The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	0	24251	4717123	capsid,head,terminase,portal,tail	Enterobacteria_phage(52.0%)	28	NA	NA
WP_000235436.1|524_1034_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001300238.1|1005_2934_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	2.7e-262
WP_000259002.1|2917_3124_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831765.1|3120_4713_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	3.2e-184
WP_001253961.1|4702_6208_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	54.2	1.0e-99
WP_000256809.1|6244_6592_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_000522615.1|6649_7678_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	60.7	3.9e-114
WP_000012981.1|7681_8104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204549.1|8096_8450_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	8.7e-42
WP_000975046.1|8465_8999_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	2.2e-57
WP_000683066.1|8995_9391_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	3.9e-59
WP_001357739.1|9398_10151_+|tail	tail protein	tail	Q687F6	Enterobacteria_phage	98.0	1.6e-133
WP_000479105.1|10164_10596_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000533423.1|10622_11036_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	2.7e-42
WP_032313647.1|11016_13596_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.8	0.0e+00
WP_025404276.1|13592_13922_+|tail	tail protein	tail	Q687F2	Enterobacteria_phage	94.5	2.2e-55
WP_001357740.1|13921_14620_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_025404352.1|14625_15369_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.0	5.9e-149
WP_032162126.1|15266_15947_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	96.9	2.4e-112
WP_032155007.1|15900_16107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000649829.1|16137_16665_-	superoxide dismutase	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_106873503.1|16798_20275_+|tail	phage tail protein	tail	Q6H9T2	Enterobacteria_phage	96.4	0.0e+00
WP_001216290.1|20343_20967_+	membrane protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_106873504.1|21031_22345_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
WP_024262417.1|22346_22616_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	5.4e-44
WP_022581903.1|22792_23773_+	type III secretion system effector NleB	NA	Q8HAB2	Salmonella_phage	49.2	9.4e-86
WP_021570498.1|23833_24097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095111390.1|24119_24251_+	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	76.5	1.5e-07
>prophage 2
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	27294	27825	4717123		Escherichia_phage(100.0%)	1	NA	NA
WP_001079066.1|27294_27825_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	98.1	7.2e-56
>prophage 3
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	31369	43750	4717123		Bacillus_phage(33.33%)	14	NA	NA
WP_024221659.1|31369_32041_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.2	1.2e-31
WP_000826791.1|32040_33399_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_000218214.1|33506_34358_-	Molecular chaperone Hsp31 and glyoxalase 3	NA	NA	NA	NA	NA
WP_071792377.1|34504_34741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001400372.1|34949_36023_-	porin	NA	Q1MVN1	Enterobacteria_phage	51.1	1.2e-97
WP_072095796.1|36588_36954_+	permease	NA	NA	NA	NA	NA
WP_000365543.1|36993_37689_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.4	8.1e-07
WP_001157243.1|37755_39174_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.9	4.0e-101
WP_000786004.1|39154_39625_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001212220.1|39613_40534_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922672.1|40706_41624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000009306.1|41702_41885_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_011076438.1|41946_42135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001400373.1|42055_43750_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.8	1.7e-18
>prophage 4
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	57292	60256	4717123		Klebsiella_phage(50.0%)	4	NA	NA
WP_032162076.1|57292_57571_-	hypothetical protein	NA	A0A286S1S8	Klebsiella_phage	46.8	3.6e-06
WP_000484284.1|57721_57952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033810085.1|58621_58861_+	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000334604.1|59587_60256_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	8.1e-81
>prophage 5
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	72508	73261	4717123		Bacillus_virus(100.0%)	1	NA	NA
WP_001272991.1|72508_73261_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 6
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	79518	150414	4717123	capsid,holin,plate,terminase,portal,integrase,transposase,tail	Enterobacteria_phage(76.6%)	75	78452:78511	136330:136454
78452:78511	attL	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGG	NA	NA	NA	NA
WP_000078920.1|79518_79659_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_071532595.1|79664_79853_+	hypothetical protein	NA	Q7Y2U2	Escherichia_phage	61.9	5.3e-06
WP_000488108.1|79849_80110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000132830.1|80152_81262_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000005425.1|81419_82604_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.0	4.4e-223
WP_000290450.1|82603_83116_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665308.1|83170_83536_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_001443605.1|83463_83700_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	8.7e-22
WP_000853425.1|83686_86494_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	91.1	0.0e+00
WP_001308727.1|86500_86995_+|tail	tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	2.5e-87
WP_000905059.1|87021_87621_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.4	1.9e-97
WP_071666280.1|87606_87825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023351586.1|87848_88397_+	hypothetical protein	NA	A0A0A7NPY7	Enterobacteria_phage	92.1	4.3e-88
WP_000972183.1|88399_88933_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	3.2e-96
WP_001164115.1|88961_89489_-|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	98.3	2.5e-93
WP_000071708.1|91644_92175_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	3.3e-93
WP_001111930.1|92167_93064_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	3.0e-155
WP_000213455.1|93067_93418_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	1.0e-58
WP_001271919.1|93414_93996_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	1.2e-99
WP_000356339.1|93992_94628_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_000920586.1|94620_95088_-|tail	tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	4.5e-86
WP_000780570.1|95225_95633_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	3.4e-66
WP_000072340.1|95629_96022_-	M15 family peptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	2.2e-70
WP_000104350.1|96018_96342_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864900.1|96344_96545_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	7.9e-32
WP_000063082.1|96544_97039_-|capsid	phage capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_000632330.1|97141_97942_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	88.0	2.4e-124
WP_001055089.1|97987_99040_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.1	6.6e-194
WP_001262673.1|99063_99900_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_000613787.1|100054_101806_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.9	0.0e+00
WP_000087833.1|101805_102852_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	98.9	1.8e-204
WP_001140702.1|103344_105570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000502620.1|105593_106715_-	ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	29.5	3.7e-17
WP_001001608.1|106895_109679_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	87.8	0.0e+00
WP_000564228.1|109675_110065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000013472.1|110137_110368_-	hypothetical protein	NA	A0A0A7NV48	Enterobacteria_phage	92.1	2.5e-29
WP_000108349.1|110690_110990_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	87.9	5.3e-40
WP_000153711.1|110986_111253_-	MarR family transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	3.4e-30
WP_000985144.1|111249_111453_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	5.5e-25
WP_000991915.1|111476_111893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514274.1|112095_112338_-	hypothetical protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	6.8e-38
WP_000159462.1|112349_112628_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	81.5	3.6e-35
WP_000739029.1|112638_112989_-	DUF4761 domain-containing protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|113010_113214_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001308719.1|113230_113437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786769.1|113512_113917_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_000290349.1|113932_114583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300279.1|114965_115967_+|integrase	integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_022581686.1|116370_117111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085961182.1|120399_121612_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_085961182.1|123111_124325_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_077697108.1|124396_125362_+	hypothetical protein	NA	A0A220A2U4	Liberibacter_phage	43.0	1.6e-58
WP_000897250.1|125377_125695_+	type I restriction-modification system, DNA-methyltransferase subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	51.0	1.4e-19
WP_101892112.1|125741_126899_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000779012.1|126895_127579_+	YecA family protein	NA	NA	NA	NA	NA
WP_000290304.1|127601_129386_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_000357608.1|129455_132740_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.3	4.7e-65
WP_001290574.1|132736_133492_+	M48 family peptidase	NA	NA	NA	NA	NA
WP_000465340.1|133543_134053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000687352.1|134110_135982_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000847882.1|136580_137246_+	YecA family protein	NA	NA	NA	NA	NA
136330:136454	attR	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTTTGT	NA	NA	NA	NA
WP_000797567.1|137307_138519_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000377223.1|138710_138950_+	DUF2492 domain-containing protein	NA	NA	NA	NA	NA
WP_001400592.1|138987_139485_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_024262403.1|139655_139979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297814.1|140184_140331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000082127.1|140443_140695_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_001658452.1|140773_141277_-	ferritin-like domain protein	NA	NA	NA	NA	NA
WP_000548675.1|142073_143063_+	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001187819.1|143132_144647_+	arabinose import ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000100203.1|144661_145648_+	arabinose ABC transporter permease	NA	NA	NA	NA	NA
WP_001302045.1|145814_146615_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001295646.1|146589_148014_+	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_000122432.1|148020_148449_-	universal stress protein C	NA	NA	NA	NA	NA
WP_001358663.1|149217_150414_+|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	156185	161829	4717123		uncultured_Caudovirales_phage(33.33%)	4	NA	NA
WP_001297437.1|156185_157847_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000204337.1|159512_160373_+	chemotaxis protein methyltransferase	NA	NA	NA	NA	NA
WP_000036371.1|160375_161425_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763865.1|161439_161829_+	two-component system response regulator	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
>prophage 8
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	167083	168817	4717123	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025326.1|167083_168817_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 9
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	174465	273210	4717123	holin,lysis,terminase,protease,tRNA,tail	Enterobacteria_phage(36.92%)	113	NA	NA
WP_000564736.1|174465_175437_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019617.1|175433_176177_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
WP_000252980.1|176217_176613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095585797.1|176665_177430_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	4.6e-72
WP_000063650.1|177446_178733_-	DUF3596 domain-containing protein	NA	Q20GI2	Phage_258-320	99.8	6.9e-254
WP_001193437.1|178766_179021_-	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_001447615.1|179212_179584_-	hypothetical protein	NA	Q8W655	Enterobacteria_phage	95.9	1.4e-61
WP_000720014.1|179624_180452_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	97.1	1.3e-128
WP_001242071.1|180448_180637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001365075.1|180821_181394_-	hypothetical protein	NA	Q8W653	Enterobacteria_phage	71.3	5.5e-78
WP_000553979.1|181399_181582_-	hypothetical protein	NA	Q8W652	Enterobacteria_phage	50.9	3.8e-09
WP_000147367.1|181779_181980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387835.1|181985_182678_-	transcriptional regulator	NA	A0A1B5FPB8	Escherichia_phage	63.6	1.4e-38
WP_000800142.1|182825_183515_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	87.8	6.8e-115
WP_000944728.1|183671_183905_+	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	77.0	1.2e-28
WP_001090266.1|183986_184694_+	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	79.9	1.2e-103
WP_042909567.1|184713_184893_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	84.7	2.2e-25
WP_077631317.1|184822_185530_+	hypothetical protein	NA	Q8W643	Enterobacteria_phage	82.8	9.5e-96
WP_000621231.1|185526_185760_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	48.6	1.9e-13
WP_001247836.1|185746_186640_+	hypothetical protein	NA	C5IHL2	Burkholderia_virus	45.1	4.4e-58
WP_000606871.1|186659_187550_+	ATPase AAA	NA	Q8W641	Enterobacteria_phage	63.3	9.8e-82
WP_000184326.1|187546_188947_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.2	4.9e-245
WP_001065352.1|188943_189201_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	71.1	1.2e-21
WP_096848401.1|189253_190243_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	2.3e-193
WP_001204809.1|190261_190642_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	99.2	1.4e-66
WP_000917756.1|190857_191055_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	6.8e-28
WP_000024314.1|191205_192264_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	98.6	3.4e-206
WP_096848402.1|192646_193606_+	Shiga toxin Stx2 subunit A	NA	Q5TJL6	Enterobacteria_phage	99.7	2.1e-175
WP_047083032.1|193617_193887_+	Shiga toxin Stx2 subunit B	NA	Q6DWN4	Enterobacteria_phage	98.9	1.3e-42
WP_047083033.1|194398_196345_+	DUF1737 domain-containing protein	NA	S5MDQ7	Escherichia_phage	98.6	0.0e+00
WP_000143459.1|196482_196662_+	DUF1378 domain-containing protein	NA	A0A088CBQ0	Shigella_phage	100.0	2.2e-25
WP_001447570.1|196702_196948_+	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	82.7	8.5e-20
WP_000284506.1|197025_197241_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001457151.1|197244_197730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001092868.1|198241_198775_+	lysozyme	NA	G9L6J6	Escherichia_phage	95.5	1.1e-99
WP_001082519.1|199073_199541_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	100.0	7.7e-78
WP_000348556.1|199993_200470_+	DUF1441 domain-containing protein	NA	Q9EYD0	Enterobacteria_phage	96.8	1.3e-80
WP_001077621.1|200466_201474_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	1.8e-201
WP_000114064.1|201635_202874_+	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	35.1	6.6e-60
WP_000229066.1|202866_203091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038670.1|203150_203732_+	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	61.3	1.5e-51
WP_088136225.1|203712_204432_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000335965.1|204424_204649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551748.1|204641_205235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000728901.1|205431_205674_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_106873505.1|205670_207485_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	49.7	9.8e-129
WP_001399692.1|207772_208018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126660.1|208014_208437_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001114742.1|208903_209098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860403.1|209094_210984_+	peptidase S14	NA	Q8VNN5	Enterobacteria_phage	51.5	9.4e-183
WP_000133409.1|211241_211523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000368825.1|212991_213228_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	100.0	4.5e-34
WP_001483060.1|215681_216698_+	peptidase	NA	Q8VNN5	Enterobacteria_phage	100.0	1.1e-190
WP_001097067.1|216785_217112_+	DUF2190 domain-containing protein	NA	Q9EYD5	Enterobacteria_phage	99.1	1.4e-49
WP_001281345.1|217104_217386_+	DNA breaking-rejoining protein	NA	S5MDP9	Escherichia_phage	98.9	2.7e-46
WP_000974964.1|217388_218015_+	hypothetical protein	NA	S5MBY4	Escherichia_phage	100.0	7.8e-102
WP_000682704.1|218024_218423_+	hypothetical protein	NA	S5MW30	Escherichia_phage	100.0	2.7e-71
WP_000174599.1|218430_219180_+|tail	tail protein	tail	S5M7Q5	Escherichia_phage	98.8	5.3e-137
WP_000479054.1|219196_219619_+|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	100.0	5.1e-73
WP_000532075.1|219645_219954_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_106873506.1|219997_222643_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	97.4	0.0e+00
WP_000847280.1|222639_222969_+|tail	tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_096848408.1|222968_223667_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	99.1	1.2e-132
WP_096848409.1|223677_224421_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	97.2	5.6e-147
WP_071528645.1|224318_224999_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	89.8	1.2e-108
WP_106873507.1|225239_228716_+|tail	phage tail protein	tail	Q6H9T2	Enterobacteria_phage	96.7	0.0e+00
WP_001449501.1|228784_229408_+	membrane protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	8.7e-69
WP_106873508.1|229473_230796_+|tail	phage tail protein	tail	A0A0P0ZDE7	Stx2-converting_phage	91.4	7.7e-75
WP_001023400.1|230797_231067_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	7.1e-44
WP_001341980.1|231276_231468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000701369.1|231496_232483_+	peptidase M85	NA	NA	NA	NA	NA
WP_001261935.1|232853_233102_-	DNA damage-inducible protein DinI	NA	Q687E4	Enterobacteria_phage	95.1	3.5e-37
WP_000891626.1|233408_233975_-	hydrolase	NA	NA	NA	NA	NA
WP_001258668.1|234284_236057_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032161923.1|236174_236627_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907248.1|236655_237396_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295503.1|237430_237952_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024929.1|237953_238556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072095795.1|238626_238692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|238830_239442_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|239450_240461_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571478.1|240706_241492_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|241488_242244_-	Mn2+/Zn2+ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001342995.1|242322_243255_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|243270_244593_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_000448381.1|244712_245684_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000091148.1|245814_247257_-	pyruvate kinase II	NA	NA	NA	NA	NA
WP_001056694.1|247384_248254_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000301720.1|248591_250067_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
WP_001069467.1|250301_252113_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000800512.1|252149_252791_+	KHG/KDPG aldolase	NA	NA	NA	NA	NA
WP_000173474.1|252846_254025_-	phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_032315773.1|254158_254449_+	damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_001295500.1|254515_254872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000024746.1|255198_255858_+	DUF533 domain-containing protein	NA	NA	NA	NA	NA
WP_071591578.1|255882_256065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000936914.1|256066_258127_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_000944252.1|258123_258786_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011656.1|258809_259466_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|259567_259798_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168738.1|259936_260311_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879330.1|260314_261187_+	membrane protein	NA	NA	NA	NA	NA
WP_000976475.1|261199_261541_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000812714.1|261935_262592_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_001313035.1|262592_262784_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
WP_001295499.1|262888_263125_-	DUF1480 domain-containing protein	NA	NA	NA	NA	NA
WP_024221588.1|263242_264682_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001297532.1|264761_267395_-	MCE family protein	NA	NA	NA	NA	NA
WP_001400643.1|267363_268647_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_001043887.1|268776_269274_+	methionine-R-sulfoxide reductase	NA	NA	NA	NA	NA
WP_000431368.1|269370_270069_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001055791.1|270088_272137_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000984517.1|272328_273210_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 10
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	277468	277678	4717123		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|277468_277678_+	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 11
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	283319	284876	4717123		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|283319_284876_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 12
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	288738	296843	4717123	tRNA	Pandoravirus(33.33%)	7	NA	NA
WP_000855020.1|288738_290100_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000457334.1|290173_290353_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001295493.1|291192_291537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000128864.1|291668_293579_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.7	5.0e-91
WP_001220997.1|293636_294332_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290571.1|294371_294953_+	membrane protein	NA	NA	NA	NA	NA
WP_000758422.1|295157_296843_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
>prophage 13
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	311598	316175	4717123		Bacillus_phage(100.0%)	3	NA	NA
WP_001400633.1|311598_313089_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	8.3e-09
WP_000616418.1|313269_314745_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000219686.1|314891_316175_-	hypothetical protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 14
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	319493	320348	4717123		Indivirus(100.0%)	1	NA	NA
WP_001186340.1|319493_320348_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	24.6	1.9e-10
>prophage 15
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	329161	333247	4717123		Staphylococcus_phage(50.0%)	4	NA	NA
WP_106873509.1|329161_330142_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	1.3e-07
WP_000719088.1|330278_331037_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_024221589.1|331154_332513_+	MFS transporter	NA	NA	NA	NA	NA
WP_001135060.1|332605_333247_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	35.4	5.9e-20
>prophage 16
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	338964	340926	4717123		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235831.1|338964_340926_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 17
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	346524	347178	4717123		Planktothrix_phage(100.0%)	1	NA	NA
WP_001400627.1|346524_347178_-	sulfate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	4.9e-14
>prophage 18
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	353942	355163	4717123		Klosneuvirus(100.0%)	1	NA	NA
WP_000082011.1|353942_355163_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.8	4.2e-27
>prophage 19
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	362639	363467	4717123		Bacillus_virus(100.0%)	1	NA	NA
WP_000175050.1|362639_363467_-	NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	1.2e-73
>prophage 20
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	369594	371856	4717123		Tupanvirus(100.0%)	1	NA	NA
WP_000082741.1|369594_371856_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.3e-143
>prophage 21
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	383153	402692	4717123	tRNA	Tupanvirus(22.22%)	20	NA	NA
WP_001144206.1|383153_385082_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	1.6e-129
WP_001700733.1|385085_385628_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|385724_385922_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|385974_386331_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|386453_386498_+|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_000018588.1|386780_387764_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_000672367.1|387778_390166_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|390170_390470_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000956520.1|390570_391551_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154197.1|391613_392165_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029444.1|392164_392914_+	vitamin B12 import ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.7	7.1e-09
WP_001209780.1|392991_393456_+	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_024221592.1|393702_394416_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000175649.1|394478_395915_+	YdiU family protein	NA	NA	NA	NA	NA
WP_001270809.1|395918_396110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082229.1|396241_397288_-	phospho-2-dehydro-3-deoxyheptonate aldolase Trp-sensitive	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_000368046.1|397444_398278_-	phosphoenolpyruvate synthase regulatory protein	NA	NA	NA	NA	NA
WP_001298222.1|398389_398557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000069375.1|398610_400989_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_022581274.1|401045_402692_-	cyclohexanecarboxylate-CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.3	1.6e-32
>prophage 22
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	421338	426422	4717123		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_000367160.1|421338_421707_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
WP_000089364.1|421715_423203_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000948914.1|423212_423959_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	2.2e-10
WP_000908027.1|423933_425205_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_000144560.1|425201_426422_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	40.9	1.7e-92
>prophage 23
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	434711	436978	4717123		Escherichia_phage(50.0%)	3	NA	NA
WP_001349911.1|434711_435380_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
WP_001070002.1|435376_436162_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_000587559.1|436165_436978_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 24
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	442482	451286	4717123		Orpheovirus(20.0%)	10	NA	NA
WP_000493943.1|442482_443124_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	34.7	1.7e-22
WP_000098896.1|443163_444312_-	cyclopropane-fatty-acyl-phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_001182331.1|444602_445814_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000269493.1|445926_446859_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190982.1|446855_447881_-	PurR family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_001303520.1|447868_448093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102278.1|448179_448269_+	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_000701040.1|448434_449604_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007283.1|449749_450331_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000101188.1|450458_451286_-	endopeptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 25
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	460089	461588	4717123		Indivirus(50.0%)	2	NA	NA
WP_000250656.1|460089_460986_+	oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
WP_001296937.1|461066_461588_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
>prophage 26
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	468498	469773	4717123	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|468498_469773_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 27
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	489753	491565	4717123		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945900.1|489753_491565_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.3	0.0e+00
>prophage 28
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	501466	502768	4717123		Bacillus_phage(100.0%)	1	NA	NA
WP_000732491.1|501466_502768_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	23.9	3.2e-17
>prophage 29
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	520529	585361	4717123	capsid,head,lysis,terminase,transposase,portal,tail	Escherichia_phage(40.98%)	82	NA	NA
WP_000148724.1|520529_521144_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	6.6e-29
