The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021256	Legionella pneumophila strain D-4954 chromosome, complete genome	3661362	596707	643377	3661362	integrase,transposase,tRNA,protease	Alteromonas_phage(11.11%)	44	611710:611724	647843:647857
WP_062726676.1|596707_597385_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_062726683.1|597396_598521_+	M42 family metallopeptidase	NA	NA	NA	NA	NA
WP_106221138.1|598597_600085_+	Dot/Icm T4SS effector AnkC/LegA12	NA	NA	NA	NA	NA
WP_062726678.1|600293_601436_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_027228868.1|601438_602353_+|protease	protease modulator HflC	protease	R4VJU7	Alteromonas_phage	29.6	2.3e-09
WP_106221140.1|602487_603783_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	34.9	9.3e-73
WP_106221141.1|603995_604565_+	cupin	NA	NA	NA	NA	NA
WP_027228865.1|604718_605177_-	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106221143.1|605306_606041_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_062726999.1|606037_606685_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_062727000.1|606668_607337_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.0	7.5e-26
WP_062727001.1|607333_608551_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_161514756.1|608543_609779_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_080463904.1|609781_610897_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_062727003.1|610986_612462_-	adenosine deaminase	NA	NA	NA	NA	NA
611710:611724	attL	GGCAAAGACGTTATC	NA	NA	NA	NA
WP_106221146.1|612634_613750_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_028378023.1|613822_615160_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	27.7	5.9e-22
WP_062727005.1|615241_616384_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_106221147.1|616370_617915_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_106183323.1|618019_618316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106221149.1|618390_619662_-	phospholipase	NA	NA	NA	NA	NA
WP_061504501.1|619940_621062_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_062727009.1|621247_621964_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	39.6	6.3e-23
WP_062727010.1|621974_622772_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_161514801.1|622804_624157_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_161514800.1|624327_626658_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_027228847.1|626773_627274_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_062727012.1|627287_628307_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_011214749.1|628424_628877_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_011213138.1|628873_629644_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_062727013.1|629647_630052_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_106221154.1|630073_631354_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.2	1.5e-94
WP_161514799.1|631615_632659_+	GNAT family N-acetyltransferase	NA	A0A2K5B2B6	Erysipelothrix_phage	31.0	1.1e-10
WP_062727016.1|632813_633077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080463913.1|633252_634083_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_062727018.1|634379_635228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028378031.1|635563_636031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062727019.1|636014_636773_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_027228837.1|636738_637347_-	uridine kinase	NA	NA	NA	NA	NA
WP_062727020.1|637343_637811_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_062727021.1|637807_638806_-	phosphotransferase	NA	NA	NA	NA	NA
WP_106221158.1|639115_640099_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.7	3.9e-31
WP_042646482.1|640384_642061_+	putative DNA binding domain-containing protein	NA	NA	NA	NA	NA
WP_042646536.1|642153_643377_+|integrase	site-specific integrase	integrase	Q9T1P3	Pseudomonas_phage	30.2	2.6e-24
647843:647857	attR	GGCAAAGACGTTATC	NA	NA	NA	NA
>prophage 2
NZ_CP021256	Legionella pneumophila strain D-4954 chromosome, complete genome	3661362	915533	1035480	3661362	transposase,tRNA,protease	Enterobacteria_phage(14.29%)	104	NA	NA
WP_106221264.1|915533_918299_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	40.0	2.4e-158
WP_062727184.1|918556_921604_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.4	5.0e-61
WP_106183406.1|921724_922987_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_010946459.1|923226_923631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062727182.1|923692_924130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027223766.1|924254_924566_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_106221266.1|924593_925847_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	51.2	4.0e-97
WP_010946463.1|925849_926317_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_161514900.1|926375_926819_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_161514899.1|926811_927768_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_106183410.1|927847_928330_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_060871634.1|928329_929382_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_060871635.1|929373_930111_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_028379500.1|930120_930759_-	porin family protein	NA	NA	NA	NA	NA
WP_106221270.1|932568_934170_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.1	4.8e-87
WP_106183414.1|934460_937727_+	DEAD/DEAH box helicase family protein	NA	M1GYP4	Paramecium_bursaria_Chlorella_virus	27.3	2.7e-36
