.5e-09
WP_000599382.1|4095390_4095756_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_000123489.1|4095762_4098585_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.4	0.0e+00
WP_000686485.1|4098661_4099621_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	4.2e-179
WP_000211282.1|4099625_4099940_+	plasmid partition protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.3	4.1e-19
WP_000193205.1|4100023_4100866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068329.1|4100905_4101403_-	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_000236495.1|4102126_4102651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000087814.1|4102665_4103712_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_000613780.1|4103711_4105463_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_001262655.1|4105617_4106454_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_001055083.1|4106477_4107530_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	1.4e-188
WP_000632309.1|4107575_4108376_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	6.9e-127
WP_000063100.1|4108477_4108972_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000864901.1|4108971_4109172_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_001342221.1|4109174_4109498_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000072341.1|4109494_4109887_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
WP_000780577.1|4109883_4110279_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
WP_032152210.1|4110417_4112295_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	80.0	1.0e-298
WP_000921127.1|4112318_4112786_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
WP_000356366.1|4112778_4113414_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
WP_001271941.1|4113410_4113992_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	3.3e-102
WP_000213444.1|4113988_4114339_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	3.5e-59
WP_001111954.1|4114342_4115239_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
WP_000071703.1|4115231_4115762_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	3.6e-92
WP_021538277.1|4115764_4117750_+|tail	phage tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	86.0	3.2e-173
4115783:4115802	attR	AAATTTAAAACCGTTATCAC	NA	NA	NA	NA
WP_000972134.1|4117752_4118286_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	4.2e-96
WP_001554335.1|4118314_4118842_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.7	2.6e-90
WP_023363133.1|4118843_4119629_-	hypothetical protein	NA	Q858V4	Yersinia_virus	76.6	1.1e-108
WP_000905061.1|4119856_4120456_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_000979945.1|4120484_4120973_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000853410.1|4120985_4123793_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.1	0.0e+00
WP_000333503.1|4123779_4123935_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651577.1|4123943_4124318_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	9.9e-36
WP_000290462.1|4124373_4124886_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000005447.1|4124885_4126070_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	8.4e-222
WP_000132830.1|4126227_4127337_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000488106.1|4127377_4127638_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|4127829_4127970_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000886683.1|4128275_4129568_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067797.1|4129658_4131002_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|4131012_4131624_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077041.1|4131782_4135889_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|4136023_4136518_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_001385255.1|4137061_4138027_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
WP_001043561.1|4138149_4139916_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202204.1|4139916_4141638_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.0	1.4e-20
WP_001241674.1|4141679_4142384_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|4142668_4142887_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|4143571_4145848_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|4145878_4146199_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|4146521_4146746_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188152.1|4146818_4148765_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.4	8.5e-38
>prophage 273
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4157981	4159700	5022408		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815373.1|4157981_4159700_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	5.2e-31
>prophage 274
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4163287	4166025	5022408		Roseobacter_phage(50.0%)	4	NA	NA
WP_001255186.1|4163287_4164118_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|4164114_4164438_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001295906.1|4164563_4165079_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|4165296_4166025_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 275
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4169150	4178290	5022408		Streptococcus_phage(25.0%)	11	NA	NA
WP_001149713.1|4169150_4170278_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_000389260.1|4170318_4170807_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061639.1|4170866_4171712_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105413.1|4171708_4172653_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996007.1|4172662_4173796_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_001295904.1|4173890_4175003_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|4175352_4175829_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|4175916_4176819_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189165.1|4176879_4177602_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201575.1|4177585_4177873_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195231.1|4178032_4178290_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
>prophage 276
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4186856	4188059	5022408		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|4186856_4188059_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 277
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4200170	4202042	5022408		Planktothrix_phage(100.0%)	1	NA	NA
WP_001295896.1|4200170_4202042_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	8.8e-16
>prophage 278
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4205257	4212141	5022408		Synechococcus_phage(33.33%)	5	NA	NA
WP_001295895.1|4205257_4205920_-	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.6	9.7e-26
WP_001295894.1|4206050_4206950_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000209354.1|4206955_4209388_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_000114256.1|4209533_4210349_+	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000961458.1|4210548_4212141_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 279
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4217137	4222363	5022408		Escherichia_phage(33.33%)	7	NA	NA
WP_001295296.1|4217137_4217653_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|4217705_4217771_-	protein YliM	NA	NA	NA	NA	NA