WP_000526512.1|521186_522041_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213025.1|522042_522660_-	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	59.6	2.1e-75
WP_106873511.1|523668_524881_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.9e-168
WP_072095802.1|524884_526408_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.7	7.4e-130
WP_000041657.1|526468_528895_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.3e-213
WP_001295396.1|529093_529399_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|529506_530217_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138582.1|530219_530780_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|530814_531156_-	DUF1283 domain-containing protein	NA	NA	NA	NA	NA
WP_001295394.1|531822_533037_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836060.1|533048_534068_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.7	1.0e-18
WP_072095801.1|534125_534236_+	transporter	NA	NA	NA	NA	NA
WP_001206148.1|534255_535551_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
WP_000005551.1|535570_535822_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.9e-15
WP_106873512.1|535891_538363_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.5	1.6e-57
WP_001098307.1|538456_538648_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
WP_000413705.1|538644_538833_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133037.1|539400_539610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|539610_540249_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000379563.1|540260_540413_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000379972.1|540579_540987_-	transcriptional regulator	NA	B1B6L9	Salmonella_phage	58.7	3.1e-14
WP_000920571.1|541070_541301_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705369.1|541284_541836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001183993.1|542636_543302_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	3.5e-84
WP_000537580.1|543336_544107_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	69.2	1.3e-85
WP_077775684.1|544107_544515_+	DUF977 domain-containing protein	NA	A0A088CBK9	Shigella_phage	62.6	2.3e-38
WP_001266133.1|544511_544808_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	5.8e-47
WP_000403783.1|545157_545514_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
WP_000935422.1|545564_545777_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	100.0	6.6e-37
WP_001224662.1|545810_545993_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_047083263.1|546158_546878_+	hypothetical protein	NA	A0A077SLK5	Escherichia_phage	64.4	1.7e-68
WP_000403779.1|546855_547212_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	95.8	4.3e-57
WP_000063625.1|547260_547473_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_000555106.1|547673_548387_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	86.1	1.2e-34
WP_001278450.1|548502_548607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303296.1|548595_548751_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	94.6	2.4e-12
WP_000967408.1|548795_549008_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_000042395.1|549110_549428_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001217944.1|549420_549792_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001452497.1|550015_550243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012817785.1|550296_550566_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	3.0e-10
WP_106873513.1|550567_551617_+	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	57.3	6.1e-115
WP_001047111.1|551630_552383_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	98.8	2.6e-136
WP_032316669.1|552468_552678_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	98.4	6.3e-24
WP_106873514.1|552679_552844_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	97.8	5.9e-17
WP_000735807.1|553224_553449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000498121.1|553501_553711_+	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	65.2	2.5e-20
WP_001299632.1|553900_554332_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	98.6	7.8e-69
WP_001339372.1|554633_554762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000023191.1|554810_556661_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000731192.1|557318_557663_+	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
WP_000992128.1|557713_558247_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.2	2.1e-100
WP_077696670.1|558370_558586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024177476.1|558732_559200_+|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	87.7	1.2e-67
WP_000735655.1|559223_559448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001429103.1|559934_560441_+	DNA-packaging protein	NA	O64316	Escherichia_phage	47.9	1.5e-34
WP_024182572.1|560412_562341_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	1.8e-261
WP_000259002.1|562324_562531_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831776.1|562527_564120_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_001253979.1|564109_565615_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
WP_000256824.1|565651_565999_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	6.8e-23
WP_000522591.1|566056_567085_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000201501.1|567136_567520_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204554.1|567512_567866_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000974986.1|567881_568415_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.2e-58
WP_000683079.1|568411_568807_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235112.1|568814_569567_+|tail	tail protein	tail	Q687F6	Enterobacteria_phage	98.0	4.6e-133
WP_106873515.1|569580_570003_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.1	3.4e-69
WP_000533440.1|570029_570443_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081787.1|570423_573036_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.4	0.0e+00
WP_000847298.1|573032_573362_+|tail	tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_106873516.1|573361_574060_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	5.8e-130
WP_106873517.1|574070_574814_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	2.8e-146
WP_106873518.1|574711_575392_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	91.6	1.8e-107
WP_106873519.1|575638_579112_+|tail	phage tail protein	tail	A0A0P0ZCI5	Stx2-converting_phage	97.1	0.0e+00
WP_047083230.1|579179_579779_+	Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	6.3e-109
WP_106873520.1|579843_581157_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.9	2.9e-82
WP_001101700.1|581158_581428_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	1.9e-44
WP_001364738.1|581637_581829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295593.1|583652_584087_-	universal stress protein F	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837918.1|584227_585361_-	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	58.8	2.4e-117
>prophage 30
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	590321	591311	4717123		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|590321_591311_-	lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 31
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	617645	621548	4717123		Klosneuvirus(100.0%)	1	NA	NA
WP_106873521.1|617645_621548_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	6.5e-53
>prophage 32
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	625487	626436	4717123		Escherichia_phage(50.0%)	2	NA	NA
WP_000428998.1|625487_626018_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731833.1|626262_626436_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 33
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	639611	646662	4717123	protease	Phage_TP(25.0%)	7	NA	NA
WP_000218823.1|639611_641573_+|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	28.6	1.6e-23
WP_000494244.1|641664_641895_-	DUF2554 domain-containing protein	NA	NA	NA	NA	NA
WP_000813794.1|642116_642293_+	mRNA interferase HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_001270286.1|642338_642755_+	antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000760665.1|642833_644240_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000335342.1|644485_645631_+	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220414.1|645648_646662_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	6.0e-27
>prophage 34
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	653795	655898	4717123		Salmonella_phage(100.0%)	1	NA	NA
WP_000689329.1|653795_655898_-	TonB-dependent siderophore receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	6.2e-135
>prophage 35
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	669466	671011	4717123		Escherichia_phage(100.0%)	1	NA	NA
WP_000702575.1|669466_671011_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 36
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	679286	680387	4717123		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768396.1|679286_680387_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	65.4	4.1e-138
>prophage 37
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	686577	688015	4717123		Escherichia_phage(50.0%)	2	NA	NA
WP_001400396.1|686577_686862_-	addiction module antidote protein, HigA family	NA	A0A2L1IV52	Escherichia_phage	50.0	5.8e-20
WP_000642387.1|687007_688015_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.9	1.2e-24
>prophage 38
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	698049	699955	4717123		Planktothrix_phage(100.0%)	2	NA	NA
WP_001285538.1|698049_698976_-	peptide ABC transport ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	2.4e-14
WP_000193538.1|698968_699955_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	2.9e-18
>prophage 39
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	704271	708078	4717123		Klosneuvirus(50.0%)	2	NA	NA
WP_001248249.1|704271_706695_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_000426292.1|706695_708078_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 40
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	713352	720288	4717123		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_022581850.1|713352_716148_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	7.5e-19
WP_000832466.1|716192_718565_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001401030.1|718602_720288_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.8	1.7e-10
>prophage 41
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	744588	746124	4717123		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194868.1|744588_746124_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	9.8e-21
>prophage 42
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	753995	754943	4717123		Bacillus_phage(100.0%)	1	NA	NA
WP_033810284.1|753995_754943_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	9.6e-19
>prophage 43
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	763162	763546	4717123		Streptococcus_phage(100.0%)	1	NA	NA
WP_000091199.1|763162_763546_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 44
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	772802	837037	4717123	capsid,holin,head,lysis,terminase,portal,transposase,tRNA,tail	Escherichia_phage(47.14%)	83	NA	NA
WP_000214712.1|772802_773006_+	protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527802.1|773041_774502_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.7	5.1e-43
WP_085961182.1|775631_776844_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_096846665.1|777247_777562_+	DinI family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001370599.1|777932_778814_-	peptidase M85	NA	NA	NA	NA	NA
WP_085961182.1|778882_780095_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_106873523.1|780061_780244_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	5.2e-06
WP_001452452.1|780260_780452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101711.1|780661_780931_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	96.6	3.5e-43
WP_106873524.1|780932_782246_-|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	98.2	2.8e-77
WP_106873525.1|782310_782910_-	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	5.2e-111
WP_106873526.1|782976_786453_-|tail	phage tail protein	tail	Q687E8	Enterobacteria_phage	95.7	0.0e+00
WP_000246303.1|786698_787379_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.1	1.6e-108
WP_061330346.1|787276_788020_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.3	1.4e-145
WP_106873527.1|788025_788724_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.0	7.6e-130
WP_000847298.1|788723_789053_-|tail	tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000081788.1|789049_791662_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.1	0.0e+00
WP_000533442.1|791642_792056_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479051.1|792082_792505_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235067.1|792518_793271_-|tail	tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000683137.1|793278_793674_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000752994.1|794259_794613_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_022581670.1|794624_795020_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.2	5.3e-56
WP_000063258.1|795061_796087_-|capsid	minor capsid protein E	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001365129.1|796142_796475_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000123292.1|796484_797804_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	1.5e-232
WP_001443752.1|797784_799386_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_000198153.1|799382_799589_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027330.1|799585_801511_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453587.1|801485_802031_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_000583869.1|802170_802272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303940.1|802419_802644_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|802725_803040_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001302153.1|803280_803421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024183411.1|803503_803971_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	83.8	3.7e-64
WP_001056806.1|804119_804689_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_096848455.1|804959_805154_-	hypothetical protein	NA	A0A0N7C1K4	Escherichia_phage	51.6	4.8e-26
WP_085961182.1|805137_806351_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_106873528.1|806356_806806_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	95.0	2.5e-73
WP_000731192.1|806856_807201_-	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
WP_024165672.1|807205_807421_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_025380333.1|807859_809710_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000466957.1|810281_810713_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_024201677.1|811162_811552_-	envelope protein	NA	NA	NA	NA	NA
WP_106378147.1|811716_811911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085961182.1|811872_813085_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_077630041.1|813323_813644_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.1	2.7e-34
WP_000211416.1|813764_814346_-	hypothetical protein	NA	Q8VNP5	Enterobacteria_phage	97.6	8.7e-63
WP_000640148.1|814619_815174_-	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	71.6	7.5e-72
WP_000228019.1|815170_815461_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	5.7e-47
WP_000940348.1|815460_816060_-	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	91.0	1.6e-104
WP_071525388.1|816131_816383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967410.1|816619_816832_-	type I toxin-antitoxin system hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	97.1	2.8e-27
WP_001303916.1|816876_817032_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	83.8	1.9e-09
WP_001278450.1|817020_817125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000610382.1|817240_817594_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	65.8	3.2e-36
WP_029594466.1|817590_817935_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	93.5	2.0e-46
WP_000063625.1|817998_818211_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_000403779.1|818259_818616_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	95.8	4.3e-57
WP_001118155.1|818673_819069_-	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_032313847.1|819084_819855_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.6	5.7e-86
WP_000788990.1|819876_820623_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	80.9	2.8e-114
WP_000702023.1|821510_821933_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	5.3e-70
WP_001033914.1|821929_822172_-	XRE family transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000410105.1|822268_822688_+	transcriptional regulator	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_000379546.1|822993_823146_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	1.3e-07
WP_000394548.1|823157_823796_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|823796_824006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032162060.1|824054_824315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560227.1|824575_824797_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	95.9	1.2e-36
WP_001359121.1|824796_824967_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	92.9	7.9e-25
WP_001519830.1|825041_825317_+	phage protein	NA	A0A0U2QW85	Escherichia_phage	92.3	4.9e-40
WP_000102216.1|825418_828544_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	82.8	0.0e+00
WP_001004423.1|828555_829608_+	enterohemolysin	NA	A0A0U2S5Y9	Escherichia_phage	63.3	1.4e-116
WP_021500490.1|829671_829866_+	restriction alleviation protein, Lar family	NA	A0A0U2QQP4	Escherichia_phage	100.0	9.0e-33
WP_001298826.1|829858_830047_+	DUF1187 domain-containing protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|830146_830362_+	Rac prophage; conserved protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040838.1|830363_831599_+	hypothetical protein	NA	A0A0U2JGI6	Escherichia_phage	99.3	1.1e-240
WP_001157377.1|831651_832587_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	2.8e-148
WP_000123735.1|832715_834089_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.4	6.6e-53
WP_001296046.1|834118_834292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387388.1|834566_835550_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001401302.1|835804_837037_+	PAS domain S-box protein	NA	A0A127AWB9	Bacillus_phage	39.5	1.8e-17
>prophage 45
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	843363	843879	4717123		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945011.1|843363_843879_+	methylated-DNA--protein-cysteine methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 46
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	877127	878393	4717123		Klosneuvirus(100.0%)	1	NA	NA
WP_022581765.1|877127_878393_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	2.7e-24
>prophage 47
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	891180	893201	4717123		Bacillus_virus(50.0%)	2	NA	NA
WP_000573411.1|891180_891987_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-14
WP_000135011.1|892037_893201_-	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	26.1	4.8e-28
>prophage 48
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	902134	904069	4717123		Lactococcus_phage(100.0%)	1	NA	NA
WP_000484987.1|902134_904069_+	exoribonuclease 2	NA	Q0GXV6	Lactococcus_phage	27.9	4.1e-32
>prophage 49
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	911884	912475	4717123		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|911884_912475_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 50
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	917399	1037559	4717123	capsid,holin,head,lysis,terminase,transposase,protease,tRNA,tail	Enterobacteria_phage(38.71%)	136	NA	NA
WP_001295576.1|917399_919997_-	DNA topoisomerase I	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
WP_001303291.1|920119_920332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001031530.1|920376_920628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422045.1|920663_921713_-|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|921932_922691_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278904.1|922687_923278_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291215.1|923317_924193_-	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
WP_022581766.1|924405_926301_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|926328_926949_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285684.1|926945_927827_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001386774.1|927964_928009_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194605.1|928100_929663_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763498.1|929662_931258_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_024221648.1|931261_932620_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000209513.1|932631_933825_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443065.1|933824_934631_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807658.1|935011_935191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001056550.1|935276_935777_+	YciE/YciF family protein	NA	NA	NA	NA	NA
WP_001079499.1|935822_936329_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001261935.1|937047_937296_+	DNA damage-inducible protein DinI	NA	Q687E4	Enterobacteria_phage	95.1	3.5e-37
WP_000701369.1|937666_938653_-	peptidase M85	NA	NA	NA	NA	NA
WP_001341980.1|938681_938873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023400.1|939082_939352_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	7.1e-44
WP_106873508.1|939353_940676_-|tail	phage tail protein	tail	A0A0P0ZDE7	Stx2-converting_phage	91.4	7.7e-75
WP_001449501.1|940741_941365_-	membrane protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	8.7e-69
WP_106873530.1|941433_944910_-|tail	phage tail protein	tail	Q6H9T2	Enterobacteria_phage	97.8	0.0e+00
WP_062875274.1|945145_945826_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	1.6e-113
WP_001456370.1|945723_946467_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.7e-148
WP_106873531.1|946477_947176_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.8	8.9e-131
WP_000807940.1|947175_947517_-|tail	tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_106873532.1|947509_950752_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.4	0.0e+00
WP_001234268.1|950799_951081_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	7.9e-46
WP_000710952.1|951104_951479_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275483.1|951493_952210_-|tail	tail protein	tail	B6DZA6	Enterobacteria_phage	99.6	2.1e-127
WP_000133388.1|952275_952620_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|952616_953063_-	hypothetical protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|953059_953410_-|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|953420_953747_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|956273_956495_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173079.1|956539_958477_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	100.0	0.0e+00
WP_001399867.1|958540_960202_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_000958380.1|960198_960762_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_032315826.1|961051_961417_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	99.2	2.6e-65
WP_000095749.1|961458_961686_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001082576.1|962048_962516_-|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	100.0	6.9e-79
WP_001056806.1|962669_963239_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992045.1|963509_964043_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.6	8.1e-100
WP_001041949.1|964554_965346_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_024165672.1|965349_965565_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000075213.1|965563_965725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012817767.1|967975_968203_-	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	100.0	2.6e-39
WP_000752026.1|968353_968623_-	Shiga toxin Stx1 subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|968632_969580_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_032313454.1|969852_970083_+	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	98.6	1.1e-29
WP_000646552.1|970154_971207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001041173.1|971207_971600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000969104.1|971596_972262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205462.1|972292_972640_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.0	5.5e-57
WP_001450023.1|972639_972882_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	97.5	2.7e-34
WP_000625371.1|972893_974294_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	94.1	1.1e-247
WP_000988198.1|974290_975169_-	ATPase AAA	NA	Q8W641	Enterobacteria_phage	89.3	4.3e-130
WP_001247833.1|975179_976088_-	hypothetical protein	NA	Q8W642	Enterobacteria_phage	95.7	4.4e-61
WP_000621234.1|976074_976308_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	48.6	1.9e-13
WP_001480341.1|976304_977168_-	hypothetical protein	NA	A0A1C9IHV9	Salmonella_phage	66.7	6.5e-99
WP_071529593.1|977130_977310_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	84.7	3.2e-24
WP_001090938.1|977329_978037_-	hypothetical protein	NA	Q8W645	Enterobacteria_phage	78.2	7.7e-98
WP_000177356.1|978033_978261_-	hypothetical protein	NA	Q8W647	Enterobacteria_phage	89.6	5.4e-29
WP_000838351.1|978370_979027_+	LexA family transcriptional repressor	NA	Q8W648	Enterobacteria_phage	93.6	8.7e-120
WP_100029038.1|979265_979775_+	helix-turn-helix domain-containing protein	NA	Q8W649	Enterobacteria_phage	71.4	2.8e-25
WP_000147362.1|979780_979981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000553974.1|980179_980362_+	hypothetical protein	NA	Q8W652	Enterobacteria_phage	50.9	2.9e-09
WP_001198820.1|980367_980949_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	67.7	7.1e-73
WP_000215935.1|980959_981214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000179799.1|981203_981506_+	DUF4752 domain-containing protein	NA	A0A1I9LJV1	Stx_converting_phage	89.4	3.3e-42
WP_001289911.1|981474_982104_+	hypothetical protein	NA	G9L663	Escherichia_phage	98.6	4.0e-106
WP_000034254.1|982100_982514_+	hypothetical protein	NA	A0A0H4ISY5	Shigella_phage	86.6	7.6e-29
WP_001014287.1|982515_982707_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	8.0e-26
WP_001449526.1|982911_983349_+	DUF551 domain-containing protein	NA	A0A1I9LJM0	Stx_converting_phage	67.6	4.5e-48
WP_000457718.1|983436_983673_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	93.8	6.4e-33
WP_000556583.1|983676_983811_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_001193437.1|983829_984084_+	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063650.1|984117_985404_+	DUF3596 domain-containing protein	NA	Q20GI2	Phage_258-320	99.8	6.9e-254
WP_000147167.1|985459_985678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302903.1|986283_986712_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	42.1	1.4e-22
WP_001144877.1|988440_989031_-	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_001401309.1|989214_989862_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	41.6	1.9e-42
WP_010904748.1|989998_990184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|990572_990851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106873533.1|992152_995626_-|tail	phage tail protein	tail	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_000246299.1|995968_996649_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.3	6.5e-110
WP_000194723.1|996546_997290_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_032162053.1|997300_997999_-|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	97.0	1.2e-130
WP_000807954.1|997998_998340_-|tail	tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_025380485.1|998332_1001575_-|tail	phage tail tape measure protein	tail	B6ETF7	Enterobacteria_phage	99.8	0.0e+00
WP_001234271.1|1001626_1001908_-|tail	phage tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	1.3e-45
WP_001030063.1|1001931_1002306_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_021497599.1|1002311_1003028_-|tail	phage major tail 2 family protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.9	2.3e-126
WP_106873534.1|1003086_1003431_-	hypothetical protein	NA	A0A0P0ZC17	Stx2-converting_phage	98.2	6.1e-56
WP_000573391.1|1003427_1003874_-	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007889.1|1003870_1004221_-|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
WP_000125988.1|1004231_1004558_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001074112.1|1007246_1007468_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	95.9	3.2e-34
WP_022581168.1|1007512_1009450_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	98.1	0.0e+00
WP_062881144.1|1009513_1011175_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	99.5	0.0e+00
WP_025380492.1|1011171_1011735_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	99.5	5.2e-89
WP_000829192.1|1012023_1012389_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000095744.1|1012430_1012631_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828070.1|1012762_1013089_-	membrane protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_071526390.1|1013024_1013276_-	hypothetical protein	NA	H6WZK4	Escherichia_phage	95.7	3.2e-30
WP_077793394.1|1013197_1013398_-	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	76.9	5.0e-10
WP_071829221.1|1013427_1013895_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	94.2	2.0e-73
WP_000661708.1|1014123_1014819_-	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	98.7	3.6e-124
WP_000992065.1|1015092_1015626_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	6.2e-100
WP_000731192.1|1015676_1016021_-	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