WP_032829049.1|937996_938431_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_010946475.1|938609_939992_+	replicative DNA helicase	NA	O80281	Escherichia_phage	58.1	2.9e-141
WP_061481418.1|939993_941067_+	alanine racemase	NA	NA	NA	NA	NA
WP_027223780.1|941139_941589_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_028379495.1|941757_942192_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_106221273.1|942306_943494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028379493.1|943599_943872_+	CDGSH iron-sulfur domain-containing protein	NA	NA	NA	NA	NA
WP_028379492.1|943891_945442_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.2	1.7e-20
WP_106221275.1|945593_946583_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_161499055.1|946924_947503_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_161499056.1|947430_947778_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_161499057.1|947830_948163_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_106221284.1|949345_950854_-	peptide MFS transporter	NA	NA	NA	NA	NA
WP_106142989.1|950892_951711_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_152027444.1|952106_953129_+	N,N'-diacetyllegionaminate synthase	NA	A0A1B1IVE2	uncultured_Mediterranean_phage	38.9	3.5e-35
WP_106221289.1|953128_954262_+	UDP-N-acetylglucosamine 2-epimerase (hydrolyzing)	NA	NA	NA	NA	NA
WP_027268532.1|954251_954860_+	acetyltransferase	NA	NA	NA	NA	NA
WP_027268531.1|954870_956373_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_106221291.1|956462_957026_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.5	1.1e-51
WP_106221293.1|957026_957911_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	33.7	1.2e-31
WP_192876620.1|957921_958950_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.9	2.7e-83
WP_106221297.1|959003_960488_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_161514826.1|960642_961518_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.0	9.3e-93
WP_027268525.1|961538_962495_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_106221301.1|962478_963483_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_161499056.1|963796_964144_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_161499055.1|964071_964650_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_161499058.1|964993_965572_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_161499056.1|965499_965847_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_106221305.1|966082_966361_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_106221307.1|966347_966830_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_106221309.1|966924_967650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106221310.1|967769_968372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106221312.1|968692_969886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106221314.1|969995_971951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106221316.1|971971_973888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161499059.1|973877_975707_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	1.9e-07
WP_106221320.1|975723_976560_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_106221322.1|976573_977410_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_106221323.1|977402_978182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106221325.1|978223_979534_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_106221327.1|979546_980551_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_161499060.1|980551_981319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106221332.1|981315_982347_-	N-acetylneuraminate synthase family protein	NA	NA	NA	NA	NA
WP_106221334.1|982545_983667_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_161499061.1|983871_984609_+	acylneuraminate cytidylyltransferase family protein	NA	NA	NA	NA	NA
WP_106221338.1|984628_985714_+	N-acetylneuraminate synthase family protein	NA	NA	NA	NA	NA
WP_106221340.1|985753_988234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106221342.1|988250_989168_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_106221344.1|989161_990181_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_106221346.1|990412_991120_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011213314.1|991679_991874_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	70.6	3.0e-12
WP_106221348.1|991965_992961_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_014841197.1|992964_993702_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_010946522.1|993783_994737_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_161514758.1|994729_996025_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_106221352.1|996434_996971_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_106221354.1|997175_998342_+	DUF1574 family protein	NA	NA	NA	NA	NA
WP_106221356.1|998338_999781_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	40.2	4.3e-71
WP_106221358.1|999886_1001263_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_061504390.1|1001467_1002169_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_161514759.1|1002334_1003594_+	MFS transporter	NA	NA	NA	NA	NA
WP_152027445.1|1003708_1005133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062727135.1|1005776_1006163_+	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_106221364.1|1006337_1007681_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_080464554.1|1007755_1009552_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_062727133.1|1009548_1010919_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	49.9	2.8e-112