WP_001295297.1|4218005_4218893_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|4219192_4219696_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|4220099_4220846_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|4220984_4221644_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|4221640_4222363_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
>prophage 280
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4228752	4240323	5022408		Synechococcus_phage(20.0%)	10	NA	NA
WP_000990158.1|4228752_4229430_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	29.7	5.2e-19
WP_000146357.1|4229503_4229770_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_000849301.1|4230034_4230295_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443542.1|4230432_4231518_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000386550.1|4231657_4232620_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001218657.1|4232647_4234798_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	1.8e-41
WP_000007091.1|4235334_4236696_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	32.6	1.5e-52
WP_001295890.1|4236924_4237596_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000743444.1|4237598_4238594_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996111.1|4238586_4240323_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
>prophage 281
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4250921	4251830	5022408		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295887.1|4250921_4251830_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	4.9e-28
>prophage 282
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4258157	4259447	5022408		Klosneuvirus(100.0%)	1	NA	NA
WP_001295886.1|4258157_4259447_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.3e-18
>prophage 283
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4269709	4276285	5022408		Planktothrix_phage(33.33%)	7	NA	NA
WP_000891663.1|4269709_4270768_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.4	7.4e-20
WP_000604037.1|4270770_4271460_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000113014.1|4271459_4272233_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|4272399_4272549_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001147439.1|4272677_4273466_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000096849.1|4273533_4275006_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.8	1.9e-13
WP_001265440.1|4275268_4276285_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
>prophage 284
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4280648	4284168	5022408		Klebsiella_phage(33.33%)	4	NA	NA
WP_001109194.1|4280648_4281701_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.1	7.5e-81
WP_000784348.1|4282016_4282397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000951272.1|4282510_4283452_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	1.3e-23
WP_000345405.1|4283448_4284168_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.9	2.4e-22
>prophage 285
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4320005	4320761	5022408		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000991076.1|4320005_4320761_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	27.9	2.9e-10
>prophage 286
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4324684	4325476	5022408		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114009.1|4324684_4325476_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	25.8	5.8e-09
>prophage 287
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4328854	4340687	5022408		Hokovirus(40.0%)	10	NA	NA
WP_001032722.1|4328854_4330336_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	4.2e-45
WP_000207133.1|4330377_4331796_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	2.8e-62
WP_001075784.1|4331792_4332302_-	YbgA family protein	NA	NA	NA	NA	NA
WP_000424788.1|4332402_4332609_-	YbfA family protein	NA	NA	NA	NA	NA
WP_001272653.1|4332921_4333011_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000741157.1|4333010_4334684_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_000088001.1|4334706_4336755_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.8	4.2e-27
WP_001295876.1|4336763_4337336_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_001295875.1|4337328_4340013_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	6.5e-12
WP_000186068.1|4340009_4340687_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.6e-26
>prophage 288
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4347342	4348107	5022408		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773282.1|4347342_4348107_+	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	2.9e-05
>prophage 289
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4352252	4354898	5022408	tRNA	Escherichia_phage(100.0%)	2	NA	NA
WP_001287134.1|4352252_4353917_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.7	0.0e+00
WP_000679501.1|4354136_4354898_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	35.7	7.4e-30
>prophage 290
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4359391	4360150	5022408		Moraxella_phage(100.0%)	1	NA	NA
WP_000480543.1|4359391_4360150_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	48.2	4.8e-45
>prophage 291
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4363981	4365928	5022408		Vibrio_phage(100.0%)	1	NA	NA
WP_001023114.1|4363981_4365928_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.2e-07
>prophage 292
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4376748	4377828	5022408		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|4376748_4377828_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 293
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4385772	4389305	5022408		Planktothrix_phage(50.0%)	3	NA	NA
WP_000631387.1|4385772_4386498_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.1	9.9e-32
WP_001207535.1|4386615_4387551_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000367903.1|4387634_4389305_+	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.9	7.2e-78
>prophage 294
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4393437	4396020	5022408	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001157896.1|4393437_4396020_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	1.2e-183
>prophage 295
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4403030	4405470	5022408		Synechococcus_phage(50.0%)	2	NA	NA
WP_001231421.1|4403030_4404119_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092082.1|4404258_4405470_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 296
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4409887	4410534	5022408		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000939738.1|4409887_4410271_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|4410324_4410534_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 297
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4424623	4426738	5022408		Morganella_phage(50.0%)	2	NA	NA
WP_001295855.1|4424623_4425052_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	4.3e-19
WP_000887629.1|4425172_4426738_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 298
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4429843	4431666	5022408		Streptococcus_phage(50.0%)	2	NA	NA
WP_000029772.1|4429843_4431064_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.5	6.1e-58
WP_000502950.1|4431036_4431666_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.3	1.3e-56
>prophage 299
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4446734	4452808	5022408		Klosneuvirus(50.0%)	3	NA	NA