WP_071826437.1|1016238_1016385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106873535.1|1016524_1018375_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	B6DZ89	Enterobacteria_phage	95.6	0.0e+00
WP_032162137.1|1018403_1018574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000466924.1|1018861_1019293_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_022581947.1|1019482_1019671_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	66.7	7.9e-18
WP_085961182.1|1019744_1020957_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_001216963.1|1021500_1021608_+	membrane protein	NA	NA	NA	NA	NA
WP_000783120.1|1021588_1022320_-	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
WP_000569315.1|1022324_1023251_-	ABC transporter ATPase	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000220837.1|1023243_1024401_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001130308.1|1024407_1025325_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000871507.1|1025535_1027833_-	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_000097402.1|1028028_1029744_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_001319943.1|1029781_1030714_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_001295454.1|1030887_1031475_-	YIP1 family protein	NA	NA	NA	NA	NA
WP_001296821.1|1031644_1032223_+	DedA family protein	NA	NA	NA	NA	NA
WP_000079538.1|1032352_1033114_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001078139.1|1033166_1034603_-	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_000691708.1|1034826_1034910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001264861.1|1035282_1036230_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_001295452.1|1036468_1036867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968208.1|1036863_1037559_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
>prophage 51
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1043613	1045134	4717123		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255032.1|1043613_1045134_-	D-ribose transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 52
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1048828	1052614	4717123		Cellulophaga_phage(50.0%)	5	NA	NA
WP_001139613.1|1048828_1049497_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_001296830.1|1049480_1049594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001308773.1|1049650_1049827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000425471.1|1049754_1050591_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489224.1|1050622_1052614_-	colicin I receptor	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
>prophage 53
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1056683	1057541	4717123		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|1056683_1057541_+	endonuclease	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 54
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1072035	1076336	4717123		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_001091934.1|1072035_1073502_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	5.1e-43
WP_000198826.1|1073619_1074606_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000594599.1|1074644_1075358_+	lipid A 1-diphosphate synthase	NA	NA	NA	NA	NA
WP_000241011.1|1075769_1076336_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 55
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1082089	1089737	4717123		Vibrio_phage(50.0%)	8	NA	NA
WP_000194883.1|1082089_1083679_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	5.5e-19
WP_000202798.1|1083682_1084027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213385.1|1084359_1085550_-	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	23.7	2.9e-20
WP_001234850.1|1085577_1086273_-	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
WP_071525106.1|1086273_1086396_+	aldose epimerase	NA	NA	NA	NA	NA
WP_000578056.1|1086421_1088182_+	ATP-dependent helicase	NA	M4Q3N1	Vibrio_phage	42.0	8.4e-101
WP_000494183.1|1088306_1088591_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050799.1|1088729_1089737_-	nucleoid-associated protein	NA	A0A1V0E8C0	Vibrio_phage	48.0	4.5e-83
>prophage 56
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1101610	1102234	4717123		Bacillus_virus(100.0%)	1	NA	NA
WP_000525587.1|1101610_1102234_-	cytochrome c biogenesis ATP-binding export protein CcmA	NA	G3M9Y6	Bacillus_virus	25.5	2.0e-12
>prophage 57
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1111221	1117023	4717123		Bacillus_phage(25.0%)	5	NA	NA
WP_000422175.1|1111221_1112865_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	1.6e-13
WP_000884957.1|1112940_1113591_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000786349.1|1113590_1114655_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	3.1e-18
WP_000406082.1|1114728_1115784_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_000865547.1|1115895_1117023_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	59.5	3.1e-117
>prophage 58
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1121300	1124150	4717123		Hokovirus(100.0%)	1	NA	NA
WP_000876005.1|1121300_1124150_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.8	1.9e-41
>prophage 59
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1133849	1136477	4717123		Bacillus_virus(100.0%)	1	NA	NA
WP_001281242.1|1133849_1136477_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
>prophage 60
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1141934	1145838	4717123		Pseudomonas_phage(66.67%)	3	NA	NA
WP_001075170.1|1141934_1144220_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_000332037.1|1144453_1145584_+	ribonucleoside-diphosphate reductase 1 subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_000179249.1|1145583_1145838_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	74.6	1.5e-24
>prophage 61
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1148900	1149980	4717123		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000779088.1|1148900_1149980_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 62
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1155872	1160491	4717123		Sodalis_phage(50.0%)	5	NA	NA
WP_000140611.1|1155872_1156844_+	hypothetical protein	NA	Q2A0A7	Sodalis_phage	54.8	1.6e-69
WP_000150342.1|1156856_1157078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000992952.1|1157118_1157922_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_001400666.1|1157939_1159229_-	MFS transporter	NA	NA	NA	NA	NA
WP_000174592.1|1159285_1160491_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.2e-26
>prophage 63
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1164093	1169096	4717123		Tupanvirus(50.0%)	4	NA	NA
WP_001317957.1|1164093_1164696_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	41.7	4.4e-09
WP_001400664.1|1165002_1166142_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	30.4	2.2e-30
WP_000461658.1|1166145_1167114_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	1.2e-35
WP_000860316.1|1167113_1169096_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	26.1	6.3e-20
>prophage 64
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1203533	1206761	4717123		Salmonella_phage(50.0%)	3	NA	NA
WP_000813854.1|1203533_1204133_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012886.1|1204191_1206024_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203399.1|1206110_1206761_-	sugar phosphatase	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	2.8e-09
>prophage 65
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1217319	1281093	4717123	capsid,holin,plate,terminase,portal,integrase,transposase,tRNA,tail	Enterobacteria_phage(75.0%)	76	1225741:1225764	1273957:1273980
WP_000156141.1|1217319_1218210_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	53.1	4.0e-67
WP_001293604.1|1218406_1219180_-	histidine/lysine/arginine/ornithine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_000569958.1|1219187_1219904_-	histidine ABC transporter permease	NA	NA	NA	NA	NA
WP_000965518.1|1219900_1220587_-	histidine ABC transporter permease	NA	NA	NA	NA	NA
WP_000737621.1|1220676_1221459_-	histidine ABC transporter substrate-binding protein HisJ	NA	NA	NA	NA	NA
WP_000748251.1|1221679_1222462_-	lysine/arginine/ornithine-binding periplasmic protein	NA	NA	NA	NA	NA
WP_000825700.1|1222721_1223291_-	3-octaprenyl-4-hydroxybenzoate carboxy-lyase partner protein	NA	NA	NA	NA	NA
WP_000334220.1|1223385_1224903_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
WP_000262113.1|1224939_1225428_-	colicin V production protein	NA	NA	NA	NA	NA
1225741:1225764	attL	GATAAGACGCGCCAGCGTCGCATC	NA	NA	NA	NA
WP_000157003.1|1225777_1226440_-	cell division protein DedD	NA	NA	NA	NA	NA
WP_000584555.1|1226429_1227698_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000118404.1|1227767_1228682_-	acetyl-CoA carboxylase carboxyl transferase subunit beta	NA	NA	NA	NA	NA
WP_000364335.1|1228837_1229497_-	protein DedA	NA	NA	NA	NA	NA
WP_001283590.1|1229579_1230392_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289160.1|1230391_1231405_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_071829263.1|1231470_1232628_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.8	5.4e-24
WP_000023402.1|1232788_1233793_-|integrase	integrase	integrase	A0A0M4RTQ0	Salmonella_phage	55.7	4.5e-99
WP_001390705.1|1233889_1234210_-	XRE family transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	1.4e-14
WP_000004249.1|1234323_1234611_+	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	52.6	4.3e-23
WP_000200503.1|1234617_1234824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813363.1|1235076_1235418_+	DUF4761 domain-containing protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	2.3e-55
WP_000158966.1|1235428_1235716_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	75.8	1.7e-32
WP_000514277.1|1235727_1235970_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000985161.1|1236165_1236369_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	86.6	2.9e-26
WP_000153680.1|1236365_1236611_+	MarR family transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	97.5	7.4e-40
WP_001274220.1|1236607_1236907_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	90.8	2.8e-41
WP_071529425.1|1236957_1237173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000013441.1|1237229_1237460_+	hypothetical protein	NA	A0A0A7NV48	Enterobacteria_phage	96.1	2.6e-31
WP_000599385.1|1237532_1237898_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	5.1e-61
WP_106873563.1|1238042_1240670_+	replication protein	NA	A0A0A7NQ77	Enterobacteria_phage	96.6	0.0e+00
WP_000502620.1|1240850_1241972_+	ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	29.5	3.7e-17
WP_001140702.1|1241995_1244221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000087812.1|1244715_1245762_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_032313218.1|1245761_1247513_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
WP_047651676.1|1247667_1248504_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	1.3e-149
WP_001055089.1|1248527_1249580_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.1	6.6e-194
WP_000632340.1|1249625_1250426_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.7	1.0e-130
WP_000063093.1|1250527_1251022_+|capsid	phage capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	98.8	1.6e-89
WP_000864901.1|1251021_1251222_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104346.1|1251224_1251548_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	98.1	1.6e-50
WP_000072345.1|1251544_1251937_+	M15 family peptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	1.7e-70
WP_045133209.1|1251933_1252341_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	2.0e-66
WP_000920584.1|1252478_1252946_+|tail	tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	98.7	1.7e-85
WP_000356356.1|1252938_1253574_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	1.2e-113
WP_001271920.1|1253570_1254152_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.9	7.3e-102
WP_000213447.1|1254148_1254499_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111960.1|1254502_1255399_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.3	6.0e-156
WP_000071720.1|1255391_1255922_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_089575684.1|1255924_1258027_+|tail	phage tail protein	tail	Q1MVL8	Enterobacteria_phage	62.5	1.8e-211
WP_000972163.1|1258029_1258563_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	3.2e-96
WP_032313334.1|1258591_1259119_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.7	4.9e-89
WP_100215893.1|1259120_1260083_-|tail	phage tail protein	tail	A0A222YWB9	Escherichia_phage	86.8	2.4e-158
WP_000905058.1|1260205_1260793_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	99.0	2.7e-104
WP_075591730.1|1260828_1261323_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	1.1e-85
WP_047651914.1|1261329_1264137_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	98.2	0.0e+00
WP_001443620.1|1264123_1264360_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	94.1	4.3e-21
WP_000651564.1|1264287_1264662_-	hypothetical protein	NA	A0A0A7NPZ0	Enterobacteria_phage	72.4	6.9e-37
WP_000290450.1|1264717_1265230_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_106873537.1|1265229_1266414_-|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	4.7e-225
WP_001519190.1|1266571_1267681_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	3.1e-194
WP_001448290.1|1267723_1267984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071531535.1|1267980_1268169_-	hypothetical protein	NA	Q7Y2U2	Escherichia_phage	61.9	5.3e-06
WP_000078916.1|1268174_1268315_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001060550.1|1268730_1269558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001173924.1|1270071_1270404_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_000794120.1|1270408_1271302_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_000615820.1|1271559_1272555_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127796.1|1272551_1273730_-	MFS transporter	NA	NA	NA	NA	NA
WP_072095739.1|1273671_1273893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000817178.1|1274004_1275225_-	3-oxoacyl-ACP synthase I	NA	NA	NA	NA	NA
1273957:1273980	attR	GATGCGACGCTGGCGCGTCTTATC	NA	NA	NA	NA
WP_000683767.1|1275383_1277390_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|1277510_1277789_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089226.1|1277822_1278371_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447356.1|1278370_1279180_-	membrane protein	NA	NA	NA	NA	NA
WP_001043835.1|1279179_1280004_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001307917.1|1280007_1281093_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.5	2.7e-89
>prophage 66
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1299136	1300069	4717123		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000368129.1|1299136_1300069_+	membrane protein	NA	E7DYY8	Enterobacteria_phage	99.7	2.7e-167
>prophage 67
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1307993	1315570	4717123		Hokovirus(50.0%)	4	NA	NA
WP_001400650.1|1307993_1311587_+	two-component system sensor histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	31.5	1.1e-35
WP_000183691.1|1311642_1312788_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|1312861_1313806_-	transporter	NA	NA	NA	NA	NA
WP_001283490.1|1313875_1315570_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.4e-23
>prophage 68
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1319261	1320182	4717123		Morganella_phage(100.0%)	1	NA	NA
WP_000484397.1|1319261_1320182_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	55.2	9.8e-77
>prophage 69
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1324000	1324735	4717123		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|1324000_1324735_+	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 70
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1341507	1342716	4717123	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_025404425.1|1341507_1342716_-|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	92.5	1.2e-204
>prophage 71
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1348141	1363511	4717123		Streptococcus_phage(33.33%)	15	NA	NA
WP_000443703.1|1348141_1350157_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	2.2e-150
WP_001401148.1|1350227_1351226_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254838.1|1351455_1352217_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|1352401_1353373_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|1353756_1354014_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_000623136.1|1354058_1355786_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|1355826_1356336_+	glucose-specific phosphotransferase enzyme IIA component	NA	NA	NA	NA	NA
WP_000096670.1|1356378_1357230_-	pyridoxine kinase	NA	NA	NA	NA	NA
WP_000719945.1|1357334_1357703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295461.1|1357705_1358617_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	7.7e-58
WP_000021036.1|1358750_1359848_-	sulfate/thiosulfate import ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_000852686.1|1359837_1360713_-	sulfate ABC transporter permease	NA	NA	NA	NA	NA
WP_000458420.1|1360712_1361546_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290255.1|1361545_1362562_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000517430.1|1362719_1363511_-	NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	2.0e-17
>prophage 72
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1366989	1371927	4717123		Mycobacterium_phage(33.33%)	6	NA	NA
WP_022581365.1|1366989_1368294_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	24.2	1.2e-08
WP_000084590.1|1368351_1369251_-	deferrochelatase/peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838945.1|1369346_1369922_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000842944.1|1369982_1370432_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|1370418_1370844_-	acetyltransferase YpeA	NA	NA	NA	NA	NA
WP_000102890.1|1371057_1371927_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.9	1.5e-13
>prophage 73
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1390479	1391430	4717123		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|1390479_1391430_+	transaldolase A	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 74
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1397430	1398644	4717123	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
WP_085961182.1|1397430_1398644_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
>prophage 75
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1410033	1410747	4717123		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|1410033_1410747_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 76
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1433498	1437500	4717123		Enterobacteria_phage(33.33%)	5	NA	NA
WP_001400504.1|1433498_1434788_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	6.6e-63
WP_001295473.1|1434873_1435500_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_071792368.1|1435476_1435806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295474.1|1435824_1436862_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001028618.1|1436861_1437500_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	4.0e-29
>prophage 77
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1443747	1450223	4717123		Escherichia_phage(60.0%)	7	NA	NA
WP_000017552.1|1443747_1443900_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
WP_000076001.1|1443917_1444109_+	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_071792369.1|1444170_1444317_+	succinate dehydrogenase	NA	NA	NA	NA	NA
WP_001295476.1|1444419_1444938_+	hypothetical protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
WP_000138281.1|1445572_1447150_-	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
WP_001299507.1|1447218_1448685_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_032315784.1|1448846_1450223_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	6.9e-42
>prophage 78
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1469242	1469674	4717123		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|1469242_1469674_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 79
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1479567	1486091	4717123		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133553.1|1479567_1480851_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.9e-34
WP_000523616.1|1481095_1481296_-	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
WP_001124469.1|1481307_1481643_-	(2Fe-2S) ferredoxin	NA	NA	NA	NA	NA
WP_025380539.1|1481644_1483495_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384413.1|1483511_1484027_-	co-chaperone protein HscB	NA	NA	NA	NA	NA
WP_000028953.1|1484122_1484446_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|1484462_1484849_-	iron-sulfur cluster scaffold-like protein	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|1484876_1486091_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 80
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1503510	1514818	4717123		Bacillus_phage(50.0%)	7	NA	NA
WP_000919167.1|1503510_1504764_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	6.0e-101
WP_000883120.1|1505091_1506282_+	flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|1506326_1506665_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_001298983.1|1506725_1508060_-	transcriptional regulator	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215894.1|1508049_1508763_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_022581814.1|1508927_1510355_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_000970093.1|1510930_1514818_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	5.9e-131
>prophage 81
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1518936	1519197	4717123		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196285.1|1518936_1519197_+	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	8.4e-18
>prophage 82
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1522657	1526400	4717123		Tetraselmis_virus(50.0%)	4	NA	NA
WP_001068343.1|1522657_1523338_-	ribonuclease 3	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_032175829.1|1523281_1523560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000002545.1|1523610_1524585_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|1524600_1526400_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 83
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1532171	1538254	4717123		Cafeteria_roenbergensis_virus(25.0%)	8	NA	NA
WP_000219193.1|1532171_1533506_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001383425.1|1533538_1534420_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189191.1|1534522_1535110_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|1535165_1535549_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262720.1|1535853_1536543_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	3.5e-55
WP_000997403.1|1536590_1537628_-	methyltransferase	NA	NA	NA	NA	NA
WP_001322361.1|1537617_1537821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001098726.1|1537834_1538254_+	thiol disulfide reductase thioredoxin	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 84
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1550624	1553198	4717123		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|1550624_1553198_-	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 85
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1559104	1560175	4717123		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168045.1|1559104_1560175_-	phospho-2-dehydro-3-deoxyheptonate aldolase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 86
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1573808	1586830	4717123	tail,transposase	Stx2-converting_phage(50.0%)	10	NA	NA
WP_000162574.1|1573808_1574291_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|1575139_1575388_+	DNA damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_010917822.1|1576260_1576632_+	DUF1076 domain-containing protein	NA	A0A0P0ZBX1	Stx2-converting_phage	99.2	1.7e-67
WP_000491541.1|1576856_1577732_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	97.6	2.8e-158
WP_001023407.1|1577872_1578142_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001230532.1|1579520_1580120_-	Ail/Lom family protein	NA	B6ETG5	Enterobacteria_phage	99.0	4.4e-110
WP_096904041.1|1580186_1581668_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.0	4.8e-267
WP_071826436.1|1583410_1584088_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	96.4	1.5e-111
WP_001303040.1|1583985_1584723_-|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_106873538.1|1585617_1586830_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	2.5e-168
>prophage 87
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1591406	1591625	4717123		Salmonella_phage(100.0%)	1	NA	NA
WP_071780853.1|1591406_1591625_-	DNA invertase	NA	A0A1S6L009	Salmonella_phage	72.0	3.2e-10
>prophage 88
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1601074	1605125	4717123		Klosneuvirus(50.0%)	4	NA	NA
WP_000097679.1|1601074_1602355_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.3	3.8e-34
WP_001301367.1|1602591_1603992_+	GABA permease	NA	NA	NA	NA	NA
WP_000156793.1|1604012_1604675_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522415.1|1604675_1605125_-	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 89
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1611024	1616321	4717123		Oenococcus_phage(20.0%)	6	NA	NA
WP_001223227.1|1611024_1611270_+	NrdH-redoxin	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080956.1|1611266_1611677_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_000246559.1|1611649_1613794_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	3.8e-196
WP_000777953.1|1613803_1614763_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	1.3e-132
WP_094970963.1|1614880_1615129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032315847.1|1615118_1616321_+	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 90
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1631329	1636889	4717123	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|1631329_1631515_-	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047196.1|1631749_1634380_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_032315849.1|1634507_1635008_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|1635250_1636312_-	DNA recombination/repair protein RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132231.1|1636391_1636889_-	nicotinamide-nucleotide amidohydrolase PncC	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 91
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1642356	1643322	4717123		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287416.1|1642356_1643322_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.3	8.0e-37
>prophage 92
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1650797	1651808	4717123		Enterobacteria_phage(100.0%)	1	NA	NA
WP_032161993.1|1650797_1651808_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.6	1.6e-27
>prophage 93
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1671276	1681296	4717123		uncultured_Mediterranean_phage(33.33%)	9	NA	NA
WP_001272906.1|1671276_1673838_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	1.3e-30
WP_001141343.1|1673943_1674600_+	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	1.8e-48
WP_000562979.1|1674640_1674877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000767721.1|1676314_1676908_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_001208062.1|1677053_1677461_+	transcriptional regulator HosA	NA	NA	NA	NA	NA
WP_000081550.1|1677580_1678573_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|1678635_1679775_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|1679914_1680541_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|1680534_1681296_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 94
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1684408	1686441	4717123		Tupanvirus(50.0%)	2	NA	NA
WP_001173673.1|1684408_1685014_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_001090340.1|1685013_1686441_-	sulfate adenylyltransferase	NA	A0A1V0SGC3	Hokovirus	31.4	1.6e-30
>prophage 95
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1691265	1692479	4717123	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
WP_085961182.1|1691265_1692479_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
>prophage 96
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1708497	1709283	4717123		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_001400806.1|1708497_1709283_-	KR domain-containing protein	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	1.4e-20
>prophage 97
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1713570	1714242	4717123		Vibrio_phage(100.0%)	1	NA	NA
WP_001199979.1|1713570_1714242_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
>prophage 98
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1718045	1721069	4717123		Streptococcus_phage(50.0%)	2	NA	NA
WP_000036723.1|1718045_1719344_-	enolase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|1719431_1721069_-	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 99
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1725101	1729216	4717123		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_000046821.1|1725101_1726403_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	2.6e-38
WP_000186450.1|1726459_1729216_+	signal transduction histidine kinase	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 100
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1736750	1737599	4717123		Vibrio_phage(100.0%)	1	NA	NA
WP_000100434.1|1736750_1737599_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	2.1e-41
>prophage 101
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1742457	1743213	4717123		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|1742457_1743213_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 102
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1754739	1770286	4717123	tRNA	environmental_halophage(16.67%)	9	NA	NA