WP_106221366.1|1011071_1012775_+	sulfate permease	NA	A0A2H4J153	uncultured_Caudovirales_phage	26.9	4.2e-41
WP_106221368.1|1012947_1014651_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_106221370.1|1014795_1015794_-	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_106221372.1|1016018_1018406_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	38.4	9.1e-175
WP_106194399.1|1018645_1020085_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_106194402.1|1020081_1020924_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_106194405.1|1020920_1022012_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_106221374.1|1021986_1023402_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_027221169.1|1023493_1023811_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011213320.1|1024006_1025044_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_027221170.1|1025021_1025930_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_062740128.1|1025926_1026406_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_062727124.1|1026341_1026944_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_028377915.1|1027118_1027817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028377916.1|1027926_1029183_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	74.1	1.9e-14
WP_027221175.1|1029583_1029919_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	36.5	5.8e-11
WP_061481371.1|1029950_1032218_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.4	3.0e-167
WP_062727121.1|1032444_1033227_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_080464060.1|1033226_1034477_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_028377920.1|1034477_1034813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062727120.1|1034880_1035480_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP021256	Legionella pneumophila strain D-4954 chromosome, complete genome	3661362	1049818	1056702	3661362		Acinetobacter_phage(42.86%)	9	NA	NA
WP_062727111.1|1049818_1050595_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	48.6	1.1e-57
WP_062727110.1|1050587_1051622_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	47.6	9.3e-76
WP_062727109.1|1051599_1052178_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	52.6	3.9e-55
WP_106221384.1|1052211_1052937_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	1.1e-17
WP_106183505.1|1052933_1053443_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_106183506.1|1053423_1053993_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_106183507.1|1053989_1054517_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	47.7	1.4e-27
WP_106183508.1|1054531_1055494_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.4	5.0e-39
WP_027227556.1|1055904_1056702_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	1.7e-21
>prophage 4
NZ_CP021256	Legionella pneumophila strain D-4954 chromosome, complete genome	3661362	1401045	1406983	3661362		Staphylococcus_phage(50.0%)	6	NA	NA
WP_062727573.1|1401045_1402119_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	27.0	1.5e-28
WP_062727574.1|1402103_1402718_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.4	4.6e-22
WP_027227759.1|1402714_1403923_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.7	5.9e-98
WP_106183665.1|1403930_1404398_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	50.9	1.9e-23
WP_028378484.1|1404524_1406162_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.5	3.2e-155
WP_062727576.1|1406158_1406983_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	44.3	2.7e-54
>prophage 5
NZ_CP021256	Legionella pneumophila strain D-4954 chromosome, complete genome	3661362	2139529	2206446	3661362	integrase,transposase,tRNA,protease	Tupanvirus(18.18%)	59	2162138:2162155	2182206:2182223
WP_106221826.1|2139529_2141596_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_106221828.1|2141585_2142491_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_028378051.1|2142724_2143510_-	DsbA family protein	NA	NA	NA	NA	NA
WP_106221830.1|2143714_2145880_-	DNA helicase II	NA	A7KV33	Bacillus_phage	36.9	9.6e-115
WP_106183926.1|2146101_2147061_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_106183927.1|2147054_2147492_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_028378047.1|2147694_2148477_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_027227838.1|2148627_2149587_-	glutathione synthase	NA	NA	NA	NA	NA
WP_106221832.1|2149586_2150882_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_106184441.1|2151191_2152088_+	DMT family transporter	NA	NA	NA	NA	NA
WP_027227834.1|2152091_2152373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106221836.1|2152359_2152710_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_106221838.1|2152743_2153406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161514725.1|2153918_2155556_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_027227830.1|2155608_2156247_+	uridine kinase	NA	A0A2K9L178	Tupanvirus	36.7	1.7e-27
WP_080463930.1|2156342_2157149_+	enoyl-ACP reductase	NA	NA	NA	NA	NA
WP_192876614.1|2157624_2159763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106221842.1|2160036_2161911_-	SurA N-terminal domain-containing protein	NA	NA	NA	NA	NA
2162138:2162155	attL	GCTCTCCCAGCTGAGCTA	NA	NA	NA	NA
WP_011214112.1|2162169_2162448_-	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	49.4	2.5e-15
WP_027227825.1|2162576_2165027_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	50.6	1.5e-212
WP_027227824.1|2165260_2166535_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.0	8.4e-135
