The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027347	Escherichia coli strain 2013C-4361 chromosome, complete genome	5317846	92728	160282	5317846	head,capsid,protease,tail,transposase,tRNA	Escherichia_phage(36.84%)	57	NA	NA
WP_001295836.1|92728_93352_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|93322_94009_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561841.1|94005_96420_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001320180.1|101040_101301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001158001.1|102532_103627_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|103695_104622_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776388.1|104851_105334_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|105411_106227_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001342079.1|106316_108098_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	7.8e-38
WP_000943558.1|108110_108887_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|108986_109865_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|110033_111488_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006887.1|111547_112909_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001298987.1|112965_114267_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001315307.1|114288_115434_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.1e-48
WP_000540946.1|115562_116348_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001301144.1|116358_117594_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703909.1|117615_118665_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580836.1|118981_120649_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495365.1|120658_121918_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152513.1|121928_122744_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855355.1|122740_123634_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815554.1|123770_124838_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|124834_125344_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212252.1|125461_126184_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000256002.1|126186_126681_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912342.1|126854_128240_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
WP_001143540.1|128275_128797_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|128904_129117_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|129118_129985_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|130465_131008_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988363.1|131227_131920_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001345007.1|131950_134560_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001255226.1|135611_136127_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|136129_136762_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_001345004.1|137972_138305_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000063245.1|138360_139386_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	3.1e-188
WP_000158868.1|139427_139823_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000752958.1|139834_140134_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.9	8.4e-46
WP_085947772.1|140154_141367_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_000985132.1|141460_142039_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683103.1|142035_142431_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	1.4e-69
WP_001342267.1|142438_143179_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000479169.1|143194_143617_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459457.1|143598_144033_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840226.1|144025_146206_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.7	0.0e+00
WP_085948178.1|146211_147424_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_153244794.1|147390_147537_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	5.4e-06
WP_000239881.1|147494_148163_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937502.1|148219_148525_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226384.1|148708_150193_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201824.1|150379_151333_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177454.1|151845_152607_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
WP_001224569.1|152789_153680_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001345000.1|153680_156653_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383942.1|156639_158877_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420935.1|159145_160282_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP027347	Escherichia coli strain 2013C-4361 chromosome, complete genome	5317846	379813	416837	5317846	head,capsid,holin,tail,transposase,integrase	Enterobacteria_phage(53.85%)	45	374406:374422	406197:406213
374406:374422	attL	CGGCCATTGTGGGGCTG	NA	NA	NA	NA
WP_000263438.1|379813_380890_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	1.8e-199
WP_106888364.1|380903_381314_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	98.3	2.1e-63
WP_085948178.1|381297_382511_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000075117.1|382516_382714_-	hypothetical protein	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	1.2e-19
WP_000411800.1|382713_382920_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_000023272.1|383367_385218_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_000499454.1|385516_385675_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|385760_386504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|386688_387378_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032178163.1|387392_387515_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|387854_388814_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_000994516.1|389025_389214_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008192.1|389210_389573_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	98.3	3.5e-62
WP_000002251.1|389569_389860_-	DUF1364 domain-containing protein	NA	K7PK25	Enterobacteria_phage	97.9	7.1e-50
WP_001286917.1|389852_390065_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	100.0	1.6e-35
WP_000950962.1|390057_390234_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
WP_000386661.1|390233_390593_-	DUF2591 family protein	NA	G8EYI2	Enterobacteria_phage	95.0	2.7e-62
WP_001254255.1|390595_390772_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000814614.1|390768_391179_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	98.5	2.1e-71
WP_000344554.1|391150_391513_-	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	67.9	4.4e-33
WP_000818841.1|391530_391737_-	hypothetical protein	NA	G8C7M4	Escherichia_phage	98.5	7.9e-27
WP_000145948.1|391809_392100_-	hypothetical protein	NA	K7PH23	Enterobacteria_phage	100.0	2.5e-50
WP_001254039.1|394026_395532_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000256792.1|395568_395916_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522630.1|395973_397002_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	1.3e-114
WP_000201528.1|397053_397428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204544.1|397420_397774_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000975037.1|397788_398364_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_000683071.1|398360_398756_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_001143011.1|398763_399516_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.2	3.9e-132
WP_000479083.1|399529_399961_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_000533403.1|399987_400401_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_106888365.1|400381_402961_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.4	0.0e+00
WP_000847298.1|402957_403287_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000194798.1|403994_404738_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|404683_405313_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_106888366.1|405553_409030_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.5	0.0e+00
406197:406213	attR	CGGCCATTGTGGGGCTG	NA	NA	NA	NA
WP_001230465.1|409097_409697_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.0	1.8e-108
WP_000268900.1|409761_411075_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	9.7e-78
WP_001023459.1|411076_411346_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_000950982.1|411451_412333_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_001369236.1|412556_413387_+	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	97.8	7.6e-153
WP_021351651.1|413510_413882_-	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_001002868.1|415100_415481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|415624_416837_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 3
NZ_CP027347	Escherichia coli strain 2013C-4361 chromosome, complete genome	5317846	627489	673561	5317846	holin,protease,transposase	Escherichia_phage(36.0%)	55	NA	NA
WP_000156528.1|627489_629250_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|629435_629888_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|629963_631004_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|631360_631870_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000875023.1|632679_634842_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|634851_635298_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001297106.1|635420_637475_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
WP_000424181.1|637506_637965_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|638060_638723_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|638895_639309_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|639353_639671_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116302.1|639728_640919_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048244.1|641013_641292_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|641288_641618_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375138.1|641708_642368_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
WP_000273151.1|643768_644011_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001090200.1|646635_646827_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|646823_647012_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000394557.1|647543_647918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379580.1|647929_648082_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.9e-07
WP_000103686.1|648354_649071_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	3.8e-52
WP_000471549.1|649120_649336_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693949.1|649332_649758_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262389.1|649829_650900_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	3.2e-63
WP_001151153.1|650940_651363_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	1.1e-64
WP_001266135.1|651359_651656_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	7.5e-47
WP_001209481.1|651652_652114_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403777.1|652091_652448_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_000935420.1|652498_652711_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_042350895.1|652796_652961_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_096250393.1|652962_653226_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	3.9e-31
