The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	0	8592	4949048	protease	Bacillus_phage(25.0%)	7	NA	NA
WP_001194534.1|456_855_-	long-chain acyl-CoA thioesterase FadM	NA	NA	NA	NA	NA
WP_000680288.1|960_1332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000969384.1|1482_3354_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_001043542.1|3545_3818_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_001295325.1|4026_6381_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_000130305.1|6568_7843_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_000122253.1|7968_8592_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 2
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	32422	41403	4949048	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_001021161.1|32422_32893_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_001150470.1|32981_34085_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	6.9e-53
WP_000543535.1|34088_34538_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001297136.1|34688_35228_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_001295328.1|35526_36411_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000974813.1|36587_36935_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_000046637.1|37063_38035_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934822.1|38045_39893_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|39920_40253_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667319.1|40275_41403_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 3
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	48355	58327	4949048		Bacillus_phage(60.0%)	7	NA	NA
WP_050866900.1|48355_49651_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	7.7e-27
WP_000113933.1|49708_50398_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_001221319.1|50587_51790_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000698839.1|51786_54930_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001306939.1|55055_56240_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001219320.1|56382_57291_-	fructokinase	NA	NA	NA	NA	NA
WP_001298537.1|57415_58327_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
>prophage 4
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	62670	63786	4949048		Bacillus_phage(100.0%)	1	NA	NA
WP_050866899.1|62670_63786_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 5
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	71201	72359	4949048		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830741.1|71201_72359_+	OXA-12 family class D beta-lactamase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 6
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	79302	80070	4949048		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939395.1|79302_80070_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.9	3.8e-26
>prophage 7
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	85366	86476	4949048		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|85366_86476_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 8
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	89554	91515	4949048		Micromonas_sp._RCC1109_virus(50.0%)	2	NA	NA
WP_001013499.1|89554_90568_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
WP_000044314.1|90564_91515_-	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
>prophage 9
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	96923	101203	4949048		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000805902.1|96923_98006_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
WP_000177903.1|98128_101203_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	98.8	0.0e+00
>prophage 10
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	105743	111338	4949048		Lactobacillus_phage(50.0%)	4	NA	NA
WP_000952482.1|105743_106643_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	3.2e-16
WP_001299008.1|106682_107966_-	cytosine deaminase	NA	NA	NA	NA	NA
WP_000076236.1|107955_109215_-	cytosine permease	NA	NA	NA	NA	NA
WP_000010276.1|109451_111338_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	9.1e-53
>prophage 11
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	119718	124256	4949048		Acanthamoeba_polyphaga_mimivirus(50.0%)	4	NA	NA
WP_000692742.1|119718_120768_-	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.3	1.1e-71
WP_000750340.1|120854_121811_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000818900.1|121807_122779_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000447335.1|122771_124256_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	8.0e-12
>prophage 12
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	136249	148363	4949048	integrase,holin	Escherichia_phage(50.0%)	6	146752:146765	152951:152964
WP_001378729.1|136249_140233_-	autotransporter adhesin EhaA	NA	A0A2L1IV18	Escherichia_phage	38.0	9.3e-124
WP_000131044.1|140805_142839_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001295527.1|142967_143555_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089077.1|143568_145041_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159102.1|145054_146725_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
146752:146765	attL	CGATCTGATTGAGA	NA	NA	NA	NA
WP_001295805.1|147799_148363_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
WP_001295805.1|147799_148363_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
152951:152964	attR	CGATCTGATTGAGA	NA	NA	NA	NA
>prophage 13
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	158286	161591	4949048		Erysipelothrix_phage(50.0%)	4	NA	NA
WP_001046293.1|158286_159612_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
WP_000474077.1|159720_159957_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|159968_160562_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001299025.1|160721_161591_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
>prophage 14
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	184361	188073	4949048		Streptococcus_phage(66.67%)	3	NA	NA
WP_000893255.1|184361_185615_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_001285288.1|185626_186730_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749882.1|187017_188073_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	1.3e-117
>prophage 15
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	198965	202884	4949048		Clostridioides_phage(50.0%)	6	NA	NA
WP_136764957.1|198965_199739_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729704.1|199924_200185_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615976.1|200187_200466_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|200621_201362_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|201332_202100_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|202305_202884_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
>prophage 16
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	213787	215929	4949048		Ralstonia_phage(100.0%)	1	NA	NA
WP_000103320.1|213787_215929_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
>prophage 17
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	226892	229652	4949048		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000614334.1|226892_229652_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.4	4.7e-82
>prophage 18
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	240128	247981	4949048		Bradyrhizobium_phage(25.0%)	9	NA	NA
WP_001297205.1|240128_240860_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|240924_241392_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297210.1|241388_242111_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052720.1|242144_242900_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|242971_244330_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211690.1|244377_245148_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|245225_246026_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648606.1|246266_247181_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997010.1|247177_247981_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
>prophage 19
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	254502	255534	4949048		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|254502_255534_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 20
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	269772	273888	4949048		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_001294757.1|269772_273255_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|273291_273888_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
>prophage 21
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	295357	296782	4949048	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|295357_296782_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 22
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	300711	301056	4949048		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|300711_301056_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 23
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	306966	307764	4949048		Planktothrix_phage(100.0%)	1	NA	NA
WP_001315242.1|306966_307764_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	1.0e-13
>prophage 24
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	313006	319812	4949048	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_072097541.1|313006_315436_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.3	3.0e-40
WP_001294700.1|315509_316040_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396036.1|316054_316759_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|316936_317392_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000937432.1|317428_318355_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174643.1|318393_319812_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 25
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	329717	330620	4949048		Sodalis_phage(100.0%)	1	NA	NA
WP_000339945.1|329717_330620_-	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	5.7e-61
>prophage 26
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	333882	334809	4949048		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000150637.1|333882_334809_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 27
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	340224	341775	4949048		Mamastrovirus(100.0%)	1	NA	NA
WP_001189608.1|340224_341775_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
>prophage 28
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	349424	350849	4949048		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|349424_350849_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 29
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	359476	360028	4949048		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|359476_360028_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 30
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	364273	365317	4949048		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|364273_365317_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 31
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	391290	393015	4949048		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_044862875.1|391290_393015_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.7	4.1e-36
>prophage 32
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	405717	406416	4949048		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916291.1|405717_406416_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.8e-23
>prophage 33
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	412748	418171	4949048		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_000035656.1|412748_415100_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.8e-37
WP_001117010.1|415264_418171_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 34
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	425915	427315	4949048		Microcystis_phage(50.0%)	2	NA	NA
WP_000257186.1|425915_426758_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
WP_000624375.1|426835_427315_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 35
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	435209	440870	4949048		Vibrio_phage(50.0%)	4	NA	NA
WP_000787111.1|435209_436724_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
WP_106904055.1|436754_437897_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000349932.1|438025_439243_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_001297614.1|439316_440870_+	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.4	4.7e-31
>prophage 36
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	446340	447489	4949048		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|446340_447489_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 37
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	451894	454711	4949048	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286857.1|451894_454711_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 38
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	461744	470811	4949048		uncultured_Caudovirales_phage(20.0%)	9	NA	NA
WP_000681360.1|461744_462911_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	7.5e-90
WP_000935262.1|463439_463649_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_001118464.1|463752_464883_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000516135.1|464971_466888_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_044862872.1|467264_467669_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102379.1|467694_468408_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528538.1|468556_469123_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001094682.1|469155_469743_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130182.1|469857_470811_-	transaldolase	NA	A0A127KNC6	Cyanophage	32.7	7.4e-11
>prophage 39
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	483849	485963	4949048		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_001219604.1|483849_485274_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	1.2e-09
WP_001188659.1|485273_485963_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
>prophage 40
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	489246	494601	4949048		Bacillus_phage(33.33%)	3	NA	NA
WP_000409451.1|489246_491184_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|491394_493062_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093810.1|493368_494601_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
>prophage 41
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	501344	502667	4949048		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|501344_502667_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 42
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	508302	511178	4949048		Salmonella_phage(50.0%)	3	NA	NA
WP_000490275.1|508302_508464_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|508590_509196_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000175943.1|509588_511178_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
>prophage 43
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	519071	520351	4949048		Salmonella_phage(50.0%)	2	NA	NA
WP_000098824.1|519071_519611_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
WP_000799911.1|519613_520351_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 44
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	523577	528942	4949048		Tupanvirus(50.0%)	4	NA	NA
WP_000106030.1|523577_524600_-	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
WP_000091572.1|524738_525653_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000410127.1|525867_527229_+	MFS transporter	NA	NA	NA	NA	NA
WP_000919567.1|527277_528942_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 45
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	549007	549952	4949048	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000181113.1|549007_549952_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	1.3e-60
>prophage 46
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	557453	558008	4949048		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151854.1|557453_558008_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 47
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	564576	566037	4949048		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208194.1|564576_566037_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
>prophage 48
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	576240	577880	4949048		Escherichia_phage(100.0%)	2	NA	NA
WP_000044711.1|576240_576837_-	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
WP_032162589.1|577313_577880_-	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.1	7.2e-54
>prophage 49
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	581276	582257	4949048		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001295601.1|581276_582257_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	55.9	1.2e-101
>prophage 50
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	585885	588020	4949048		Klebsiella_phage(33.33%)	4	NA	NA
WP_000692345.1|585885_586107_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001560709.1|586169_586646_-	RadC family protein	NA	NA	NA	NA	NA
WP_000849588.1|586661_587147_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
WP_001234620.1|587201_588020_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
>prophage 51
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	603528	607855	4949048	transposase	Stx2-converting_phage(75.0%)	5	NA	NA
WP_002431009.1|603528_603909_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	97.6	2.3e-64
WP_000612632.1|603905_604253_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	98.3	1.4e-60
WP_000997960.1|604302_605688_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	2.0e-259
WP_000823243.1|605926_607285_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000937736.1|607663_607855_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.4e-06
>prophage 52
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	615843	621196	4949048	transposase	Stx2-converting_phage(40.0%)	6	NA	NA
WP_000684856.1|615843_616800_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|616800_617568_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|618124_618382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000422741.1|618779_619205_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|619201_619552_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|619582_621196_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
>prophage 53
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	626946	632328	4949048	transposase	Enterobacteria_phage(66.67%)	6	NA	NA
WP_088130945.1|626946_628174_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.7	1.0e-174
WP_001446914.1|628560_628800_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	66.0	1.5e-13
WP_000345346.1|629010_630267_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000705931.1|630279_630567_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000916805.1|630582_631026_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000416152.1|631296_632328_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	8.0e-19
>prophage 54
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	643580	645893	4949048	transposase	Stx2-converting_phage(66.67%)	3	NA	NA
WP_001201739.1|643580_643964_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
WP_000609174.1|643960_644308_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_077166855.1|644357_645893_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.9	1.4e-261
>prophage 55
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	660736	665980	4949048		Acanthamoeba_polyphaga_moumouvirus(50.0%)	2	NA	NA
WP_025380671.1|660736_663187_-	ATP-dependent DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	25.5	7.7e-20
WP_024174459.1|663199_665980_-	DEAD/DEAH box helicase family protein	NA	A0A2H4J643	uncultured_Caudovirales_phage	43.0	2.6e-08
>prophage 56
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	670418	682512	4949048	integrase,tRNA	Stenotrophomonas_phage(20.0%)	8	663161:663175	675501:675515
663161:663175	attL	ACGAAGTTGTTGCCA	NA	NA	NA	NA
WP_001218948.1|670418_671663_-|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	42.2	1.1e-83
WP_001315986.1|672129_673149_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	3.2e-44
WP_025380672.1|673278_674781_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	7.9e-84
WP_001295681.1|674899_675982_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
675501:675515	attR	ACGAAGTTGTTGCCA	NA	NA	NA	NA
WP_000584114.1|675981_677082_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|677348_678860_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|679213_679657_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416392.1|679656_682512_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
>prophage 57
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	690788	696885	4949048		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_000013047.1|690788_691724_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.9	3.2e-51