WP_001400817.1|1754739_1755945_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.0	1.3e-73
WP_000184266.1|1755944_1756388_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117724.1|1756438_1757245_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	1.7e-16
WP_000678646.1|1757482_1758580_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000016907.1|1759158_1760412_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|1760643_1761975_+	N-acetylglutamate synthase	NA	NA	NA	NA	NA
WP_106873540.1|1762036_1763863_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.9	3.2e-26
WP_001285991.1|1763862_1767405_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.6	1.5e-08
WP_001138223.1|1767397_1770286_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	9.0e-68
>prophage 103
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1775762	1782535	4717123		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|1775762_1776557_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|1776563_1777439_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957914.1|1777589_1779836_-	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|1779848_1780379_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082188.1|1781063_1781753_+	DNA mismatch repair protein MutH	NA	NA	NA	NA	NA
WP_000895624.1|1781821_1782535_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 104
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1792165	1794653	4717123		Aichi_virus(50.0%)	2	NA	NA
WP_000256438.1|1792165_1793584_-	arabinose-proton symporter	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603529.1|1793891_1794653_-	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.3	2.9e-18
>prophage 105
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1809372	1810128	4717123		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|1809372_1810128_-	lipoprotein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 106
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1834588	1849980	4717123	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280192.1|1834588_1835989_+	xanthine permease XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001307990.1|1836003_1837323_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012163.1|1837358_1838726_+	guanine/hypoxanthine permease GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_000838407.1|1838761_1839250_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_001400825.1|1839249_1841169_-	oxidoreductase (Fe-S)-binding subunit	NA	NA	NA	NA	NA
WP_001317296.1|1841471_1841558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001400826.1|1841604_1843053_+	uric acid transporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001010156.1|1843054_1843180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001192818.1|1843302_1843851_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003071.1|1843893_1845411_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|1845420_1846519_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813202.1|1846609_1848343_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.4e-60
WP_000715214.1|1848348_1849059_-	thiol:disulfide interchange protein DsbC	NA	NA	NA	NA	NA
WP_000806638.1|1849083_1849980_-	tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 107
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1853779	1858256	4717123		Pandoravirus(50.0%)	2	NA	NA
WP_001400828.1|1853779_1855219_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.5	1.2e-31
WP_000195017.1|1855382_1858256_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	3.7e-263
>prophage 108
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1866783	1868016	4717123		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|1866783_1868016_-	D-3-phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 109
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1879277	1891180	4717123	transposase	Enterobacteria_phage(90.0%)	14	NA	NA
WP_025404448.1|1879277_1881611_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
WP_000856729.1|1881625_1881946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000459319.1|1882081_1882537_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_001244665.1|1882529_1882817_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_025404449.1|1882809_1883400_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	97.0	4.5e-67
WP_001149160.1|1883396_1883663_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001330887.1|1883675_1883867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283035.1|1884214_1884949_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	99.2	2.7e-130
WP_000638631.1|1884945_1885446_+	transactivation protein	NA	NA	NA	NA	NA
WP_000446137.1|1885519_1886092_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	3.8e-95
WP_000611230.1|1886402_1886825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000220867.1|1886821_1888693_-	hypothetical protein	NA	A0A097BY72	Enterococcus_phage	21.7	5.3e-13
WP_001218984.1|1888702_1889866_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	88.9	2.9e-203
WP_085961182.1|1889967_1891180_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
>prophage 110
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1900546	1901224	4717123		Bacillus_virus(100.0%)	1	NA	NA
WP_000956884.1|1900546_1901224_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.2	2.2e-09
>prophage 111
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1905440	1909144	4717123	transposase	Enterobacteria_phage(50.0%)	4	NA	NA
WP_085961182.1|1905440_1906653_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_001239639.1|1907419_1907863_-	PTS mannitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_071792413.1|1907958_1908156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000646939.1|1908235_1909144_+	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	56.1	8.8e-54
>prophage 112
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1917413	1918568	4717123		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|1917413_1918568_+	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 113
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1941281	1942544	4717123		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001218873.1|1941281_1942544_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	38.3	1.2e-77
>prophage 114
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1949519	1956781	4717123	transposase	Enterobacteria_phage(33.33%)	8	NA	NA
WP_000684859.1|1949519_1950476_+	Fe3+ dicitrate ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|1950476_1951244_+	Fe(3+) dicitrate transport ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_001368752.1|1951801_1952215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000173339.1|1953374_1953545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085961182.1|1953610_1954823_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_096847361.1|1954789_1955038_+	DUF1436 domain-containing protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	7.1e-06
WP_072097708.1|1955464_1955602_-	PapI protein	NA	A0A0N7BTS3	Escherichia_phage	85.7	3.9e-06
WP_085961182.1|1955567_1956781_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
>prophage 115
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	1977112	1978285	4717123		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524942.1|1977112_1978285_+	aminotransferase class V-fold PLP-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	31.0	7.2e-40
>prophage 116
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2000498	2001383	4717123		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018237.1|2000498_2001383_+	NAD(P)-dependent oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 117
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2007459	2016809	4717123		Staphylococcus_phage(33.33%)	7	NA	NA
WP_000013149.1|2007459_2008287_+	2,5-diketo-D-gluconic acid reductase A	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
WP_000691599.1|2008486_2009413_+	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
WP_000848524.1|2009463_2009721_+	membrane protein	NA	NA	NA	NA	NA
WP_000095225.1|2009762_2011982_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059395.1|2012092_2013505_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965712.1|2013579_2014317_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_001281878.1|2014550_2016809_-	DNA topoisomerase 4 subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.1e-84
>prophage 118
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2020119	2020512	4717123		Stx_converting_phage(100.0%)	1	NA	NA
WP_000712658.1|2020119_2020512_-	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 119
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2024378	2035341	4717123		Bacillus_virus(20.0%)	13	NA	NA
WP_000195296.1|2024378_2026271_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
WP_000105733.1|2026299_2026881_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444747.1|2026880_2027708_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_000833388.1|2027732_2028155_-	DUF1249 domain-containing protein	NA	NA	NA	NA	NA
WP_000917117.1|2028155_2028785_-	ADP-ribose pyrophosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735277.1|2028989_2030471_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_001701108.1|2030470_2030731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000831543.1|2030618_2031290_+	DUF1190 domain-containing protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|2031295_2032456_+	ATP-Grasp family ATPase	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_001374603.1|2032493_2033282_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_001295627.1|2033424_2034198_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000469266.1|2034255_2034426_-	DUF4051 domain-containing protein	NA	NA	NA	NA	NA
WP_001076997.1|2034687_2035341_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 120
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2039628	2041062	4717123		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|2039628_2041062_-	bifunctional heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 121
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2046199	2047438	4717123		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708466.1|2046199_2047438_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	51.6	1.0e-92
>prophage 122
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2053840	2069989	4717123	tRNA	Moraxella_phage(16.67%)	16	NA	NA
WP_001264365.1|2053840_2054854_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
WP_001303669.1|2054862_2055093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001144069.1|2055091_2055307_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|2055417_2057163_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_001126645.1|2057176_2057299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000437371.1|2057357_2059199_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228947.1|2059277_2059784_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001066497.1|2060037_2060802_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_000018005.1|2061089_2061713_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000094701.1|2061819_2063340_-	PAS domain S-box protein	NA	A0A1B0V854	Salmonella_phage	52.2	1.8e-35
WP_071586365.1|2063615_2063822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297164.1|2063757_2065137_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.5e-33
WP_000450589.1|2065178_2065511_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_001384174.1|2065617_2065800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000212438.1|2065729_2066713_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_032315832.1|2066896_2069989_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.2	1.3e-157
>prophage 123
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2084559	2085525	4717123		Escherichia_phage(100.0%)	1	NA	NA
WP_001098805.1|2084559_2085525_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 124
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2106249	2108544	4717123		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861753.1|2106249_2108544_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	5.7e-158
>prophage 125
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2116633	2117779	4717123		Streptococcus_phage(100.0%)	1	NA	NA
WP_001400750.1|2116633_2117779_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.6	4.0e-51
>prophage 126
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2137580	2145377	4717123		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809263.1|2137580_2138444_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.6e-50
WP_022581511.1|2138508_2140545_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000246855.1|2140502_2140898_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158034.1|2140917_2141508_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646044.1|2141517_2142093_+	osmotically-inducible protein OsmY	NA	NA	NA	NA	NA
WP_000147627.1|2142206_2143247_-	permease	NA	NA	NA	NA	NA
WP_000084526.1|2143319_2143955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037608.1|2144082_2144601_+	glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000449041.1|2144580_2145024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000189314.1|2145074_2145377_+	GIY-YIG nuclease family protein	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
>prophage 127
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2151078	2152968	4717123		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001301504.1|2151078_2152968_-	DEAD/DEAH box family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 128
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2158449	2165088	4717123		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|2158449_2161122_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031057.1|2161146_2162634_-	transcription termination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|2162661_2163114_-	ribosome maturation factor	NA	NA	NA	NA	NA
WP_000207679.1|2163744_2165088_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 129
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2169169	2172042	4717123	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764747.1|2169169_2170018_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	4.4e-23
WP_001107467.1|2170107_2172042_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 130
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2178671	2180149	4717123		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|2178671_2179643_+	octaprenyl-diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445413.1|2179870_2180149_+	sugar fermentation stimulation protein B	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
>prophage 131
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2184217	2199011	4717123		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|2184217_2185027_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922872.1|2185236_2186214_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_001295557.1|2186227_2187214_+	arabinose 5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030005.1|2187234_2187801_+	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|2187797_2188373_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|2188341_2188899_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|2188905_2189631_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809065.1|2189678_2191112_+	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
WP_001176599.1|2191134_2191422_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_001400765.1|2191539_2192031_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|2192076_2192931_+	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|2192927_2193200_+	phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620410.1|2193412_2194045_+	protein YrbL	NA	NA	NA	NA	NA
WP_000047097.1|2194041_2194770_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001300411.1|2194766_2195420_-	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000809774.1|2195649_2197986_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_032315834.1|2198081_2199011_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	6.7e-17
>prophage 132
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2205760	2210508	4717123		Salmonella_phage(50.0%)	5	NA	NA
WP_000445120.1|2205760_2206888_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	87.2	4.0e-72
WP_000979870.1|2206947_2207412_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000208990.1|2207408_2208284_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_001301938.1|2208280_2208970_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108459.1|2209017_2210508_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 133
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2214202	2214700	4717123		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366126.1|2214202_2214700_-	stringent starvation protein B	NA	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
>prophage 134
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2218665	2221190	4717123	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001295271.1|2218665_2220033_+|protease	periplasmic pH-dependent serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|2220122_2221190_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 135
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2237667	2238711	4717123		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|2237667_2238711_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 136
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2250031	2258869	4717123	transposase	Ostreococcus_lucimarinus_virus(25.0%)	10	NA	NA
WP_001258919.1|2250031_2250916_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.5	4.9e-25
WP_001295275.1|2250999_2251179_+	DUF2556 domain-containing protein	NA	NA	NA	NA	NA
WP_001129518.1|2251181_2251844_-	acrEF/envCD operon repressor	NA	NA	NA	NA	NA
WP_106873543.1|2252020_2252254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000160334.1|2252242_2253400_+	MexX family efflux pump subunit	NA	NA	NA	NA	NA
WP_085961182.1|2253478_2254691_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_029594386.1|2254730_2255741_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.7	1.4e-71
WP_000019655.1|2255808_2256990_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_106873544.1|2256999_2258103_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078340.1|2258110_2258869_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	9.1e-20
>prophage 137
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2269205	2270677	4717123	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|2269205_2269715_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004448.1|2269729_2270677_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.1e-06
>prophage 138
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2290554	2296128	4717123		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_000031783.1|2290554_2291739_-	translation elongation factor EF-Tu 1	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|2291809_2293924_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|2294020_2294491_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|2294587_2294962_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903377.1|2295087_2295375_-	sulfurtransferase TusB	NA	NA	NA	NA	NA
WP_000820714.1|2295382_2295742_-	sulfurtransferase TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_001209679.1|2295741_2296128_-	sulfurtransferase TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	2.5e-18
>prophage 139
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2301669	2311210	4717123		Tupanvirus(25.0%)	10	NA	NA
WP_000634798.1|2301669_2303583_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
WP_000057365.1|2303582_2304605_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|2304598_2304817_+	hypothetical protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|2304870_2305740_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148912.1|2305794_2306199_-	OsmC family protein	NA	NA	NA	NA	NA
WP_032161887.1|2306278_2306494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000242755.1|2306500_2307133_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_000484358.1|2307171_2309274_+	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000963777.1|2309340_2310561_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_000601869.1|2310646_2311210_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	2.1e-61
>prophage 140
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2330231	2331068	4717123		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|2330231_2331068_-	DNA adenine methylase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 141
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2347971	2351738	4717123		Bacillus_phage(66.67%)	3	NA	NA
WP_001400414.1|2347971_2349594_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.3	5.8e-141
WP_001253696.1|2349669_2351022_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|2351018_2351738_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 142
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2358301	2359180	4717123	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000039092.1|2358301_2359180_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	52.8	1.1e-69
>prophage 143
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2365838	2368232	4717123		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081903.1|2365838_2368232_-	glycogen phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 144
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2373451	2374678	4717123		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105483.1|2373451_2374678_-	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	59.8	3.7e-132
>prophage 145
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2384062	2386510	4717123		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|2384062_2386510_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 146
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2406514	2408325	4717123		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073577.1|2406514_2407258_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	24.5	2.9e-10
WP_000907801.1|2407254_2408325_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 147
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2412697	2414180	4717123		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416895.1|2412697_2413411_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_000082096.1|2413412_2414180_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.7	3.7e-13
>prophage 148
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2420662	2423481	4717123		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|2420662_2421517_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|2421761_2422820_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000617723.1|2422812_2423481_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 149
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2426487	2431002	4717123		Dickeya_phage(50.0%)	5	NA	NA
WP_000964721.1|2426487_2427114_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_000106556.1|2427187_2429386_+	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	38.3	8.5e-119
WP_000385059.1|2429418_2429727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130621.1|2429871_2430117_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100467.1|2430336_2431002_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
>prophage 150
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2454250	2455057	4717123		Bacillus_virus(100.0%)	1	NA	NA
WP_000173674.1|2454250_2455057_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	28.7	1.3e-16
>prophage 151
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2461677	2465885	4717123		Burkholderia_phage(50.0%)	3	NA	NA
WP_001259387.1|2461677_2461953_-	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	48.8	1.9e-15
WP_001314210.1|2462025_2463150_-	inner membrane transport permease YhhJ	NA	NA	NA	NA	NA
WP_000149086.1|2463149_2465885_-	ABC transporter ATP-binding protein/permease	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 152
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2479296	2481339	4717123		Indivirus(100.0%)	1	NA	NA
WP_001400449.1|2479296_2481339_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	1.2e-45
>prophage 153
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2484713	2485139	4717123		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000065774.1|2484713_2485139_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.2e-50
>prophage 154
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2496728	2498198	4717123		Pithovirus(50.0%)	2	NA	NA
WP_001400452.1|2496728_2497499_+	hemin import ATP-binding protein HmuV	NA	W5SAS9	Pithovirus	29.6	8.6e-18
WP_001296814.1|2497550_2498198_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 155
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2542580	2544565	4717123		Bacillus_virus(50.0%)	2	NA	NA
WP_000107036.1|2542580_2543585_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.9	8.6e-18
WP_001196486.1|2543581_2544565_-	dipeptide transport ATP-binding protein DppD	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
>prophage 156
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2560194	2562528	4717123		Escherichia_phage(100.0%)	1	NA	NA
WP_000013940.1|2560194_2562528_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	2.7e-70
>prophage 157
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2566182	2566395	4717123		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|2566182_2566395_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 158
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2570620	2571616	4717123		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182639.1|2570620_2571616_+	O-acetyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.1	7.0e-12
>prophage 159
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2576934	2578476	4717123		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146501.1|2576934_2578476_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	1.1e-16
>prophage 160
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2596402	2601012	4717123	tRNA	Clostridioides_phage(50.0%)	3	NA	NA
WP_000985746.1|2596402_2597698_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	29.8	2.2e-21
WP_000741486.1|2597827_2598979_-	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_000582418.1|2599167_2601012_-|tRNA	selenocysteinyl-tRNA-specific translation elongation factor SelB	tRNA	A0A2K9KZ60	Tupanvirus	27.2	3.3e-15
>prophage 161
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2623537	2633043	4717123		Rhizobium_phage(16.67%)	9	NA	NA
WP_000024392.1|2623537_2623789_-	glutaredoxin	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|2623929_2624361_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_001308139.1|2624605_2626150_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214147.1|2626159_2627443_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483863.1|2627446_2628406_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982117.1|2628392_2629427_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000646014.1|2629665_2630691_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213830.1|2630700_2631897_-	2-amino-3-ketobutyrate CoA ligase	NA	V5LQ39	Emiliania_huxleyi_virus	29.7	3.8e-36
WP_000587750.1|2632110_2633043_+	ADP-L-glycero-D-mannoheptose-6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
>prophage 162
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2636459	2638564	4717123		Catovirus(50.0%)	2	NA	NA
WP_022581273.1|2636459_2637443_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	2.4e-12
WP_000364797.1|2637538_2638564_-	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.9	1.6e-11
>prophage 163
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2646002	2650565	4717123		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171873.1|2646002_2646482_+	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	6.3e-27
WP_001114545.1|2646520_2647330_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.8	1.0e-24
WP_001051798.1|2647427_2647595_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|2647615_2647852_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001297375.1|2648068_2648737_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000050121.1|2648908_2650129_+	bifunctional phosphopantothenoylcysteine decarboxylase CoaC/phosphopantothenate--cysteine ligase CoaB	NA	Q9HH70	Methanothermobacter_phage	33.9	2.9e-44
WP_001298007.1|2650109_2650565_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
>prophage 164
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2655664	2660685	4717123		Pseudomonas_phage(33.33%)	4	NA	NA
WP_000870058.1|2655664_2657347_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	21.7	4.3e-22
WP_001295237.1|2657604_2658228_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|2658282_2658558_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280491.1|2658576_2660685_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 165
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2665806	2667198	4717123		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|2665806_2667198_+	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 166
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2673340	2683731	4717123		Enterobacteria_phage(100.0%)	11	NA	NA
WP_001218986.1|2673340_2674516_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	93.0	1.3e-211
WP_000503665.1|2674520_2675429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000446137.1|2676908_2677481_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	3.8e-95
WP_000638631.1|2677554_2678055_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283035.1|2678051_2678786_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	99.2	2.7e-130
WP_001149160.1|2679336_2679603_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_025404478.1|2679599_2680199_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	89.1	3.0e-58