WP_000207986.1|653236_654106_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_001278454.1|654221_654326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902696.1|654514_654727_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
WP_032280206.1|654894_655155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265133.1|655174_656224_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_001217436.1|656236_656608_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000265267.1|657119_657938_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917737.1|658224_658422_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000261909.1|658559_659273_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874357.1|660040_661891_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_000411814.1|662337_662544_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_000138558.1|662799_663072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|663231_663765_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675929.1|663985_664099_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	97.3	5.6e-11
WP_012816791.1|664320_664506_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|665032_665347_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|665428_665653_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_085948178.1|665702_666916_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_012817858.1|667002_667896_-	Tir-cytoskeleton coupling protein TccP2	NA	NA	NA	NA	NA
WP_001443410.1|668341_668725_-	hypothetical protein	NA	Q6H9S1	Enterobacteria_phage	84.3	4.4e-55
WP_001058323.1|669342_670461_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107384.1|670457_672251_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186421.1|672269_672977_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003671.1|672973_673561_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP027347	Escherichia coli strain 2013C-4361 chromosome, complete genome	5317846	724261	792578	5317846	protease,transposase,integrase	Escherichia_phage(25.0%)	57	716498:716512	747479:747493
716498:716512	attL	TTCTGGCGGCGGTAA	NA	NA	NA	NA
WP_000279869.1|724261_725464_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
WP_000282209.1|725650_727468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303889.1|728579_728876_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000579535.1|729102_729300_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000335710.1|729518_730952_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000282084.1|731772_732336_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000998045.1|735606_737145_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.7e-299
WP_106888408.1|738327_738480_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_000024297.1|739183_739543_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000591991.1|739635_741255_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_042352357.1|742134_742833_+	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000424145.1|742923_743226_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_000612150.1|743234_743555_+	urease subunit beta	NA	NA	NA	NA	NA
WP_000065682.1|743547_745251_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_000966485.1|745260_745725_+	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_001142973.1|745725_746400_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_001021388.1|746411_747029_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_000803992.1|748240_748504_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
747479:747493	attR	TTCTGGCGGCGGTAA	NA	NA	NA	NA
WP_001135715.1|748805_748946_+	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_000435663.1|752827_753253_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_000624701.1|753249_753600_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000088522.1|753630_755244_+|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000957251.1|756186_756528_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000042916.1|756514_756844_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|757045_758258_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001176766.1|758417_758885_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506898.1|758902_760111_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797372.1|760121_761078_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001182418.1|761077_762157_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_001040060.1|762158_762932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280118.1|762924_764067_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001035166.1|764076_765135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000254140.1|765456_766038_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001054789.1|766037_767195_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007449.1|767217_767673_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|767695_768736_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|768784_769363_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301248.1|769431_770007_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_001053349.1|770430_770817_+	protein TerF	NA	NA	NA	NA	NA
WP_001223350.1|771330_773421_-	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_000477623.1|774873_775092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310149.1|775725_776061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004881.1|776841_777036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001377350.1|777087_777261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303898.1|777349_777622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001340489.1|777905_778121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000958487.1|778186_778384_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001231525.1|779113_780238_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_001301456.1|781591_782050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167434.1|782507_783017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260386.1|783105_783729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000124179.1|783824_784058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287881.1|784110_784302_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001345400.1|784976_786023_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_001304205.1|786776_788945_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000502842.1|790662_791301_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.5	1.9e-55
WP_085948178.1|791364_792578_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 5
NZ_CP027347	Escherichia coli strain 2013C-4361 chromosome, complete genome	5317846	898288	967385	5317846	head,capsid,terminase,holin,tail,tRNA,transposase,integrase	Stx2-converting_phage(35.85%)	75	893382:893396	899863:899877
893382:893396	attL	GATCGCGATGTACGC	NA	NA	NA	NA
WP_000074981.1|898288_899407_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	2.9e-83
WP_000003742.1|899375_899645_-	excisionase	NA	NA	NA	NA	NA
WP_085948178.1|900888_902102_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
899863:899877	attR	GCGTACATCGCGATC	NA	NA	NA	NA
WP_106888368.1|902127_903486_-	exonuclease	NA	NA	NA	NA	NA
WP_001090200.1|903578_903770_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|903766_903955_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_122993436.1|904294_904435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|904438_904657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001447517.1|904697_905087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|905382_905661_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|905662_905854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169687.1|905874_906246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001444689.1|906343_906646_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	1.5e-05
WP_000693943.1|906642_907068_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095671.1|907090_908053_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_001151120.1|908093_908516_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.9	1.3e-63
WP_032272537.1|908512_908767_+	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	92.9	1.4e-41
WP_001002672.1|908759_909071_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	97.1	1.1e-59
WP_001204666.1|909376_909955_+	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	100.0	2.6e-104
WP_000156210.1|909914_911012_-	hypothetical protein	NA	A0A0U2S621	Escherichia_phage	99.5	1.4e-210
WP_085948178.1|911646_912860_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_072058819.1|912897_913038_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.0	2.2e-12
WP_012817871.1|913205_913478_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	9.4e-12
WP_001369253.1|913479_914535_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	2.4e-87
WP_000140024.1|914535_914901_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	1.6e-38
WP_000640048.1|914909_915440_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|915681_915879_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935544.1|916029_917088_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.0	2.0e-198
WP_000874287.1|917884_919735_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	98.1	0.0e+00
WP_000411802.1|920182_920389_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000731236.1|920393_920738_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992167.1|920788_921322_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
WP_001056806.1|921592_922162_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|922161_922308_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|922535_922721_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|923145_923373_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279788.1|923414_923780_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	2.0e-65
WP_000958415.1|924070_924634_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	3.8e-79
WP_001369319.1|924630_926292_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.9	0.0e+00
WP_000172984.1|926355_928293_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.7	0.0e+00
WP_001063099.1|928337_928559_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125988.1|931247_931574_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|931583_931934_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|931930_932377_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|932373_932718_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275472.1|932784_933501_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
WP_001030042.1|933506_933881_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	6.6e-64
WP_001453698.1|933976_934186_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_106888369.1|934238_937481_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	98.5	0.0e+00
WP_000807928.1|937473_937815_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	95.6	5.3e-60