WP_000148581.1|691736_692198_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|692270_692657_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_025380673.1|692862_695559_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|695699_695753_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181312.1|695937_696885_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
>prophage 58
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	700523	767050	4949048	protease,transposase,tRNA	Vibrio_phage(23.08%)	66	NA	NA
WP_000187791.1|700523_702662_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
WP_001106226.1|702819_703284_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	2.5e-52
WP_001232255.1|703328_703715_-	cytochrome b562	NA	NA	NA	NA	NA
WP_001162171.1|703897_705250_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|705344_705896_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_059324791.1|706051_707416_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853753.1|707591_708590_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000596015.1|708622_709618_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001297255.1|709604_710627_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000210557.1|710640_712143_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265933.1|712282_713239_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055072.1|713548_714079_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_001219160.1|714458_714800_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_044862999.1|714802_718582_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269316.1|718578_720312_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001295196.1|720517_721156_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|721478_722822_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|722883_723090_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175286.1|723414_723972_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000886900.1|723961_724702_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589409.1|724891_726835_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|726957_727338_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560597.1|727426_728287_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001295194.1|728395_729361_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331456.1|729468_730131_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|730175_731588_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|731896_732517_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119478.1|732734_733373_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_001309930.1|733519_734716_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.7	1.3e-206
WP_001526538.1|734723_735338_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	8.9e-42
WP_001586585.1|735780_736575_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|736645_737095_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|737136_737364_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|737368_737683_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216677.1|737689_738085_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492918.1|738411_738687_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170835.1|738816_739503_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_000949501.1|739502_740357_-	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_000056760.1|740366_741017_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776521.1|741030_741495_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|741504_741810_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001305665.1|741825_743223_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001295191.1|743577_744642_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|744749_745505_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569713.1|745501_746251_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|746432_746762_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|746910_747186_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001305666.1|747302_748928_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|749011_750175_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101676.1|750177_750816_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|750825_751224_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012565.1|751241_751901_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|751951_752650_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220123.1|752668_753070_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|753196_753928_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076316.1|754018_756460_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177639.1|756498_756924_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|757128_758427_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|758530_758728_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|758809_759814_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|759816_761076_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|761161_762442_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|762518_762827_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280339.1|762912_763863_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122499.1|763855_765703_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_000990321.1|765712_767050_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
>prophage 59
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	770964	771510	4949048		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|770964_771510_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 60
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	778938	779916	4949048		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|778938_779916_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 61
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	784836	785370	4949048		Morganella_phage(100.0%)	1	NA	NA
WP_001238378.1|784836_785370_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 62
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	791160	793144	4949048		Vibrio_phage(50.0%)	2	NA	NA
WP_000729117.1|791160_792807_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|792850_793144_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 63
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	807419	810631	4949048	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_000856832.1|807419_808877_+	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	4.0e-48
WP_001295074.1|809113_810631_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
>prophage 64
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	831827	833330	4949048		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296882.1|831827_833330_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	7.0e-56
>prophage 65
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	838169	838958	4949048		Cedratvirus(100.0%)	1	NA	NA
WP_001193391.1|838169_838958_+	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	8.5e-13
>prophage 66
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	844562	846112	4949048		Bacillus_virus(50.0%)	2	NA	NA
WP_001039799.1|844562_845321_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	3.6e-16
WP_106904059.1|845431_846112_+	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.1	1.9e-08
>prophage 67
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	850097	852083	4949048		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001307516.1|850097_852083_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	5.5e-149
>prophage 68
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	857328	859476	4949048		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|857328_859476_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 69
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	876298	877648	4949048		Moraxella_phage(100.0%)	1	NA	NA
WP_050866829.1|876298_877648_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	2.3e-159
>prophage 70
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	881465	885078	4949048		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|881465_882002_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357740.1|882255_885078_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
>prophage 71
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	889285	944816	4949048	capsid,holin,tRNA,portal,integrase,lysis,tail,head	Escherichia_phage(50.79%)	67	884984:884998	896466:896480
884984:884998	attL	GTGGCGGCGGCGAAA	NA	NA	NA	NA
WP_001147328.1|889285_890365_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
WP_000918363.1|890417_891833_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_000235518.1|891915_892899_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891389.1|893064_893307_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543828.1|893440_894478_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_032209684.1|894566_895664_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	100.0	1.2e-211
WP_032209683.1|895725_895974_+	DinI family protein	NA	S5MQI1	Escherichia_phage	98.8	3.1e-38
WP_050866830.1|896243_896915_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	98.7	6.0e-124
896466:896480	attR	TTTCGCCGCCGCCAC	NA	NA	NA	NA
WP_050866831.1|896956_898684_-|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	98.1	2.1e-229
WP_000078852.1|898825_898966_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	97.8	7.7e-18
WP_106904060.1|899163_902631_-	host specificity protein J	NA	S5MW25	Escherichia_phage	98.6	0.0e+00
WP_047634908.1|902870_903509_-|tail	tail assembly protein	tail	S5MDP1	Escherichia_phage	97.8	2.1e-94
WP_050866984.1|903406_904150_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	96.8	1.5e-147
WP_021574157.1|904160_904859_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.4	1.5e-130
WP_021574156.1|904858_905188_-|tail	phage tail protein	tail	S5MW28	Escherichia_phage	96.3	3.4e-56
WP_000533402.1|907761_908175_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479116.1|908201_908633_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000235046.1|908646_909399_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	1.0e-132
WP_000683079.1|909406_909802_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_024213759.1|909798_910374_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	9.8e-51
WP_001204554.1|910389_910743_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201501.1|910735_911119_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522591.1|911170_912199_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000256823.1|912256_912604_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_001253979.1|912640_914146_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
WP_040078097.1|914135_915728_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	4.5e-186
WP_000259002.1|915724_915931_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_040078692.1|917813_918320_-	DNA-packaging protein	NA	O64316	Escherichia_phage	47.9	3.7e-33
WP_001109015.1|919030_919573_-	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	100.0	1.1e-99
WP_032209690.1|919775_920213_-|lysis	lysis protein	lysis	A0A0P0ZFH2	Escherichia_phage	97.9	4.7e-69
WP_032209664.1|920215_920365_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	81.6	2.1e-13
WP_032209662.1|920364_920931_-	antirepressor	NA	A0A0H4IQ87	Shigella_phage	97.9	1.7e-103
WP_050866981.1|921204_921738_-	lysozyme	NA	G9L6J6	Escherichia_phage	95.5	3.1e-99
WP_000406285.1|921862_922150_+	hypothetical protein	NA	I6S632	Salmonella_phage	55.8	1.4e-21
WP_001371270.1|922154_922382_-	DUF1327 domain-containing protein	NA	Q5G8W5	Enterobacteria_phage	50.7	4.6e-12
WP_050866982.1|922409_922967_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	81.7	8.9e-49
WP_000284510.1|922970_923186_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_106904061.1|923681_925655_-	DUF1737 domain-containing protein	NA	S5MDQ7	Escherichia_phage	78.5	2.3e-301
WP_001398907.1|925898_926222_+	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	100.0	2.0e-61
WP_032209657.1|926519_926789_-	Shiga toxin Stx2d subunit B	NA	Q5TJL5	Enterobacteria_phage	98.9	1.3e-42
WP_001365055.1|926800_927760_-	Shiga toxin Stx2d subunit A	NA	Q6DWN9	Enterobacteria_phage	100.0	1.6e-175
WP_032209655.1|928142_929201_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.9	8.9e-207
WP_000917768.1|929351_929549_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	100.0	6.1e-29
WP_001202275.1|930161_931151_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	4.7e-194
WP_001061404.1|931158_931956_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	100.0	5.2e-151
WP_000767113.1|931975_932365_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210155.1|932361_932688_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	7.8e-53
WP_001343335.1|932684_933338_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	9.6e-127
WP_072097526.1|933337_933832_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	97.6	1.5e-87
WP_000128175.1|933828_934197_-	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_000620696.1|934817_935042_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_072097525.1|935038_935896_-	peptidase	NA	S5MQL6	Escherichia_phage	99.6	9.5e-159
WP_001087324.1|935892_937047_-	hypothetical protein	NA	K7PLX4	Enterobacteria_phage	85.0	2.3e-176
WP_000515863.1|937043_937595_-	hypothetical protein	NA	A0A0P0ZE62	Stx2-converting_phage	95.1	1.0e-97
WP_001191680.1|937587_937848_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZCZ7	Stx2-converting_phage	98.8	3.5e-40
WP_001020631.1|937945_938638_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	95.7	1.4e-120
WP_000135680.1|939360_939723_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081287.1|939788_940613_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_032209649.1|940741_941278_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	5.3e-99
WP_032209648.1|941268_942147_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	93.5	1.5e-167
WP_000156999.1|942143_942347_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	98.5	6.1e-32
WP_000476212.1|942339_942579_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	100.0	4.4e-37
WP_032209646.1|942575_942887_+	hypothetical protein	NA	A0A2H4N7F8	Pectobacterium_phage	40.9	2.8e-12
WP_032209645.1|942886_943429_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.8	6.8e-102
WP_032209644.1|943465_943738_+	pyocin activator protein PrtN	NA	S5MQM5	Escherichia_phage	98.9	2.7e-43
WP_032209643.1|943771_944320_-	hypothetical protein	NA	S5M7T3	Escherichia_phage	89.6	2.4e-83
WP_000287252.1|944342_944816_-	SocA family protein	NA	K4NZT7	Burkholderia_phage	31.8	2.4e-18
>prophage 72
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	949175	949784	4949048		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|949175_949784_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 73
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	958999	960115	4949048		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|958999_960115_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 74
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	975921	976713	4949048		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001130548.1|975921_976713_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.5	2.4e-47
>prophage 75
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	982363	986047	4949048		Dickeya_phage(100.0%)	1	NA	NA
WP_000096011.1|982363_986047_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 76
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1001417	1003007	4949048		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187566.1|1001417_1003007_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 77
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1008375	1010139	4949048		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|1008375_1008648_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000940106.1|1008834_1009425_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362392.1|1009467_1010139_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 78
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1019353	1027682	4949048		Vibrio_phage(50.0%)	2	NA	NA
WP_000653944.1|1019353_1023577_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
WP_000263098.1|1023653_1027682_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 79
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1031798	1034851	4949048		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|1031798_1032983_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023081.1|1033900_1034851_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 80
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1051932	1053147	4949048		Oenococcus_phage(100.0%)	1	NA	NA
WP_000690946.1|1051932_1053147_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.6	4.5e-45
>prophage 81
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1065264	1072511	4949048		Serratia_phage(33.33%)	5	NA	NA
WP_000184827.1|1065264_1067562_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|1067612_1067933_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004446.1|1067947_1069027_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001174083.1|1069335_1071837_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424845.1|1071848_1072511_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
>prophage 82
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1085502	1089687	4949048		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_106904063.1|1085502_1089687_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.5	3.6e-25
>prophage 83
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1095324	1099828	4949048		Erwinia_phage(50.0%)	5	NA	NA
WP_001293343.1|1095324_1096656_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_001307494.1|1096722_1097649_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|1097741_1098227_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|1098311_1098557_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|1098982_1099828_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 84
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1111403	1116263	4949048		Feldmannia_irregularis_virus(33.33%)	4	NA	NA
WP_001033722.1|1111403_1112102_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|1112098_1113472_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270260.1|1113577_1114252_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001297064.1|1115642_1116263_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
>prophage 85
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1130971	1134022	4949048		Escherichia_phage(100.0%)	1	NA	NA
WP_011310337.1|1130971_1134022_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 86
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1146765	1151496	4949048		Prochlorococcus_phage(33.33%)	5	NA	NA
WP_000357967.1|1146765_1147776_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	22.2	1.3e-05
WP_000094544.1|1147808_1148696_-	aldolase	NA	NA	NA	NA	NA
WP_001299483.1|1148720_1149599_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	73.6	2.7e-47
WP_000160872.1|1149771_1150668_+	sugar kinase	NA	NA	NA	NA	NA
WP_000022286.1|1150707_1151496_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	1.3e-21
>prophage 87
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1158812	1161283	4949048		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000190577.1|1158812_1159862_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
WP_001188777.1|1159873_1161283_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 88
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1165361	1168148	4949048		uncultured_virus(100.0%)	1	NA	NA
WP_000250006.1|1165361_1168148_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 89
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1181840	1182455	4949048		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|1181840_1182455_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 90
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1191245	1194532	4949048		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109943.1|1191245_1192022_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
WP_000459594.1|1192024_1192540_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001315927.1|1192543_1192813_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187530.1|1192891_1194532_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
>prophage 91
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1206944	1208774	4949048		Catovirus(100.0%)	1	NA	NA
WP_001346040.1|1206944_1208774_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	9.7e-84
>prophage 92
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1216258	1220117	4949048		Bacillus_phage(100.0%)	3	NA	NA
