The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027539	Serratia marcescens strain AR_0099 chromosome, complete genome	5284831	1697688	1735794	5284831	terminase,integrase,lysis,portal,tRNA,plate,tail,head,capsid	Erwinia_phage(46.15%)	49	1697566:1697617	1729565:1729616
1697566:1697617	attL	AAAATTTGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAGT	NA	NA	NA	NA
WP_033649027.1|1697688_1698732_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	87.0	1.0e-178
WP_033649028.1|1698731_1699310_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	55.3	9.9e-59
WP_071998162.1|1699441_1699705_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	85.1	4.8e-37
WP_033649029.1|1699736_1700246_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	53.6	5.5e-45
WP_049279101.1|1700256_1700436_+	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	51.0	1.1e-05
WP_031221632.1|1700447_1700750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033649030.1|1700814_1701108_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	54.4	6.4e-06
WP_023460307.1|1701107_1701332_+	hypothetical protein	NA	Q6K1F5	Salmonella_virus	56.9	3.7e-14
WP_015379131.1|1701454_1701736_+	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	51.2	4.5e-17
WP_033649031.1|1701725_1702151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033649032.1|1702147_1704361_+	replication endonuclease	NA	S4TTC1	Salmonella_phage	58.9	4.7e-242
WP_049299940.1|1704401_1704632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139818298.1|1704679_1704877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033649106.1|1704973_1705873_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019843167.1|1706001_1706574_+	flavin oxidoreductase	NA	NA	NA	NA	NA
WP_071605322.1|1707098_1707353_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	47.6	5.9e-16
WP_033633573.1|1707352_1707694_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_033649034.1|1707738_1708773_-|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	79.5	3.2e-161
WP_033649036.1|1708772_1710545_-|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	82.0	4.4e-291
WP_033649037.1|1710687_1711503_+|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	53.1	2.7e-70
WP_033649038.1|1711545_1712757_+|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	78.5	7.9e-159
WP_033649039.1|1712759_1713419_+|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	69.4	5.2e-80
WP_033639340.1|1713512_1714001_+|head	head completion/stabilization protein	head	F1BUQ6	Erwinia_phage	54.3	1.1e-39
WP_015379118.1|1714000_1714204_+	phage Tail protein X	NA	A0A0F7LCN2	Escherichia_phage	68.7	2.4e-20
WP_031231709.1|1714208_1714418_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	43.5	2.0e-09
WP_033649040.1|1714401_1714914_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	66.5	5.7e-58
WP_033649041.1|1714910_1715339_+|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	36.6	5.5e-14
WP_033649042.1|1715434_1715908_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	61.8	3.4e-49
WP_033649043.1|1715894_1716341_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	58.4	4.6e-40
WP_033649044.1|1716413_1717043_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	72.8	6.3e-75
WP_154231760.1|1717053_1717194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033649045.1|1717190_1717541_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	67.2	2.2e-37
WP_033649046.1|1717545_1718454_+|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	68.2	8.1e-108
WP_033649047.1|1718446_1718980_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	76.0	5.7e-77
WP_106024918.1|1718986_1721608_+	hypothetical protein	NA	Q858V4	Yersinia_virus	54.1	3.7e-60
WP_033649048.1|1721609_1722155_+|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	46.4	2.0e-37
WP_033649049.1|1722431_1723601_+|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	81.7	3.1e-184
WP_023447563.1|1723616_1724126_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	76.2	1.7e-70
WP_033639350.1|1724180_1724462_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	69.0	5.3e-26
WP_023456045.1|1724494_1724617_+|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	72.5	1.5e-09