WP_001447444.1|937814_938513_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.4	4.4e-130
WP_001302649.1|938529_938850_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|938957_939131_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_000967279.1|940178_940916_+|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	98.8	1.9e-147
WP_122996286.1|940861_941494_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_000514853.1|941730_945210_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	97.4	0.0e+00
WP_001230459.1|945276_945876_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_000268887.1|945940_947263_+|tail	tail fiber protein	tail	Q687E6	Enterobacteria_phage	99.1	2.4e-76
WP_001023356.1|947264_947534_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
WP_115801847.1|947640_947730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157719312.1|947749_948061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012779351.1|948147_950097_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_000145590.1|954256_954835_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001301834.1|954857_954983_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001303921.1|955062_955338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938117.1|955398_956760_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	28.9	4.0e-50
WP_000799400.1|957123_957987_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|957970_959107_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000359438.1|959356_960586_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|960731_961853_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000735412.1|961928_963389_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|963388_964060_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|964227_965598_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|965601_966243_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|966278_967385_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP027347	Escherichia coli strain 2013C-4361 chromosome, complete genome	5317846	1068598	1142932	5317846	protease,terminase,holin,portal,tail,transposase	Enterobacteria_phage(40.38%)	79	NA	NA
WP_000268365.1|1068598_1069147_+	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	36.1	2.7e-21
WP_085948178.1|1070993_1072206_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000075578.1|1072270_1072807_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	71.9	4.1e-59
WP_072127369.1|1072839_1073121_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	75.8	1.6e-30
WP_001444682.1|1073117_1073414_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	4.4e-47
WP_001209477.1|1073410_1073872_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	95.2	6.9e-39
WP_000403788.1|1073849_1074206_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	6.7e-58
WP_000137950.1|1074301_1074673_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.9	2.7e-49
WP_000610381.1|1074669_1075023_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	65.0	5.5e-36
WP_000220602.1|1075228_1075528_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	96.0	1.6e-49
WP_001260976.1|1075533_1075791_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	88.0	6.6e-31
WP_001447497.1|1075926_1076205_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	6.9e-10
WP_001344904.1|1076206_1077256_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	1.0e-109
WP_000904137.1|1077268_1077643_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_000762902.1|1077639_1078461_+	hypothetical protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
WP_000917735.1|1078687_1078885_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000483498.1|1079035_1080094_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.0	1.7e-205
WP_000142980.1|1080688_1082635_+	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	99.1	0.0e+00
WP_000143458.1|1082772_1082952_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290214.1|1082992_1083238_+	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	98.8	3.2e-19
WP_001072901.1|1083315_1083531_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001344902.1|1083534_1083780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|1083805_1085018_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000992150.1|1085441_1085975_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.2	2.1e-100
WP_012578895.1|1086493_1086679_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000373407.1|1087154_1087631_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_001077625.1|1087627_1089751_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102413.1|1089747_1089960_+	hypothetical protein	NA	Q687G1	Enterobacteria_phage	98.6	2.3e-29
WP_000974564.1|1089959_1091462_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|1091406_1093431_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|1093518_1093845_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1093837_1094119_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1094121_1094745_+	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1094757_1095156_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1095163_1095916_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|1095929_1096352_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|1096378_1096687_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000918237.1|1096730_1099376_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	99.4	0.0e+00
WP_000847298.1|1099372_1099702_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_122996286.1|1101097_1101730_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_000514851.1|1101966_1105443_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.7	0.0e+00
WP_001230455.1|1105510_1106110_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
WP_000279057.1|1106174_1107488_+|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.0	3.7e-77
WP_106888371.1|1107489_1107789_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.7	3.3e-42
WP_085948178.1|1107791_1109005_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000692020.1|1110207_1110798_+	protein kinase	NA	NA	NA	NA	NA
WP_001079509.1|1111834_1112341_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|1112386_1112887_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1112972_1113152_-	general stress protein	NA	NA	NA	NA	NA
WP_000443067.1|1113532_1114339_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|1114338_1115532_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001344826.1|1115543_1116902_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000763511.1|1116905_1118501_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194584.1|1118500_1120063_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1120154_1120199_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|1120336_1121218_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1121214_1121835_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|1121935_1122808_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278906.1|1122847_1123438_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559281.1|1123434_1124193_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_000422045.1|1124412_1125462_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|1125497_1125749_-	YciN family protein	NA	NA	NA	NA	NA
WP_001297122.1|1126128_1128726_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
WP_000776253.1|1128935_1129910_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_001295577.1|1130240_1130369_+	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_001297116.1|1130371_1130539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310756.1|1130652_1130748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000099519.1|1130911_1133587_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_001176295.1|1133650_1134241_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
WP_001256539.1|1134410_1135175_+	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_000876286.1|1135323_1135632_+	lipopolysaccharide assembly protein LapA	NA	NA	NA	NA	NA
WP_000891353.1|1135638_1136808_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_000176278.1|1136999_1137737_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_001295580.1|1137736_1138063_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_000498253.1|1138188_1138407_-	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_001088625.1|1138675_1139425_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_001288368.1|1139514_1139688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153244795.1|1141606_1141753_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	80.0	4.9e-07
WP_085948178.1|1141718_1142932_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 7
NZ_CP027347	Escherichia coli strain 2013C-4361 chromosome, complete genome	5317846	1203313	1264926	5317846	head,capsid,terminase,holin,tail,tRNA,transposase,integrase	Escherichia_phage(42.03%)	73	1202947:1202962	1234102:1234117
1202947:1202962	attL	TGCTGGATAAGCTGCG	NA	NA	NA	NA
WP_000628065.1|1203313_1204546_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1204800_1205784_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123745.1|1206261_1207635_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157407.1|1207763_1208699_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040839.1|1208750_1209986_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_000079604.1|1209987_1210203_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|1210302_1210491_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001443846.1|1210528_1210678_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_000166313.1|1210733_1211543_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_000105140.1|1211535_1214136_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_001344816.1|1214237_1214513_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_001352098.1|1214587_1214758_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|1214757_1214979_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|1215420_1215909_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1215905_1216061_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001326317.1|1216071_1216251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233319.1|1216493_1216913_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|1216992_1217247_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693803.1|1217243_1217666_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001304174.1|1217743_1218532_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000788980.1|1218538_1219285_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_000450712.1|1219307_1220069_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_001141110.1|1220084_1220507_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000935420.1|1220612_1220825_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_042350895.1|1220910_1221075_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000224233.1|1221076_1221340_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000208018.1|1221350_1221512_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000365100.1|1221590_1221836_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_001100703.1|1222267_1223419_+	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000016656.1|1223386_1224376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000940319.1|1226265_1226865_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000247761.1|1226864_1227155_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000640158.1|1227151_1227706_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000466957.1|1228267_1228699_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000143077.1|1229269_1231123_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000284522.1|1231272_1231488_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000731221.1|1231492_1231837_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000992086.1|1231887_1232421_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	1.3e-100