WP_000383406.1|1216258_1218421_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
WP_001213584.1|1218504_1219221_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000130691.1|1219220_1220117_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
>prophage 93
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1223153	1225942	4949048		Salmonella_phage(100.0%)	2	NA	NA
WP_001389394.1|1223153_1224632_+	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	54.7	1.8e-43
WP_000678270.1|1224628_1225942_+	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	33.6	4.7e-08
>prophage 94
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1242215	1248359	4949048		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000612044.1|1242215_1243346_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
WP_001145196.1|1243350_1244025_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000676056.1|1244002_1244884_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001226604.1|1244902_1245970_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	3.5e-102
WP_000006621.1|1245969_1247232_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_000866670.1|1247228_1248359_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
>prophage 95
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1252401	1257813	4949048		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|1252401_1252731_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047499.1|1252861_1254127_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001299253.1|1254260_1255745_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001238869.1|1255791_1257813_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
>prophage 96
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1267565	1269212	4949048		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012633.1|1267565_1269212_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	3.9e-68
>prophage 97
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1282603	1288456	4949048		Enterobacteria_phage(33.33%)	5	NA	NA
WP_001056273.1|1282603_1283494_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
WP_000211858.1|1283518_1284484_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000387753.1|1284488_1285994_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	4.6e-15
WP_000715936.1|1286001_1286421_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000102319.1|1286587_1288456_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
>prophage 98
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1291624	1292617	4949048		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845103.1|1291624_1292617_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	1.7e-50
>prophage 99
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1304569	1307931	4949048		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000933736.1|1304569_1305940_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
WP_000334099.1|1306101_1307931_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
>prophage 100
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1313461	1317302	4949048		Cyanophage(50.0%)	4	NA	NA
WP_000867146.1|1313461_1314502_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000741620.1|1314588_1315548_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_001251991.1|1315547_1316438_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063125.1|1316528_1317302_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 101
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1328290	1329628	4949048		Moraxella_phage(100.0%)	1	NA	NA
WP_001299598.1|1328290_1329628_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 102
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1339826	1347195	4949048		Staphylococcus_phage(33.33%)	8	NA	NA
WP_001307474.1|1339826_1340084_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239730.1|1340047_1340407_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|1340423_1340564_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_120795392.1|1340793_1340874_-	protein YsdD	NA	NA	NA	NA	NA
WP_000059111.1|1341170_1342574_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673464.1|1342578_1343679_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000060116.1|1343678_1344752_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000072071.1|1344780_1347195_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.1	1.8e-114
>prophage 103
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1351901	1353050	4949048		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|1351901_1353050_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 104
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1357477	1358431	4949048		Cyanophage(50.0%)	2	NA	NA
WP_001243437.1|1357477_1357891_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_001243431.1|1358002_1358431_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
>prophage 105
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1364783	1373945	4949048		Aeromonas_phage(25.0%)	10	NA	NA
WP_001087147.1|1364783_1366499_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
WP_000828483.1|1366495_1367989_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.4	1.1e-29
WP_000511287.1|1368035_1368485_-	membrane protein	NA	NA	NA	NA	NA
WP_000703959.1|1368594_1368942_+	YidH family protein	NA	NA	NA	NA	NA
WP_001113432.1|1368931_1369294_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000148039.1|1369290_1369788_+	radical SAM protein	NA	NA	NA	NA	NA
WP_000828746.1|1369795_1370980_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000060506.1|1371398_1371488_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001315912.1|1372052_1372151_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000168480.1|1372256_1373945_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	4.2e-57
>prophage 106
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1381249	1382584	4949048		Moraxella_phage(100.0%)	1	NA	NA
WP_001349999.1|1381249_1382584_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 107
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1394702	1396094	4949048		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|1394702_1396094_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 108
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1401215	1407966	4949048		Bordetella_phage(25.0%)	6	NA	NA
WP_000280488.1|1401215_1403324_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|1403342_1403618_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001295237.1|1403672_1404296_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000870053.1|1404553_1406236_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	1.9e-22
WP_000924289.1|1406232_1406850_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001297374.1|1407141_1407966_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	6.3e-91
>prophage 109
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1411339	1415902	4949048		Xanthomonas_phage(25.0%)	7	NA	NA
WP_001298007.1|1411339_1411795_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
WP_000050139.1|1411775_1412996_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_001298959.1|1413167_1413836_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000091955.1|1414052_1414289_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|1414309_1414477_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114533.1|1414574_1415384_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001171866.1|1415422_1415902_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
>prophage 110
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1423340	1425434	4949048		Archaeal_BJ1_virus(50.0%)	2	NA	NA
WP_000364782.1|1423340_1424366_+	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.5	1.4e-10
WP_000064012.1|1424450_1425434_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	2.4e-12
>prophage 111
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1428833	1438339	4949048		Synechococcus_phage(16.67%)	9	NA	NA
WP_000587750.1|1428833_1429766_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
WP_001213834.1|1429979_1431176_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000646014.1|1431185_1432211_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_000982091.1|1432449_1433484_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000483856.1|1433470_1434430_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214147.1|1434433_1435717_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000116566.1|1435726_1437271_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001315904.1|1437515_1437947_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024392.1|1438087_1438339_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 112
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1460434	1471124	4949048		uncultured_Caudovirales_phage(66.67%)	6	NA	NA
WP_001346013.1|1460434_1461268_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	47.0	3.3e-23
WP_000072855.1|1461420_1462263_-	lyase	NA	NA	NA	NA	NA
WP_001271686.1|1462367_1462751_-	protein YhhH	NA	NA	NA	NA	NA
WP_000015317.1|1462722_1466958_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	7.3e-26
WP_000779792.1|1467186_1467795_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_000582482.1|1469279_1471124_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.5e-15
>prophage 113
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1506406	1507402	4949048		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182653.1|1506406_1507402_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 114
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1511626	1511839	4949048		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|1511626_1511839_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 115
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1515493	1517827	4949048		Escherichia_phage(100.0%)	1	NA	NA
WP_000013918.1|1515493_1517827_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	3.1e-71
>prophage 116
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1528040	1530025	4949048		Planktothrix_phage(50.0%)	2	NA	NA
WP_001196486.1|1528040_1529024_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
WP_000107018.1|1529020_1530025_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	8.6e-18
>prophage 117
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1577005	1577653	4949048		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|1577005_1577653_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 118
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1582529	1584664	4949048		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000065786.1|1582529_1582955_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.5e-51
WP_000922639.1|1582967_1584257_-	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000008957.1|1584310_1584664_-	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
>prophage 119
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1587778	1589821	4949048		Indivirus(100.0%)	1	NA	NA
WP_001295214.1|1587778_1589821_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	3.4e-45
>prophage 120
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1603252	1609134	4949048		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000149132.1|1603252_1605988_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
WP_000593555.1|1607441_1607801_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001190062.1|1607920_1608322_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000173666.1|1608327_1609134_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	4.5e-17
>prophage 121
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1617027	1621159	4949048		Dickeya_phage(50.0%)	4	NA	NA
WP_001100467.1|1617027_1617693_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
WP_000130621.1|1617913_1618159_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_000106507.1|1618260_1620459_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.1	5.5e-118
WP_000964718.1|1620532_1621159_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 122
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1624165	1626984	4949048		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000617723.1|1624165_1624834_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
WP_001042003.1|1624826_1625885_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|1626129_1626984_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 123
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1633465	1634948	4949048		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000082101.1|1633465_1634233_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
WP_000416895.1|1634234_1634948_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
>prophage 124
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1638488	1640299	4949048		Planktothrix_phage(50.0%)	2	NA	NA
WP_000907790.1|1638488_1639559_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
WP_000073609.1|1639555_1640299_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	8.3e-10
>prophage 125
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1660307	1662755	4949048		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|1660307_1662755_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 126
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1671982	1673209	4949048		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105493.1|1671982_1673209_+	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	60.0	5.2e-134
>prophage 127
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1677588	1679982	4949048		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|1677588_1679982_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 128
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1685951	1686830	4949048		Sodalis_phage(100.0%)	1	NA	NA
WP_000039063.1|1685951_1686830_-	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.9e-69
>prophage 129
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1693393	1697905	4949048		Bacillus_phage(66.67%)	5	NA	NA
WP_001157751.1|1693393_1694113_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253696.1|1694109_1695462_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_000650976.1|1695493_1695790_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000493756.1|1695848_1696166_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001265681.1|1696282_1697905_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
>prophage 130
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1714878	1715715	4949048		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|1714878_1715715_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 131
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1739939	1743966	4949048		Acinetobacter_phage(50.0%)	3	NA	NA
WP_000601847.1|1739939_1740503_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
WP_000963785.1|1740588_1741809_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001295162.1|1741875_1743966_-	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
>prophage 132
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1755046	1760620	4949048		uncultured_Caudovirales_phage(33.33%)	7	NA	NA
WP_001209710.1|1755046_1755433_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	5.6e-18
WP_050866832.1|1755432_1755792_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_000903377.1|1755799_1756087_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|1756212_1756587_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|1756683_1757154_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|1757250_1759365_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_000031783.1|1759435_1760620_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 133
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1780497	1781969	4949048	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000004432.1|1780497_1781445_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
WP_000114984.1|1781459_1781969_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
>prophage 134
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1792471	1796625	4949048		Bacillus_virus(50.0%)	4	NA	NA
WP_106904067.1|1792471_1793230_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.3	5.9e-19
WP_001299298.1|1793237_1794341_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000019655.1|1794350_1795532_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000738575.1|1795599_1796625_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.5	6.9e-71
>prophage 135
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1803129	1804014	4949048		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258900.1|1803129_1804014_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.1e-24
>prophage 136
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1814579	1815623	4949048		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|1814579_1815623_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 137
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1832118	1834643	4949048	protease	uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_000497724.1|1832118_1833186_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295271.1|1833275_1834643_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
>prophage 138
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1838609	1839107	4949048	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|1838609_1839107_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 139
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1842811	1847559	4949048		Burkholderia_virus(50.0%)	5	NA	NA
WP_000108460.1|1842811_1844302_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
WP_000054239.1|1844349_1845039_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000209027.1|1845035_1845911_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000979880.1|1845907_1846372_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000445142.1|1846431_1847559_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.7e-73
>prophage 140
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1854308	1869102	4949048		Staphylococcus_phage(25.0%)	17	NA	NA
WP_001176896.1|1854308_1855238_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_000809774.1|1855333_1857670_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299134.1|1857899_1858553_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000047091.1|1858549_1859278_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000620387.1|1859274_1859907_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|1860119_1860392_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|1860388_1861243_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000183676.1|1861288_1861780_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|1861897_1862185_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000809051.1|1862207_1863641_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|1863688_1864414_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000669785.1|1864420_1864978_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000030537.1|1864946_1865522_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030005.1|1865518_1866085_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_001295557.1|1866105_1867092_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000922872.1|1867105_1868083_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000438245.1|1868292_1869102_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 141
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1873170	1874648	4949048		Vibrio_phage(50.0%)	2	NA	NA
WP_000445413.1|1873170_1873449_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
WP_001047336.1|1873676_1874648_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 142
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1881275	1884148	4949048	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107467.1|1881275_1883210_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000764731.1|1883299_1884148_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 143
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1888230	1894869	4949048		Dickeya_phage(50.0%)	4	NA	NA
WP_000207685.1|1888230_1889574_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_001300397.1|1890204_1890657_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031057.1|1890684_1892172_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133043.1|1892196_1894869_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	1.5e-24
>prophage 144
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1900350	1902240	4949048		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|1900350_1902240_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 145
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1909346	1917139	4949048		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
WP_001345969.1|1909346_1909649_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	1.7e-14
WP_000449451.1|1909699_1910143_+	YhbP family protein	NA	NA	NA	NA	NA