WP_010947585.1|2166678_2167323_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.5	1.2e-57
WP_106221844.1|2167325_2168657_-	trigger factor	NA	NA	NA	NA	NA
WP_080463929.1|2169522_2170749_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_106183931.1|2171066_2172917_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	32.8	1.1e-71
WP_027227819.1|2172969_2173644_-	ribonuclease III	NA	A0A0P0BX11	Ostreococcus_lucimarinus_virus	33.8	1.3e-25
WP_027227818.1|2173633_2174026_-	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_027227817.1|2174037_2174793_-	signal peptidase I	NA	NA	NA	NA	NA
WP_027227816.1|2174899_2176732_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.2	2.1e-22
WP_161514724.1|2176926_2177943_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_106183936.1|2178034_2179174_+	GspL family type II secretion system protein LspL	NA	NA	NA	NA	NA
WP_106183937.1|2179170_2179641_+	GspM family type II secretion system protein LspM	NA	NA	NA	NA	NA
WP_080463927.1|2179746_2180280_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_027227811.1|2180532_2181858_+	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_106221849.1|2182542_2184072_+	alpha,alpha-trehalase	NA	NA	NA	NA	NA
2182206:2182223	attR	GCTCTCCCAGCTGAGCTA	NA	NA	NA	NA
WP_161514746.1|2184096_2185161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106221853.1|2185252_2185693_-	VOC family protein	NA	NA	NA	NA	NA
WP_010947600.1|2185926_2186454_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	33.8	1.7e-20
WP_062727742.1|2186690_2187911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062727743.1|2188034_2189207_+	SET domain-containing protein	NA	NA	NA	NA	NA
WP_062727744.1|2189545_2189860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106183941.1|2190023_2191136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062727746.1|2191216_2191492_-	acylphosphatase	NA	NA	NA	NA	NA
WP_062727747.1|2191644_2191998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062727748.1|2192189_2193515_-	phosphatidylserine/phosphatidylglycerophosphate/ cardiolipin synthase family protein	NA	NA	NA	NA	NA
WP_062727749.1|2193743_2194709_+	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	48.3	1.4e-78
WP_106221855.1|2194772_2196494_-	secretion system protein	NA	NA	NA	NA	NA
WP_027222068.1|2196604_2196871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161514723.1|2196915_2197335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062727752.1|2197344_2198625_-	MFS transporter	NA	NA	NA	NA	NA
WP_106183942.1|2199013_2199508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106221857.1|2199762_2201043_+	chloride channel protein	NA	NA	NA	NA	NA
WP_161514722.1|2201142_2201646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062727420.1|2201909_2202389_+	YchJ family protein	NA	NA	NA	NA	NA
WP_027227795.1|2202408_2204214_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_161499056.1|2204395_2204743_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_161499058.1|2204670_2205249_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_161499055.1|2205592_2206171_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_161499056.1|2206098_2206446_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP021256	Legionella pneumophila strain D-4954 chromosome, complete genome	3661362	2362117	2372238	3661362		Bacillus_phage(16.67%)	7	NA	NA
WP_038838944.1|2362117_2363806_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.4	1.0e-15
WP_161514883.1|2363937_2364945_-	AraC family transcriptional regulator ligand-binding domain-containing protein	NA	NA	NA	NA	NA
WP_106184006.1|2365069_2366395_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	31.4	6.2e-48
WP_106221921.1|2366413_2367562_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.0	1.1e-125
WP_062726357.1|2367765_2368878_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.7	7.2e-50
WP_027229222.1|2368976_2370116_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.7	1.6e-23
WP_062726356.1|2370303_2372238_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.6	1.3e-147
>prophage 7
NZ_CP021256	Legionella pneumophila strain D-4954 chromosome, complete genome	3661362	2833858	2873183	3661362	integrase,transposase	Burkholderia_phage(33.33%)	41	2854805:2854864	2868002:2868065
WP_152027460.1|2833858_2833939_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014842352.1|2834447_2835299_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_027265135.1|2835295_2835904_-	AbiEi antitoxin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_014842354.1|2836146_2836410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042754800.1|2836409_2837171_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_014842362.1|2837578_2838727_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_014842363.1|2838756_2839875_+	DUF3494 domain-containing protein	NA	NA	NA	NA	NA
WP_154080660.1|2840178_2840337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027265134.1|2840384_2840726_+	helix-turn-helix domain-containing protein	NA	A0A218MNC9	uncultured_virus	39.0	4.5e-11
WP_042754799.1|2840742_2841234_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	26.5	3.4e-12
WP_014842364.1|2841482_2841734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014842365.1|2841814_2842009_-	CsbD family protein	NA	NA	NA	NA	NA
WP_014842366.1|2842141_2842495_-	PRC-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_014842368.1|2843351_2843855_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014842369.1|2843857_2845039_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_065211439.1|2845343_2845511_+	DUF3309 domain-containing protein	NA	NA	NA	NA	NA