WP_001344811.1|1232694_1233234_+	ant domain protein	NA	Q5MBW0	Stx1-converting_phage	99.4	3.0e-86
WP_085948178.1|1233236_1234450_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
1234102:1234117	attR	CGCAGCTTATCCAGCA	NA	NA	NA	NA
WP_000285960.1|1234526_1234703_+	phage antirepressor	NA	Q5MBW0	Stx1-converting_phage	98.3	3.3e-26
WP_001280923.1|1234797_1234929_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_012817877.1|1235151_1235337_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_000828070.1|1235737_1236064_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095744.1|1236195_1236396_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829192.1|1236437_1236803_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000958380.1|1237091_1237655_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001411753.1|1237651_1239313_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_000173011.1|1239376_1241314_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001063025.1|1241358_1241580_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|1243944_1244271_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007911.1|1244280_1244631_+|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000573391.1|1244627_1245074_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133393.1|1245070_1245415_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275480.1|1245483_1246200_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.9	1.4e-126
WP_001030060.1|1246205_1246580_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001453698.1|1246675_1246885_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_106888373.1|1246936_1250179_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	98.9	0.0e+00
WP_000807964.1|1250171_1250513_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001152159.1|1250512_1251211_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
WP_000194763.1|1251221_1251965_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_064732755.1|1251910_1252543_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_106888374.1|1252733_1253261_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	54.1	5.8e-50
WP_106888375.1|1253394_1256892_+	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.2	0.0e+00
WP_001230550.1|1256962_1257562_+	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_106888376.1|1257626_1258922_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.9	2.4e-76
WP_085948178.1|1258973_1260186_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001023992.1|1260254_1260524_+|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_001131659.1|1260636_1261212_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001443810.1|1261284_1261914_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001143784.1|1261995_1262637_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001295593.1|1263217_1263652_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837930.1|1263792_1264926_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.3	1.2e-116
>prophage 8
NZ_CP027347	Escherichia coli strain 2013C-4361 chromosome, complete genome	5317846	1463032	1552840	5317846	head,capsid,terminase,holin,portal,lysis,tail,transposase,integrase	Stx2-converting_phage(30.3%)	101	1521106:1521122	1560356:1560372
WP_000214712.1|1463032_1463236_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527750.1|1463271_1464732_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.3	5.6e-42
WP_000347482.1|1464820_1466104_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_096245710.1|1466163_1466478_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	81.9	1.3e-25
WP_001121225.1|1467073_1467724_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000491542.1|1467948_1468824_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001023452.1|1468964_1469234_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_064764776.1|1469235_1469358_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	86.1	4.3e-09
WP_085948178.1|1469323_1470537_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000023139.1|1470588_1472358_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	96.8	0.0e+00
WP_001059384.1|1473881_1474571_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_000140002.1|1474567_1474933_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001265289.1|1474933_1475989_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
WP_032178572.1|1475990_1476269_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.8e-11
WP_001217394.1|1476338_1476596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961821.1|1476816_1477029_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001449026.1|1477307_1478066_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|1478764_1478929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450683.1|1478925_1479660_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.3	2.9e-108
WP_157825328.1|1479693_1480236_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|1480147_1481188_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705622.1|1481159_1481711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|1481997_1482405_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|1482669_1482969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171894.1|1483041_1483260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1483282_1483690_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|1483667_1483901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001342117.1|1483894_1484062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449172.1|1484461_1484650_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199480.1|1484646_1484835_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048484.1|1484930_1487402_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.7	5.5e-58
WP_000113189.1|1487466_1487715_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|1487692_1488823_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000737224.1|1488868_1489507_-	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000028540.1|1489863_1490607_+	UPF0259 family protein	NA	NA	NA	NA	NA
WP_000808667.1|1490636_1491176_+	septation protein A	NA	NA	NA	NA	NA
WP_000108160.1|1491280_1491679_+	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000171274.1|1491718_1492438_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_001261191.1|1492528_1492882_+	recombinase family protein	NA	NA	NA	NA	NA
WP_001144879.1|1495387_1495978_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|1496161_1496809_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|1496945_1497092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|1497519_1497798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000950979.1|1500583_1501495_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|1501601_1501724_-	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_106888377.1|1502838_1504413_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.4	3.2e-67
WP_001228290.1|1504564_1505164_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	97.0	4.1e-108
WP_000514717.1|1505231_1508705_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.2	0.0e+00
WP_096860308.1|1509047_1509680_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	97.1	2.3e-101
WP_001369422.1|1509625_1510369_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.2	1.1e-147
WP_001369426.1|1510374_1511073_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.0	7.6e-130
WP_000807940.1|1511072_1511414_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_001369428.1|1511406_1512849_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.3	5.1e-229
WP_000091308.1|1512867_1513233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937595.1|1513232_1514420_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001453698.1|1516528_1516738_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030041.1|1516833_1517208_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	5.0e-64
WP_001275480.1|1517213_1517930_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.9	1.4e-126
WP_000133393.1|1517996_1518341_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|1518337_1518784_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|1518780_1519131_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|1519140_1519467_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_012817878.1|1519469_1522049_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.8	0.0e+00
1521106:1521122	attL	TGCTGCTCCAGCGCCTC	NA	NA	NA	NA
WP_001063099.1|1521994_1522216_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173011.1|1522260_1524198_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001369319.1|1524261_1525923_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.9	0.0e+00
WP_000958415.1|1525919_1526483_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	3.8e-79
WP_000279803.1|1526772_1527138_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	96.7	2.9e-64
WP_000095736.1|1527179_1527407_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000736096.1|1527775_1528000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|1528085_1528271_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000992122.1|1528788_1529322_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_000731236.1|1529372_1529717_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000411811.1|1529721_1529928_-|holin	holin	holin	O48430	Enterobacteria_phage	100.0	1.8e-31
WP_000143036.1|1530373_1532224_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_001344632.1|1532671_1532803_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_085948178.1|1533062_1534275_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001064906.1|1534543_1535233_-	antiterminator	NA	I6PDF8	Cronobacter_phage	48.1	5.5e-56
WP_085948953.1|1535317_1535398_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.2e-06
WP_085948952.1|1535363_1536577_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.0	4.2e-168