WP_000037608.1|1910122_1910641_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_001315854.1|1910768_1911404_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_106904068.1|1911476_1912517_+	permease	NA	NA	NA	NA	NA
WP_000646033.1|1912630_1913206_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158035.1|1913215_1913806_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000246855.1|1913825_1914221_-	YraN family protein	NA	NA	NA	NA	NA
WP_000249144.1|1914178_1916215_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000809253.1|1916278_1917139_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.3	2.1e-49
>prophage 146
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1940147	1941293	4949048		Streptococcus_phage(100.0%)	1	NA	NA
WP_001299416.1|1940147_1941293_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 147
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1949386	1951681	4949048		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|1949386_1951681_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 148
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1977914	1978880	4949048		Escherichia_phage(100.0%)	1	NA	NA
WP_001098805.1|1977914_1978880_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 149
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	1991301	2007496	4949048	tRNA	Herpes_simplex_virus(16.67%)	12	NA	NA
WP_001082882.1|1991301_1994394_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	1.0e-157
WP_000212465.1|1994577_1995561_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_000450589.1|1995779_1996112_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000627213.1|1996153_1997644_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.8e-33
WP_106904070.1|1997950_1999471_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	51.5	9.0e-35
WP_000018003.1|1999624_2000248_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001065909.1|2000535_2001300_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000228937.1|2001553_2002060_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000437371.1|2002138_2003980_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000918827.1|2004174_2005920_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_001144069.1|2006030_2006246_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264365.1|2006482_2007496_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
>prophage 150
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2013878	2015117	4949048	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708471.1|2013878_2015117_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.3	5.0e-92
>prophage 151
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2020254	2021688	4949048		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|2020254_2021688_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 152
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2031202	2042163	4949048		Staphylococcus_phage(20.0%)	11	NA	NA
WP_001076997.1|2031202_2031856_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
WP_000469266.1|2032116_2032287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295627.1|2032344_2033118_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000188373.1|2033233_2034049_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_000442860.1|2034086_2035247_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000831543.1|2035252_2035924_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000735278.1|2036071_2037553_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917117.1|2037757_2038387_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000833393.1|2038387_2038810_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000444747.1|2038834_2039662_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000195296.1|2040270_2042163_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
>prophage 153
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2054274	2065097	4949048		Stx_converting_phage(25.0%)	9	NA	NA
WP_000712658.1|2054274_2054667_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
WP_000183494.1|2054719_2055202_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001281881.1|2055747_2058006_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
WP_000965717.1|2058238_2058976_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_000059395.1|2059050_2060463_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000095187.1|2060573_2062793_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_001702562.1|2062835_2063093_-	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000691598.1|2063143_2064070_-	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000013149.1|2064269_2065097_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
>prophage 154
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2071173	2072058	4949048		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018758.1|2071173_2072058_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 155
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2095542	2096715	4949048		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524972.1|2095542_2096715_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	4.2e-40
>prophage 156
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2130084	2132219	4949048		Klebsiella_phage(33.33%)	4	NA	NA
WP_000692309.1|2130084_2130306_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_044862993.1|2130368_2130845_-	RadC family protein	NA	NA	NA	NA	NA
WP_000849580.1|2130860_2131346_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	1.2e-12
WP_001234620.1|2131400_2132219_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
>prophage 157
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2151179	2152832	4949048		Moraxella_phage(100.0%)	1	NA	NA
WP_001379178.1|2151179_2152832_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	28.4	1.5e-38
>prophage 158
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2167473	2168049	4949048		Enterobacterial_phage(100.0%)	1	NA	NA
WP_000737515.1|2167473_2168049_+	Ail/Lom family protein	NA	Q9LA63	Enterobacterial_phage	32.2	6.0e-16
>prophage 159
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2174640	2183413	4949048		Mycobacterium_phage(33.33%)	8	NA	NA
WP_001285503.1|2174640_2175873_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.8	7.7e-61
WP_000502848.1|2175857_2176496_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.5	1.5e-55
WP_000226517.1|2176574_2176844_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001378814.1|2176864_2177509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000323309.1|2178006_2178216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000264910.1|2178249_2178441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096988538.1|2178450_2178816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106904071.1|2179321_2183413_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	43.7	1.2e-296
>prophage 160
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2187185	2188322	4949048		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001228923.1|2187185_2188322_+	porin	NA	Q1MVN1	Enterobacteria_phage	56.3	1.4e-117
>prophage 161
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2191340	2197419	4949048	transposase	Acinetobacter_phage(100.0%)	3	NA	NA
WP_000593011.1|2191340_2193185_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	31.3	8.1e-14
WP_001223359.1|2193530_2195618_-	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	32.2	3.4e-08
WP_085947598.1|2196256_2197419_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
>prophage 162
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2208329	2210156	4949048		Bacillus_phage(100.0%)	1	NA	NA
WP_001106666.1|2208329_2210156_-	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	26.9	9.8e-20
>prophage 163
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2214670	2215936	4949048	integrase	Pseudomonas_phage(100.0%)	1	2211338:2211353	2225263:2225278
2211338:2211353	attL	CTCCTGAACGATAATT	NA	NA	NA	NA
WP_044862808.1|2214670_2215936_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	1.0e-79
WP_044862808.1|2214670_2215936_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	1.0e-79
2225263:2225278	attR	AATTATCGTTCAGGAG	NA	NA	NA	NA
>prophage 164
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2238718	2239873	4949048		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|2238718_2239873_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 165
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2253449	2254127	4949048		Bacillus_virus(100.0%)	1	NA	NA
WP_000956871.1|2253449_2254127_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	1.1e-08
>prophage 166
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2272130	2273363	4949048		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|2272130_2273363_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 167
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2281890	2287258	4949048		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_000195050.1|2281890_2284764_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	2.8e-263
WP_000951964.1|2285024_2285768_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001363803.1|2285824_2287258_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	2.6e-31
>prophage 168
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2291063	2297150	4949048	tRNA	Brevibacillus_phage(25.0%)	5	NA	NA
WP_000806638.1|2291063_2291960_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
WP_000715214.1|2291984_2292695_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000813215.1|2292700_2294434_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	3.2e-60
WP_001701073.1|2294524_2295622_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003068.1|2295632_2297150_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
>prophage 169
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2302316	2306454	4949048		Moraxella_phage(50.0%)	3	NA	NA
WP_000012163.1|2302316_2303684_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_001295158.1|2303719_2305036_-	guanine deaminase	NA	NA	NA	NA	NA
WP_044862814.1|2305053_2306454_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 170
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2330732	2331488	4949048		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|2330732_2331488_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 171
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2354314	2356802	4949048		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000603518.1|2354314_2355076_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
WP_000256438.1|2355383_2356802_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
>prophage 172
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2366433	2373205	4949048		Moraxella_phage(33.33%)	5	NA	NA
WP_000895624.1|2366433_2367147_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_000082188.1|2367215_2367905_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564489.1|2368589_2369120_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957914.1|2369132_2371379_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000816232.1|2372410_2373205_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 173
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2378682	2394068	4949048	tRNA	Klosneuvirus(16.67%)	9	NA	NA
WP_050866879.1|2378682_2381571_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	5.3e-68
WP_001285985.1|2381563_2385106_+	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.8	1.5e-08
WP_000775946.1|2385105_2386932_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	7.8e-25
WP_000237948.1|2386993_2388325_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000016907.1|2388556_2389810_+	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000678646.1|2390388_2391486_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000117728.1|2391562_2392369_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000184251.1|2392419_2392863_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_001347723.1|2392862_2394068_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.2	7.8e-74
>prophage 174
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2405594	2406350	4949048		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|2405594_2406350_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 175
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2411208	2412057	4949048		Vibrio_phage(100.0%)	1	NA	NA
WP_000100394.1|2411208_2412057_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	1.0e-40
>prophage 176
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2415072	2420539	4949048	transposase	Stx2-converting_phage(50.0%)	5	NA	NA
WP_000422741.1|2415072_2415498_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|2415494_2415845_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|2415875_2417489_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_044862864.1|2417844_2419197_+	MFS transporter	NA	NA	NA	NA	NA
WP_000211812.1|2419198_2420539_+	glucarate dehydratase	NA	Q6A202	Oenococcus_phage	24.3	3.5e-06
>prophage 177
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2424943	2426245	4949048		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000046790.1|2424943_2426245_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	2.0e-38
>prophage 178
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2430277	2436120	4949048		Only_Syngen_Nebraska_virus(33.33%)	6	NA	NA
WP_000210878.1|2430277_2431915_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_000036723.1|2432002_2433301_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000034929.1|2433356_2433719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000793004.1|2433754_2434660_-	YgcG family protein	NA	NA	NA	NA	NA
WP_001379137.1|2434673_2435276_-	LemA family protein	NA	NA	NA	NA	NA
WP_001199982.1|2435448_2436120_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
>prophage 179
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2455152	2457185	4949048		Hokovirus(50.0%)	2	NA	NA
WP_001090346.1|2455152_2456580_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.6	2.8e-30
WP_001173673.1|2456579_2457185_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
>prophage 180
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2460297	2464013	4949048		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_001295182.1|2460297_2461059_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|2461052_2461679_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|2461818_2462958_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|2463020_2464013_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
>prophage 181
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2469227	2476367	4949048		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|2469227_2469866_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590384.1|2469862_2471125_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
WP_000847985.1|2471121_2472030_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|2472225_2472993_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141340.1|2473043_2473700_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001272924.1|2473805_2476367_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 182
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2494192	2495206	4949048		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001300105.1|2494192_2495206_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	1.0e-26
>prophage 183
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2502779	2503745	4949048		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287415.1|2502779_2503745_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 184
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2509210	2514770	4949048	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_000132231.1|2509210_2509708_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
WP_000963143.1|2509787_2510849_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000140506.1|2511091_2511592_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000047176.1|2511719_2514350_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|2514584_2514770_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 185
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2528505	2533801	4949048		Bacillus_virus(20.0%)	5	NA	NA
WP_001299852.1|2528505_2529708_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777968.1|2530062_2531022_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	2.2e-132
WP_000246542.1|2531031_2533176_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.4	3.8e-196
WP_000080944.1|2533148_2533559_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	2.7e-18
WP_001223227.1|2533555_2533801_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 186
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2537736	2541860	4949048		Clostridium_phage(50.0%)	4	NA	NA
WP_000522424.1|2537736_2538186_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156811.1|2538186_2538849_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001325764.1|2538869_2540270_-	GABA permease	NA	NA	NA	NA	NA
WP_001087606.1|2540579_2541860_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	2.4e-33
>prophage 187
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2552307	2554246	4949048	transposase	Shigella_phage(50.0%)	3	NA	NA
WP_085950812.1|2552307_2553521_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	56.8	2.4e-99
WP_001283984.1|2553541_2553841_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_001367084.1|2554006_2554246_-	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	49.2	2.5e-08
>prophage 188
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2561046	2572144	4949048	integrase,transposase	Acinetobacter_phage(28.57%)	8	2561197:2561210	2573546:2573559
WP_085947771.1|2561046_2562208_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
2561197:2561210	attL	AGTAAACAGCAAAA	NA	NA	NA	NA
WP_001201739.1|2563429_2563813_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
WP_000609174.1|2563809_2564157_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_077166855.1|2564206_2565742_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.9	1.4e-261
WP_085951104.1|2565983_2567146_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	2.6e-50
WP_001378315.1|2567759_2569499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113815.1|2569637_2570879_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.3	4.5e-101
WP_000162574.1|2571661_2572144_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
2573546:2573559	attR	TTTTGCTGTTTACT	NA	NA	NA	NA
>prophage 189
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2585777	2586848	4949048		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168044.1|2585777_2586848_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 190
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2592754	2595328	4949048		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|2592754_2595328_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 191
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2601195	2602494	4949048		Burkholderia_virus(100.0%)	1	NA	NA
WP_000852115.1|2601195_2602494_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	2.2e-45
>prophage 192
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2607787	2614046	4949048	tRNA	Achromobacter_phage(25.0%)	7	NA	NA
WP_001098726.1|2607787_2608207_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997404.1|2608413_2609451_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262716.1|2609498_2610188_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000627807.1|2610492_2610876_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_044862804.1|2610931_2611519_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000365855.1|2611621_2612503_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|2612711_2614046_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 193
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2619817	2623559	4949048		Tupanvirus(50.0%)	3	NA	NA
WP_000790168.1|2619817_2621617_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|2621632_2622607_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|2622878_2623559_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 194
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2627016	2627277	4949048		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|2627016_2627277_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 195
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2631396	2642704	4949048		Bacillus_phage(50.0%)	7	NA	NA
WP_000970122.1|2631396_2635284_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	7.7e-131
WP_001297612.1|2635859_2637287_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_001215888.1|2637451_2638165_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001298983.1|2638154_2639489_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717694.1|2639549_2639888_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000883122.1|2639932_2641123_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919159.1|2641450_2642704_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 196