WP_001244665.1|2680191_2680479_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459319.1|2680471_2680927_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_000856729.1|2681062_2681383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025404479.1|2681397_2683731_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.7	0.0e+00
>prophage 167
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2707342	2708881	4717123		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000723942.1|2707342_2708881_+	type III secretion system LEE outer membrane ring protein EscC	NA	D0U184	Enterobacteria_phage	29.3	1.0e-09
>prophage 168
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2737536	2746558	4717123		Micromonas_sp._RCC1109_virus(25.0%)	14	NA	NA
WP_000168421.1|2737536_2739225_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.4	1.8e-55
WP_001300753.1|2739330_2739429_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000454302.1|2739415_2739706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001450379.1|2739702_2739861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303728.1|2739883_2739997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060506.1|2739993_2740083_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_077626237.1|2740140_2740323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022581773.1|2740362_2741547_+	multidrug transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000148051.1|2741554_2742052_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|2742048_2742411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000703959.1|2742400_2742748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000511299.1|2742856_2743306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000828465.1|2743352_2744846_-	sulfatase	NA	A0A2K9L1A5	Tupanvirus	25.6	6.6e-30
WP_032315845.1|2744842_2746558_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.4	3.3e-41
>prophage 169
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2753418	2754372	4717123		Synechococcus_phage(50.0%)	2	NA	NA
WP_001132431.1|2753418_2753847_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|2753958_2754372_-	heat-shock protein IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 170
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2759901	2767270	4717123		Bacillus_virus(33.33%)	8	NA	NA
WP_000072067.1|2759901_2762316_-	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060100.1|2762344_2763418_-	DNA replication and repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|2763417_2764518_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|2764522_2765926_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_001301651.1|2766219_2766420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000831330.1|2766532_2766673_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|2766689_2767049_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|2767012_2767270_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 171
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2777467	2778805	4717123		Moraxella_phage(100.0%)	1	NA	NA
WP_000082693.1|2777467_2778805_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 172
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2787798	2795406	4717123		Bacillus_phage(25.0%)	6	NA	NA
WP_000063125.1|2787798_2788572_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251991.1|2788754_2789645_-	phosphate ABC transporter permease PtsA	NA	NA	NA	NA	NA
WP_000741620.1|2789644_2790604_-	phosphate ABC transporter permease	NA	NA	NA	NA	NA
WP_000867142.1|2790690_2791731_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	1.6e-51
WP_000334096.1|2792044_2793874_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	3.3e-132
WP_032315846.1|2794035_2795406_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.3	5.3e-34
>prophage 173
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2807360	2808353	4717123		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845104.1|2807360_2808353_+	asparagine synthetase A	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 174
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2811521	2817374	4717123		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102319.1|2811521_2813390_+	low affinity potassium transport system protein kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_000715936.1|2813556_2813976_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387770.1|2813983_2815489_+	ribose import ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000211858.1|2815493_2816459_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|2816483_2817374_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 175
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2830764	2832411	4717123		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012635.1|2830764_2832411_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	32.2	2.3e-68
>prophage 176
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2840785	2846197	4717123		Bacillus_phage(33.33%)	5	NA	NA
WP_001238869.1|2840785_2842807_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
WP_001401007.1|2842853_2844338_-	guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase	NA	NA	NA	NA	NA
WP_071528314.1|2844343_2844466_-	addiction module toxin RelE	NA	NA	NA	NA	NA
WP_000047502.1|2844471_2845737_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|2845867_2846197_+	thiol reductase thioredoxin	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 177
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2850239	2856383	4717123		Enterobacteria_phage(40.0%)	6	NA	NA
WP_001401006.1|2850239_2851370_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.3	3.9e-27
WP_000006621.1|2851366_2852629_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_001226628.1|2852628_2853696_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	2.3e-101
WP_000676056.1|2853714_2854596_+	glucose-1-phosphate thymidylyltransferase 2	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001145183.1|2854573_2855248_+	dTDP-fucosamine acetyltransferase	NA	NA	NA	NA	NA
WP_000612044.1|2855252_2856383_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 178
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2864465	2866121	4717123		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000395865.1|2864465_2866121_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.0e-44
>prophage 179
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2874220	2882833	4717123		Salmonella_phage(50.0%)	8	NA	NA
WP_000678262.1|2874220_2875546_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	32.7	3.1e-07
WP_022581283.1|2875542_2877021_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	54.7	3.0e-43
WP_000799889.1|2877209_2877413_+	membrane protein	NA	NA	NA	NA	NA
WP_001160654.1|2877449_2878274_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_000812796.1|2878270_2878978_+	DUF484 domain-containing protein	NA	NA	NA	NA	NA
WP_000130686.1|2878974_2879871_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	1.1e-24
WP_001213584.1|2879870_2880587_+	flavin mononucleotide phosphatase YigB	NA	NA	NA	NA	NA
WP_000383407.1|2880670_2882833_+	DNA-dependent helicase	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 180
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2891199	2893029	4717123		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|2891199_2893029_+	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 181
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2901597	2902905	4717123	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_096848298.1|2901597_2901726_-	PapI protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	3.6e-06
WP_106873549.1|2901691_2902905_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	2.5e-168
>prophage 182
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2908887	2912174	4717123		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187543.1|2908887_2910528_+	ubiquinone biosynthesis protein UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	4.8e-42
WP_001295260.1|2910606_2910876_+	twin-arginine translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459599.1|2910879_2911395_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|2911397_2912174_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 183
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2920964	2921579	4717123		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|2920964_2921579_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 184
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2935268	2938055	4717123		uncultured_virus(100.0%)	1	NA	NA
WP_000250006.1|2935268_2938055_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 185
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2942130	2944601	4717123		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_024221533.1|2942130_2943540_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|2943551_2944601_-	two-component system sensor histidine kinase NtrB	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 186
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	2953779	3020348	4717123	capsid,holin,plate,head,lysis,terminase,portal,integrase,tRNA,tail	Escherichia_phage(33.33%)	77	2986777:2986823	3020459:3020505
WP_000560983.1|2953779_2954217_+|tRNA	D-aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_000080784.1|2954213_2955203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032161984.1|2957476_2957578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032149214.1|2957601_2957820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001452667.1|2958109_2958322_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001446299.1|2958562_2958781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101892102.1|2958774_2958963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027708.1|2959110_2960040_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829013.1|2960036_2960672_-	formate dehydrogenase cytochrome b556(fdo) subunit	NA	NA	NA	NA	NA
WP_000331377.1|2960668_2961571_-	formate dehydrogenase-O iron-sulfur subunit	NA	NA	NA	NA	NA
WP_077697102.1|2961583_2964634_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_071792348.1|2964637_2964892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000753595.1|2964827_2965661_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_001400645.1|2965813_2966869_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_000931324.1|2966918_2968667_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_001019458.1|2968666_2969737_-	peptidase	NA	NA	NA	NA	NA
WP_000446023.1|2969726_2971178_-	fructose-like PTS system EIIBC component	NA	NA	NA	NA	NA
WP_000729614.1|2971188_2971635_-	fructose-like phosphotransferase enzyme IIA component	NA	NA	NA	NA	NA
WP_000749945.1|2972112_2973507_+	glycoporin	NA	NA	NA	NA	NA
WP_000619508.1|2973547_2973862_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179715.1|2973871_2974696_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000211504.1|2975146_2976406_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144078.1|2976402_2977872_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217141.1|2978159_2978996_+	transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_001362440.1|2978979_2979918_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063507.1|2979914_2980949_-	rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001297064.1|2981233_2981854_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001311271.1|2982028_2982136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106873550.1|2982151_2983096_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270249.1|2983244_2983919_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580424.1|2984034_2985408_-	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	26.2	3.8e-16
WP_001033722.1|2985404_2986103_-	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|2986252_2986753_+	periplasmic protein CpxP	NA	NA	NA	NA	NA
2986777:2986823	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000023384.1|2986938_2987919_-|integrase	integrase	integrase	U5N0A8	Enterobacteria_phage	100.0	4.7e-186
WP_001192857.1|2987988_2988282_-	transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
WP_000453534.1|2988434_2988707_+	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_000217670.1|2988876_2989377_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|2989440_2989665_+	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277898.1|2989664_2989964_+	hypothetical protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_001113264.1|2989966_2990191_+	hypothetical protein	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027676.1|2990187_2990463_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	98.9	8.6e-45
WP_000268590.1|2990452_2992759_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.4	0.0e+00
WP_029594353.1|2992737_2993190_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.0	3.0e-79
WP_000554776.1|2993189_2993423_+	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	82.0	3.0e-22
WP_001540306.1|2993674_2994613_+	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	97.8	7.2e-184
WP_000688782.1|2994613_2995606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000140373.1|2995592_2996711_-	hypothetical protein	NA	Q858T2	Yersinia_virus	99.7	5.8e-172
WP_000038178.1|2997086_2998121_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	9.3e-201
WP_000156875.1|2998120_2999893_-|terminase	terminase ATPase subunit	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001085958.1|3000066_3000921_+|capsid	phage capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.8	3.4e-140
WP_001248561.1|3000979_3002053_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.7	1.5e-201
WP_000203465.1|3002056_3002800_+	hypothetical protein	NA	Q858W5	Yersinia_virus	97.2	1.9e-123
WP_000988633.1|3002899_3003409_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846409.1|3003408_3003612_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123124.1|3003615_3003897_+|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001144101.1|3003896_3004394_+	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736594.1|3004408_3004834_+	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	96.5	2.5e-59
WP_000040677.1|3004821_3005265_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.0	4.1e-65
WP_001440152.1|3005218_3005392_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000917157.1|3005354_3005822_+	Tail completion protein R	NA	U5N0S7	Enterobacteria_phage	97.4	3.3e-81
WP_001001792.1|3005814_3006267_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.7	9.1e-76
WP_000255497.1|3006338_3007124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093705.1|3007207_3007843_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.5	1.2e-113
WP_000127173.1|3007839_3008187_+|plate	baseplate assembly protein W	plate	A0A0F7L9X3	Escherichia_phage	99.1	8.5e-58
WP_001121506.1|3008191_3009100_+|plate	phage baseplate protein	plate	U5N3T9	Enterobacteria_phage	99.0	4.8e-161
WP_001285314.1|3009092_3009623_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	100.0	1.0e-102
WP_000104679.1|3009633_3011562_+	hypothetical protein	NA	U5N099	Enterobacteria_phage	71.2	6.6e-224
WP_000930007.1|3011530_3012094_+|tail	tail fiber assembly protein	tail	Q858V3	Yersinia_virus	93.6	1.9e-86
WP_000796111.1|3012345_3013413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001286678.1|3013746_3014937_+|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	2.6e-223
WP_001251408.1|3014949_3015468_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|3015524_3015800_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|3015832_3015952_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_032315802.1|3015944_3018392_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	95.1	0.0e+00
WP_000978881.1|3018406_3018886_+|tail	tail assembly protein	tail	O64315	Escherichia_phage	98.7	4.3e-84
WP_000887624.1|3018885_3020049_+	phage late control D family protein	NA	Q858U5	Yersinia_virus	98.7	2.0e-204
WP_000490743.1|3020048_3020348_+	hypothetical protein	NA	Q858U4	Yersinia_virus	98.0	5.4e-53
3020459:3020505	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
>prophage 187
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3031453	3032299	4717123		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000084268.1|3031453_3032299_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 188
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3036062	3037394	4717123		Erwinia_phage(100.0%)	1	NA	NA
WP_001293341.1|3036062_3037394_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 189
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3054568	3061815	4717123		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424838.1|3054568_3055231_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_001174106.1|3055242_3057744_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004446.1|3058052_3059132_+	fructose-like permease IIC component 2	NA	NA	NA	NA	NA
WP_000161256.1|3059146_3059467_+	PTS system fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000184872.1|3059517_3061815_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 190
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3077731	3083514	4717123	tRNA	Burkholderia_virus(50.0%)	5	NA	NA
WP_000125451.1|3077731_3079048_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	35.4	1.0e-58
WP_001300495.1|3079154_3079802_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000806411.1|3079801_3080161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000187008.1|3080200_3081301_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000591372.1|3081669_3083514_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 191
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3091855	3094908	4717123		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000023081.1|3091855_3092806_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_001296716.1|3092788_3092983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032162082.1|3092992_3093148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000031784.1|3093723_3094908_+	translation elongation factor EF-Tu 2	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 192
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3099025	3107354	4717123		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|3099025_3103054_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|3103130_3107354_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 193
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3116571	3118335	4717123		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|3116571_3117243_+	endonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000940106.1|3117285_3117876_+	DUF416 domain-containing protein	NA	NA	NA	NA	NA
WP_001044513.1|3118062_3118335_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 194
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3123697	3125287	4717123		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187553.1|3123697_3125287_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	2.2e-68
>prophage 195
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3141090	3144774	4717123		Dickeya_phage(100.0%)	1	NA	NA
WP_022581623.1|3141090_3144774_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 196
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3156652	3157444	4717123		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001130536.1|3156652_3157444_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	5.3e-47
>prophage 197
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3173535	3174651	4717123		Mycoplasma_phage(100.0%)	1	NA	NA
WP_001400514.1|3173535_3174651_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 198
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3183866	3184475	4717123		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|3183866_3184475_+	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 199
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3191066	3193614	4717123		Escherichia_phage(50.0%)	2	NA	NA
WP_000918363.1|3191066_3192482_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001147333.1|3192534_3193614_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	6.8e-29
>prophage 200
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3197836	3201450	4717123		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_000357740.1|3197836_3200659_-	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_001327774.1|3200609_3200792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000168305.1|3200913_3201450_+	ssDNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 201
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3205264	3206614	4717123		Moraxella_phage(100.0%)	1	NA	NA
WP_032084836.1|3205264_3206614_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.8	8.0e-160
>prophage 202
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3212198	3214157	4717123		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078209.1|3212198_3214157_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 203
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3223552	3225700	4717123		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|3223552_3225700_-	formate dehydrogenase N subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 204
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3230945	3232931	4717123		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001400507.1|3230945_3232931_-	alkyl/aryl-sulfatase	NA	A0A2P0VMX1	Tetraselmis_virus	44.3	4.2e-149
>prophage 205
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3238467	3239988	4717123		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001089398.1|3238467_3239988_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	2.2e-17
>prophage 206
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3245641	3247191	4717123		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_022581749.1|3245641_3246322_-	alpha-D-ribose 1-methylphosphonate 5-triphosphate synthase subunit PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	9.3e-08
WP_001075516.1|3246432_3247191_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.3	2.1e-16
>prophage 207
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3252795	3253584	4717123		Cedratvirus(100.0%)	1	NA	NA
WP_001193432.1|3252795_3253584_-	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	29.7	1.1e-12
>prophage 208
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3258421	3259924	4717123		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296659.1|3258421_3259924_+	proline/glycine betaine transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	1.4e-56
>prophage 209
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3271449	3272663	4717123	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
WP_085961182.1|3271449_3272663_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
>prophage 210
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3282433	3351927	4717123	tRNA,protease,transposase	Enterobacteria_phage(16.67%)	58	NA	NA
WP_001295074.1|3282433_3283951_-|tRNA	lysine--tRNA ligase heat inducible	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856822.1|3284187_3285645_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.4	1.5e-47
WP_085961182.1|3285789_3287002_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000092909.1|3289243_3290578_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_071525046.1|3290807_3291053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001187177.1|3290943_3292482_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000044747.1|3292768_3292987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032245855.1|3293147_3293348_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	92.9	8.8e-07
WP_085961182.1|3293313_3294527_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000609742.1|3295585_3296260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000953025.1|3296308_3297298_-	non-LEE encoded effector protein NleB	NA	Q8HAB2	Salmonella_phage	58.5	6.3e-98
WP_001121622.1|3297904_3299554_-	enterotoxin	NA	NA	NA	NA	NA
WP_000788140.1|3299634_3299829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001375513.1|3301216_3302836_+|transposase	ISL3-like element ISEc38 family transposase	transposase	NA	NA	NA	NA
WP_000704132.1|3302832_3304404_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.6	5.8e-295
WP_001218841.1|3304520_3305786_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_001188520.1|3306165_3306741_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000068918.1|3306777_3308475_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883400.1|3308450_3308789_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000961959.1|3308904_3310206_-	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000069437.1|3310323_3311760_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267445.1|3312096_3312573_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000015843.1|3312588_3313845_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001026276.1|3314120_3314414_+	molecular chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|3314457_3316104_+	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_000558209.1|3316241_3316595_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_001008058.1|3316787_3317657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000940510.1|3317891_3318920_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_000257278.1|3318961_3319528_+	elongation factor P	NA	NA	NA	NA	NA
WP_000977757.1|3319579_3319705_+	entericidin A	NA	NA	NA	NA	NA
WP_000239596.1|3319815_3319962_+	entericidin B	NA	NA	NA	NA	NA
WP_000118478.1|3320142_3320460_+	quaternary ammonium compound-resistance protein SugE	NA	NA	NA	NA	NA
WP_001238374.1|3320456_3320990_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	55.0	4.7e-47
WP_000609663.1|3322274_3322634_-	fumarate reductase subunit D	NA	NA	NA	NA	NA
WP_000208757.1|3322644_3323040_-	fumarate reductase subunit C	NA	NA	NA	NA	NA
WP_000829498.1|3323050_3323785_-	fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001192973.1|3323777_3325586_-	fumarate reductase flavoprotein subunit	NA	NA	NA	NA	NA
WP_000004771.1|3325910_3326888_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001300174.1|3327106_3328609_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_001236835.1|3328759_3332083_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_000934920.1|3332104_3333073_-	phosphatidylserine decarboxylase proenzyme	NA	NA	NA	NA	NA
WP_000041957.1|3333169_3334222_-	ribosome small subunit-dependent GTPase	NA	NA	NA	NA	NA
WP_001376672.1|3334316_3334862_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	3.8e-28
WP_010723271.1|3335725_3335779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294212.1|3335761_3336901_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_001401261.1|3336899_3338447_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|3338418_3338880_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_000990299.1|3338898_3340233_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122481.1|3340242_3342090_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_001280339.1|3342082_3343033_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|3343118_3343427_+	RNA-binding protein Hfq	NA	NA	NA	NA	NA
WP_000460360.1|3343503_3344784_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|3344869_3346129_+|protease	protease modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|3346131_3347136_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|3347217_3347415_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|3347518_3348817_+	adenylosuccinate synthetase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|3349021_3349447_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000076316.1|3349485_3351927_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
>prophage 211
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3355859	3357023	4717123		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943951.1|3355859_3357023_+	hypothetical protein	NA	B2ZXR7	Ralstonia_phage	43.5	3.7e-81
>prophage 212
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3371311	3372520	4717123	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_071826454.1|3371311_3372520_+|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	93.5	4.9e-209
>prophage 213
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3393662	3400150	4717123		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_000055075.1|3393662_3394193_-	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265940.1|3394502_3395459_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000205816.1|3395598_3397101_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_077630024.1|3397111_3398137_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596005.1|3398123_3399119_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|3399151_3400150_-	fructose 1,6-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 214
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3404612	3407645	4717123		uncultured_Caudovirales_phage(33.33%)	3	NA	NA
WP_000212717.1|3404612_3404852_+	type II toxin-antitoxin system antitoxin, RelB/DinJ family	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	49.4	4.0e-14
WP_001106233.1|3404852_3405317_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	K4F9T1	Cronobacter_phage	57.7	3.8e-53
WP_000187778.1|3405506_3407645_-	anaerobic ribonucleoside triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
>prophage 215
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3411283	3417380	4717123		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_001181324.1|3411283_3412231_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|3412415_3412469_+	MgtA leader peptide	NA	NA	NA	NA	NA
WP_000471893.1|3412609_3415306_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|3415511_3415898_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
WP_000148581.1|3415970_3416432_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|3416444_3417380_-	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 216
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3425720	3430884	4717123	tRNA	Klosneuvirus(50.0%)	3	NA	NA