WP_000054483.1|1536915_1537881_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_000705364.1|1537861_1538383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476993.1|1538366_1538594_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|1538671_1539079_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000379591.1|1539271_1539424_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_001344637.1|1539435_1539801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001328010.1|1539769_1540057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1540472_1540661_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083273.1|1540657_1540849_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048302.1|1540942_1543414_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	3.2e-58
WP_001296941.1|1543501_1543738_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000876990.1|1543772_1545053_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	1.9e-155
WP_001360138.1|1545072_1545183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836079.1|1545240_1546260_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001295394.1|1546271_1547486_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1547691_1548018_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|1548152_1548494_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1548528_1549089_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1549091_1549802_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|1549909_1550215_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041554.1|1550413_1552840_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	2.0e-214
1560356:1560372	attR	TGCTGCTCCAGCGCCTC	NA	NA	NA	NA
>prophage 9
NZ_CP027347	Escherichia coli strain 2013C-4361 chromosome, complete genome	5317846	1688605	1726688	5317846	head,plate,capsid,terminase,holin,portal,tail,transposase,tRNA	Enterobacteria_phage(85.71%)	44	NA	NA
WP_100206497.1|1688605_1688884_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.4	6.2e-27
WP_000159459.1|1688894_1689173_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	78.3	1.5e-33
WP_000514277.1|1689184_1689427_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000165075.1|1689491_1690373_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	92.6	1.9e-114
WP_000686506.1|1691945_1692905_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	7.1e-179
WP_000211267.1|1692909_1693221_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	2.2e-41
WP_001390707.1|1693585_1693855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000236489.1|1694417_1694942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000087824.1|1694956_1696003_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.1	1.9e-201
WP_000613748.1|1696002_1697754_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.3	0.0e+00
WP_001262673.1|1697908_1698745_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_001055104.1|1698768_1699821_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
WP_000632344.1|1699866_1700667_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
WP_000063082.1|1700769_1701264_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_000864901.1|1701263_1701464_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|1701466_1701790_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|1701786_1702179_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780569.1|1702175_1702583_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	4.5e-66
WP_000920593.1|1702720_1703188_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	1.0e-85
WP_000356341.1|1703180_1703816_+|tail	tail protein	tail	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
WP_001271894.1|1703812_1704394_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	1.0e-100
WP_000213447.1|1704390_1704741_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111942.1|1704744_1705641_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	1.1e-154
WP_000071739.1|1705633_1706164_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_000108519.1|1706166_1708299_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.7	4.2e-131
WP_000144026.1|1708298_1708877_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	1.7e-95
WP_000954196.1|1708920_1709493_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000979957.1|1709649_1710138_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	3.0e-85
WP_000853433.1|1710150_1712958_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	94.9	0.0e+00
WP_000333503.1|1712944_1713100_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651581.1|1713108_1713483_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	6.9e-37
WP_000005431.1|1714049_1715234_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	8.1e-225
WP_000132811.1|1715391_1716501_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	9.6e-204
WP_001035742.1|1716726_1718229_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000488103.1|1718472_1718733_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078923.1|1718923_1719064_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	95.7	4.5e-18
WP_001229265.1|1719370_1719670_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672378.1|1719674_1722062_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018594.1|1722076_1723060_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|1723343_1723388_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|1723510_1723867_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|1723919_1724117_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|1724213_1724756_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144192.1|1724759_1726688_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
>prophage 10
NZ_CP027347	Escherichia coli strain 2013C-4361 chromosome, complete genome	5317846	1944823	2031577	5317846	head,capsid,terminase,holin,portal,tail,transposase,integrase	Escherichia_phage(32.26%)	101	2030044:2030103	2044519:2044599
WP_000826461.1|1944823_1946032_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.5	4.9e-209
WP_000879833.1|1947423_1948221_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000734033.1|1948230_1948782_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001070440.1|1948950_1949283_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001274299.1|1949616_1949931_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000067950.1|1951794_1952790_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282694.1|1952782_1953469_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213292.1|1953468_1954842_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807584.1|1954860_1955304_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000620092.1|1955300_1956428_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133124.1|1956532_1956997_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|1957001_1958006_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282098.1|1958002_1958416_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001302429.1|1958418_1958784_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253450.1|1958783_1959521_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|1959530_1959800_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000942326.1|1959807_1960593_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103994.1|1960882_1961506_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524607.1|1961549_1961792_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|1961900_1962128_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000949111.1|1962425_1963241_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001377491.1|1963237_1964932_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009309.1|1965102_1965285_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922683.1|1965363_1966281_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001210913.1|1966453_1967374_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786004.1|1967362_1967833_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001157238.1|1967813_1969232_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
WP_000365565.1|1969298_1969994_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
WP_001313057.1|1970033_1970399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824375.1|1970965_1972129_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.2	7.2e-109
WP_000218214.1|1972719_1973571_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826738.1|1973678_1975037_-	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_001339045.1|1975036_1975708_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920136.1|1975840_1976254_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000730130.1|1976362_1977367_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240109.1|1977367_1978003_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_122993428.1|1978238_1978910_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001079074.1|1979252_1979783_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_122993429.1|1981017_1982031_-	peptidase M85	NA	NA	NA	NA	NA
WP_001023476.1|1982436_1982706_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
WP_106888379.1|1982707_1984030_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.4	1.6e-75
WP_001230455.1|1984094_1984694_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
WP_000514851.1|1984761_1988238_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.7	0.0e+00
WP_122996286.1|1988484_1989117_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_001369128.1|1989062_1989806_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	3.3e-147
WP_001152113.1|1989811_1990510_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	99.1	4.7e-132
WP_000847298.1|1990509_1990839_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000533440.1|1993425_1993839_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479045.1|1993865_1994288_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000235098.1|1994301_1995054_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000683079.1|1995061_1995457_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974980.1|1995453_1995987_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_001204554.1|1996002_1996356_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201501.1|1996348_1996732_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522591.1|1996783_1997812_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000256823.1|1997869_1998217_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_001253979.1|1998253_1999759_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
WP_001369121.1|1999748_2001341_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
WP_000259002.1|2001337_2001544_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001426431.1|2001527_2003456_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	3.6e-262
WP_001426432.1|2003427_2003934_-	DNA-packaging protein	NA	O64316	Escherichia_phage	47.3	7.4e-34
WP_001444498.1|2004360_2004585_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.3e-19
WP_001302717.1|2004666_2004981_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012817896.1|2005507_2005693_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	83.6	4.0e-22
WP_001092858.1|2006210_2006744_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	1.9e-101
WP_000284516.1|2007301_2007517_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	7.7e-33
WP_001290231.1|2007593_2007866_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|2007906_2008086_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000023159.1|2008223_2010161_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.9	0.0e+00