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2648462	2649974	4949048		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493473.1|2648462_2649974_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
>prophage 197
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2665138	2671595	4949048		Faustovirus(20.0%)	8	NA	NA
WP_001295373.1|2665138_2666353_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|2666380_2666767_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|2666783_2667107_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000384411.1|2667202_2667718_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196613.1|2667734_2669585_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_001124469.1|2669586_2669922_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523616.1|2669933_2670134_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000133582.1|2670311_2671595_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.2e-34
>prophage 198
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2681480	2681912	4949048		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|2681480_2681912_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 199
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2690741	2697036	4949048		Escherichia_phage(60.0%)	6	NA	NA
WP_000937933.1|2690741_2692112_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	4.0e-42
WP_001299507.1|2692273_2693740_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138282.1|2693808_2695386_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_000755179.1|2695478_2696018_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.3	4.1e-43
WP_000669402.1|2696033_2696549_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.0e-62
WP_001344399.1|2696862_2697036_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
>prophage 200
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2703470	2707472	4949048		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_001028614.1|2703470_2704109_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
WP_001299062.1|2704108_2705146_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.0	6.3e-72
WP_001295473.1|2705470_2706097_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198328.1|2706182_2707472_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
>prophage 201
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2728515	2729229	4949048		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|2728515_2729229_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 202
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2747274	2748225	4949048		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|2747274_2748225_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 203
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2766777	2771715	4949048		Deep-sea_thermophilic_phage(33.33%)	6	NA	NA
WP_000102886.1|2766777_2767647_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
WP_000406000.1|2767860_2768286_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_001300381.1|2768272_2768722_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000838945.1|2768782_2769358_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000084590.1|2769453_2770353_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_001315775.1|2770410_2771715_-	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
>prophage 204
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2775193	2790563	4949048		Streptococcus_phage(33.33%)	15	NA	NA
WP_000517431.1|2775193_2775985_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
WP_000290223.1|2776155_2777172_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000458405.1|2777171_2778005_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_044862800.1|2778004_2778880_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000021040.1|2778869_2779967_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_001297645.1|2780100_2781012_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	3.5e-58
WP_000719943.1|2781014_2781383_-	YfeK family protein	NA	NA	NA	NA	NA
WP_000096660.1|2781487_2782339_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000522247.1|2782380_2782890_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000623136.1|2782930_2784658_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000487600.1|2784702_2784960_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034402.1|2785343_2786315_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000254843.1|2786499_2787261_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_001297862.1|2787490_2788477_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000443665.1|2788547_2790563_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	6.5e-150
>prophage 205
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2816413	2817148	4949048		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|2816413_2817148_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 206
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2820966	2821887	4949048		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|2820966_2821887_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 207
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2825616	2827311	4949048		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_106904078.1|2825616_2827311_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
>prophage 208
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2839831	2841265	4949048		Bacillus_phage(100.0%)	1	NA	NA
WP_000194515.1|2839831_2841265_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 209
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2844305	2845238	4949048		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000368131.1|2844305_2845238_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 210
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2865153	2869284	4949048		Citrobacter_phage(50.0%)	3	NA	NA
WP_000209359.1|2865153_2867586_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001295295.1|2867591_2868491_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000424889.1|2868621_2869284_+	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.7	1.6e-25
>prophage 211
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2872602	2874474	4949048		Planktothrix_phage(100.0%)	1	NA	NA
WP_001315369.1|2872602_2874474_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
>prophage 212
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2885807	2887010	4949048		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|2885807_2887010_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 213
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2895459	2904610	4949048		Vibrio_phage(25.0%)	11	NA	NA
WP_001195240.1|2895459_2895717_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|2895876_2896164_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189159.1|2896147_2896870_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|2896930_2897833_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|2897920_2898397_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_106904081.1|2898748_2899861_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996025.1|2899955_2901089_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.4	5.0e-30
WP_000105430.1|2901098_2902052_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061657.1|2902048_2902894_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|2902953_2903442_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149733.1|2903482_2904610_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
>prophage 214
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2907947	2910685	4949048		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027205.1|2907947_2908676_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270740.1|2908893_2909409_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|2909534_2909858_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255144.1|2909854_2910685_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
>prophage 215
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2914272	2915991	4949048		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815350.1|2914272_2915991_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
>prophage 216
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2925288	2949011	4949048	protease,tRNA	uncultured_Mediterranean_phage(16.67%)	15	NA	NA
WP_000188180.1|2925288_2927235_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|2927307_2927532_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|2927854_2928175_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|2928205_2930482_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|2931166_2931385_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|2931669_2932374_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202178.1|2932415_2934137_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	3.2e-20
WP_106904082.1|2934137_2935904_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_000537418.1|2936026_2936992_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_106904083.1|2938164_2942193_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|2942351_2942963_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|2942973_2944317_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|2944407_2945700_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850317.1|2945938_2948383_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.7	1.1e-220
WP_000213098.1|2948393_2949011_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 217
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2955320	2958535	4949048		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|2955320_2956061_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|2956252_2958535_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
>prophage 218
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2962633	2963722	4949048		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057149.1|2962633_2963722_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 219
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2968808	2973349	4949048		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|2968808_2969093_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705706.1|2969299_2971564_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|2971600_2973349_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
>prophage 220
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	2988054	2999185	4949048	tRNA	Rhodobacter_phage(20.0%)	6	NA	NA
WP_001295932.1|2988054_2988603_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_000977920.1|2990871_2991960_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000117881.1|2992561_2993962_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001297200.1|2994130_2995333_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193844.1|2995598_2998211_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001090514.1|2998417_2999185_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.7e-29
>prophage 221
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3015106	3017014	4949048		Tupanvirus(100.0%)	1	NA	NA
WP_000053120.1|3015106_3017014_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	3.2e-53
>prophage 222
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3029624	3031679	4949048		Bacillus_phage(100.0%)	1	NA	NA
WP_001315388.1|3029624_3031679_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
>prophage 223
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3035912	3036572	4949048	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|3035912_3036572_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 224
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3055836	3062328	4949048		Morganella_phage(33.33%)	7	NA	NA
WP_000066490.1|3055836_3056049_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071528578.1|3056059_3056248_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001315395.1|3056222_3056453_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|3056442_3056616_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000829672.1|3056663_3057737_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001367057.1|3057808_3060553_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_001120112.1|3061635_3062328_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
>prophage 225
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3067168	3068089	4949048		Klosneuvirus(100.0%)	1	NA	NA
WP_000420629.1|3067168_3068089_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
>prophage 226
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3072391	3074491	4949048		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|3072391_3072565_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001240629.1|3072647_3073976_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.9	5.3e-233
WP_001028087.1|3073996_3074491_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	2.1e-49
>prophage 227
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3089267	3090191	4949048		Cronobacter_phage(100.0%)	1	NA	NA
WP_001307105.1|3089267_3090191_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	9.2e-91
>prophage 228
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3097010	3171120	4949048	integrase,transposase	Stx2-converting_phage(21.05%)	54	3098035:3098050	3173102:3173117
WP_029397591.1|3097010_3098369_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	1.5e-20
3098035:3098050	attL	TGAATATCATTGGGAA	NA	NA	NA	NA
WP_085947771.1|3098409_3099572_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000389396.1|3099657_3099981_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_000611856.1|3099977_3100964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000279859.1|3101329_3102547_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.7	5.0e-44
WP_005067490.1|3102716_3104246_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000070932.1|3104217_3104505_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_050866913.1|3104605_3106441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050866912.1|3107755_3108349_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_050866911.1|3108719_3109103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072097540.1|3110704_3111511_-	YjiK family protein	NA	NA	NA	NA	NA
WP_000544018.1|3112956_3114513_+	L-lactate permease	NA	NA	NA	NA	NA
WP_001102090.1|3114562_3115282_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000054156.1|3115292_3116708_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_000182867.1|3117895_3118423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106904085.1|3118767_3120534_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	25.5	3.5e-22
WP_072097551.1|3120546_3130224_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	36.8	5.6e-29
WP_047626466.1|3130225_3130609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021578776.1|3131580_3131874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050866960.1|3132238_3133096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050866961.1|3133328_3134045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000118523.1|3134041_3134305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000171783.1|3135763_3136138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080195.1|3136178_3137792_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|3137822_3138173_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|3138169_3138595_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000957247.1|3140704_3141085_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_001137792.1|3141071_3141401_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_096148377.1|3141502_3143116_-|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.4	7.5e-165
WP_000624701.1|3143146_3143497_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_050866906.1|3143493_3143919_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	3.6e-34
WP_001122107.1|3144370_3145087_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000108736.1|3145086_3148182_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	28.1	3.0e-53
WP_024175232.1|3148200_3149268_-	Appr-1-p processing protein	NA	B0FIJ9	Escherichia_phage	37.1	2.9e-16
WP_000228012.1|3149926_3151234_-	restriction endonuclease	NA	A0A2H4PQP5	Staphylococcus_phage	29.2	1.4e-36
WP_000985461.1|3151233_3153672_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	37.8	1.7e-75
WP_024175231.1|3153711_3153951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050866907.1|3154983_3156345_-	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_001399565.1|3156503_3157106_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	31.5	7.7e-06
WP_001288265.1|3157152_3157869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106904086.1|3158150_3159023_+	GTPase family protein	NA	NA	NA	NA	NA
WP_096148375.1|3159395_3162515_+	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_096148373.1|3162635_3165152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047651727.1|3165227_3165683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077875616.1|3165717_3165993_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_047651723.1|3166082_3166901_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.5	2.5e-47
WP_047651721.1|3166992_3167478_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	34.4	2.6e-12
WP_001186725.1|3167493_3167970_+	RadC family protein	NA	NA	NA	NA	NA
WP_000691818.1|3168056_3168278_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	2.5e-10
WP_047651719.1|3168357_3168726_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000854745.1|3168815_3169193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041124065.1|3169189_3169678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839242.1|3169689_3169887_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000875212.1|3170100_3171120_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
3173102:3173117	attR	TGAATATCATTGGGAA	NA	NA	NA	NA
>prophage 229
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3175677	3176511	4949048		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|3175677_3176511_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 230
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3180644	3181178	4949048		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857414.1|3180644_3181178_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	1.0e-25
>prophage 231
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3190486	3191407	4949048		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|3190486_3191407_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 232
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3196069	3196315	4949048		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|3196069_3196315_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 233
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3212161	3213103	4949048		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|3212161_3213103_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 234
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3225461	3226642	4949048		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|3225461_3226196_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|3226405_3226642_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 235
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3229914	3231557	4949048		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257000.1|3229914_3230556_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267931.1|3230552_3231557_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 236
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3243888	3244146	4949048		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|3243888_3244146_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 237
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3251435	3255158	4949048		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033695.1|3251435_3252137_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
WP_001251389.1|3252136_3253381_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291270.1|3253409_3254321_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952736.1|3254336_3255158_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
>prophage 238
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3258434	3260412	4949048		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000799401.1|3258434_3259292_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|3259275_3260412_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
>prophage 239
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3265532	3266903	4949048		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423729.1|3265532_3266903_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