WP_000416399.1|3425720_3428576_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.0e-140
WP_000786399.1|3428575_3429019_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|3429372_3430884_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
>prophage 217
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3435124	3436144	4717123		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_001400715.1|3435124_3436144_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	30.7	4.9e-45
>prophage 218
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3448228	3457625	4717123		uncultured_Mediterranean_phage(100.0%)	2	NA	NA
WP_106873552.1|3448228_3454543_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	21.6	7.5e-35
WP_072095798.1|3454793_3457625_+	ATP-dependent helicase	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	25.2	1.4e-41
>prophage 219
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3462535	3473462	4717123		uncultured_Mediterranean_phage(33.33%)	3	NA	NA
WP_000937964.1|3462535_3468877_+	DUF1998 domain-containing protein	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.1	6.4e-58
WP_000218181.1|3468873_3470988_+	ATP-dependent helicase	NA	G3MA40	Bacillus_virus	24.1	5.9e-08
WP_000991452.1|3472481_3473462_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	56.2	3.6e-101
>prophage 220
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3476821	3478498	4717123		Escherichia_phage(100.0%)	2	NA	NA
WP_000790583.1|3476821_3477424_+	type 1 fimbriae regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_000044711.1|3477901_3478498_+	type 1 fimbriae regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 221
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3488696	3490157	4717123		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208195.1|3488696_3490157_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
>prophage 222
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3496725	3497277	4717123		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151867.1|3496725_3497277_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	44.4	1.3e-36
>prophage 223
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3533964	3535629	4717123		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000919565.1|3533964_3535629_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 224
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3546239	3547519	4717123		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|3546239_3546977_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098821.1|3546979_3547519_-	primosomal protein 1	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 225
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3555449	3558325	4717123		Streptococcus_phage(50.0%)	3	NA	NA
WP_106873554.1|3555449_3557039_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	1.8e-30
WP_001295748.1|3557431_3558037_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_001304521.1|3558145_3558325_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	2.0e-10
>prophage 226
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3564263	3565586	4717123		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|3564263_3565586_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 227
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3572306	3573539	4717123		Enterococcus_phage(100.0%)	1	NA	NA
WP_000093814.1|3572306_3573539_+	trifunctional nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase/transcriptional regulator NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	3.6e-82
>prophage 228
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3577818	3581634	4717123		Klosneuvirus(50.0%)	3	NA	NA
WP_000046749.1|3577818_3579486_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_001297284.1|3579459_3579588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000409478.1|3579696_3581634_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 229
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3584917	3587031	4717123		Bacillus_phage(50.0%)	2	NA	NA
WP_001188659.1|3584917_3585607_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_001219595.1|3585606_3587031_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	3.6e-09
>prophage 230
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3598799	3607866	4717123		Cyanophage(20.0%)	9	NA	NA
WP_000130185.1|3598799_3599753_+	transaldolase 1	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
WP_001400455.1|3599867_3600455_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|3600487_3601054_-	succinate-acetate/proton symporter SatP	NA	NA	NA	NA	NA
WP_001102364.1|3601202_3601916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032315851.1|3601941_3602346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000516135.1|3602722_3604639_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|3604727_3605858_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000935262.1|3605961_3606171_-	regulatory protein MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_000681368.1|3606699_3607866_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.8	9.2e-88
>prophage 231
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3617351	3620168	4717123	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286887.1|3617351_3620168_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.1e-77
>prophage 232
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3624575	3625724	4717123		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|3624575_3625724_+	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 233
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3631194	3636855	4717123		Hepacivirus(50.0%)	4	NA	NA
WP_001297614.1|3631194_3632748_-	ATP-dependent acyl-CoA ligase	NA	Q75ZG1	Hepacivirus	25.4	4.7e-31
WP_000349922.1|3632821_3634039_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347111.1|3634167_3635310_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787091.1|3635340_3636855_-	L-carnitine/gamma-butyrobetaine antiporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	2.7e-07
>prophage 234
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3644751	3646712	4717123		Bacillus_phage(50.0%)	4	NA	NA
WP_024221573.1|3644751_3645231_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	45.7	1.5e-28
WP_000125566.1|3645316_3645550_+	antitoxin	NA	NA	NA	NA	NA
WP_001160974.1|3645552_3645867_+	plasmid maintenance protein CcdB	NA	NA	NA	NA	NA
WP_000257203.1|3645863_3646712_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.4e-08
>prophage 235
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3655757	3661179	4717123		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117012.1|3655757_3658664_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_000035601.1|3658827_3661179_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.8e-37
>prophage 236
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3667511	3668210	4717123		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916324.1|3667511_3668210_-	thiamine import ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.8e-23
>prophage 237
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3680700	3682425	4717123		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425669.1|3680700_3682425_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	2.4e-36
>prophage 238
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3708514	3709558	4717123		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|3708514_3709558_+	guanosine monophosphate reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 239
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3713803	3714355	4717123		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923722.1|3713803_3714355_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.1e-11
>prophage 240
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3722982	3724407	4717123		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_032315853.1|3722982_3724407_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.5	2.7e-41
>prophage 241
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3732152	3738775	4717123		Mamastrovirus(33.33%)	5	NA	NA
WP_001189606.1|3732152_3733703_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
WP_001400465.1|3733904_3736295_-	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|3736500_3737037_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|3737077_3737740_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_000150637.1|3737848_3738775_+	ABC transporter ATPase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 242
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3742037	3742910	4717123	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000339956.1|3742037_3742910_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	49.2	1.2e-60
>prophage 243
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3752868	3759674	4717123	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174653.1|3752868_3754287_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.4	7.1e-26
WP_000937416.1|3754325_3755252_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|3755288_3755744_-	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
WP_000396030.1|3755921_3756626_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294681.1|3756640_3757171_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001400470.1|3757244_3759674_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.1	5.1e-40
>prophage 244
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3764911	3765709	4717123		Planktothrix_phage(100.0%)	1	NA	NA
WP_001400473.1|3764911_3765709_+	iron(3+)-hydroxamate import ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	4.6e-14
>prophage 245
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3771620	3771965	4717123		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|3771620_3771965_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 246
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3775894	3777319	4717123	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|3775894_3777319_+|protease	periplasmic serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 247
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3789793	3790552	4717123		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|3789793_3790552_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 248
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3799380	3803496	4717123		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_000569400.1|3799380_3799977_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.8	2.3e-26
WP_001294774.1|3800013_3803496_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
>prophage 249
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3816499	3817531	4717123		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|3816499_3817531_-	methionine import ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 250
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3824191	3831823	4717123		Indivirus(25.0%)	9	NA	NA
WP_000997053.1|3824191_3824995_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	5.4e-39
WP_000648583.1|3824991_3825906_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|3826146_3826947_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000016010.1|3826950_3827574_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|3827621_3828980_-	lytic transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052748.1|3829051_3829807_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001295200.1|3829840_3830563_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|3830559_3831027_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001366128.1|3831091_3831823_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
>prophage 251
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3838297	3841622	4717123		Caulobacter_phage(50.0%)	4	NA	NA
WP_000284050.1|3838297_3838876_+	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333379.1|3839081_3839849_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225690.1|3839819_3840560_-	transpeptidase	NA	NA	NA	NA	NA
WP_000280524.1|3840872_3841622_+	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	2.0e-19
>prophage 252
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3846772	3849360	4717123	transposase	Bacillus_phage(50.0%)	3	NA	NA
WP_000521553.1|3846772_3847339_+	RNA ligase RtcB family protein	NA	A0A0A0RRX9	Bacillus_phage	31.1	2.7e-08
WP_001358663.1|3847317_3848514_-|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_106873556.1|3848718_3849360_+	RNA ligase RtcB family protein	NA	K4K356	Caulobacter_virus	31.6	4.1e-13
>prophage 253
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3854037	3857749	4717123		Streptococcus_phage(66.67%)	3	NA	NA
WP_000749857.1|3854037_3855093_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.3	2.9e-117
WP_001285293.1|3855380_3856484_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893246.1|3856495_3857749_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	9.8e-96
>prophage 254
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3865553	3867752	4717123		Acinetobacter_phage(100.0%)	1	NA	NA
WP_032315918.1|3865553_3867752_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.4	2.8e-37
>prophage 255
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3886061	3886913	4717123		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001174461.1|3886061_3886913_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.2e-47
>prophage 256
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3892952	3896272	4717123		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000398811.1|3892952_3893837_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.4	4.7e-52
WP_001306921.1|3893996_3894590_-	membrane protein	NA	NA	NA	NA	NA
WP_001400526.1|3894601_3894838_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046283.1|3894946_3896272_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.4	1.2e-112
>prophage 257
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3903549	3919249	4717123	holin,transposase	Escherichia_phage(40.0%)	10	NA	NA
WP_085961182.1|3903549_3904763_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_001213049.1|3905108_3905870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001362383.1|3906023_3906818_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000338365.1|3907147_3907669_-	DNA recombinase	NA	A0A2L1IV36	Escherichia_phage	52.9	2.2e-49
WP_001159144.1|3908773_3910444_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	1.0e-60
WP_000089079.1|3910457_3911930_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001301903.1|3911943_3912531_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_071524590.1|3912447_3912663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000131059.1|3912659_3914693_+|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	1.7e-20
WP_072095750.1|3915265_3919249_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	38.0	5.5e-124
>prophage 258
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3929935	3930985	4717123		Tupanvirus(100.0%)	1	NA	NA
WP_000692736.1|3929935_3930985_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.2	1.7e-72
>prophage 259
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3939362	3945049	4717123		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000010277.1|3939362_3941249_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.2	5.3e-53
WP_000076222.1|3941484_3942744_+	cytosine permease	NA	NA	NA	NA	NA
WP_001299008.1|3942733_3944017_+	cytosine deaminase	NA	NA	NA	NA	NA
WP_022581475.1|3944149_3945049_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.0	9.4e-16
>prophage 260
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3949590	3953870	4717123		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_000177945.1|3949590_3952665_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.3	0.0e+00
WP_000805909.1|3952787_3953870_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	99.2	9.1e-191
>prophage 261
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3961104	3963065	4717123		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000044326.1|3961104_3962055_+	acetaldehyde dehydrogenase (acetylating)	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	1.1e-35
WP_001013503.1|3962051_3963065_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	4.1e-44
>prophage 262
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3966444	3969070	4717123		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_000842100.1|3966444_3967554_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
WP_001141271.1|3967588_3967864_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000078832.1|3968023_3969070_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.7	3.6e-35
>prophage 263
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3977093	3977861	4717123		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939375.1|3977093_3977861_+	taurine import ATP-binding protein TauB	NA	G9BWD6	Planktothrix_phage	40.3	8.6e-26
>prophage 264
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3984738	3985896	4717123		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830755.1|3984738_3985896_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 265
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	3993311	3994427	4717123		Bacillus_phage(100.0%)	1	NA	NA
WP_000484048.1|3993311_3994427_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 266
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4001022	4010994	4717123		Bacillus_phage(60.0%)	7	NA	NA
WP_001298537.1|4001022_4001934_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001219315.1|4002058_4002967_+	fructokinase	NA	NA	NA	NA	NA
WP_032161981.1|4003109_4004294_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_000698861.1|4004419_4007563_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	7.6e-12
WP_001221321.1|4007559_4008762_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000113933.1|4008951_4009641_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893603.1|4009698_4010994_+	PAS domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
>prophage 267
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4019620	4028601	4717123	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|4019620_4020748_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|4020770_4021103_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|4021130_4022978_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|4022988_4023960_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|4024088_4024436_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_001295328.1|4024612_4025497_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001400901.1|4025795_4026335_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|4026485_4026935_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150436.1|4026938_4028042_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	4.8e-54
WP_001021161.1|4028130_4028601_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 268
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4051949	4056996	4717123	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|4051949_4052573_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|4052698_4053973_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|4054160_4056515_+|protease	Lon protease	protease	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|4056723_4056996_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 269
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4060136	4060832	4717123		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817227.1|4060136_4060832_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 270
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4064155	4067702	4717123		Bacillus_phage(100.0%)	2	NA	NA
WP_001235605.1|4064155_4065928_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	7.5e-49
WP_001256201.1|4065920_4067702_+	multidrug resistance-like ATP-binding protein MdlB	NA	W8CYL7	Bacillus_phage	27.1	2.3e-42
>prophage 271
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4076537	4079687	4717123		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|4076537_4079687_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 272
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4086695	4095153	4717123		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|4086695_4087247_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122013.1|4087375_4089307_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|4089359_4089689_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|4089688_4090294_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678201.1|4090403_4092278_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001220233.1|4092458_4093103_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250105.1|4093234_4094197_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801812.1|4094193_4095153_-	acetylesterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.7	2.9e-15
>prophage 273
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4103950	4106455	4717123		uncultured_virus(100.0%)	1	NA	NA
WP_000083986.1|4103950_4106455_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.2	2.2e-115
>prophage 274
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4131520	4133683	4717123		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000739056.1|4131520_4133683_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	31.1	4.1e-17
>prophage 275
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4137297	4141634	4717123		Salmonella_phage(50.0%)	5	NA	NA
WP_000843739.1|4137297_4138608_-	hypothetical protein	NA	S4TRP0	Salmonella_phage	38.6	1.4e-07
WP_001001646.1|4138973_4139336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000970331.1|4139438_4139897_-	NfeD family protein	NA	NA	NA	NA	NA
WP_000904502.1|4139893_4140811_-	paraslipin	NA	NA	NA	NA	NA
WP_001157540.1|4140956_4141634_+	iron export ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	1.4e-27
>prophage 276
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4144770	4145457	4717123		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110573.1|4144770_4145457_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 277
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4148579	4214286	4717123	capsid,head,lysis,terminase,transposase,integrase,portal,protease,tRNA,tail	Enterobacteria_phage(55.88%)	65	4183058:4183104	4214709:4214755
WP_001158010.1|4148579_4149674_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|4149742_4150669_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776388.1|4150897_4151380_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|4151457_4152273_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001400908.1|4152362_4154144_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	26.8	5.1e-37
WP_000943556.1|4154156_4154933_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765827.1|4155032_4155911_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401139.1|4156079_4157534_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006964.1|4157593_4158955_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|4159011_4160313_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_000706340.1|4160334_4161489_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.5	6.0e-47
WP_000540946.1|4161617_4162403_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001400909.1|4162413_4163649_-	allantoate amidohydrolase	NA	NA	NA	NA	NA
WP_022581656.1|4163670_4164717_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580825.1|4165034_4166702_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_022581657.1|4166711_4167971_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|4167981_4168797_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855366.1|4168793_4169687_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815564.1|4169823_4170891_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|4170887_4171397_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212266.1|4171514_4172237_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000256002.1|4172239_4172734_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000912345.1|4172907_4174293_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143551.1|4174328_4174850_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|4174957_4175170_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_000729161.1|4175171_4176038_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_001400910.1|4176507_4177050_+	type-1 fimbrial protein subunit A	NA	NA	NA	NA	NA
WP_000988364.1|4177269_4177962_+	fimbrial chaperone SfmC	NA	NA	NA	NA	NA
WP_047083047.1|4177992_4180602_+	outer membrane usher protein	NA	NA	NA	NA	NA
WP_000691070.1|4180614_4181622_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255119.1|4181632_4182148_+	fimbriae assembly protein	NA	NA	NA	NA	NA
WP_000805422.1|4182150_4182783_-	DNA-binding response regulator	NA	NA	NA	NA	NA
4183058:4183104	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_071792383.1|4183117_4183642_-|integrase	phage integrase family protein	integrase	A0A088CD23	Shigella_phage	85.6	2.0e-87
WP_106873549.1|4183687_4184901_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	2.5e-168
WP_001135277.1|4185063_4185561_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001082739.1|4185557_4186019_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	99.3	2.4e-76
WP_000738421.1|4186050_4186344_-	hypothetical protein	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001307652.1|4186703_4186898_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453587.1|4187287_4187833_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027269.1|4187807_4189733_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|4189729_4189936_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001358553.1|4189932_4191534_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	2.9e-310
WP_000123248.1|4191514_4192834_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	1.8e-233
WP_001358225.1|4192843_4193176_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_000063244.1|4193231_4194257_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
WP_000158866.1|4194298_4194694_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	96.2	5.2e-59
WP_000785282.1|4194705_4195059_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000975081.1|4195070_4195649_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683105.1|4195645_4196041_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001342267.1|4196048_4196789_+|tail	tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000479169.1|4196804_4197227_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459457.1|4197208_4197643_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840246.1|4197635_4200215_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	97.6	0.0e+00
WP_000847347.1|4200211_4200541_+|tail	tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_001152619.1|4200540_4201239_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_000194780.1|4201244_4201988_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_001311619.1|4201885_4202557_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.6	3.1e-104
WP_025404253.1|4202617_4206115_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.2	0.0e+00
WP_001233090.1|4206185_4206785_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_025404254.1|4206849_4209810_+	membrane protein	NA	A0A2D1UII2	Escherichia_phage	98.3	3.0e-58
WP_000885574.1|4209809_4210394_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	1.2e-101
WP_001309429.1|4210366_4210504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041983107.1|4210448_4211075_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937502.1|4211173_4211479_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001201825.1|4213332_4214286_-|protease	outer membrane protease	protease	NA	NA	NA	NA
4214709:4214755	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 278
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4221979	4224095	4717123		Hokovirus(50.0%)	2	NA	NA
WP_000247580.1|4221979_4223422_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.2	1.7e-11
WP_000770953.1|4223411_4224095_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 279
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4227240	4230384	4717123		Leptospira_phage(100.0%)	1	NA	NA
WP_000573999.1|4227240_4230384_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.5	7.5e-60
>prophage 280
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4241824	4247867	4717123		Tupanvirus(50.0%)	3	NA	NA
WP_000077788.1|4241824_4245706_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.5	9.9e-62
WP_000096706.1|4245921_4247055_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140645.1|4247051_4247867_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 281
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4262891	4264714	4717123		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502952.1|4262891_4263521_-	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
WP_000029813.1|4263493_4264714_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	3.6e-58
>prophage 282
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4267823	4269938	4717123		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|4267823_4269389_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_000278505.1|4269509_4269938_-	universal stress protein G	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
>prophage 283
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4285371	4286018	4717123		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|4285371_4285581_+	cold-shock protein CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939738.1|4285634_4286018_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 284
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4290833	4293273	4717123		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|4290833_4292045_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231428.1|4292184_4293273_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 285
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4300283	4302866	4717123	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001297565.1|4300283_4302866_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 286