WP_153244796.1|2010146_2010290_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	97.4	3.7e-15
WP_000466957.1|2010639_2011071_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000422741.1|2011158_2011584_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|2011580_2011931_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080194.1|2011961_2013575_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	64.0	4.4e-181
WP_000301789.1|2014060_2014774_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917764.1|2014908_2015106_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	6.8e-28
WP_000640033.1|2015329_2015884_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	8.0e-66
WP_001217447.1|2015892_2016252_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_001265229.1|2016264_2017314_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2017315_2017588_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2017709_2018054_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2018173_2018386_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2018619_2019177_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2019178_2019397_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000034815.1|2019524_2019836_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	1.6e-55
WP_000699809.1|2019828_2020056_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2020052_2020334_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450617.1|2020366_2021083_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
WP_000788760.1|2021104_2021851_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.2	3.6e-114
WP_001262366.1|2021857_2022928_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.7e-64
WP_000693883.1|2022999_2023425_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391948.1|2023408_2023690_-	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000362152.1|2023789_2024209_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
WP_001345283.1|2024474_2024627_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
WP_000394546.1|2024638_2025277_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2025277_2025487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2026057_2026246_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2026242_2026434_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048405.1|2026526_2028914_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	63.8	5.9e-81
WP_001300307.1|2029149_2029947_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
2030044:2030103	attL	CGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTC	NA	NA	NA	NA
WP_001345280.1|2030302_2031577_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.9	1.4e-76
WP_001345280.1|2030302_2031577_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.9	1.4e-76
2044519:2044599	attR	CGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTCGAGTCCAGTCAGAGGAGCCAA	NA	NA	NA	NA
>prophage 11
NZ_CP027347	Escherichia coli strain 2013C-4361 chromosome, complete genome	5317846	2257108	2325988	5317846	capsid,protease,terminase,holin,lysis,transposase,integrase	Enterobacteria_phage(20.69%)	64	2295052:2295087	2326928:2326963
WP_000101907.1|2257108_2258350_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	43.1	1.6e-98
WP_000387403.1|2258846_2259053_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001345228.1|2259007_2260816_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGN8	uncultured_Caudovirales_phage	41.1	2.9e-08
WP_023981888.1|2261031_2261271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204078.1|2261243_2261477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205000.1|2261469_2261703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770163.1|2261708_2262008_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833625.1|2262004_2263405_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.1	1.6e-115
WP_001080641.1|2263607_2263853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000391151.1|2263983_2264178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018604.1|2264181_2264343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001229488.1|2264470_2264959_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	41.7	3.9e-24
WP_001369202.1|2265121_2266045_+|capsid	phage capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.9	1.2e-13
WP_001113637.1|2269422_2270070_+	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_001211568.1|2270104_2271157_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_000824439.1|2271153_2271711_-	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_000982426.1|2271707_2273651_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_001026418.1|2273647_2274127_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000186540.1|2274123_2274333_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001295447.1|2274329_2275067_-	heme exporter protein CcmC	NA	NA	NA	NA	NA
WP_000971722.1|2275108_2275771_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000888560.1|2275767_2276385_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
WP_000528376.1|2276403_2277006_-	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000835176.1|2277015_2277465_-	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000013506.1|2277461_2278325_-	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000091291.1|2278311_2279007_-	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_032272416.1|2279013_2281500_-	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000557378.1|2281496_2281760_-	chaperone NapD	NA	NA	NA	NA	NA
WP_000686723.1|2281749_2282244_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_000849214.1|2282652_2283141_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000758043.1|2283289_2284936_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000422230.1|2285153_2286797_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000884922.1|2286872_2287523_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000786386.1|2287522_2288587_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406116.1|2288660_2289716_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865576.1|2289827_2290919_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
WP_001249151.1|2291657_2294330_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_001061917.1|2294346_2294997_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
2295052:2295087	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTACG	NA	NA	NA	NA
WP_001225855.1|2298321_2299098_-	YfaP family protein	NA	NA	NA	NA	NA
WP_001104541.1|2299102_2300752_-	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_122993426.1|2300752_2305147_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_001025665.1|2305948_2307271_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.5	9.7e-227
WP_072145680.1|2307964_2308603_-	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	43.0	2.4e-34
WP_085948178.1|2308640_2309853_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000881316.1|2309893_2310418_-	hypothetical protein	NA	A0A0N7CEE8	Salmonella_phage	89.7	1.2e-84
WP_000092247.1|2310567_2311005_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	97.9	5.0e-71
WP_000075144.1|2311001_2311499_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	1.9e-90
WP_000284524.1|2311498_2311714_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|2311856_2312255_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|2312335_2312494_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|2312579_2313323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235460.1|2313575_2314199_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_001028854.1|2314195_2314861_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223927.1|2314857_2315460_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
WP_001108084.1|2315434_2316001_-	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_042352449.1|2316548_2317481_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	6.1e-151
WP_001345214.1|2317519_2318347_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.6	1.6e-150
WP_001254228.1|2318850_2319033_-	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_001281192.1|2319189_2319534_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
WP_001444001.1|2319639_2319858_+	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
WP_000533670.1|2319835_2320906_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
WP_001215757.1|2320900_2321527_-	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_000012296.1|2321523_2323212_-	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
WP_001281242.1|2323360_2325988_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
2326928:2326963	attR	CGTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCA	NA	NA	NA	NA
>prophage 12
NZ_CP027347	Escherichia coli strain 2013C-4361 chromosome, complete genome	5317846	2414662	2507938	5317846	integrase,bacteriocin,capsid,terminase,holin,portal,tail,transposase,tRNA	Escherichia_phage(71.23%)	101	2446214:2446237	2508134:2508157
WP_001283576.1|2414662_2415475_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|2415474_2416488_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699121.1|2416553_2417690_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
WP_000615813.1|2417788_2418784_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127749.1|2418780_2419959_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|2420242_2421463_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683806.1|2421621_2423628_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|2423748_2424027_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089232.1|2424060_2424609_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447359.1|2424608_2425418_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043815.1|2425417_2426242_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|2426245_2427331_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001295704.1|2427365_2428298_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|2428463_2429015_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001315753.1|2429087_2429939_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000844750.1|2429940_2430480_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000714139.1|2430476_2430965_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000018471.1|2430961_2431471_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000482748.1|2431486_2432239_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001112824.1|2432258_2434904_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033328.1|2434984_2435548_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|2436231_2436717_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426169.1|2436919_2439064_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531954.1|2439063_2440374_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296869.1|2440553_2440838_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|2441209_2442550_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000937833.1|2442916_2443975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|2444156_2444912_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|2445205_2446138_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