WP_033649050.1|1724609_1727456_+|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	51.2	7.9e-109
WP_015379102.1|1727460_1727946_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	65.7	1.5e-47
WP_033649051.1|1727942_1729091_+	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	63.4	1.9e-125
WP_071998163.1|1729181_1729412_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	64.5	3.2e-21
WP_033649053.1|1729792_1730281_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
1729565:1729616	attR	AAAATTTGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAGT	NA	NA	NA	NA
WP_033636080.1|1730355_1732197_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
WP_025304325.1|1732354_1734103_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.8	6.6e-74
WP_001144069.1|1734239_1734455_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_033649054.1|1734780_1735794_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	4.3e-110
>prophage 2
NZ_CP027539	Serratia marcescens strain AR_0099 chromosome, complete genome	5284831	2344381	2391238	5284831	holin,tail,terminase,integrase	Escherichia_phage(23.81%)	59	2343468:2343483	2396303:2396318
2343468:2343483	attL	GACGAAGTCGGCGATG	NA	NA	NA	NA
WP_033635581.1|2344381_2345845_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.5	8.8e-88
WP_025303899.1|2345947_2347525_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_106024921.1|2347749_2348952_+|integrase	site-specific integrase	integrase	T1S9J3	Salmonella_phage	69.3	4.8e-156
WP_106024922.1|2348955_2349240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106024923.1|2349236_2349899_-	DNA methyltransferase	NA	A0A248SKY3	Klebsiella_phage	65.0	1.6e-81
WP_075686446.1|2350016_2350268_-	AlpA family phage regulatory protein	NA	A0A193GYW1	Enterobacter_phage	48.8	9.3e-14
WP_106024924.1|2350308_2351187_-	recombinase RecT	NA	G9L6A2	Escherichia_phage	74.4	5.2e-120
WP_106024925.1|2351183_2352005_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	79.4	1.1e-127
WP_106024926.1|2352004_2352310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106024927.1|2352317_2353364_-	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	59.5	5.1e-37
WP_072270178.1|2353360_2353513_-	DUF2985 domain-containing protein	NA	T1SA20	Salmonella_phage	50.0	1.6e-05
WP_049234886.1|2353787_2354384_-	helix-turn-helix transcriptional regulator	NA	G9L6A6	Escherichia_phage	51.8	9.5e-49
WP_033648895.1|2354532_2354751_+	hypothetical protein	NA	Q858D6	Salmonella_phage	58.0	1.5e-15
WP_064290116.1|2355089_2356040_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	59.7	4.1e-78
WP_158523364.1|2355951_2356512_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	37.8	9.3e-22
WP_050438974.1|2356775_2357075_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	72.7	7.1e-37
WP_033648893.1|2357077_2357290_+	TraR/DksA family transcriptional regulator	NA	Q9ZXI6	Pseudomonas_virus	50.8	4.0e-10
WP_106024928.1|2357300_2357783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106024929.1|2357779_2358442_+	hypothetical protein	NA	R9VWB9	Serratia_phage	61.1	2.6e-71
WP_072010256.1|2358431_2358617_+	restriction alleviation protein, Lar family	NA	A0A0U2QQP4	Escherichia_phage	66.0	1.2e-15
WP_106024930.1|2358613_2358889_+	hypothetical protein	NA	S4TW48	Salmonella_phage	61.4	7.3e-20
WP_106024931.1|2358878_2359343_+	ead/Ea22-like family protein	NA	NA	NA	NA	NA
WP_106024932.1|2359339_2359867_+	hypothetical protein	NA	A0A248SKW5	Klebsiella_phage	56.9	5.9e-10
WP_106024933.1|2359859_2360246_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	33.0	3.0e-11
WP_089192151.1|2360317_2360575_+	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	51.8	1.6e-16
WP_106024934.1|2360681_2361230_+|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	66.9	1.4e-59
WP_106024935.1|2361226_2362699_+|terminase	terminase	terminase	G9L6B8	Escherichia_phage	78.3	1.7e-235
WP_158703209.1|2362727_2363225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106024936.1|2363797_2365483_+|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	58.5	1.4e-185
WP_060430634.1|2365482_2365779_+	hypothetical protein	NA	Q2A090	Sodalis_phage	72.9	7.1e-29
WP_106024937.1|2365744_2366008_+	hypothetical protein	NA	V5KSC6	Escherichia_phage	64.2	2.0e-11