WP_000140634.1|4446734_4447550_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.5	4.3e-07
WP_000096765.1|4447546_4448680_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000077758.1|4448926_4452808_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.4	1.7e-61
>prophage 300
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4464196	4465741	5022408		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000937457.1|4464196_4465741_+	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.0	1.8e-14
>prophage 301
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4475310	4478454	5022408		Leptospira_phage(100.0%)	1	NA	NA
WP_000574008.1|4475310_4478454_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	2.2e-59
>prophage 302
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4481599	4483715	5022408		Bacillus_phage(50.0%)	2	NA	NA
WP_000770953.1|4481599_4482283_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000253846.1|4482272_4483715_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	2.3e-11
>prophage 303
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4492507	4496983	5022408	tRNA,tail,integrase	Enterobacteria_phage(20.0%)	7	4489454:4489467	4503028:4503041
4489454:4489467	attL	GCCTGGCGTAACGC	NA	NA	NA	NA
WP_023363122.1|4492507_4492813_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	63.6	4.0e-43
WP_001295845.1|4492870_4493170_+|integrase	tyrosine-type recombinase/integrase	integrase	B9UDL9	Salmonella_phage	81.2	5.0e-30
WP_001331488.1|4493189_4493498_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A088CD23	Shigella_phage	81.8	7.4e-37
WP_000729155.1|4493852_4494719_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190282.1|4494720_4494933_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143517.1|4495040_4495562_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912352.1|4495597_4496983_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
4503028:4503041	attR	GCGTTACGCCAGGC	NA	NA	NA	NA
>prophage 304
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4509218	4510364	5022408		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295840.1|4509218_4510364_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	43.0	9.7e-50
>prophage 305
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4526108	4526795	5022408		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110573.1|4526108_4526795_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 306
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4530051	4530729	5022408		Bacillus_virus(100.0%)	1	NA	NA
WP_001157551.1|4530051_4530729_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 307
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4536097	4539339	5022408		Escherichia_phage(66.67%)	3	NA	NA
WP_000083947.1|4536097_4538602_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	1.0e-115
WP_000806442.1|4538659_4539001_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
WP_000057523.1|4539036_4539339_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	80.0	1.3e-41
>prophage 308
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4548901	4557359	5022408		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
WP_000801794.1|4548901_4549861_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	25.0	2.9e-15
WP_001250114.1|4549857_4550820_-	ferrochelatase	NA	NA	NA	NA	NA
WP_001220233.1|4550951_4551596_-	adenylate kinase	NA	NA	NA	NA	NA
WP_000678189.1|4551776_4553651_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.8	1.0e-117
WP_001195025.1|4553760_4554366_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|4554365_4554695_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000122044.1|4554747_4556679_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	3.9e-43
WP_000127356.1|4556807_4557359_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 309
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4564197	4567347	5022408		Leptospira_phage(100.0%)	1	NA	NA
WP_001132478.1|4564197_4567347_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	4.7e-54
>prophage 310
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4576185	4579732	5022408		Bacillus_phage(100.0%)	2	NA	NA
WP_001256214.1|4576185_4577967_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	3.4e-41
WP_001235630.1|4577959_4579732_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	2.3e-50
>prophage 311
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4583055	4583751	5022408		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817227.1|4583055_4583751_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 312
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4586903	4591950	5022408	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_001043542.1|4586903_4587176_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_001295325.1|4587384_4589739_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_000130299.1|4589926_4591201_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	1.9e-131
WP_000122253.1|4591326_4591950_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 313
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4613384	4622227	5022408	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_001021161.1|4613384_4613855_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_001150440.1|4613943_4615047_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.1	1.3e-54
WP_000543535.1|4615050_4615500_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001295828.1|4615650_4616190_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_001295827.1|4616488_4617373_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000974813.1|4617410_4617758_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_000046637.1|4617887_4618859_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934823.1|4618869_4620717_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|4620744_4621077_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667319.1|4621099_4622227_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 314
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4629178	4639276	5022408		Bacillus_phage(60.0%)	7	NA	NA
WP_000893576.1|4629178_4630474_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
WP_000113933.1|4630531_4631221_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_001221274.1|4631410_4632613_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000698843.1|4632609_4635753_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	7.6e-12
WP_012896741.1|4635878_4637063_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001219313.1|4637331_4638240_-	fructokinase	NA	NA	NA	NA	NA
WP_012896740.1|4638364_4639276_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	6.0e-103
>prophage 315
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4643565	4644681	5022408		Bacillus_phage(100.0%)	1	NA	NA
WP_000484048.1|4643565_4644681_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 316
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4652096	4653254	5022408		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830769.1|4652096_4653254_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
>prophage 317
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4660162	4663630	5022408		Planktothrix_phage(50.0%)	4	NA	NA
WP_000939359.1|4660162_4660930_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.8	4.3e-25