2446214:2446237	attL	GTCCTCTTAGTTAAATGGATATAA	NA	NA	NA	NA
WP_000012449.1|2454778_2456044_-	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	98.8	9.9e-205
WP_000540391.1|2456054_2456306_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455649.1|2456315_2456762_-	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
WP_000509481.1|2456764_2457421_-	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000035558.1|2457514_2457916_-	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000078907.1|2457972_2458113_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835360.1|2458345_2459080_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_001301884.1|2459170_2459788_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000455634.1|2459793_2460072_-	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_001146329.1|2461350_2462976_-	hypothetical protein	NA	A0A088CBK0	Shigella_phage	99.8	0.0e+00
WP_001370566.1|2463279_2463459_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	2.8e-28
WP_001023433.1|2463597_2463867_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	98.9	6.4e-45
WP_106888381.1|2463868_2465806_-|tail	phage tail protein	tail	A0A1I9LJS9	Stx_converting_phage	99.3	3.1e-64
WP_000207922.1|2465802_2466453_-	hypothetical protein	NA	A0A0P0ZG46	Escherichia_phage	100.0	4.6e-121
WP_000829202.1|2466452_2467016_-	hypothetical protein	NA	A0A0P0ZGG2	Escherichia_phage	100.0	4.1e-102
WP_001371266.1|2466999_2467461_-	hypothetical protein	NA	V5URI4	Shigella_phage	99.3	7.8e-75
WP_001140444.1|2467510_2467900_-	hypothetical protein	NA	V5UT93	Shigella_phage	100.0	9.9e-63
WP_000214474.1|2467954_2469169_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345014.1|2469192_2470200_-	hypothetical protein	NA	Q08J90	Stx2-converting_phage	100.0	1.8e-180
WP_000787035.1|2470357_2472502_-|portal	portal protein	portal	A0A0P0ZG74	Escherichia_phage	99.9	0.0e+00
WP_106888382.1|2472501_2474163_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	99.8	0.0e+00
WP_085948178.1|2474228_2475441_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_159030176.1|2475407_2475572_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	1.6e-06
WP_001086073.1|2475501_2476308_-|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_001108577.1|2476600_2477152_-	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	99.5	8.4e-100
WP_012816804.1|2477390_2477576_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_000539792.1|2477803_2477950_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2477949_2478519_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|2478789_2479323_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|2479327_2479543_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290230.1|2479620_2479866_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|2479906_2480086_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_106888383.1|2480222_2482160_-	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	99.7	0.0e+00
WP_000738068.1|2482657_2482927_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|2482938_2483898_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001204859.1|2484681_2485116_-	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_000144767.1|2485108_2485303_-	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_000813671.1|2485299_2485863_-	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
WP_000402092.1|2485870_2486320_-	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_001193567.1|2486319_2487291_-	DNA primase	NA	A0A2R2Z336	Escherichia_phage	100.0	1.4e-195
WP_000913119.1|2487280_2488801_-	DEAD/DEAH box helicase	NA	A0A2R2Z335	Escherichia_phage	100.0	6.4e-307
WP_001271433.1|2488794_2489172_-	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_001302923.1|2489338_2489533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240875.1|2489703_2489907_-	hypothetical protein	NA	A0A2R2Z333	Escherichia_phage	98.5	9.8e-30
WP_001056250.1|2490002_2490716_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_000939560.1|2490810_2492280_+	SAM-dependent methyltransferase	NA	A0A2L1IV91	Escherichia_phage	99.6	1.9e-284
WP_001064714.1|2492276_2493230_+	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_000201269.1|2494090_2494738_+	Rha family transcriptional regulator	NA	A0A2R2Z320	Escherichia_phage	100.0	1.5e-119
WP_000934197.1|2495032_2495314_+	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	100.0	3.0e-45
WP_000995345.1|2495334_2495616_+	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_032344411.1|2495632_2496583_+	DNA recombination protein RecT	NA	A0A0P0ZFY9	Escherichia_phage	99.1	1.0e-177
WP_000187063.1|2496579_2497269_+	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	100.0	3.5e-135
WP_000344636.1|2497268_2497856_+	hypothetical protein	NA	A0A0N7KZV4	Escherichia_phage	99.5	2.0e-107
WP_001071603.1|2497930_2498278_+	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
WP_000080417.1|2498341_2499163_+	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_032344414.1|2499239_2499683_+	hypothetical protein	NA	A0A0H4IQ60	Shigella_phage	97.3	2.3e-76
WP_001345192.1|2499790_2500669_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	99.7	3.8e-179
WP_032344415.1|2500862_2501102_+	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	98.7	8.0e-39
WP_032344417.1|2501098_2501800_+	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	99.6	3.9e-134
WP_001447495.1|2501804_2501993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106888384.1|2502030_2502300_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	89.4	2.5e-25
WP_000212746.1|2502301_2502589_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_047081478.1|2502592_2503216_+	DUF551 domain-containing protein	NA	A0A1I9LJM0	Stx_converting_phage	96.1	3.6e-115
WP_000203834.1|2503571_2504210_+	phage antirepressor Ant	NA	A0A0P0ZG08	Escherichia_phage	99.5	5.5e-119
WP_000809302.1|2504265_2504697_+	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000163448.1|2504693_2505320_+	adenine methylase	NA	G9L6F9	Escherichia_phage	100.0	1.8e-122
WP_001291843.1|2505279_2505492_+	DUF1382 family protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
WP_000994797.1|2505527_2505926_+	DUF1627 domain-containing protein	NA	G3CFH0	Escherichia_phage	99.2	4.7e-52
WP_021351637.1|2506069_2506303_+	hypothetical protein	NA	G3CFG9	Escherichia_phage	100.0	2.3e-35
WP_000497812.1|2506290_2506542_+	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_024174014.1|2506602_2506785_+	helix-turn-helix domain-containing protein	NA	G3CFG7	Escherichia_phage	100.0	4.1e-27
WP_032274263.1|2506768_2507938_-|integrase	integrase family protein	integrase	G3CFG6	Escherichia_phage	100.0	7.5e-231
2508134:2508157	attR	GTCCTCTTAGTTAAATGGATATAA	NA	NA	NA	NA
>prophage 13
NZ_CP027347	Escherichia coli strain 2013C-4361 chromosome, complete genome	5317846	2737622	2817866	5317846	protease,terminase,portal,tail,transposase,tRNA	Enterobacteria_phage(65.96%)	79	NA	NA
WP_001298974.1|2737622_2738360_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|2738491_2739826_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000365855.1|2740035_2740917_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|2741019_2741607_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|2741662_2742046_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|2742349_2743039_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|2743086_2744124_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|2744330_2744750_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001341635.1|2744818_2745517_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000083007.1|2745548_2748209_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|2748322_2749678_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001300818.1|2749723_2750047_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|2750043_2751342_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|2757194_2759768_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040115.1|2759897_2760629_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079107.1|2760625_2761606_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|2761740_2762478_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|2762748_2763090_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|2763193_2763241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200116.1|2763339_2764500_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225214.1|2764542_2765664_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168054.1|2765674_2766745_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000976004.1|2766954_2767320_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|2767469_2767988_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969032.1|2767977_2769204_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589821.1|2769219_2769702_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|2769778_2770126_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264774.1|2770167_2770935_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|2770965_2771514_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|2771532_2771781_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460032.1|2772029_2773391_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|2773557_2774349_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|2774369_2775656_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|2775710_2776304_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|2776426_2777305_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|2777390_2779052_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|2779200_2779542_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|2779603_2779894_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|2779883_2780360_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|2780491_2780974_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217540.1|2781822_2782071_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	100.0	2.4e-38
WP_001023452.1|2782438_2782708_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_106888386.1|2782709_2784032_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.1	5.9e-75
WP_001230455.1|2784096_2784696_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
WP_000514851.1|2784763_2788240_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.7	0.0e+00
WP_122996286.1|2788486_2789119_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_001369128.1|2789064_2789808_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	3.3e-147
WP_001152113.1|2789813_2790512_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	99.1	4.7e-132
WP_000847298.1|2790511_2790841_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918243.1|2790837_2793483_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	100.0	0.0e+00
WP_000532073.1|2793526_2793835_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479043.1|2793861_2794284_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|2794297_2795050_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_085948178.1|2795211_2796424_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000682711.1|2796427_2796574_-	hypothetical protein	NA	Q687G0	Enterobacteria_phage	100.0	3.5e-21
