The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021259	Legionella pneumophila strain D-7708 chromosome, complete genome	3412234	1001422	1008261	3412234		Acinetobacter_phage(42.86%)	9	NA	NA
WP_106224977.1|1001422_1002199_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	48.6	1.5e-57
WP_061692139.1|1002191_1003226_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	47.6	2.7e-75
WP_061637689.1|1003203_1003782_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	53.2	1.0e-55
WP_010946572.1|1003815_1004541_-	LPS export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	3.1e-17
WP_011215024.1|1004537_1005047_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_011215025.1|1005027_1005597_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_011213328.1|1005593_1006121_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	47.7	1.4e-27
WP_061692138.1|1006134_1007097_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.4	1.1e-38
WP_011215026.1|1007463_1008261_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	1.7e-21
>prophage 2
NZ_CP021259	Legionella pneumophila strain D-7708 chromosome, complete genome	3412234	1101870	1171592	3412234	protease,integrase,tRNA,transposase	Bandra_megavirus(10.0%)	52	1165864:1165879	1172566:1172581
WP_027221274.1|1101870_1104666_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9V7W4	Bandra_megavirus	27.8	4.9e-87
WP_027221275.1|1104662_1105127_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_027221276.1|1105266_1105830_-	multidrug DMT transporter permease	NA	NA	NA	NA	NA
WP_027221277.1|1106004_1108194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106224993.1|1108439_1111565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032828879.1|1111829_1112717_+	GTPase Era	NA	NA	NA	NA	NA
WP_027221280.1|1112706_1113396_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_027221281.1|1113460_1114636_-	DUF5617 domain-containing protein	NA	NA	NA	NA	NA
WP_027221282.1|1114797_1115685_-	GALA protein	NA	NA	NA	NA	NA
WP_027221283.1|1115984_1116731_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_027221284.1|1116717_1118535_+	2-oxoacid:acceptor oxidoreductase subunit alpha	NA	NA	NA	NA	NA
WP_192877332.1|1118518_1119487_+	2-oxoacid:ferredoxin oxidoreductase subunit beta	NA	NA	NA	NA	NA
WP_011946039.1|1120030_1120306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106224996.1|1120296_1120503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014841292.1|1120802_1121477_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.5	3.1e-27
WP_027227651.1|1121695_1122502_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_106224997.1|1122513_1123956_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_106224998.1|1124001_1124880_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_106224999.1|1124906_1126574_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	26.7	7.3e-46
WP_106225000.1|1126552_1130014_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_028377962.1|1130090_1131353_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_028377963.1|1131356_1132535_-	DUF4785 family protein	NA	NA	NA	NA	NA
WP_192877333.1|1132531_1133431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_192877334.1|1133617_1135639_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.5	2.6e-138
WP_192877381.1|1135768_1137925_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_106225004.1|1137921_1138899_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_192877335.1|1138922_1140269_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_027227662.1|1140343_1143790_+	DNA polymerase III subunit alpha	NA	A0A291AWR1	Streptomyces_phage	36.0	2.3e-187
WP_027227663.1|1143872_1145123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027227664.1|1145598_1146483_+	decaprenyl-phosphate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_192877336.1|1146482_1147991_+	protein LphB	NA	NA	NA	NA	NA
WP_027227666.1|1148045_1149923_+	polysaccharide biosynthesis protein	NA	L7Y3T9	Megavirus	29.1	1.8e-24
WP_106225007.1|1150069_1150663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106225008.1|1151032_1152727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027227669.1|1153139_1153880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027227670.1|1153979_1155443_-	amino acid permease	NA	NA	NA	NA	NA
WP_106225009.1|1155822_1156968_+	multidrug DMT transporter permease	NA	NA	NA	NA	NA
WP_106224842.1|1157099_1158086_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.1	3.2e-33
WP_106225010.1|1158631_1159390_+	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_106225011.1|1159460_1160528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106225012.1|1160583_1162257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152687500.1|1162253_1162988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106225015.1|1163394_1163997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106225016.1|1164171_1164678_-	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	36.0	1.4e-16
WP_106225017.1|1164743_1165166_-	single-stranded DNA-binding protein	NA	A0A077SK05	Escherichia_phage	41.4	2.1e-18
WP_106225018.1|1165266_1165461_-	hypothetical protein	NA	NA	NA	NA	NA