WP_001018403.1|4660942_4661905_-	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001141271.1|4662210_4662486_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_000842109.1|4662520_4663630_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.9	4.0e-32
>prophage 318
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4666708	4668669	5022408		Micromonas_sp._RCC1109_virus(50.0%)	2	NA	NA
WP_001013504.1|4666708_4667722_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.4	1.4e-44
WP_000044319.1|4667718_4668669_-	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	4.3e-35
>prophage 319
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4674079	4678359	5022408		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000805862.1|4674079_4675162_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	98.9	7.0e-191
WP_000177883.1|4675284_4678359_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.3	0.0e+00
>prophage 320
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4683318	4685205	5022408		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000010274.1|4683318_4685205_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	2.4e-53
>prophage 321
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4692851	4693901	5022408		Tupanvirus(100.0%)	1	NA	NA
WP_000692730.1|4692851_4693901_-	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	1.4e-71
>prophage 322
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4705799	4713367	5022408	holin,integrase	Vibrio_phage(33.33%)	5	4698534:4698547	4714394:4714407
4698534:4698547	attL	TTGCCGTTGGTGAA	NA	NA	NA	NA
WP_000131040.1|4705799_4707833_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001295807.1|4707961_4708549_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_001295806.1|4708562_4710035_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159129.1|4710048_4711719_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	8.9e-60
WP_001295805.1|4712803_4713367_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
4714394:4714407	attR	TTGCCGTTGGTGAA	NA	NA	NA	NA
>prophage 323
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4723285	4726590	5022408		Erysipelothrix_phage(50.0%)	4	NA	NA
WP_001046304.1|4723285_4724611_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
WP_000474088.1|4724719_4724956_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001295800.1|4724967_4725561_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001295799.1|4725720_4726590_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.1e-53
>prophage 324
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4732632	4733484	5022408		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001174452.1|4732632_4733484_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.2e-47
>prophage 325
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4750492	4751812	5022408	integrase	Pseudomonas_phage(50.0%)	2	4745281:4745294	4761738:4761751
4745281:4745294	attL	TAAAAACATCGCTG	NA	NA	NA	NA
WP_000996167.1|4750492_4750828_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	44.6	1.5e-06
WP_000171155.1|4751035_4751812_+|integrase	site-specific integrase	integrase	T1S9J3	Salmonella_phage	26.4	1.2e-11
4761738:4761751	attR	CAGCGATGTTTTTA	NA	NA	NA	NA
>prophage 326
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4757041	4764995	5022408		Streptococcus_phage(50.0%)	5	NA	NA
WP_000229741.1|4757041_4758679_+	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	28.7	1.0e-23
WP_000671528.1|4758668_4759916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000893315.1|4761282_4762536_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	2.0e-96
WP_001285288.1|4762547_4763651_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749899.1|4763939_4764995_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	3.5e-118
>prophage 327
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4769671	4770823	5022408		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001311432.1|4769671_4770823_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.1	6.6e-30
>prophage 328
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4781394	4784717	5022408		Clostridioides_phage(50.0%)	4	NA	NA
WP_000093933.1|4781394_4782144_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_001225679.1|4782455_4783196_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|4783166_4783934_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4784138_4784717_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
>prophage 329
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4789148	4793350	5022408		Bradyrhizobium_phage(33.33%)	5	NA	NA
WP_001385210.1|4789148_4789880_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_000917890.1|4789944_4790412_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001295200.1|4790408_4791131_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052747.1|4791164_4791920_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|4791991_4793350_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
>prophage 330
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4803528	4804560	5022408		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|4803528_4804560_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 331
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4817518	4821634	5022408		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_001294788.1|4817518_4821001_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	2.8e-209
WP_000569423.1|4821037_4821634_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
>prophage 332
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4830462	4831221	5022408		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|4830462_4831221_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 333
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4842800	4844225	5022408	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753937.1|4842800_4844225_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
>prophage 334
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4848154	4848499	5022408		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|4848154_4848499_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 335
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4854410	4855208	5022408		Planktothrix_phage(100.0%)	1	NA	NA
WP_001295786.1|4854410_4855208_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	4.6e-14
>prophage 336
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4865592	4872398	5022408	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_001553961.1|4865592_4868022_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.6	6.0e-41
WP_001294702.1|4868095_4868626_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396050.1|4868640_4869345_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|4869522_4869978_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000937399.1|4870014_4870941_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174644.1|4870979_4872398_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 337
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4882529	4883450	5022408	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000339933.1|4882529_4883450_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	48.8	4.9e-60
>prophage 338
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4886712	4893180	5022408		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_000150638.1|4886712_4887639_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000651599.1|4887747_4888410_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683335.1|4888450_4888987_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_001295777.1|4889192_4891583_+	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_001189632.1|4891629_4893180_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	3.5e-18