WP_060448551.1|2366018_2366699_+	peptidase	NA	G9L6C4	Escherichia_phage	70.1	1.4e-51
WP_060448550.1|2366704_2367691_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	71.6	1.1e-139
WP_060418226.1|2367744_2368191_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	59.9	1.1e-33
WP_106024998.1|2368201_2368486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060418224.1|2368525_2368849_+	hypothetical protein	NA	T1SBJ0	Salmonella_phage	54.9	2.7e-21
WP_033648873.1|2368848_2369457_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	61.4	7.7e-62
WP_106024938.1|2369456_2371958_+	hypothetical protein	NA	A0A0F6TJD3	Escherichia_coli_O157_typing_phage	61.3	1.6e-307
WP_106024939.1|2371957_2372431_+	hypothetical protein	NA	Q858G2	Salmonella_phage	66.0	1.1e-52
WP_106024940.1|2372423_2372993_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	49.7	1.9e-30
WP_106024999.1|2373002_2375759_+	hypothetical protein	NA	Q858G0	Salmonella_phage	34.6	1.9e-99
WP_106024941.1|2375758_2379148_+	hypothetical protein	NA	A0A1E1GEP2	Vibrio_phage	36.3	2.2e-182
WP_106024942.1|2379148_2379577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106024943.1|2379601_2380036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158703210.1|2380079_2380598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158703211.1|2380621_2381170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158703212.1|2381196_2381694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106024944.1|2381981_2382521_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	41.0	7.3e-32
WP_156106907.1|2382694_2382856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106024945.1|2382909_2383224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050438967.1|2383325_2383574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106024946.1|2383760_2386361_+	hypothetical protein	NA	G9L6E4	Escherichia_phage	36.5	3.0e-54
WP_060706595.1|2386392_2386626_+|holin	holin	holin	H9C183	Pectobacterium_phage	69.6	1.2e-20
WP_106024947.1|2386609_2387125_+	lysozyme	NA	I6PBN2	Cronobacter_phage	66.0	9.7e-50
WP_106024948.1|2387109_2387484_+	hypothetical protein	NA	A0A248XD11	Klebsiella_phage	48.4	3.1e-13
WP_033648863.1|2387480_2387741_+	hypothetical protein	NA	A0A248XCT8	Klebsiella_phage	58.6	1.5e-14
WP_033635579.1|2388123_2388486_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033648862.1|2388608_2389442_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_033648861.1|2389456_2391238_-	response regulator	NA	A0A2K9L0Z8	Tupanvirus	23.7	3.5e-14
2396303:2396318	attR	GACGAAGTCGGCGATG	NA	NA	NA	NA
>prophage 3
NZ_CP027539	Serratia marcescens strain AR_0099 chromosome, complete genome	5284831	3034322	3070570	5284831	capsid,integrase,portal,plate,tail,head,lysis	Salmonella_phage(38.89%)	44	3034606:3034645	3070687:3070726
WP_004935122.1|3034322_3034535_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	77.1	9.9e-25
3034606:3034645	attL	AAAAAAAGCCCGCAAGTCTGCGGGCAAAAGTTCCTTGTTA	NA	NA	NA	NA
WP_072008418.1|3034726_3034948_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	66.7	4.3e-23
WP_099817099.1|3035255_3036065_+	chaperonin	NA	A0A0F7L9X0	Escherichia_phage	83.6	1.4e-138
WP_106024955.1|3036212_3037304_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	58.6	4.1e-114
WP_106024956.1|3037300_3037765_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	61.9	2.0e-49
WP_106025001.1|3037776_3040695_-|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	53.3	1.1e-158
WP_099817277.1|3040687_3040825_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	73.7	5.8e-10
WP_060417830.1|3040821_3041148_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	56.8	5.1e-20
WP_049187570.1|3041219_3041735_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	66.3	2.0e-58
WP_106024957.1|3041745_3042918_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	80.4	4.2e-181
WP_106024958.1|3043111_3044203_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	44.8	4.8e-30
WP_106024959.1|3044212_3045124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106024960.1|3045120_3047457_-	hypothetical protein	NA	A0A2D1GNM3	Pseudomonas_phage	25.8	6.6e-37
WP_106024961.1|3047449_3048061_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	61.8	4.2e-60