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4309807	4313340	4717123		Bathycoccus_sp._RCC1105_virus(50.0%)	3	NA	NA
WP_000367867.1|4309807_4311478_-	molecular chaperone HscC	NA	E5EQT9	Bathycoccus_sp._RCC1105_virus	35.7	4.0e-76
WP_001207491.1|4311561_4312497_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|4312614_4313340_-	glutamate/aspartate transport ATP-binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 287
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4319222	4320302	4717123		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|4319222_4320302_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 288
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4324396	4326061	4717123		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337081.1|4324396_4326061_-	asparagine synthetase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	7.9e-85
>prophage 289
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4330687	4334501	4717123	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001023125.1|4330687_4332634_+	PTS N-acetylglucosamine EIICBA component	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
WP_001287134.1|4332836_4334501_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.7	0.0e+00
>prophage 290
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4338784	4354047	4717123		Hokovirus(33.33%)	13	NA	NA
WP_000773284.1|4338784_4339549_-	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	2.9e-05
WP_022581284.1|4339733_4340279_+	replication initiation negative regulator SeqA	NA	NA	NA	NA	NA
WP_001401280.1|4340304_4341945_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_000186067.1|4342107_4342785_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	30.6	2.6e-26
WP_106873558.1|4342781_4345466_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
WP_001401278.1|4345458_4346031_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000087943.1|4346039_4348088_-	K(+)-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.1	8.4e-28
WP_000730090.1|4348110_4349784_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001365534.1|4349783_4349873_-	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424924.1|4350184_4350391_+	DUF2517 domain-containing protein	NA	NA	NA	NA	NA
WP_001076009.1|4350491_4351001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000207122.1|4350997_4352416_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.0	8.9e-61
WP_001032697.1|4352565_4354047_-	dipeptide permease D	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
>prophage 291
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4357425	4358217	4717123		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114033.1|4357425_4358217_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	27.2	1.9e-07
>prophage 292
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4402224	4405744	4717123		Vibrio_phage(33.33%)	4	NA	NA
WP_000345408.1|4402224_4402944_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	5.4e-22
WP_000951292.1|4402940_4403882_-	zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000784351.1|4403995_4404376_-	periplasmic protein	NA	NA	NA	NA	NA
WP_001109208.1|4404691_4405744_+	phospho-2-dehydro-3-deoxyheptonate aldolase Phe-sensitive	NA	A0A2I6UFP9	Klebsiella_phage	49.1	7.5e-81
>prophage 293
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4410098	4416673	4717123		Tupanvirus(33.33%)	8	NA	NA
WP_001265447.1|4410098_4411115_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
WP_000950174.1|4411376_4412849_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	4.2e-13
WP_001147439.1|4412916_4413705_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|4413833_4413983_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001303847.1|4413918_4414128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000101988.1|4414149_4414923_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604043.1|4414922_4415612_+	molybdenum ABC transporter permease	NA	NA	NA	NA	NA
WP_000891660.1|4415614_4416673_+	molybdenum import ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	4.4e-20
>prophage 294
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4421106	4449192	4717123	capsid,holin,head,lysis,terminase,transposase,portal,tail	Enterobacteria_phage(48.28%)	37	NA	NA
WP_106873559.1|4421106_4421376_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	98.9	3.0e-42
WP_077627910.1|4421431_4421890_+	recombination protein NinB	NA	Q8H9Z8	Enterobacteria_phage	100.0	4.3e-81
WP_000153262.1|4421886_4422414_+	phage N-6-adenine-methyltransferase	NA	Q8H9Z7	Enterobacteria_phage	99.4	3.6e-100
WP_001254222.1|4422410_4422593_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	100.0	1.9e-29
WP_000566868.1|4422589_4422760_+	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	98.2	1.2e-25
WP_001108038.1|4422752_4423364_+	recombination protein NinG	NA	Q716C3	Shigella_phage	99.5	6.0e-99
WP_001028841.1|4423360_4424026_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	96.4	4.4e-127
WP_000750155.1|4424237_4425197_-	DUF2219 domain-containing protein	NA	NA	NA	NA	NA
WP_032160865.1|4425534_4425657_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|4425671_4426361_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001299184.1|4426572_4427289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|4427374_4427533_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_025404260.1|4427831_4428482_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	92.1	3.1e-109
WP_001358663.1|4428460_4429657_-|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_100706965.1|4430979_4431132_+	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	98.0	5.8e-19
WP_085947772.1|4431304_4432518_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_000075198.1|4432671_4432833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024164617.1|4432831_4433047_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_085961182.1|4433491_4434705_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000092318.1|4434853_4435291_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000881338.1|4435440_4436058_+	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.4	1.2e-91
WP_032158834.1|4436025_4436166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001307652.1|4436245_4436440_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000235436.1|4436834_4437344_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_012816790.1|4437315_4439244_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	5.5e-263
WP_000259002.1|4439227_4439434_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_025404261.1|4439430_4441023_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	1.9e-184
WP_024239710.1|4441012_4442518_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256846.1|4442554_4442902_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	9.9e-22
WP_000522623.1|4442959_4443988_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000201512.1|4444039_4444423_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_025380275.1|4444415_4444865_+	host specificity protein J	NA	Q9LA64	Enterobacterial_phage	98.1	2.3e-55
WP_025404262.1|4444932_4445505_+	hypothetical protein	NA	A0A0P0ZCF6	Stx2-converting_phage	93.5	2.3e-100
WP_106873560.1|4445569_4446883_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
WP_001023459.1|4446884_4447154_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_000950982.1|4447259_4448141_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_000652081.1|4448364_4449192_+	hypothetical protein	NA	A5LH49	Enterobacteria_phage	98.2	3.1e-154
>prophage 295
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4453295	4454585	4717123		Klosneuvirus(100.0%)	1	NA	NA
WP_001400531.1|4453295_4454585_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.7e-18
>prophage 296
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4461066	4461975	4717123		Streptococcus_phage(100.0%)	1	NA	NA
WP_001400532.1|4461066_4461975_-	hypothetical protein	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 297
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4472571	4489597	4717123		Anomala_cuprea_entomopoxvirus(16.67%)	13	NA	NA
WP_000996092.1|4472571_4474308_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000976400.1|4474300_4475299_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|4475298_4475970_-	DUF1956 domain-containing tetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000007108.1|4476198_4477563_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_032315864.1|4478170_4480183_+	type III effector	NA	NA	NA	NA	NA
WP_001218666.1|4480465_4482616_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	1.1e-41
WP_032315865.1|4482643_4483606_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443490.1|4483746_4484832_+	lactate dehydrogenase	NA	NA	NA	NA	NA
WP_000849301.1|4485060_4485321_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146364.1|4485586_4485853_-	DksA/TraR family C4-type zinc finger protein	NA	E5G6L7	Salmonella_phage	45.6	2.4e-07
WP_000990177.1|4485926_4486604_-	PKHD-type hydroxylase	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_022581175.1|4486645_4488928_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000558091.1|4489192_4489597_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	2.6e-05
>prophage 298
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4492993	4498217	4717123		Planktothrix_phage(33.33%)	6	NA	NA
WP_000569080.1|4492993_4493716_-	glutamine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159065.1|4493712_4494372_-	glutamine ABC transporter permease	NA	NA	NA	NA	NA
WP_000843866.1|4494509_4495256_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000100800.1|4495659_4496163_-	DNA starvation/stationary phase protection protein	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001295297.1|4496461_4497349_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_001295296.1|4497701_4498217_+	outer membrane protein X	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 299
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4503389	4511731	4717123		Tupanvirus(33.33%)	6	NA	NA
WP_000961444.1|4503389_4504982_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	1.2e-61
WP_000168801.1|4505222_4506488_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114270.1|4506639_4507455_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_000209338.1|4507600_4510033_-	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	44.9	1.6e-09
WP_000576965.1|4510038_4510938_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001400535.1|4511068_4511731_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.2	4.8e-25
>prophage 300
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4514946	4516818	4717123		Planktothrix_phage(100.0%)	1	NA	NA
WP_032315866.1|4514946_4516818_+	glutathione import ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
>prophage 301
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4528154	4529357	4717123		Stx2-converting_phage(100.0%)	1	NA	NA
WP_024221665.1|4528154_4529357_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.8	2.4e-99
>prophage 302
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4538691	4547861	4717123		Vibrio_phage(25.0%)	11	NA	NA
WP_001195231.1|4538691_4538949_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_001201576.1|4539108_4539396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000189169.1|4539379_4540102_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_000684324.1|4540162_4541065_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|4541152_4541629_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_001303977.1|4541834_4541996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126069.1|4541979_4543092_+	putrescine-binding periplasmic protein	NA	NA	NA	NA	NA
WP_000996006.1|4543186_4544320_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_001061658.1|4545299_4546145_+	spermidine/putrescine ABC transporter permease	NA	NA	NA	NA	NA
WP_000389260.1|4546204_4546693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001149701.1|4546733_4547861_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
>prophage 303
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4554672	4555401	4717123		Planktothrix_phage(100.0%)	1	NA	NA
WP_000027205.1|4554672_4555401_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 304
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4559090	4559921	4717123		Roseobacter_phage(100.0%)	1	NA	NA
WP_001255148.1|4559090_4559921_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	9.6e-07
>prophage 305
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4563508	4565227	4717123		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815359.1|4563508_4565227_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	3.1e-31
>prophage 306
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4574487	4607367	4717123	tRNA,protease,capsid,terminase	uncultured_Caudovirales_phage(11.11%)	31	NA	NA
WP_000188188.1|4574487_4576434_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	8.5e-38
WP_000410785.1|4576506_4576731_-	cold-shock protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_096848389.1|4577135_4578359_+	DUF4102 domain-containing protein	NA	A0A2H4JB45	uncultured_Caudovirales_phage	53.4	9.5e-128
WP_045893402.1|4578355_4579129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044860659.1|4579220_4579445_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	62.7	2.1e-17
WP_072097685.1|4579454_4580153_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_045153888.1|4580145_4580328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050867054.1|4580331_4580523_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	51.8	7.6e-08
WP_050867053.1|4580512_4580755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770140.1|4580760_4581060_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_050867052.1|4581056_4582811_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.6	1.2e-91
WP_000557482.1|4583097_4583349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000391152.1|4583479_4583674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018605.1|4583677_4583839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001229490.1|4583968_4584457_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	42.3	2.1e-25
WP_000562893.1|4584619_4585543_+|capsid	phage major capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.3	5.9e-13
WP_000520781.1|4585916_4586237_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934038.1|4586267_4588544_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001414119.1|4588600_4588807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001040187.1|4589409_4589628_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241688.1|4589912_4590617_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202214.1|4590658_4592380_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	5.8e-22
WP_001043577.1|4592380_4594147_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_000537431.1|4594269_4595235_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.4e-62
WP_000228473.1|4595778_4596273_+	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
WP_022581185.1|4596407_4600553_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|4600707_4601319_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_000067755.1|4601329_4602673_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886680.1|4602763_4604056_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.0	5.6e-94
WP_000850303.1|4604294_4606739_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213089.1|4606749_4607367_+	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 307
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4612206	4615421	4717123		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|4612206_4612947_-	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292812.1|4613138_4615421_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
>prophage 308
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4619519	4620608	4717123		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057154.1|4619519_4620608_+	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 309
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4625694	4630235	4717123		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|4625694_4625979_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_022581755.1|4626185_4628450_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551273.1|4628486_4630235_+	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	4.3e-57
>prophage 310
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4644940	4655740	4717123	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_001295932.1|4644940_4645489_+	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109491.1|4645515_4646163_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_032315867.1|4646213_4647404_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977932.1|4647588_4648677_-	outer membrane protein F	NA	Q1MVN1	Enterobacteria_phage	54.3	2.8e-99
WP_000117881.1|4649279_4650680_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001400545.1|4650849_4652052_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193850.1|4652317_4654930_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	9.1e-19
WP_001090499.1|4654972_4655740_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	3.4e-30
>prophage 311
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4671658	4673566	4717123		Tupanvirus(100.0%)	1	NA	NA
WP_000053100.1|4671658_4673566_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.9e-53
>prophage 312
NZ_CP027319	Escherichia coli strain 2014C-3084 chromosome, complete genome	4717123	4678233	4716084	4717123	holin,lysis,transposase,integrase,protease	Enterobacteria_phage(38.1%)	47	4686735:4686750	4706025:4706040
WP_000156509.1|4678233_4679994_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|4680179_4680632_+	macrodomain Ter protein	NA	NA	NA	NA	NA
WP_000750414.1|4680706_4681762_-	outer membrane protein A	NA	NA	NA	NA	NA
WP_000860783.1|4681916_4682135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000288710.1|4682118_4682628_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839153.1|4682846_4683476_+	protein Sxy	NA	NA	NA	NA	NA
WP_001309395.1|4683438_4685592_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|4685610_4686057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000420536.1|4686179_4688234_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
4686735:4686750	attL	GCGGATTTTTTCCGCC	NA	NA	NA	NA
WP_000424181.1|4688265_4688724_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|4688819_4689482_-	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
WP_000665217.1|4689654_4690068_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|4690112_4690430_-	heat-shock protein HspQ	NA	NA	NA	NA	NA
WP_000116291.1|4690487_4691678_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048228.1|4691772_4692051_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|4692047_4692377_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375136.1|4692467_4693127_-	BAX inhibitor protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
WP_001299351.1|4693534_4694554_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|4694531_4694774_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_025380290.1|4694841_4697277_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001098307.1|4697370_4697562_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
WP_000413705.1|4697558_4697747_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_085961182.1|4698584_4699798_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_072095850.1|4699872_4699992_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_032313415.1|4700063_4701146_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.7	1.7e-64
WP_000788742.1|4701152_4701899_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	84.6	5.6e-115
WP_000451007.1|4701920_4702691_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_001151233.1|4702706_4703120_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|4703471_4704245_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001013636.1|4704792_4705005_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_001341388.1|4705172_4705451_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265141.1|4705452_4706502_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.5e-110
4706025:4706040	attR	GGCGGAAAAAATCCGC	NA	NA	NA	NA
WP_001217436.1|4706514_4706886_+	endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|4706875_4707247_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265267.1|4707398_4708217_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917737.1|4708503_4708701_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000261909.1|4708838_4709552_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_071527758.1|4709998_4710193_-	hypothetical protein	NA	Q8VNP0	Enterobacteria_phage	98.3	7.9e-29
WP_000874348.1|4710319_4712170_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_001368593.1|4712464_4712611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024182511.1|4712609_4712825_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
WP_001303880.1|4712787_4713132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001360224.1|4713080_4713317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032313472.1|4713285_4713468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032162009.1|4713512_4714046_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.2	2.1e-100
WP_096848425.1|4714377_4714866_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	95.2	8.9e-69
WP_085961182.1|4714871_4716084_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
>prophage 1
NZ_CP027320	Escherichia coli strain 2014C-3084 plasmid unnamed1	78854	52	78854	78854	holin,tail,head	Escherichia_phage(53.19%)	101	NA	NA
WP_001187875.1|52_853_+	protein kilA	NA	Q1MVK4	Enterobacteria_phage	100.0	1.9e-148
WP_001408987.1|882_1728_+	hypothetical protein	NA	Q71TB9	Escherichia_phage	98.2	1.2e-150
WP_001369095.1|1778_2024_+	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	45.0	3.5e-13
WP_001352007.1|2205_2361_+	type I toxin-antitoxin system hok family toxin	NA	A0A1I9LJU7	Stx_converting_phage	90.2	4.0e-15
WP_000509939.1|2477_2987_-	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
WP_001345489.1|2998_3229_-	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	98.7	3.0e-35
WP_001345490.1|3284_3503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000041761.1|3615_4431_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.3	9.8e-113
WP_000085145.1|4440_6030_-	hypothetical protein	NA	A0A077SLN8	Escherichia_phage	100.0	2.5e-306
WP_000067710.1|6090_7797_-	hypothetical protein	NA	Q71TM1	Escherichia_phage	100.0	0.0e+00
WP_000038866.1|8022_9024_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
WP_001285362.1|9040_10237_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_001774495.1|10309_10771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001076427.1|10794_11655_-	replication protein RepA	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
WP_023156141.1|11973_12366_-	hypothetical protein	NA	A0A1B0VBK3	Salmonella_phage	97.7	9.9e-71
WP_000007765.1|12543_12966_-	hypothetical protein	NA	Q71TL5	Escherichia_phage	100.0	5.0e-60
WP_000890206.1|13005_13794_-	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	91.6	5.8e-110
WP_001369296.1|13802_13982_-	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	98.3	6.8e-27
WP_001177860.1|14256_14541_+	hypothetical protein	NA	Q71TA2	Escherichia_phage	100.0	3.5e-49
WP_000472529.1|14533_15439_+	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
WP_000660987.1|15435_17700_+	DMT family permease	NA	A0A077SL51	Escherichia_phage	68.5	0.0e+00
WP_024134673.1|18497_18683_-	hypothetical protein	NA	Q71T99	Escherichia_phage	100.0	1.5e-16
WP_001068935.1|19071_19263_-	hypothetical protein	NA	Q71T98	Escherichia_phage	100.0	6.0e-29
WP_000900640.1|19454_19880_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	100.0	1.8e-70
WP_000234831.1|19879_20044_+	DUF3927 domain-containing protein	NA	Q71T96	Escherichia_phage	100.0	7.6e-17
WP_001410793.1|20310_20526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001276602.1|20516_21881_+	replicative DNA helicase	NA	O80281	Escherichia_phage	99.6	3.6e-253
WP_001198652.1|21880_22879_+	hypothetical protein	NA	Q71TK3	Escherichia_phage	99.4	2.1e-194
WP_000535208.1|22925_23558_-	hypothetical protein	NA	Q1MVH8	Enterobacteria_phage	100.0	9.0e-90
WP_000212019.1|23550_24567_-	hypothetical protein	NA	A0A1B0V7N3	Salmonella_phage	100.0	4.5e-192
WP_000602713.1|24568_25354_-	hypothetical protein	NA	A0A1B0V7N6	Salmonella_phage	100.0	7.2e-145
WP_000896806.1|25340_26069_-	hypothetical protein	NA	Q71TJ9	Escherichia_phage	100.0	4.2e-139
WP_024245585.1|26072_27290_-	hypothetical protein	NA	A0A1B0VAL1	Salmonella_phage	99.8	1.9e-224
WP_000235786.1|27299_27677_-	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_000840930.1|27823_28069_+	hypothetical protein	NA	A0A1B0VDU5	Salmonella_phage	100.0	1.5e-40
WP_001749370.1|28071_28650_+	norphogenetic protein	NA	A0A1B0VBR8	Salmonella_phage	100.0	2.0e-107
WP_000096174.1|28716_28872_+	hypothetical protein	NA	Q71TJ4	Escherichia_phage	100.0	7.0e-20
WP_106873564.1|28813_29476_+	norphogenetic protein	NA	Q71T83	Escherichia_phage	99.5	2.2e-123
WP_001749369.1|29373_30000_+	hypothetical protein	NA	A0A077SK52	Escherichia_phage	98.6	8.9e-122
WP_001354545.1|29996_30674_+	calcineurin phosphoesterase	NA	A0A077SLQ6	Escherichia_phage	100.0	7.6e-135
WP_106873565.1|30670_31315_+	hypothetical protein	NA	Q1MVG6	Enterobacteria_phage	100.0	1.2e-132
WP_000267620.1|31453_31672_+	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
WP_000107689.1|31673_32936_+	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	100.0	5.4e-235
WP_000021766.1|33008_33515_+	hypothetical protein	NA	A0A1B0VAK0	Salmonella_phage	100.0	4.8e-94
WP_000675643.1|33709_34291_+	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	100.0	2.0e-112
WP_001471568.1|34283_34544_+	hypothetical protein	NA	Q1MVG1	Enterobacteria_phage	100.0	5.2e-44
WP_001065196.1|34536_35181_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	100.0	5.2e-133
WP_023156128.1|35177_35765_+	hypothetical protein	NA	E7C9P6	Salmonella_phage	70.4	8.0e-40
WP_106873566.1|35761_36421_+	hypothetical protein	NA	A0A2D1GLY5	Escherichia_phage	78.6	4.0e-80
WP_001158250.1|36389_36596_+	hypothetical protein	NA	A0A0N7C1V6	Escherichia_phage	97.1	4.3e-33
WP_072184292.1|36525_36807_+	hypothetical protein	NA	Q9XJH3	Enterobacteria_phage	96.8	3.8e-48
WP_106873567.1|36803_37679_+	Eaa protein	NA	A0A1B0V865	Salmonella_phage	75.9	8.6e-107
WP_001554875.1|37675_37936_+	hypothetical protein	NA	A0A1B0V7L4	Salmonella_phage	100.0	3.8e-42
WP_000517420.1|38012_38246_+	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	100.0	2.5e-37
WP_000269004.1|38424_38718_+	hypothetical protein	NA	A0A077SK23	Escherichia_phage	92.8	3.1e-45
WP_001749397.1|38724_39099_+	hypothetical protein	NA	A0A1B0VBU7	Salmonella_phage	100.0	4.4e-68
WP_001749396.1|39080_40013_+	hypothetical protein	NA	A0A1B0VDS6	Salmonella_phage	100.0	1.3e-182
WP_001261543.1|40009_40372_+	hypothetical protein	NA	A0A1B0VBR1	Salmonella_phage	100.0	9.8e-57
WP_001062545.1|41447_41804_-	hypothetical protein	NA	A0A1B0VCG1	Salmonella_phage	100.0	2.4e-63
WP_001749394.1|41804_42389_-	hypothetical protein	NA	A0A1B0V861	Salmonella_phage	100.0	1.7e-111
WP_000506730.1|42563_42953_+	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	100.0	8.3e-70
WP_001190712.1|43025_43247_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216045.1|43246_43627_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
WP_000113018.1|43631_43811_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	1.2e-23
WP_000648833.1|43838_44882_+	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	99.7	1.1e-206
WP_001312282.1|44970_45423_+	late promoter-activating protein (Gp10)	NA	Q71T63	Escherichia_phage	99.3	6.7e-79
WP_062858117.1|45509_46703_+	hypothetical protein	NA	Q5QBP3	Enterobacteria_phage	99.0	4.5e-207
WP_000124159.1|46702_48187_+	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	99.8	4.3e-292
WP_097520985.1|48211_49063_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.3	1.4e-157
WP_000874154.1|49173_49383_-	hypothetical protein	NA	Q5XLQ8	Enterobacteria_phage	100.0	4.8e-32
WP_012817944.1|49348_49444_-	hypothetical protein	NA	Q38402	Escherichia_phage	100.0	2.8e-11
WP_001312283.1|49462_49576_-	hypothetical protein	NA	Q5XLQ7	Enterobacteria_phage	100.0	3.2e-14
WP_000542332.1|49987_50209_+	hypothetical protein	NA	A0A077SLI9	Escherichia_phage	100.0	3.4e-36
WP_024245509.1|50216_51248_+	recombinase	NA	A0A077SLE7	Escherichia_phage	99.4	1.4e-193
WP_024245510.1|51298_51610_+	hypothetical protein	NA	Q5XLQ4	Enterobacteria_phage	93.2	6.3e-44
WP_000848367.1|51856_52417_+	recombinase	NA	Q71TG3	Escherichia_phage	96.2	1.8e-97
WP_024245511.1|52606_53248_+	hypothetical protein	NA	A0A077SK30	Escherichia_phage	96.7	1.5e-111
WP_024245512.1|53338_54379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024245513.1|54378_54888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000747846.1|54946_55195_-	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_000224043.1|55191_55632_-	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_106873568.1|55665_62433_-	helicase	NA	A0A077SK04	Escherichia_phage	98.7	0.0e+00
WP_000774705.1|62509_64219_+	hypothetical protein	NA	Q1MVN6	Enterobacteria_phage	99.6	0.0e+00
WP_000132937.1|64211_65231_+|head	head processing protein	head	Q71TR6	Escherichia_phage	96.8	4.4e-179
WP_071550067.1|65210_65381_-|holin	antiholin	holin	Q71TR5	Escherichia_phage	93.1	2.5e-26
WP_001345478.1|65516_66074_-	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
WP_000068872.1|66243_66732_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	79.0	1.3e-64
WP_000148486.1|66980_68336_+	dGTPase	NA	NA	NA	NA	NA
WP_099368671.1|68543_68915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001165937.1|69117_69426_-	hypothetical protein	NA	Q1MVN0	Enterobacteria_phage	94.1	2.4e-48
WP_033559464.1|69415_72403_-	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	99.5	0.0e+00