>prophage 240
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3270039	3273768	4949048		Enterobacteria_phage(66.67%)	5	NA	NA
WP_000444487.1|3270039_3271290_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001307134.1|3271392_3271716_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_032141808.1|3272248_3272359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|3272411_3272816_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332302.1|3273036_3273768_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
>prophage 241
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3279635	3281957	4949048		Escherichia_phage(100.0%)	1	NA	NA
WP_001307136.1|3279635_3281957_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	42.8	1.5e-89
>prophage 242
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3290491	3292179	4949048		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|3290491_3290911_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457616.1|3290910_3292179_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
>prophage 243
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3318938	3321690	4949048		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033352.1|3318938_3320618_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|3320742_3321690_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 244
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3324826	3328834	4949048		Pseudomonas_phage(50.0%)	5	NA	NA
WP_000804726.1|3324826_3325909_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456467.1|3325908_3326742_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200392.1|3326738_3327131_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|3327134_3327944_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|3327979_3328834_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
>prophage 245
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3331935	3332166	4949048		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146442.1|3331935_3332166_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	6.5e-06
>prophage 246
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3343297	3353307	4949048		Escherichia_phage(25.0%)	10	NA	NA
WP_000702660.1|3343297_3344836_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571699.1|3344832_3345543_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|3345542_3346220_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555849.1|3346944_3347787_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001307143.1|3347836_3348295_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|3348407_3349313_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193437.1|3349404_3350418_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|3350619_3351528_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|3351671_3352085_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068079.1|3352689_3353307_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
>prophage 247
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3361716	3363731	4949048		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110945.1|3361716_3362730_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|3362726_3363731_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 248
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3371665	3440450	4949048	terminase,capsid,holin,portal,integrase,protease,tail,head	Escherichia_phage(34.62%)	76	3371502:3371529	3423382:3423409
3371502:3371529	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113694.1|3371665_3372796_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	2.0e-103
WP_000113183.1|3372773_3373022_-	excisionase	NA	NA	NA	NA	NA
WP_097467291.1|3373086_3375558_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	4.0e-56
WP_000092783.1|3375653_3375842_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450221.1|3375838_3376027_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_047090954.1|3376555_3377071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000380318.1|3377184_3377337_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_000367559.1|3377504_3377894_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024213789.1|3377997_3378273_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	54.8	1.1e-15
WP_032308163.1|3378256_3378682_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_032211818.1|3378704_3379658_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	50.8	3.1e-73
WP_032308164.1|3379664_3380405_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	82.7	1.8e-113
WP_000450863.1|3380434_3381205_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.2	1.8e-84
WP_032308165.1|3381220_3381586_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	64.1	5.1e-37
WP_032308166.1|3381718_3381931_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	88.6	1.7e-32
WP_106904087.1|3381963_3382182_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	88.9	1.3e-27
WP_032308168.1|3382183_3382447_+	hypothetical protein	NA	S4TNB5	Salmonella_phage	70.1	2.6e-30
WP_000207997.1|3382457_3382625_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
WP_000206826.1|3382621_3382966_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	99.1	3.8e-58
WP_000902695.1|3383199_3383412_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	95.7	1.4e-26
WP_024210728.1|3383925_3384204_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	3.7e-11
WP_106904088.1|3384205_3385255_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	5.9e-110
WP_000904136.1|3385267_3385630_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.9	2.4e-34
WP_001064918.1|3385622_3386288_+	antiterminator	NA	I6PDF8	Cronobacter_phage	52.0	1.6e-60
WP_000342738.1|3386541_3387255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917733.1|3387428_3387626_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
WP_032308170.1|3387777_3388836_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	4.0e-207
WP_000271629.1|3389315_3389744_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000382065.1|3390440_3391166_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_106904089.1|3393028_3394993_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	79.2	2.2e-296
WP_000142780.1|3395127_3395307_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	93.2	5.4e-24
WP_001290230.1|3395347_3395593_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284490.1|3395670_3395886_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	98.6	2.0e-33
WP_039264424.1|3395889_3396681_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	86.7	4.0e-34
WP_001092874.1|3397192_3397726_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	1.4e-99
WP_062896309.1|3397882_3398065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071974579.1|3398433_3398640_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	63.2	4.6e-11
WP_000735655.1|3398704_3398929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001405844.1|3399415_3399922_+	DNA-packaging protein	NA	O64316	Escherichia_phage	48.5	1.6e-33
WP_106904090.1|3399893_3401822_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	7.4e-260
WP_032217785.1|3401805_3402012_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	4.6e-11
WP_047091052.1|3402008_3403601_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.5	2.6e-186
WP_096891638.1|3403590_3405096_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	3.0e-99
WP_000256803.1|3405132_3405480_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
WP_044803575.1|3405537_3406566_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.7e-114
WP_000201497.1|3406618_3407002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204259.1|3406994_3407348_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.1e-40
WP_000974993.1|3407363_3407939_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	2.9e-50
WP_000683075.1|3407935_3408331_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	80.9	2.2e-57
WP_097467317.1|3408338_3409088_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	93.2	6.9e-129
WP_052903904.1|3409107_3409539_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	66.4	6.2e-42
WP_106904091.1|3409565_3409970_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	83.8	5.9e-42
WP_106904092.1|3409950_3412533_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.3	0.0e+00
WP_032211147.1|3412529_3412859_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	97.2	5.2e-57
WP_106904093.1|3412858_3413557_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.7	8.1e-132
WP_099205856.1|3413567_3414311_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	94.3	7.0e-142
WP_122996100.1|3414256_3414889_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	1.0e-101
WP_106904128.1|3415995_3419040_+	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	76.1	0.0e+00
WP_106904094.1|3419882_3421841_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	97.8	1.1e-173
WP_096891559.1|3422352_3422913_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.2	9.3e-54
WP_001079499.1|3423559_3424066_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
3423382:3423409	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|3424111_3424612_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|3424697_3424877_-	general stress protein	NA	NA	NA	NA	NA
WP_000443056.1|3425257_3426064_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209516.1|3426063_3427257_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000763511.1|3428629_3430225_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194592.1|3430224_3431787_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|3431878_3431923_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|3432060_3432942_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|3432938_3433559_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|3433659_3434532_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278906.1|3434571_3435162_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559280.1|3435158_3435917_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
WP_000422045.1|3436136_3437186_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|3437221_3437473_-	YciN family protein	NA	NA	NA	NA	NA
WP_001297122.1|3437852_3440450_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
>prophage 249
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3445374	3445965	4949048		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|3445374_3445965_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 250
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3453780	3459440	4949048		Lactococcus_phage(50.0%)	5	NA	NA
WP_044862852.1|3453780_3455715_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
WP_000437858.1|3455782_3456910_-	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|3457054_3457843_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000968857.1|3458212_3458566_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000573407.1|3458633_3459440_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 251
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3472355	3473621	4949048		Klosneuvirus(100.0%)	1	NA	NA
WP_050866937.1|3472355_3473621_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	4.6e-24
>prophage 252
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3487624	3488707	4949048		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057977.1|3487624_3488707_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 253
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3505324	3505840	4949048		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945005.1|3505324_3505840_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
>prophage 254
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3512166	3519436	4949048	tRNA	Bacillus_phage(20.0%)	6	NA	NA
WP_001307164.1|3512166_3513399_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|3513653_3514637_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123745.1|3515114_3516488_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000081418.1|3516616_3517552_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_001082294.1|3517727_3518162_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_000837924.1|3518302_3519436_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
>prophage 255
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3524394	3525384	4949048		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|3524394_3525384_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 256
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3556666	3560569	4949048		Klosneuvirus(100.0%)	1	NA	NA
WP_000139614.1|3556666_3560569_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 257
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3564508	3565457	4949048		Escherichia_phage(50.0%)	2	NA	NA
WP_001307188.1|3564508_3565039_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731833.1|3565283_3565457_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 258
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3583087	3587410	4949048		Cronobacter_phage(50.0%)	4	NA	NA
WP_001270286.1|3583087_3583504_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000760588.1|3583582_3584989_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_050866952.1|3585233_3586379_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220412.1|3586396_3587410_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	1.2e-27
>prophage 259
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3594542	3596645	4949048		Salmonella_phage(100.0%)	1	NA	NA
WP_000689355.1|3594542_3596645_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	1.1e-134
>prophage 260
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3603727	3607966	4949048		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_106904098.1|3603727_3607966_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	44.2	3.2e-21
>prophage 261
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3613769	3615314	4949048		Escherichia_phage(100.0%)	1	NA	NA
WP_000702560.1|3613769_3615314_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 262
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3622199	3622490	4949048		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001295648.1|3622199_3622490_-	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.7e-25
>prophage 263
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3628502	3629944	4949048		Escherichia_phage(50.0%)	2	NA	NA
WP_000781370.1|3628502_3628787_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000642407.1|3628933_3629944_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
>prophage 264
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3633217	3635123	4949048		Planktothrix_phage(100.0%)	2	NA	NA
WP_001285539.1|3633217_3634144_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	2.4e-14
WP_050866951.1|3634136_3635123_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	2.9e-18
>prophage 265
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3639439	3643246	4949048		Klosneuvirus(50.0%)	2	NA	NA
WP_001307211.1|3639439_3641839_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_106904099.1|3641863_3643246_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.7	1.5e-17
>prophage 266
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3648520	3651316	4949048		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_001317088.1|3648520_3651316_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	4.4e-19
>prophage 267
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3672044	3673412	4949048		Escherichia_phage(100.0%)	1	NA	NA
WP_158707432.1|3672044_3673412_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.0	1.5e-105
>prophage 268
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3680867	3682403	4949048		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194881.1|3680867_3682403_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	9.8e-21
>prophage 269
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3690284	3691703	4949048		Bacillus_phage(100.0%)	1	NA	NA
WP_000558044.1|3690284_3691703_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 270
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3699449	3701579	4949048		Streptococcus_phage(50.0%)	3	NA	NA
WP_000091199.1|3699449_3699833_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803525.1|3699864_3700083_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000012620.1|3700139_3701579_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	8.2e-30
>prophage 271
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3709083	3709974	4949048		Bacillus_phage(100.0%)	1	NA	NA
WP_000592814.1|3709083_3709974_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
>prophage 272
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3715339	3730776	4949048		Escherichia_phage(44.44%)	16	NA	NA
WP_000214712.1|3715339_3715543_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527759.1|3715578_3717039_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.1	8.6e-43
WP_001498991.1|3717127_3717481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106904101.1|3717468_3718494_-	MFS transporter	NA	NA	NA	NA	NA
WP_000836072.1|3718551_3719571_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	1.6e-16
WP_044862782.1|3719582_3720797_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	28.8	2.4e-46
WP_000598292.1|3721002_3721329_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|3721463_3721805_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|3721839_3722400_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|3722402_3723113_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|3723220_3723526_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_044862783.1|3723724_3726151_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.8	2.3e-213
WP_001433342.1|3726211_3728635_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.8e-208
WP_000213028.1|3728645_3729263_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526492.1|3729264_3730119_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|3730161_3730776_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
>prophage 273
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3740920	3750776	4949048	capsid,terminase,integrase,head	Enterobacteria_phage(60.0%)	17	3749485:3749499	3750842:3750856
WP_106904103.1|3740920_3741505_-|terminase	terminase small subunit	terminase	K7PJS9	Enterobacteria_phage	57.2	3.2e-57
WP_050867514.1|3741751_3742165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050867513.1|3742177_3742513_-|head	head decoration protein	head	NA	NA	NA	NA
WP_050867512.1|3742524_3743580_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.4	2.1e-70
WP_047090822.1|3743579_3743786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047090821.1|3744193_3744604_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_106904104.1|3744600_3744879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106904105.1|3745167_3746922_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.3	5.4e-92
WP_047087380.1|3746918_3747218_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_106904106.1|3747223_3747451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096552851.1|3747443_3747680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609225.1|3747669_3747882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024201884.1|3747874_3748072_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000201456.1|3748266_3748446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000182306.1|3748503_3748707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000953271.1|3748983_3749172_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
3749485:3749499	attL	TTGTTTCACGTTGTA	NA	NA	NA	NA
WP_001364183.1|3749546_3750776_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	54.9	1.9e-131
WP_001364183.1|3749546_3750776_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	54.9	1.9e-131
3750842:3750856	attR	TACAACGTGAAACAA	NA	NA	NA	NA
>prophage 274
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3759792	3761094	4949048		Bacillus_phage(100.0%)	1	NA	NA
WP_000732487.1|3759792_3761094_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	7.2e-17
>prophage 275
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3771169	3772981	4949048		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945871.1|3771169_3772981_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.8	0.0e+00
>prophage 276
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3792767	3794042	4949048	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|3792767_3794042_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 277
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3800953	3802452	4949048		Salmonella_phage(50.0%)	2	NA	NA
WP_001296937.1|3800953_3801475_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
WP_000250661.1|3801555_3802452_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	3.6e-07
>prophage 278