WP_106024962.1|3048053_3048962_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	68.5	4.8e-108
WP_106024963.1|3048961_3049309_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	57.3	5.2e-31
WP_106024964.1|3049305_3049944_-|plate	phage baseplate assembly protein V	plate	S4TUB5	Salmonella_phage	58.3	8.3e-59
WP_033654172.1|3050025_3050481_-	phage virion morphogenesis protein	NA	A0A077K9X5	Ralstonia_phage	47.6	6.4e-29
WP_033654171.1|3050468_3050936_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	51.0	2.9e-37
WP_106024965.1|3050944_3051382_-|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	46.6	1.8e-20
WP_106024966.1|3051378_3051858_-	lysozyme	NA	I6S1V9	Salmonella_phage	58.8	2.2e-51
WP_060428438.1|3051857_3052124_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_033654167.1|3052145_3052349_-|tail	tail protein X	tail	F1BUQ5	Erwinia_phage	55.2	3.3e-17
WP_106024967.1|3052348_3052870_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	49.0	5.8e-34
WP_106024968.1|3052961_3053618_-	hypothetical protein	NA	F1BUQ7	Erwinia_phage	46.9	4.0e-40
WP_106024969.1|3053621_3054716_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	62.3	1.2e-121
WP_106024970.1|3054776_3055577_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1J0I2E9	Salmonella_phage	45.6	2.6e-49
WP_106024971.1|3055764_3057534_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	65.8	3.5e-232
WP_106024972.1|3057534_3058569_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	68.6	1.6e-136
WP_106024973.1|3059242_3060421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106024974.1|3060529_3060874_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	42.2	2.5e-17
WP_106024975.1|3060875_3063476_-	replication endonuclease	NA	F1BUS0	Erwinia_phage	60.5	4.7e-225
WP_106025002.1|3063472_3064483_-	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	42.0	3.0e-63
WP_106024976.1|3064524_3065154_-	hypothetical protein	NA	A0A088FQU9	Escherichia_phage	59.2	3.5e-09
WP_106024977.1|3065146_3065971_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	46.6	8.5e-64
WP_106024978.1|3065967_3066819_-	3'-5' exonuclease	NA	A0A1D9C9N8	Salinivibrio_phage	59.8	2.6e-55
WP_033654156.1|3066822_3067041_-	TraR/DksA family transcriptional regulator	NA	A0A0M3LQ09	Mannheimia_phage	38.9	1.5e-07
WP_084826429.1|3067187_3067385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060428469.1|3067671_3067944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085058744.1|3067940_3068141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158703213.1|3068155_3068506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084969774.1|3068604_3068904_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	45.2	1.8e-19
WP_106024979.1|3068990_3069554_+	BRCT domain-containing protein	NA	NA	NA	NA	NA
WP_084969776.1|3069556_3070570_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	48.3	2.6e-86
3070687:3070726	attR	AAAAAAAGCCCGCAAGTCTGCGGGCAAAAGTTCCTTGTTA	NA	NA	NA	NA
>prophage 4
NZ_CP027539	Serratia marcescens strain AR_0099 chromosome, complete genome	5284831	3999352	4054425	5284831	coat,protease,tRNA	Tupanvirus(22.22%)	50	NA	NA
WP_033646315.1|3999352_4001740_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	25.0	1.8e-05
WP_004931416.1|4001754_4002738_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.9	2.2e-34
WP_151498502.1|4002984_4003080_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_004931417.1|4003149_4003506_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_004931418.1|4003549_4003747_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_048233542.1|4003845_4004397_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	2.6e-16
WP_025159696.1|4004400_4006329_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	3.5e-132
WP_033646316.1|4006544_4007168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033646317.1|4007407_4008457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033646318.1|4008841_4009531_+	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_033646319.1|4009567_4010701_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033638320.1|4010851_4012135_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_039566431.1|4012392_4013730_-	cytochrome c	NA	NA	NA	NA	NA