WP_000175482.1|72415_72781_-	hypothetical protein	NA	Q1MVM8	Enterobacteria_phage	99.2	2.3e-45
WP_001569351.1|72777_74697_-	hypothetical protein	NA	A0A077SLK4	Escherichia_phage	96.6	0.0e+00
WP_001345482.1|74698_75301_-	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
WP_000580776.1|75287_75731_-	hypothetical protein	NA	A0A077SK09	Escherichia_phage	100.0	1.3e-82
WP_000887652.1|75727_76057_-|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_000145199.1|76131_76395_-	hypothetical protein	NA	Q71TD9	Escherichia_phage	67.1	1.1e-22
WP_001165547.1|76830_77403_-	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	85.0	4.4e-83
WP_071678610.1|77547_77973_+|tail	phage tail protein	tail	K7P7Q7	Enterobacteria_phage	49.3	3.3e-27
WP_000367945.1|77978_78590_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	78.6	3.6e-83
WP_106873569.1|78589_78854_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	37.4	2.2e-05
>prophage 1
NZ_CP027321	Escherichia coli strain 2014C-3084 plasmid unnamed2	84276	10370	77430	84276	protease,integrase,transposase	Stx2-converting_phage(54.55%)	51	41049:41108	69618:72323
WP_086163899.1|10370_10469_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	2.5e-07
WP_085953785.1|10434_11648_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	2.5e-168
WP_000361610.1|12453_13431_+	repFIB replication protein A	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_001341442.1|13593_13821_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	6.2e-33
WP_001341423.1|13874_14549_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|14545_14893_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_012917687.1|14896_16465_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
WP_000499131.1|16977_17361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000091308.1|17288_17654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937603.1|17653_18841_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000422675.1|22827_23304_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	90.7	3.0e-45
WP_001443774.1|26430_26661_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000907857.1|37234_38266_-	replication initiation protein	NA	NA	NA	NA	NA
WP_012917679.1|38253_38343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071527584.1|38449_38680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000335839.1|38973_39615_+	transcription termination factor NusG	NA	NA	NA	NA	NA
WP_000154135.1|39755_40421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001368562.1|40384_40534_+	hypothetical protein	NA	NA	NA	NA	NA
41049:41108	attL	GTAAGCGCACCGTGAAGGACGTGGGGTAAAAATTAGTTTACAGATTGAGTGACATTCCAG	NA	NA	NA	NA
WP_012917687.1|41080_42649_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
WP_000631725.1|42652_43000_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|42996_43671_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001066949.1|43724_44111_-	recombinase	NA	NA	NA	NA	NA
WP_000704534.1|44238_45099_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.3e-09
WP_106873570.1|45191_45377_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	1.8e-06
WP_085961182.1|45342_46556_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_001165114.1|46706_47252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044768.1|47413_47830_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_001261287.1|47826_48057_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_077248527.1|48034_48172_-	toxin-antitoxin system, antitoxin component, AbrB family protein	NA	NA	NA	NA	NA
WP_012680950.1|48144_48348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012680949.1|48308_48503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000465041.1|48616_49030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001164205.1|49031_49814_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
WP_000864810.1|49986_50340_+	colicin M immunity protein	NA	NA	NA	NA	NA
WP_001213545.1|50752_52192_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000987096.1|52195_54316_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	30.2	1.6e-45
WP_000217745.1|54365_57362_-	enterohemolysin	NA	NA	NA	NA	NA
WP_000520917.1|57363_57855_-	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_071525077.1|59748_59928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302199.1|60528_61350_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_000975743.1|61349_62456_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_000550559.1|62549_64271_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_012680945.1|64344_65343_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_012917688.1|65646_67185_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.8	1.9e-295
WP_000612591.1|67234_67582_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000091308.1|67818_68184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937603.1|68183_69371_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_012917687.1|69649_71218_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
WP_000631725.1|71221_71569_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|71565_72240_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001034100.1|73527_77430_+|protease	serine protease EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
69618:72323	attR	GTAAGCGCACCGTGAAGGACGTGGGGTAAAAATTAGTTTACAGATTGAGTGACATTCCAGGGCAACAACTCTTTCACGCGGTTGGCAGGCCAGGTGTTGATTACACTGATCACGTGGCGTAGCCACGTTTCCGGCTCGATTCCGTTAAGTTTGCAGCTACCGATCAGGCTGTACATCACTGCCGCACTCTCGCCTCCACCATCAGAGCCGAAGAACATGTAGTTACGCCGCCCCAGTGCAACTACCCGGAGGGCGTTTTCACACAGGTTATTGTCGATCTCCACCCAGCCATTGCGGCAGTATTCGTTCAGAGCGTCCCATTGCTTCAGCAGATAGGTGAACGCTTTCGCTGTATCCGAGTGGCGCGACAGCGTGCTCATCTGCCCCTGGAGCCACTCATACAACGACTGCATTAGCGGTACCGTTCTGGCTTTTCTGACCGCCAGTCGCTCTTCTGCCGGACTGCCGCGGATCTCAGCCTCGATAGCGTACAGTTCCCCGATACGACGGAGCGCTTCTCCCGTTACTGTCGTTGGATGGCGGACATGTACATCGTGGATCTTGCGTCGGGCATGTGCCATACAAGCCGCTTCGGTTACCTGACCGCTTTCGTAAAGAGCATTGTAACCCGCATATGCATCGGCCTGCAGGATACCTCTGTAGTCCGCCAGATGTTGCTGTGGGTGGATGCCTTTGCGGTCGGGAGAGTATGAGAACCACACCGCTGCCGGCATGGTCGAACCGGCGTTGCGATCGTCACGAACATAGACCCACAGCCGTCCGGTACGGGTTTTACCCTGACCCGGCTCCAGTACATTTACCGGCGTGTCATCGGCATGCACTTTACCCGCCATCAGCACATAGTGCTTCAGTTCATCATACAGCGGGCGAAGCTGCTCTCCCATGATGTCAACCCAGCGCCCCATCGTATTGCGGTGCAGCTCCACGCCCTGGCGGGCATAGATTTCCGACTGACGGTACAGCGGCAGATGCTCGGCGAACTTAGCCATGATTATGCGGGCCAGCAGAGCCGGACTGGCGTAACTGCGCTCGATGGGTTTTGGTGGCTGCGGAGCCTGAACTATACAGTCGCACCGGCTGCAGGCCAGTTTTGGGCGAACCGTTTCGATTACCCTGAACGCGGTGTTGATGATATCCAGTTGTTCAGAGATGCTTTCTCCCAGCGGTTTCAGTTTGCCGCTGCAGACGGGGCATTCGGTTTCTGCCGGGGAGATAACCTGCCTGTCACGGGGAAGTGTTGCCGGAAGTGCTTTGCGGACGGGAGAGTCTGATGTTTTCGGCGCTGTCTCTCCGGCCATTGAGGTGAGTTGCAACTGCGCCTCACCAAGCCTGTTCTGGAGCTCGGTTATACGCGTTTCTGCCCGTGCGATCTTCTTTTCTATCTTCTCGCGGCTTTTCTCGCTGCTGCGACCGAACAACATTCTCTGCAGTTTAGCGACCAGCGCTCTGAGTGAGCTGATCTCGCGGGCATAGCCGGTTATTTCACCAGACAGACGATAACAGCCTGCTGTGCGATCAGCAGGGCCTTCAGTTGCTCGATGTCGTCGGGGAGTGTGTTGTTCATTCCCCTGTTTTATCACGGGTTATATCCGGATGCCAGGCCGTTCTGTCCGTTTGGGATGTTGCCACGCGATCCCCTCCAGTAGCATGGATAACTGAGCTGGCGTCAGGTGCACTTTCCCTTCCCGGGTTACCGGCCAGACGAAGCGGCCCCGTTCCAGGCGTTTGGCGAACAGGCATAACCCGTCACGATCGGCCCACAGTATTTTCACCATTTTGCCACTGCGGCCCCGGAAGACGAAGATATGCCCGGAGAACGGGTCATCTTTCAGCGTGTTCTGCACCTTCGAAGCCAGGCCGTTGAAGCCACAACGCATATCTGTGATGCCAGCGATGATCCAGATTCTGGTACCGGTTGGCAGCGTTATCATCGGGTACCTCCTTTCATTTCGCGGATTAGCGCCCGTAACATTTCCGGAGTGAGAGGGTCAAACAGTTTTACCACACCTGATTTAAGATGCAGCTCGCACCGTGGGACGTTTCCGGGATCACTCTCAGGGCACTCATCAGGCTTGTTACGCCAGAAGGGATTTGTAACTGGTCTGGTCGGCTCTGGCGTATCAGTCAGAGCCACCGGGACAGGCATGCATTCCTGTATGTCATCATCGCTCAGTAAGCCGTCCTCGTACTGGCTTTTCCATTTAAACAGCAGGTTATCATTGATACCGTGCTCTCTGGCGATCCGGGCAACAACAGCACCGGGCTGTAATGCCTGCTTAGCCAGACGGACCTTAAATTCACGGCTGTAGCTGGCTCGCCGTTCTTTTCGCCATGTGCCTTCGCTGATTTGAGGCTCTGTTAATTCCTTCTTTCTGTTGGCATAAAGGATGGCATCAAGCTGAGCTAATGAAACTGAATCGGGCAATGGCCATGCGATACCGGATGCAATAAATCGCTGAAAAAGCGTATGTATTGTGGAATGACTGAGACCTAGACGCTGAGCGATGGCCCGGATGGTCAGTTTATCTTCAAATCTTAAACGCAGAGCATCAGGCAAATAAGAACGGAAGCAGGGAATATCTTTTTTTGTCTGGGAATTCATCGTTCGTGTCCATCTATATAGATGGGCGCGATTGTTGCCAGACAGGACAATTTTCACAAGACGTCGCAGATGGGGCGCTTACG	NA	NA	NA	NA
>prophage 1
NZ_CP027322	Escherichia coli strain 2014C-3084 plasmid unnamed3, complete sequence	706680	88502	155522	706680	tail,capsid,transposase,head,integrase,tRNA,terminase	Stx2-converting_phage(32.56%)	60	84036:84051	132485:132500
84036:84051	attL	TGCTGTTTGTTTGAAT	NA	NA	NA	NA
WP_000113674.1|88502_89633_-|integrase	integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|89610_89859_-	excisionase	NA	NA	NA	NA	NA
WP_000199480.1|92486_92675_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
WP_000449172.1|92671_92860_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000920491.1|93420_93654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|93631_94039_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|94061_94280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|94352_94652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|94916_95324_-	transcriptional regulator	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|95400_95628_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705622.1|95611_96163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072095744.1|96963_97629_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.9e-85
WP_000450692.1|97662_98397_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.7	7.7e-109
WP_001449026.1|99255_100014_+	accessory colonization factor AcfC	NA	NA	NA	NA	NA
WP_000961821.1|100292_100505_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001217394.1|100725_100983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|101052_101331_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001265289.1|101332_102388_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
WP_000140002.1|102388_102754_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001059384.1|102750_103440_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_071526446.1|103470_103617_+	antiterminator	NA	NA	NA	NA	NA
WP_001358663.1|103990_105187_-|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_000958387.1|105692_106256_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_025404407.1|106252_107914_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	99.3	0.0e+00
WP_022581168.1|107977_109915_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	98.1	0.0e+00
WP_001074112.1|109959_110181_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	95.9	3.2e-34
WP_000125988.1|112869_113196_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007889.1|113206_113557_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
WP_000573391.1|113553_114000_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_106873534.1|113996_114341_+	hypothetical protein	NA	A0A0P0ZC17	Stx2-converting_phage	98.2	6.1e-56
WP_021497599.1|114399_115116_+|tail	phage major tail 2 family protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.9	2.3e-126
WP_001030063.1|115121_115496_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001234271.1|115519_115801_+|tail	phage tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	1.3e-45
WP_106873573.1|115852_119095_+|tail	phage tail tape measure protein	tail	B6ETF7	Enterobacteria_phage	99.6	0.0e+00
WP_000807940.1|119087_119429_+|tail	tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_032162127.1|119428_120127_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	1.8e-131
WP_106873574.1|120137_120881_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	3.8e-148
WP_071826436.1|120778_121456_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	96.4	1.5e-111
WP_106873575.1|121696_125176_+|tail	phage tail protein	tail	A0A0P0ZBW1	Stx2-converting_phage	88.6	0.0e+00
WP_047083230.1|125243_125843_+	Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	6.3e-109
WP_106873576.1|125907_127221_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
WP_047083218.1|127242_127491_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	93.9	5.4e-38
WP_032162001.1|127781_128186_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	96.3	1.3e-68
WP_001025673.1|128483_129725_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	84.7	3.2e-216
WP_000500118.1|129993_130182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072095845.1|130376_130586_-	avirulence protein	NA	Q6H9S1	Enterobacteria_phage	100.0	1.7e-32
WP_085961182.1|130745_131959_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_001261971.1|133102_133351_-	DNA-damage-inducible protein DinI	NA	H6WZN4	Escherichia_phage	100.0	2.4e-38
132485:132500	attR	TGCTGTTTGTTTGAAT	NA	NA	NA	NA
WP_001295431.1|133865_135551_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|135547_136267_+	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	25.1	5.1e-12
WP_000950409.1|136313_136784_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|136823_137285_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001400695.1|137409_139410_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001294387.1|140535_142815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001300974.1|142825_143914_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636925.1|144220_144538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032315933.1|144598_148231_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_077793355.1|151917_152064_-	PapI protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	1.9e-06
WP_085961182.1|152029_153243_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_001400694.1|153488_155522_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	23.9	3.7e-44
>prophage 2
NZ_CP027322	Escherichia coli strain 2014C-3084 plasmid unnamed3, complete sequence	706680	281323	370715	706680	portal,tail,holin,transposase,plate,capsid,head,integrase,terminase,lysis	Enterobacteria_phage(33.33%)	88	308216:308275	343440:344750
WP_085961182.1|281323_282536_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_001069811.1|284019_284892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514100.1|284975_286127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063109629.1|286521_286752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071532116.1|286759_287104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001328684.1|287137_287347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001313066.1|287330_287510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001201739.1|287694_288078_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	36.3	4.1e-13
WP_000609174.1|288074_288422_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001317930.1|290042_290165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000973176.1|290316_290862_+	adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase	NA	NA	NA	NA	NA
WP_001297350.1|290858_291602_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193786.1|291613_292693_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001255280.1|292757_293690_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011447.1|294147_295065_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011039.1|295166_296117_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001323172.1|296390_297878_+	MATE family multidrug exporter	NA	NA	NA	NA	NA
WP_022581204.1|298510_299227_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060259.1|299569_301024_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378561.1|301125_302442_-	shikimate transporter	NA	Q6JIH2	Burkholderia_virus	27.7	1.1e-41
WP_000477874.1|302756_303809_+	lipopolysaccharide heptosyltransferase family protein	NA	NA	NA	NA	NA
308216:308275	attL	TGAACCGCCCCGGGAATCCTGGAGACTAAACTTCCTGAGAAAGAGGTAAACAGGATGACT	NA	NA	NA	NA
WP_085961182.1|308269_309482_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_001202999.1|314402_314684_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_001284344.1|314762_316031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000727981.1|316002_316422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000075767.1|316426_318541_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	26.4	3.9e-28
WP_022581240.1|318845_320705_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_022581241.1|320668_321730_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000235844.1|322065_322527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000983666.1|322523_322778_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	56.7	1.0e-12
WP_001242259.1|322928_323201_+	addiction module antidote protein, HigA family	NA	NA	NA	NA	NA
WP_071792412.1|325362_325566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000055685.1|326191_327454_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	40.3	3.8e-71
WP_001302302.1|327791_328589_-	protein MtfA	NA	NA	NA	NA	NA
WP_000533625.1|328823_329849_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	58.2	4.0e-103
WP_000096346.1|329848_330052_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_085953672.1|331311_332524_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.3	7.1e-168
WP_000450617.1|333248_333965_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
WP_042353845.1|333997_334279_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	72.5	3.9e-29
WP_000699809.1|334275_334503_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000034815.1|334495_334807_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	1.6e-55
WP_000683609.1|334934_335153_+	hypothetical protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|335154_335712_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|335945_336158_+	Hok/Gef family protein	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|336277_336622_+	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|336743_337016_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	4.9e-08
WP_001265229.1|337017_338067_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217447.1|338079_338439_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_000640035.1|338447_339002_+	late gene antiterminator protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|339226_339424_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|339558_340272_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001368722.1|340722_341154_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_001304197.1|341455_341584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025404270.1|341632_343468_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	96.0	0.0e+00
WP_085961182.1|343493_344706_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_024165672.1|345084_345300_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
343440:344750	attR	TGAACCGCCCCGGGAATCCTGGAGACTAAACTTCCTGAGAAAGAGGTAAACAGGATGACTAAAAATACTCGTTTTTCCCCTGAAGTCCGTCAACGGGCAGTCCGTATGGTTCTGGAAAGTCAGGGCGAATATGACTCACAATGGGCGACAATTTGTTCCATTGCTCCAAAGATTGGCTGTACGCCGGAGACTCTGCGTGTCTGGGTTCGCCAGCATGAGCGGGATACCGGGGGCGGTGATGGAGGGCTCACCACCGCTGAACGTCAGCGTCTGAAAGAGCTGGAGCGTGAAAATCGTGAACTGCGCCGCAGTAACGATATCCTTCGCCAGGCTTCCGCTTATTTTGCGAAGGCGGAGTTCGACCGCCTCTGGAAAAAATGATGCCACTGCTGGATAAGCTGCGTGAGCAGTACGGGGTCGGACCGCTATGCAGCGAACTGCATATTGCCCCGTCAACGTATTACCACTGTCAGCAACAGCGACATCATCCGGATAAACGCAGTGCCCGTGCGCAGCGCGATGACTGGCTGAAGAAAGAGATACAGCGCGTATACGATGAAAATCACAAGGTATACGGTGTGCGTAAAGTCTGGCGTCAGTTGTTACGGGAAGGTATCAGAGTGGCCAGATGCACTGTGGCACGTCTCATGGCGGTTATGGGACTTGCCGGTGTTCTCCGGGGTAAAAAGGTCCGTACGACCATCAGCCGGAAAGCCGTTGCCGCAGGCGACCGCGTAAACCGTCAGTTCGTGGCAGAACGACCTGACCAGCTGTGGGTGGCTGATTTTACTTACGTCAGCACATGGCAGGGCTTCGTCTATGTGGCGTTCATCATTGATGTGTTTGCCGGATACATTGTGGGGTGGCGGGTCTCATCGTCCATGGAGACGACATTCGTGCTGGATGCACTGGAGCAGGCGTTATGGGCCCGTCGACCGTCCGGCACGGTCCATCACAGTGATAAAGGTTCTCAGTATGTATCGCTGGCCTACACACAGCGGCTTAAGGAAGCCGGATTACTGGCATCAACAGGAAGTACAGGCGACTCGTATGACAACGCGATGGCGGAGAGCATCAATGGTCTTTACAAAGCGGAGGTAATACACCGTAAGAGCTGGAAAAACCGTGCAGAAGTGGAACTGGCCACACTCACGTGGGTGGACTGGTATAACAATCGACGATTGCTGGAAAGGCTGGGCCATACTCCTCCGGCAGAAGCAGAAAAAGCTTATTATGCTTCCATCGGAAACGATGATCTGGCAGCCTGAGTTCACAGATAAAACACTCTCCAGGAAACCCGGGGCGGTTCAG	NA	NA	NA	NA
WP_000731192.1|345304_345649_+	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
WP_106873578.1|345699_346233_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	94.9	2.6e-98
WP_076611052.1|346355_346571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023307894.1|346722_347190_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	94.2	9.7e-73
WP_001096930.1|347272_347413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303878.1|347655_347970_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|348051_348276_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_000235436.1|348677_349187_+|terminase	terminase	terminase	O64316	Escherichia_phage	36.1	2.8e-17
WP_001300238.1|349158_351087_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	2.7e-262
WP_000259002.1|351070_351277_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831765.1|351273_352866_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	3.2e-184
WP_001253961.1|352855_354361_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	54.2	1.0e-99
WP_000256809.1|354397_354745_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_000522615.1|354802_355831_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	60.7	3.9e-114
WP_000012981.1|355834_356257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204549.1|356249_356603_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	8.7e-42
WP_000975046.1|356618_357152_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	2.2e-57
WP_000683066.1|357148_357544_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	3.9e-59
WP_001357739.1|357551_358304_+|tail	tail protein	tail	Q687F6	Enterobacteria_phage	98.0	1.6e-133
WP_000479105.1|358317_358749_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000533423.1|358775_359189_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	2.7e-42
WP_032313647.1|359169_361749_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.8	0.0e+00
WP_025404276.1|361745_362075_+|tail	tail protein	tail	Q687F2	Enterobacteria_phage	94.5	2.2e-55
WP_001357740.1|362074_362773_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_025404352.1|362778_363522_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.0	5.9e-149
WP_032162126.1|363419_364100_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	96.9	2.4e-112
WP_032155007.1|364053_364260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000649829.1|364290_364818_-	superoxide dismutase	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_106873503.1|364951_368428_+|tail	phage tail protein	tail	Q6H9T2	Enterobacteria_phage	96.4	0.0e+00
WP_106873579.1|368494_369067_+	Ail/Lom family protein	NA	A0A0P0ZBV0	Stx2-converting_phage	93.0	1.5e-99
WP_106873580.1|369131_370445_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.6	1.7e-82
WP_001401301.1|370466_370715_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	96.3	2.8e-39
>prophage 3
NZ_CP027322	Escherichia coli strain 2014C-3084 plasmid unnamed3, complete sequence	706680	610452	682234	706680	tail,holin,transposase,capsid,lysis,head,integrase,tRNA,terminase	Stx2-converting_phage(31.37%)	86	613610:613625	688035:688050
WP_022581747.1|610452_611571_-|integrase	integrase	integrase	Q77Z04	Phage_21	44.2	3.5e-84
WP_000003742.1|611539_611809_-	excisionase	NA	NA	NA	NA	NA
WP_077793350.1|611870_613808_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	6.7e-59
613610:613625	attL	GCTTGTATTCGCGATG	NA	NA	NA	NA
WP_085961182.1|613804_615018_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_072187376.1|614979_615282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032162212.1|615348_615627_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	6.3e-11
WP_001265233.1|615628_616678_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.4e-110
WP_032162108.1|616690_617065_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	6.4e-35
WP_000762928.1|617061_617883_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_000216629.1|618479_618647_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000143049.1|619053_620904_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_085954673.1|621187_621403_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	95.8	5.0e-32
WP_032184262.1|621365_621710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001360224.1|621658_621895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303879.1|621863_622058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001003112.1|622090_622624_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	2.1e-100
WP_001443546.1|622701_622893_+	hypothetical protein	NA	A0A0M4S639	Salmonella_phage	63.9	7.8e-05
WP_024173637.1|623050_623518_+|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	87.1	7.2e-68
WP_000735655.1|623541_623766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303918.1|623762_623981_+	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	73.3	6.4e-11
WP_000347013.1|624122_624263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302977.1|624392_624578_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_001372000.1|624619_624985_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	1.6e-62
WP_032245592.1|624953_625091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000958392.1|625273_625837_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	93.5	3.6e-82
WP_025404317.1|625833_627495_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.2	0.0e+00
WP_106873582.1|627558_629496_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.8	0.0e+00
WP_001063027.1|629540_629762_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	98.6	9.9e-36
WP_000125968.1|632288_632615_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	98.1	2.7e-53
WP_001007905.1|632625_632976_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|632972_633419_+	hypothetical protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133391.1|633415_633760_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275505.1|633818_634535_+	hypothetical protein	NA	A0A0P0ZD29	Stx2-converting_phage	97.5	5.2e-126
WP_001030047.1|634540_634915_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	92.7	5.8e-60
WP_001234261.1|634938_635220_+	hypothetical protein	NA	A0A0P0ZED8	Stx2-converting_phage	98.9	5.1e-45
WP_106873583.1|635267_638510_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	96.0	0.0e+00
WP_000807940.1|638502_638844_+|tail	tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_032162127.1|638843_639542_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	1.8e-131
WP_000170104.1|639558_639813_-	hypothetical protein	NA	G0ZNE9	Cronobacter_phage	44.2	5.9e-08
WP_000410309.1|639922_640075_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|640338_641217_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_001303040.1|641270_642008_+|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_106873584.1|642830_646307_+|tail	phage tail protein	tail	A0A0P0ZBW1	Stx2-converting_phage	98.0	0.0e+00
WP_045895398.1|646373_646973_+	Lom family protein	NA	A0A0P0ZBV0	Stx2-converting_phage	98.5	7.5e-110
WP_053892623.1|647037_648351_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
WP_024262417.1|648352_648622_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	5.4e-44
WP_001301673.1|648837_651186_+	type III secretion system effector HECT-type E3 ubiquitin transferase	NA	NA	NA	NA	NA
WP_001301984.1|651776_655178_+	DUF4765 domain-containing protein	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001450921.1|655554_655746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077697694.1|655720_656689_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.7	2.4e-174
WP_085961182.1|656654_657868_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_001301834.1|658594_658720_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001303921.1|658799_659075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|659135_660497_-	type III secretion system protein	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303923.1|660617_660830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000799400.1|660860_661724_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|661707_662844_-	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_001299275.1|662822_663038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000359446.1|663093_664320_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|664368_665490_-	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
WP_000085256.1|665738_666968_+|integrase	integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_000953272.1|667332_667521_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_106873585.1|667578_668304_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000226782.1|668325_668523_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|668515_668728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106873586.1|668717_668975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204078.1|668947_669181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|669173_669407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|669412_669712_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_032315890.1|669708_671109_+	DNA primase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	1.2e-115
WP_000192401.1|671309_671561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126687.1|671557_671968_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|671978_672251_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301569.1|672207_672336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001132079.1|672377_672602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796958.1|672853_673060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907455.1|673059_674115_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.7	3.5e-70
WP_000380886.1|674127_674463_+|head	head decoration protein	head	A0A248XD52	Klebsiella_phage	38.6	3.6e-05
WP_000224599.1|674475_674889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|675094_675637_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|675893_676175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735412.1|676776_678237_-	sensor protein PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|678236_678908_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|679076_680447_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|680450_681092_-	lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001353282.1|681127_682234_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
688035:688050	attR	CATCGCGAATACAAGC	NA	NA	NA	NA