WP_014842370.1|2845635_2846841_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_014842371.1|2847047_2848823_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_080031823.1|2849162_2849597_+	TIGR00341 family protein	NA	NA	NA	NA	NA
WP_014842373.1|2849632_2849959_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_110540214.1|2850017_2850458_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_014842375.1|2850473_2850800_+	DUF389 domain-containing protein	NA	NA	NA	NA	NA
WP_014842376.1|2851067_2852078_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_014842377.1|2852372_2852708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014842378.1|2852877_2854209_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	35.6	3.0e-58
2854805:2854864	attL	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAATAAAATCAAGTAGT	NA	NA	NA	NA
WP_106222062.1|2855042_2856743_+	AAA family ATPase	NA	E5E3R2	Burkholderia_phage	22.7	6.8e-15
WP_106222064.1|2856821_2858165_-	DUF2130 domain-containing protein	NA	NA	NA	NA	NA
WP_152027452.1|2858674_2859028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106222072.1|2859378_2859744_-	TraK family protein	NA	NA	NA	NA	NA
WP_161499066.1|2859927_2860068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106222074.1|2861876_2862152_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_192876615.1|2862773_2864006_+	DUF4143 domain-containing protein	NA	NA	NA	NA	NA
WP_106222078.1|2864027_2864795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106222080.1|2864960_2865860_+	HipA domain-containing protein	NA	NA	NA	NA	NA
WP_106222082.1|2865849_2866500_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_106222084.1|2866612_2867842_-|integrase	integrase family protein	integrase	A0A0P0IKP2	Acinetobacter_phage	32.4	8.8e-49
WP_106222086.1|2868147_2868504_+	hypothetical protein	NA	NA	NA	NA	NA
2868002:2868065	attR	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAATAAAATCAAGTAGTTACG	NA	NA	NA	NA
WP_106222088.1|2868941_2869976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062728144.1|2870158_2871010_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_062728146.1|2871006_2871615_-	AbiEi antitoxin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_106174732.1|2872007_2873183_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	20.5	8.3e-12
>prophage 8
NZ_CP021256	Legionella pneumophila strain D-4954 chromosome, complete genome	3661362	3108674	3144543	3661362	integrase,transposase,tRNA	Acanthamoeba_polyphaga_moumouvirus(20.0%)	33	3133756:3133801	3147774:3147819
WP_027228154.1|3108674_3109010_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_080464320.1|3109087_3109843_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_106184250.1|3109994_3110579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062728257.1|3110881_3111655_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_106222230.1|3111860_3112856_-	DMT family transporter	NA	NA	NA	NA	NA
WP_062728255.1|3113280_3114126_+	DUF2306 domain-containing protein	NA	NA	NA	NA	NA
WP_106222232.1|3114161_3115829_-	lpg2552 family Dot/Icm T4SS effector	NA	NA	NA	NA	NA
WP_106222234.1|3116006_3117374_+	MFS transporter	NA	NA	NA	NA	NA
WP_106222236.1|3117513_3119214_-	DnaJ domain-containing protein	NA	L7RC83	Acanthamoeba_polyphaga_moumouvirus	53.1	1.2e-08
WP_027228161.1|3119790_3120225_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	52.4	1.0e-15
WP_062728251.1|3120391_3120991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062740188.1|3121135_3121864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106184253.1|3122199_3122874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152027458.1|3123238_3123925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062728225.1|3124271_3125588_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_106222238.1|3125789_3127100_-	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	64.7	9.5e-25
WP_106222240.1|3127349_3127979_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_106222244.1|3128889_3129183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106222246.1|3129401_3130457_-	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_192875956.1|3130453_3131497_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_106222248.1|3131571_3132606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106222250.1|3133391_3133628_-	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
3133756:3133801	attL	TTGGTCGGGACGGAAGGATTTGAACCTTCGACCACTAGCACCCCAT	NA	NA	NA	NA
WP_080124663.1|3133970_3135212_+|integrase	site-specific integrase	integrase	I6R9B6	Salmonella_phage	29.6	3.5e-45
WP_106222252.1|3135709_3136561_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_106222254.1|3136557_3137145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027222671.1|3137401_3137866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038839570.1|3139291_3140269_-	Abi family protein	NA	A3QSC6	Clostridium_virus	27.7	1.4e-25
WP_106222256.1|3140470_3140773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038839574.1|3140765_3141398_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_106222266.1|3141404_3142223_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_154213644.1|3142614_3142767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106222268.1|3142847_3143657_+|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_106222270.1|3143646_3144543_+|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
3147774:3147819	attR	TTGGTCGGGACGGAAGGATTTGAACCTTCGACCACTAGCACCCCAT	NA	NA	NA	NA