WP_004931432.1|4013742_4015524_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_033646320.1|4015526_4016252_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_004931439.1|4016559_4017225_-	transglycosylase SLT domain-containing protein	NA	I6ZXX9	Escherichia_phage	46.3	1.0e-06
WP_033646321.1|4017334_4017634_+	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_033638313.1|4017765_4018710_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033638312.1|4018706_4019597_+	manganese/iron ABC transporter ATP-binding protein	NA	A0A1V0SKJ1	Klosneuvirus	27.7	2.5e-08
WP_015377686.1|4019596_4020457_+	iron/manganese ABC transporter permease subunit YfeC	NA	NA	NA	NA	NA
WP_033646322.1|4020456_4021311_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_033646323.1|4021550_4022420_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_033638308.1|4022455_4023016_-	membrane protein	NA	NA	NA	NA	NA
WP_033646324.1|4023201_4024482_+|protease	protease	protease	NA	NA	NA	NA
WP_033638306.1|4024545_4025211_+	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_033638305.1|4025634_4026183_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	35.8	6.4e-07
WP_086556888.1|4026358_4027756_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_033646325.1|4027820_4028630_-	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_033646326.1|4028639_4029743_-	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_033638301.1|4029898_4030618_+	phosphonate utilization transcriptional regulator PhnR	NA	NA	NA	NA	NA
WP_033646327.1|4030793_4031804_+	2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033646328.1|4031800_4032937_+	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.7	1.3e-25
WP_033646329.1|4032938_4033802_+	2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_033638295.1|4033804_4034608_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_033646330.1|4034654_4035446_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_033646331.1|4035677_4037072_+	MFS transporter	NA	NA	NA	NA	NA
WP_033646332.1|4037172_4037880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033638291.1|4038117_4038996_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_033646333.1|4039305_4041354_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	5.7e-85
WP_033638287.1|4041373_4042084_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_033638286.1|4042180_4042678_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_033638760.1|4042933_4044181_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_033647432.1|4044149_4046780_+	PqiB family protein	NA	NA	NA	NA	NA
WP_033646334.1|4046881_4048318_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_033638282.1|4048592_4049132_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_071998115.1|4049134_4049638_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_106024987.1|4049637_4050192_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_033646336.1|4050216_4050981_+	molecular chaperone	NA	NA	NA	NA	NA
WP_033647434.1|4051126_4053469_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_033638278.1|4053489_4054425_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
>prophage 5
NZ_CP027539	Serratia marcescens strain AR_0099 chromosome, complete genome	5284831	5273384	5282088	5284831	integrase	Enterobacteria_phage(66.67%)	9	5274567:5274581	5280475:5280489
WP_033647429.1|5273384_5275718_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	60.0	3.6e-261
5274567:5274581	attL	CTGGAACAGTGCGGC	NA	NA	NA	NA
WP_085286335.1|5275728_5276064_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_085286334.1|5276060_5276324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071998180.1|5276320_5276866_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	55.4	7.7e-21
WP_033649940.1|5276871_5277117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033649939.1|5277113_5277377_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	55.0	1.5e-17
WP_033649938.1|5278112_5279303_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.1	2.8e-140
WP_086556832.1|5279721_5280981_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.6	3.6e-98
5280475:5280489	attR	GCCGCACTGTTCCAG	NA	NA	NA	NA
WP_033637217.1|5280984_5282088_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.4	2.6e-60