>prophage 339
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4900835	4902260	5022408		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|4900835_4902260_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 340
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4915373	4915925	5022408		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923703.1|4915373_4915925_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.5e-11
>prophage 341
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4920171	4921215	5022408		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217320.1|4920171_4921215_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 342
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4947184	4948909	5022408		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425639.1|4947184_4948909_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.9e-36
>prophage 343
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4960386	4961085	5022408		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916271.1|4960386_4961085_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.2	5.2e-22
>prophage 344
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4972824	4978247	5022408		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_000035602.1|4972824_4975176_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.2	2.3e-37
WP_001117001.1|4975340_4978247_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 345
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4986024	4987985	5022408		Microcystis_phage(50.0%)	4	NA	NA
WP_000257181.1|4986024_4986873_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
WP_001160964.1|4986899_4987184_-	CcdB family protein	NA	NA	NA	NA	NA
WP_000125566.1|4987186_4987420_-	antitoxin	NA	NA	NA	NA	NA
WP_000624375.1|4987505_4987985_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 346
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	4995879	5001539	5022408		Vibrio_phage(50.0%)	4	NA	NA
WP_000787105.1|4995879_4997394_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
WP_000347117.1|4997424_4998567_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000349970.1|4998695_4999913_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_001295759.1|4999985_5001539_+	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	26.0	2.0e-34
>prophage 347
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	5007042	5008191	5022408		Halovirus(100.0%)	1	NA	NA
WP_001295757.1|5007042_5008191_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	9.8e-50
>prophage 348
NZ_CP027534	Escherichia coli strain AR_0081 chromosome, complete genome	5022408	5012999	5015816	5022408	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286823.1|5012999_5015816_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.3	2.1e-77
>prophage 1
NZ_CP027537	Escherichia coli strain AR_0081 plasmid unnamed2, complete sequence	100279	8785	59220	100279	transposase,integrase	Escherichia_phage(34.78%)	48	44469:44528	59962:60762
WP_085947770.1|8785_10155_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_001276232.1|10400_11120_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845940.1|11116_11551_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_000117179.1|11605_13564_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.4	1.3e-22
WP_000005990.1|13629_13863_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000290841.1|13925_14465_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.9	1.2e-45
WP_032143370.1|14698_14887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032277138.1|15107_15374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001348621.1|15399_15963_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	1.0e-20
WP_000170714.1|16010_17372_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_000218642.1|17423_17654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001027516.1|18688_18880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271753.1|18876_19299_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001671341.1|19345_19648_-	antirestriction protein	NA	NA	NA	NA	NA
WP_000274437.1|21014_21449_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104873.1|21462_21684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000086185.1|21684_22368_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
WP_077885859.1|22752_23655_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000817036.1|24521_25493_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
WP_000772446.1|25492_26659_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000852146.1|27246_28002_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
WP_000016982.1|28775_29582_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_001159868.1|29582_29888_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813634.1|29889_30108_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000246636.1|30815_31811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991832.1|31814_32747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001553854.1|33794_36911_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	3.7e-27
WP_023142242.1|37032_38304_-	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	28.0	1.5e-11
WP_001617892.1|38300_39857_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	3.2e-104
WP_001190712.1|40039_40261_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216034.1|40260_40641_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001513661.1|40645_40825_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001513660.1|40852_41212_+	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
WP_001513659.1|41498_41816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012372828.1|42043_43060_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
44469:44528	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067858.1|44531_45236_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_158701885.1|45241_45433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001189113.1|45471_46980_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_000839179.1|47481_47886_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|47882_48230_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001310017.1|49309_50332_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
WP_001300609.1|50328_51111_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	2.0e-139
WP_000977394.1|51849_52641_-	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_001298664.1|52647_54618_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_001322642.1|55860_56133_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001072358.1|56979_58149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001309252.1|58515_58704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106023106.1|58824_59220_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
59962:60762	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGTATTGCCCGCTCCACGGTTTATAAAATTCTTGAAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGGTAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTTCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGTGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCTGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGA	NA	NA	NA	NA