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3812685	3821476	4949048		Streptomyces_phage(20.0%)	8	NA	NA
WP_000101193.1|3812685_3813501_+	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|3813628_3814210_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701040.1|3814355_3815525_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|3815690_3815780_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|3816078_3817104_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269501.1|3817100_3818033_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000098911.1|3819646_3820795_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	4.2e-85
WP_000493947.1|3820834_3821476_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 279
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3826969	3829236	4949048		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587560.1|3826969_3827782_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001069997.1|3827785_3828571_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001310861.1|3828567_3829236_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
>prophage 280
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3837526	3842610	4949048		environmental_halophage(33.33%)	5	NA	NA
WP_000144565.1|3837526_3838747_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
WP_000908012.1|3838743_3840015_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948872.1|3839989_3840736_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	2.2e-10
WP_000089364.1|3840745_3842233_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367160.1|3842241_3842610_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
>prophage 281
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3861200	3880794	4949048	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_000553696.1|3861200_3862901_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	1.6e-32
WP_000069375.1|3862957_3865336_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000368046.1|3865668_3866502_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082204.1|3866658_3867705_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001270809.1|3867836_3868028_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175615.1|3868031_3869468_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001315654.1|3869530_3870244_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209780.1|3870490_3870955_-	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_000029466.1|3871032_3871782_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154187.1|3871781_3872333_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956519.1|3872395_3873376_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|3873476_3873776_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672359.1|3873780_3876168_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|3876182_3877166_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|3877449_3877494_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|3877616_3877973_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|3878025_3878223_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|3878319_3878862_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144192.1|3878865_3880794_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
>prophage 282
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3892094	3894356	4949048		Tupanvirus(100.0%)	1	NA	NA
WP_000077844.1|3892094_3894356_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	3.0e-143
>prophage 283
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3900483	3901311	4949048		Bacillus_virus(100.0%)	1	NA	NA
WP_000175053.1|3900483_3901311_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	1.2e-73
>prophage 284
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3908787	3910008	4949048		Klosneuvirus(100.0%)	1	NA	NA
WP_000081983.1|3908787_3910008_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
>prophage 285
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3916771	3917425	4949048		Planktothrix_phage(100.0%)	1	NA	NA
WP_001315662.1|3916771_3917425_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.7	6.4e-14
>prophage 286
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3923023	3924985	4949048		Streptococcus_phage(100.0%)	1	NA	NA
WP_106904109.1|3923023_3924985_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 287
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3929925	3930552	4949048		Tupanvirus(100.0%)	1	NA	NA
WP_106904110.1|3929925_3930552_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	33.9	1.4e-18
>prophage 288
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3933795	3934650	4949048		Indivirus(100.0%)	1	NA	NA
WP_001186343.1|3933795_3934650_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 289
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3937968	3942544	4949048		Bacillus_phage(100.0%)	2	NA	NA
WP_000219686.1|3937968_3939252_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_001295489.1|3941053_3942544_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	1.1e-08
>prophage 290
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3948495	3949704	4949048	transposase	Salmonella_phage(100.0%)	1	NA	NA
WP_071531852.1|3948495_3949704_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	91.3	1.4e-208
>prophage 291
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3959047	3960739	4949048		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001367067.1|3959047_3960739_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	1.2e-35
>prophage 292
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3965797	3967159	4949048		Pandoravirus(100.0%)	1	NA	NA
WP_000854972.1|3965797_3967159_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
>prophage 293
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3978216	3978426	4949048		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|3978216_3978426_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 294
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3983757	3985806	4949048		Moraxella_phage(100.0%)	1	NA	NA
WP_001326055.1|3983757_3985806_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.3	1.2e-85
>prophage 295
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	3993302	3997772	4949048		Escherichia_phage(33.33%)	7	NA	NA
WP_000812724.1|3993302_3993959_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_000976492.1|3994354_3994696_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879280.1|3994708_3995581_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|3995584_3995959_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|3996097_3996328_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011652.1|3996429_3997086_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|3997109_3997772_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 296
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4005827	4007303	4949048		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|4005827_4007303_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 297
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4011301	4018365	4949048		Bacillus_virus(50.0%)	9	NA	NA
WP_001184045.1|4011301_4012624_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|4012639_4013572_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|4013650_4014406_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571465.1|4014402_4015188_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|4015334_4016345_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|4016353_4016965_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|4017103_4017169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044862941.1|4017239_4017842_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|4017843_4018365_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 298
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4022258	4024309	4949048		Escherichia_coli_phage(50.0%)	3	NA	NA
WP_000639274.1|4022258_4023077_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252979.1|4023129_4023525_+	membrane protein	NA	NA	NA	NA	NA
WP_000019588.1|4023565_4024309_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 299
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4030925	4032659	4949048	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025326.1|4030925_4032659_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 300
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4037911	4043555	4949048		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000763867.1|4037911_4038301_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036378.1|4038315_4039365_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204335.1|4039367_4040228_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483220.1|4040246_4041848_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	8.3e-15
WP_001297437.1|4041893_4043555_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
>prophage 301
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4053641	4055156	4949048		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001187810.1|4053641_4055156_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 302
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4067148	4067901	4949048		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|4067148_4067901_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 303
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4079712	4080381	4949048		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000334601.1|4079712_4080381_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	7.3e-82
>prophage 304
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4094397	4106778	4949048		Bacillus_phage(28.57%)	12	NA	NA
WP_001350521.1|4094397_4096092_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|4096262_4096445_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922676.1|4096523_4097441_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212248.1|4097613_4098534_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786005.1|4098522_4098993_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.0e-33
WP_001157239.1|4098973_4100392_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_000365566.1|4100458_4101154_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_001313057.1|4101193_4101559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824362.1|4102124_4103198_+	outer membrane protein F	NA	Q1MVN1	Enterobacteria_phage	51.6	6.2e-99
WP_000218214.1|4103790_4104642_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826773.1|4104748_4106107_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	8.7e-05
WP_001339045.1|4106106_4106778_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 305
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4110322	4110853	4949048		Escherichia_phage(100.0%)	1	NA	NA
WP_001079074.1|4110322_4110853_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
>prophage 306
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4130468	4131737	4949048	integrase	Stenotrophomonas_phage(100.0%)	1	4113013:4113026	4135775:4135788
4113013:4113026	attL	TGGCTGCGGCAGCA	NA	NA	NA	NA
WP_044862908.1|4130468_4131737_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	39.9	1.1e-75
WP_044862908.1|4130468_4131737_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	39.9	1.1e-75
4135775:4135788	attR	TGCTGCCGCAGCCA	NA	NA	NA	NA
>prophage 307
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4145249	4145984	4949048		Cellulophaga_phage(100.0%)	1	NA	NA
WP_044862899.1|4145249_4145984_+	DNA-binding protein	NA	M1Q742	Cellulophaga_phage	41.6	1.7e-26
>prophage 308
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4151039	4151258	4949048		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_023155944.1|4151039_4151258_-	AlpA family transcriptional regulator	NA	B7SYF9	Stenotrophomonas_phage	52.8	3.0e-08
>prophage 309
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4158260	4159070	4949048		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_001000035.1|4158260_4159070_-	propanediol diffusion facilitator PduF	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	26.1	2.6e-09
>prophage 310
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4176562	4177729	4949048		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001296209.1|4176562_4177729_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
>prophage 311
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4185373	4186273	4949048		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|4185373_4186273_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 312
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4194975	4198870	4949048		Paramecium_bursaria_Chlorella_virus(33.33%)	3	NA	NA
WP_000704791.1|4194975_4196142_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.5	6.7e-115
WP_000043488.1|4196390_4197797_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.1e-37
WP_000866330.1|4197856_4198870_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	51.2	7.0e-92
>prophage 313
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4206669	4209132	4949048		Bacillus_phage(50.0%)	2	NA	NA
WP_000183060.1|4206669_4207563_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001116018.1|4207737_4209132_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 314
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4214940	4221643	4949048		Bacillus_phage(25.0%)	6	NA	NA
WP_001313977.1|4214940_4216311_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	2.2e-32
WP_000079285.1|4216412_4217849_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_000699721.1|4217851_4219075_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000479836.1|4219071_4219551_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043598.1|4219553_4220519_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	3.8e-87
WP_000048190.1|4220521_4221643_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 315
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4225886	4236362	4949048		uncultured_marine_virus(20.0%)	8	NA	NA
WP_000654516.1|4225886_4226726_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	1.3e-06
WP_000137136.1|4226903_4229066_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482901.1|4229068_4229512_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|4229517_4230657_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_044862884.1|4231315_4232899_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001252331.1|4233172_4235026_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|4235047_4235629_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|4235720_4236362_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 316
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4241026	4242379	4949048		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469734.1|4241026_4242379_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.2e-06
>prophage 317
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4255819	4262693	4949048	tRNA	Bacillus_phage(50.0%)	8	NA	NA
WP_000675150.1|4255819_4257223_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137869.1|4257219_4257942_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.4e-30
WP_000929408.1|4258132_4258465_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|4258673_4258970_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|4258971_4259268_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476011.1|4259370_4260732_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
WP_000716757.1|4261061_4261379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|4261793_4262693_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 318
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4271913	4275470	4949048		Serratia_phage(50.0%)	4	NA	NA
WP_000846219.1|4271913_4272918_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	1.3e-13
WP_000011973.1|4272914_4273880_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|4273853_4274600_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001315719.1|4274651_4275470_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
>prophage 319
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4286117	4288151	4949048	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001295427.1|4286117_4288151_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 320
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4300715	4310157	4949048		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292774.1|4300715_4301852_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_001317947.1|4301848_4303849_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001295429.1|4303973_4304435_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|4304475_4304946_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|4304992_4305712_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|4305708_4307394_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|4307615_4308347_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|4308406_4308514_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|4308494_4309226_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569325.1|4309230_4310157_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 321
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4330468	4331989	4949048		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255039.1|4330468_4331989_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 322
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4335683	4339469	4949048		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|4335683_4336352_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425462.1|4336609_4337446_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489233.1|4337477_4339469_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
>prophage 323
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4343538	4344396	4949048		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|4343538_4344396_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 324
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4358894	4363195	4949048		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_000848214.1|4358894_4360361_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.3	8.7e-43
WP_000198822.1|4360478_4361465_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000594599.1|4361503_4362217_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241012.1|4362628_4363195_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 325
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4368949	4376597	4949048		Vibrio_phage(50.0%)	7	NA	NA
WP_000194928.1|4368949_4370539_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
WP_020240570.1|4370542_4370887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213360.1|4371219_4372410_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_001234850.1|4372437_4373133_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578076.1|4373281_4375042_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_000494183.1|4375166_4375451_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|4375589_4376597_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
>prophage 326
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4388296	4388914	4949048		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|4388296_4388914_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 327
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4397681	4403480	4949048		Bacillus_phage(25.0%)	5	NA	NA
WP_000422188.1|4397681_4399325_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000884922.1|4399400_4400051_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000710368.1|4400050_4401115_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406098.1|4401188_4402244_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_050866849.1|4402355_4403480_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.5	5.3e-117
>prophage 328
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4407757	4410607	4949048		Hokovirus(100.0%)	1	NA	NA
WP_000876014.1|4407757_4410607_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
>prophage 329
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4420307	4422935	4949048		Bacillus_virus(100.0%)	1	NA	NA
WP_001281242.1|4420307_4422935_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
>prophage 330
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4428361	4434363	4949048		Pseudomonas_phage(50.0%)	5	NA	NA
WP_047149127.1|4428361_4430647_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	4.3e-283
WP_000332036.1|4430735_4431866_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_000135040.1|4431865_4432120_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301050.1|4432173_4432824_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000779084.1|4433286_4434363_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 331
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4440256	4441159	4949048	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000140553.1|4440256_4441159_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.4	9.6e-69