WP_000974958.1|2796586_2797210_-|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	100.0	8.9e-106
WP_001281348.1|2797212_2797494_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	100.0	2.1e-46
WP_001097065.1|2797486_2797813_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114424.1|2797900_2799925_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974564.1|2799869_2801372_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102413.1|2801371_2801584_-	hypothetical protein	NA	Q687G1	Enterobacteria_phage	98.6	2.3e-29
WP_001077625.1|2801580_2803704_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000373407.1|2803700_2804177_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_012816791.1|2804650_2804836_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000752026.1|2805839_2806109_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|2806118_2807066_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000144764.1|2807998_2808193_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001108006.1|2808189_2808795_-	recombination protein NinG	NA	Q8VNP2	Enterobacteria_phage	100.0	1.9e-97
WP_000211413.1|2809592_2810297_-	phage antirepressor Ant	NA	Q8VNP5	Enterobacteria_phage	100.0	9.6e-133
WP_001254256.1|2810571_2810754_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153268.1|2810750_2811278_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001303571.1|2811274_2811721_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_001449504.1|2811677_2811914_-	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_000103678.1|2811924_2812140_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001000130.1|2812272_2812551_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_001036037.1|2812620_2812890_-	hypothetical protein	NA	Q687G4	Enterobacteria_phage	100.0	8.4e-45
WP_085948178.1|2813350_2814564_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000448925.1|2815628_2816045_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_000214990.1|2816117_2817866_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
>prophage 14
NZ_CP027347	Escherichia coli strain 2013C-4361 chromosome, complete genome	5317846	2891108	2898248	5317846		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|2891108_2893670_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141347.1|2893775_2894432_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
WP_001297141.1|2894482_2895250_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|2895445_2896354_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590389.1|2896350_2897613_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
WP_001278994.1|2897609_2898248_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 15
NZ_CP027347	Escherichia coli strain 2013C-4361 chromosome, complete genome	5317846	4443580	4478579	5317846	head,capsid,terminase,holin,tail,tRNA	Stx2-converting_phage(44.83%)	33	NA	NA
WP_001047110.1|4443580_4444333_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	99.2	5.3e-137
WP_001339373.1|4444642_4444795_+	restriction endonuclease subunit M	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
WP_000143076.1|4445612_4447463_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.9	0.0e+00
WP_000411802.1|4447911_4448118_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075132.1|4448117_4448615_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_001208681.1|4448831_4449017_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_001303878.1|4449544_4449859_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000958398.1|4450759_4451323_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	7.3e-83
WP_009453642.1|4451319_4452981_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	98.7	0.0e+00
WP_000173088.1|4453044_4454982_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	98.4	0.0e+00
WP_001063096.1|4455026_4455248_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000125988.1|4457611_4457938_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|4457947_4458298_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|4458294_4458741_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|4458737_4459082_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275461.1|4459148_4459865_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.3	2.1e-127
WP_001030043.1|4459870_4460245_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001453698.1|4460340_4460550_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212952.1|4460601_4463844_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.2	0.0e+00
WP_000807964.1|4463836_4464178_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001152209.1|4464177_4464876_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	3.1e-131
WP_000194763.1|4464886_4465630_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_126303346.1|4465575_4466208_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.5	1.2e-97
WP_106888399.1|4466443_4469920_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.1	0.0e+00
WP_001216290.1|4469988_4470612_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_106888400.1|4470676_4471999_+|tail	phage tail protein	tail	Q687E6	Enterobacteria_phage	99.3	8.3e-77
WP_001023356.1|4472000_4472270_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
WP_000442132.1|4472430_4472853_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001345294.1|4472982_4474041_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001117798.1|4474119_4474770_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132154.1|4474952_4475543_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|4476044_4476293_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000543817.1|4477541_4478579_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 16
NZ_CP027347	Escherichia coli strain 2013C-4361 chromosome, complete genome	5317846	4605005	4656958	5317846	protease,transposase,tRNA	Vibrio_phage(15.38%)	49	NA	NA
WP_001232412.1|4605005_4606010_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4606012_4607272_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460353.1|4607357_4608638_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|4608714_4609023_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280349.1|4609108_4610059_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122520.1|4610051_4611899_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_000990321.1|4611908_4613246_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|4613264_4613726_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_001307537.1|4613697_4615245_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001294195.1|4615243_4616383_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010723271.1|4616365_4616419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|4617282_4617828_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|4617922_4618975_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_000934920.1|4619071_4620040_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236850.1|4620061_4623385_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001276180.1|4623413_4623728_-	YjeO family protein	NA	NA	NA	NA	NA
WP_000342867.1|4623724_4624039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001346081.1|4624090_4625593_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004771.1|4625811_4626789_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001192991.1|4627113_4628922_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|4628914_4629649_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000208757.1|4629659_4630055_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_001299198.1|4630065_4630425_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001299193.1|4630487_4631621_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001238378.1|4631709_4632243_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_000118482.1|4632239_4632557_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000239596.1|4632738_4632885_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977757.1|4632995_4633121_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|4633172_4633739_-	elongation factor P	NA	NA	NA	NA	NA
WP_000940530.1|4633780_4634809_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_001008073.1|4635198_4636068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000558209.1|4636271_4636625_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|4636761_4638408_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|4638451_4638745_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000015837.1|4639020_4640277_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267448.1|4640292_4640769_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000069437.1|4641105_4642542_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961959.1|4642659_4643961_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000883400.1|4644076_4644415_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000068905.1|4644390_4646088_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001188520.1|4646124_4646700_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_106888402.1|4647079_4647346_+	DUF4102 domain-containing protein	NA	E5AGD0	Erwinia_phage	55.4	1.5e-17
WP_085948178.1|4647348_4648562_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000631719.1|4651319_4651667_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	1.0e-42
WP_000603950.1|4653988_4654537_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9LA63	Enterobacterial_phage	32.4	1.3e-15
WP_001340019.1|4655460_4655664_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_159026288.1|4655595_4655925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159030177.1|4655988_4656666_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_106888404.1|4656613_4656958_+|transposase	transposase	transposase	A0A1W6JP07	Morganella_phage	97.3	4.5e-51
>prophage 17
NZ_CP027347	Escherichia coli strain 2013C-4361 chromosome, complete genome	5317846	5173571	5184443	5317846	transposase,integrase	Enterobacteria_phage(22.22%)	10	5167163:5167176	5181772:5181785
5167163:5167176	attL	AACAAATTGCCGCC	NA	NA	NA	NA
WP_000749863.1|5173571_5174627_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|5174914_5176018_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893251.1|5176029_5177283_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
WP_000772642.1|5177638_5178853_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.5e-133
WP_000251023.1|5178995_5179877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000083330.1|5180074_5180272_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	48.1	1.7e-07
WP_001035842.1|5180271_5180703_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	5.1e-28
WP_001019379.1|5180715_5181549_+	hypothetical protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_085948178.1|5181682_5182895_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
5181772:5181785	attR	GGCGGCAATTTGTT	NA	NA	NA	NA
WP_000942525.1|5183372_5184443_+	DNA cytosine methyltransferase	NA	A0A1B1IRZ3	uncultured_Mediterranean_phage	29.6	2.6e-20