1165864:1165879	attL	TTATTTTGATGATTAA	NA	NA	NA	NA
WP_192877337.1|1165871_1166411_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_106225020.1|1166582_1167842_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_106225021.1|1167834_1168827_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_106225022.1|1168829_1169837_+|integrase	tyrosine-type recombinase/integrase	integrase	S5M872	Bacillus_phage	24.5	1.3e-10
WP_106225023.1|1170084_1170594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_192877338.1|1170692_1171592_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
1172566:1172581	attR	TTATTTTGATGATTAA	NA	NA	NA	NA
>prophage 3
NZ_CP021259	Legionella pneumophila strain D-7708 chromosome, complete genome	3412234	1260970	1282821	3412234	transposase,integrase	Pseudomonas_phage(25.0%)	27	1262413:1262432	1270550:1270569
WP_106225101.1|1260970_1262152_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	29.7	6.5e-41
1262413:1262432	attL	CGTGTCGAATATGTGTCGAA	NA	NA	NA	NA
WP_106225102.1|1262885_1264079_+	DUF4263 domain-containing protein	NA	NA	NA	NA	NA
WP_106225103.1|1264283_1266038_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	32.8	5.1e-66
WP_061692146.1|1266115_1266367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106225105.1|1266790_1267150_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_106225106.1|1267391_1267838_+	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	45.5	1.4e-25
WP_106225107.1|1267841_1268411_+	PIN domain-containing protein	NA	K4HZX4	Acidithiobacillus_phage	58.5	9.4e-54
WP_106225108.1|1268596_1269277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106225109.1|1269297_1270515_-|integrase	integrase family protein	integrase	A0A0M3LRG1	Mannheimia_phage	24.4	4.6e-05
WP_106224842.1|1270774_1271761_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.1	3.2e-33
1270550:1270569	attR	CGTGTCGAATATGTGTCGAA	NA	NA	NA	NA
WP_106225110.1|1271930_1272704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106225111.1|1272884_1273256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011215191.1|1273255_1273615_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106225112.1|1273683_1273947_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_061504501.1|1274357_1275479_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_106225113.1|1275463_1276480_-|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	78.5	2.7e-152
WP_106225114.1|1276579_1276780_-	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
WP_027221326.1|1277144_1277648_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_106225115.1|1277650_1278832_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_106225116.1|1279006_1279297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161499092.1|1279445_1279619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011214444.1|1279730_1279898_+	DUF3309 domain-containing protein	NA	NA	NA	NA	NA
WP_161499093.1|1280385_1281309_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_027221328.1|1281431_1281683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027221329.1|1281703_1281910_-	CsbD family protein	NA	NA	NA	NA	NA
WP_106225118.1|1282020_1282374_-	PRC-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_106225119.1|1282608_1282821_-|transposase	transposase	transposase	A0A1B0Z042	Pseudomonas_phage	47.6	1.1e-07
>prophage 4
NZ_CP021259	Legionella pneumophila strain D-7708 chromosome, complete genome	3412234	1379082	1388578	3412234		Staphylococcus_phage(42.86%)	9	NA	NA
WP_027227755.1|1379082_1380411_+	sigma-54-dependent Fis family transcriptional regulator	NA	W8CYM9	Bacillus_phage	26.8	1.7e-08
WP_011213531.1|1380585_1380831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027227756.1|1381141_1382578_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_027227757.1|1382640_1383714_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	26.9	1.8e-29
WP_027227758.1|1383698_1384313_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.4	4.6e-22
WP_027227759.1|1384309_1385518_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.7	5.9e-98
WP_106225156.1|1385525_1385993_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.1	9.2e-23
WP_028378484.1|1386119_1387757_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.5	3.2e-155
WP_027227762.1|1387753_1388578_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	44.3	2.1e-54
>prophage 5
NZ_CP021259	Legionella pneumophila strain D-7708 chromosome, complete genome	3412234	2328177	2338294	3412234		Bacillus_phage(16.67%)	7	NA	NA
WP_106225504.1|2328177_2329860_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.4	6.1e-16
WP_062726360.1|2329993_2331001_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_106184006.1|2331125_2332451_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	31.4	6.2e-48
WP_027229220.1|2332469_2333618_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.2	1.7e-126
WP_027229221.1|2333820_2334933_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.4	4.7e-49
WP_027229222.1|2335031_2336171_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.7	1.6e-23
WP_106225505.1|2336359_2338294_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.6	1.3e-147