>prophage 332
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4444311	4449315	4949048		Tupanvirus(50.0%)	4	NA	NA
WP_001297077.1|4444311_4444914_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
WP_106904117.1|4445221_4446361_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.9e-29
WP_000461661.1|4446364_4447333_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.2	2.0e-35
WP_106904118.1|4447332_4449315_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	3.1e-19
>prophage 333
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4483725	4486953	4949048		Salmonella_phage(50.0%)	3	NA	NA
WP_000813860.1|4483725_4484325_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012899.1|4484383_4486216_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203389.1|4486302_4486953_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	34.3	5.2e-08
>prophage 334
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4497512	4499385	4949048		Sodalis_phage(50.0%)	2	NA	NA
WP_000156113.1|4497512_4498415_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	44.5	8.2e-68
WP_001293612.1|4498611_4499385_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 335
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4503596	4505114	4949048		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|4503596_4505114_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 336
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4511590	4512727	4949048		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699122.1|4511590_4512727_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
>prophage 337
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4521281	4522367	4949048		Pandoravirus(100.0%)	1	NA	NA
WP_000918470.1|4521281_4522367_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
>prophage 338
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4525503	4527096	4949048		Tupanvirus(100.0%)	1	NA	NA
WP_000961458.1|4525503_4527096_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 339
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4532093	4537317	4949048		Escherichia_phage(33.33%)	6	NA	NA
WP_001295296.1|4532093_4532609_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|4532661_4532727_-	protein YliM	NA	NA	NA	NA	NA
WP_000100800.1|4534146_4534650_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|4535053_4535800_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|4535938_4536598_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|4536594_4537317_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
>prophage 340
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4540853	4555661	4949048		Erwinia_phage(14.29%)	12	NA	NA
WP_000710619.1|4540853_4541114_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_000430045.1|4541376_4543659_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990177.1|4543700_4544378_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000146369.1|4544451_4544718_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|4544982_4545243_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443512.1|4545470_4546556_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000386551.1|4546696_4547659_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001307069.1|4547686_4549837_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	5.7e-43
WP_001145128.1|4549956_4550439_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
WP_000007102.1|4550670_4552035_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001315358.1|4552263_4552935_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000996092.1|4553924_4555661_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
>prophage 341
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4566972	4567881	4949048		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|4566972_4567881_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 342
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4585914	4592488	4949048		Planktothrix_phage(33.33%)	7	NA	NA
WP_000891683.1|4585914_4586973_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-20
WP_000604034.1|4586975_4587665_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000101990.1|4587664_4588438_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|4588604_4588754_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001147439.1|4588882_4589671_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000096881.1|4589738_4591211_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	4.2e-13
WP_001265438.1|4591471_4592488_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
>prophage 343
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4596844	4600364	4949048		Klebsiella_phage(33.33%)	4	NA	NA
WP_001109196.1|4596844_4597897_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
WP_000784351.1|4598212_4598593_+	periplasmic protein	NA	NA	NA	NA	NA
WP_000951292.1|4598706_4599648_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000345410.1|4599644_4600364_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
>prophage 344
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4636403	4637195	4949048		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114025.1|4636403_4637195_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	28.8	3.7e-08
>prophage 345
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4640573	4643515	4949048		Acinetobacter_phage(50.0%)	2	NA	NA
WP_001032694.1|4640573_4642055_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
WP_000207157.1|4642096_4643515_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.0	3.1e-61
>prophage 346
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4647978	4656767	4949048		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_106904123.1|4647978_4652172_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	2.5e-26
WP_000424924.1|4652414_4652621_-	YbfA family protein	NA	NA	NA	NA	NA
WP_001272653.1|4652933_4653023_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000741137.1|4653022_4654696_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_000087967.1|4654718_4656767_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.8	4.2e-27
>prophage 347
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4660020	4660698	4949048		Bacillus_phage(100.0%)	1	NA	NA
WP_000186103.1|4660020_4660698_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	8.9e-27
>prophage 348
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4667353	4668118	4949048		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773301.1|4667353_4668118_+	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	35.4	4.4e-06
>prophage 349
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4672267	4676081	4949048	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_001287154.1|4672267_4673932_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
WP_001023134.1|4674134_4676081_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
>prophage 350
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4680707	4682372	4949048		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337088.1|4680707_4682372_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.1	1.4e-84
>prophage 351
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4686467	4687547	4949048		Pseudomonas_phage(100.0%)	1	NA	NA
WP_072097532.1|4686467_4687547_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 352
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4695443	4698976	4949048		Planktothrix_phage(50.0%)	3	NA	NA
WP_000631384.1|4695443_4696169_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_001207519.1|4696286_4697222_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000367891.1|4697305_4698976_+	molecular chaperone HscC	NA	E5EQT9	Bathycoccus_sp._RCC1105_virus	35.7	1.8e-76
>prophage 353
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4705914	4708497	4949048	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001157890.1|4705914_4708497_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 354
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4715507	4717947	4949048		Synechococcus_phage(50.0%)	2	NA	NA
WP_001231415.1|4715507_4716596_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092082.1|4716735_4717947_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 355
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4722762	4723410	4949048		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000939738.1|4722762_4723146_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|4723200_4723410_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 356
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4738837	4740952	4949048		Morganella_phage(50.0%)	2	NA	NA
WP_000278505.1|4738837_4739266_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
WP_000887629.1|4739386_4740952_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 357
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4744018	4745841	4949048		Streptococcus_phage(50.0%)	2	NA	NA
WP_000029802.1|4744018_4745239_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.0	1.2e-58
WP_000502941.1|4745211_4745841_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
>prophage 358
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4760385	4766428	4949048		Klosneuvirus(50.0%)	3	NA	NA
WP_000140647.1|4760385_4761201_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
WP_000096702.1|4761197_4762331_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000077727.1|4762546_4766428_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.4	3.8e-61
>prophage 359
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4777857	4781001	4949048		Leptospira_phage(100.0%)	1	NA	NA
WP_000573940.1|4777857_4781001_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	2.2e-59
>prophage 360
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4784146	4849817	4949048	capsid,terminase,portal,integrase,lysis,protease,tail,transposase,head	Enterobacteria_phage(57.14%)	76	4799943:4799989	4849831:4849877
WP_000770941.1|4784146_4784830_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	34.7	2.3e-30
WP_000253805.1|4784819_4786268_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	3.9e-11
WP_000103149.1|4787004_4788906_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	1.7e-27
WP_001160804.1|4788933_4789395_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_000394594.1|4791462_4792599_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_106904124.1|4792867_4795105_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000662376.1|4795091_4798064_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224569.1|4798064_4798955_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177464.1|4799137_4799899_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
4799943:4799989	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201825.1|4800411_4801365_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226378.1|4801551_4803036_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000937502.1|4803219_4803525_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_000239874.1|4803581_4804250_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_120795384.1|4804615_4804729_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|4804797_4805031_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086514.1|4805347_4805938_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000885616.1|4806035_4806611_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_072044802.1|4806610_4809550_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	57.4	2.9e-74
WP_032219766.1|4809614_4810214_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	97.0	4.1e-108
WP_000515713.1|4810284_4813782_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.3	0.0e+00
WP_000090895.1|4813842_4814475_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	89.5	5.5e-95
WP_000194783.1|4814411_4815155_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_001152639.1|4815160_4815859_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000847379.1|4815858_4816188_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000840218.1|4816184_4818746_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	91.8	0.0e+00
WP_000459457.1|4818738_4819173_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_044862921.1|4819154_4819577_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.3e-68
WP_001437681.1|4819592_4820333_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.6	2.3e-132
WP_000683105.1|4820340_4820736_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000985132.1|4820732_4821311_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752960.1|4821321_4821675_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	7.6e-62
WP_032327600.1|4821686_4822082_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	96.2	1.1e-58
WP_001441714.1|4822123_4823149_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	4.7e-189
WP_001299443.1|4823204_4823537_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_044862920.1|4823546_4824866_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	99.3	6.7e-236
WP_044862919.1|4824846_4826448_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	2.5e-309
WP_000198149.1|4826444_4826651_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027290.1|4826647_4828573_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
WP_044862917.1|4828547_4829093_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	3.4e-93
WP_001421937.1|4829481_4829676_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_001031427.1|4829840_4830047_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001403557.1|4830332_4830743_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	99.3	9.4e-72
WP_000738500.1|4831033_4831327_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_123010639.1|4831417_4831600_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	80.0	8.5e-17
WP_001135281.1|4831816_4832314_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_000839596.1|4832313_4832529_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737275.1|4833118_4834201_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	76.3	8.9e-154
WP_001204791.1|4834389_4834773_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971068.1|4834858_4834999_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001099518.1|4834995_4835358_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	94.8	6.2e-59
WP_000774486.1|4835354_4835645_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_000224907.1|4835637_4835808_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001010743.1|4835807_4836263_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	1.7e-61
WP_000986835.1|4836433_4836685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021568450.1|4836744_4837359_-	hypothetical protein	NA	Q7Y5X0	Haemophilus_phage	41.7	6.4e-32
WP_050866891.1|4837970_4839437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050866890.1|4839447_4839867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021568452.1|4840255_4840435_-	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	89.7	2.3e-22
WP_021568453.1|4840431_4841133_-	replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	97.9	1.2e-127
WP_044862924.1|4841129_4842059_-	replication protein	NA	M1FN81	Enterobacteria_phage	67.6	6.1e-111
WP_001182773.1|4842145_4842685_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_001067458.1|4842754_4842985_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|4843089_4843779_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000066829.1|4843860_4844124_+	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	95.4	4.2e-41
WP_001444023.1|4844259_4844580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309317.1|4845046_4845337_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	83.8	5.0e-27
WP_000995411.1|4845412_4845709_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	2.8e-49
WP_001438244.1|4845714_4846500_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.4e-148
WP_000186829.1|4846496_4847177_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.1	4.6e-132
WP_000682311.1|4847173_4847356_+	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	96.7	1.4e-27
WP_000548531.1|4847328_4847520_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_001386642.1|4847530_4847812_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763390.1|4847910_4848129_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
WP_000488407.1|4848176_4848455_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000446905.1|4848426_4848798_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000051902.1|4848653_4849817_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
4849831:4849877	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 361
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4856907	4860038	4949048	tRNA	Enterococcus_phage(50.0%)	4	NA	NA
WP_000729154.1|4856907_4857774_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|4857775_4857988_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143552.1|4858095_4858617_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|4858652_4860038_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 362
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4871515	4872661	4949048		Streptococcus_phage(100.0%)	1	NA	NA
WP_000706355.1|4871515_4872661_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
>prophage 363
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4878851	4880633	4949048		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001096878.1|4878851_4880633_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.1	2.1e-38
>prophage 364
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4887009	4894826	4949048		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_106904126.1|4887009_4891299_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	41.5	2.1e-20
WP_000561869.1|4891728_4894143_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001110573.1|4894139_4894826_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 365
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4897962	4898640	4949048		Bacillus_virus(100.0%)	1	NA	NA
WP_001157535.1|4897962_4898640_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 366
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4903179	4906139	4949048		uncultured_virus(50.0%)	2	NA	NA
WP_000078268.1|4903179_4905684_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.2	3.8e-115
WP_001344274.1|4905797_4906139_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	1.8e-39
>prophage 367
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4914333	4922895	4949048		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
WP_000801832.1|4914333_4915293_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	1.1e-14
WP_001250088.1|4915289_4916252_-	ferrochelatase	NA	NA	NA	NA	NA
WP_001220233.1|4916487_4917132_-	adenylate kinase	NA	NA	NA	NA	NA
WP_000678208.1|4917312_4919187_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001195025.1|4919296_4919902_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|4919901_4920231_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000122008.1|4920283_4922215_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000127356.1|4922343_4922895_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 368
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4929903	4933053	4949048		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|4929903_4933053_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 369
NZ_CP027310	Escherichia coli strain 2014C-4135 chromosome, complete genome	4949048	4941887	4945434	4949048		Bacillus_phage(100.0%)	2	NA	NA
WP_001256174.1|4941887_4943669_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.4e-42
WP_001235609.1|4943661_4945434_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.6e-49
>prophage 1
NZ_CP027311	Escherichia coli strain 2014C-4135 plasmid unnamed, complete sequence	133438	120544	128342	133438	integrase	Escherichia_phage(28.57%)	10	111442:111454	122309:122321
111442:111454	attL	GGAAGGGAAGTCT	NA	NA	NA	NA
WP_000016979.1|120544_121354_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.5	7.8e-54
WP_000239529.1|121491_121767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633911.1|121760_122405_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.5	8.8e-40
122309:122321	attR	AGACTTCCCTTCC	NA	NA	NA	NA
WP_001103694.1|122633_123605_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	9.7e-67
WP_000340833.1|123609_124002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072001427.1|124279_125272_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	58.9	2.6e-99
WP_032219119.1|125271_125709_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	46.8	2.4e-25
WP_019842136.1|125705_125954_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	5.4e-14
WP_050866972.1|126347_127274_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_050866973.1|127658_128342_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	8.7e-30
