The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027368	Escherichia coli strain 2014C-3307 chromosome, complete genome	4965987	63120	144130	4965987	integrase,portal,protease,tRNA,capsid,tail,head,terminase,lysis	Enterobacteria_phage(70.37%)	87	56242:56258	115603:115619
56242:56258	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001163428.1|63120_63321_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001281193.1|63444_63789_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	1.0e-58
WP_000120059.1|64031_64634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|64844_65066_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000084446.1|65219_66284_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	64.8	1.0e-133
WP_000682291.1|66280_66439_-	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	88.5	1.3e-21
WP_096096059.1|66435_67116_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	96.9	1.6e-129
WP_106888931.1|67112_67898_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	4.1e-148
WP_000995439.1|67903_68200_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_001309317.1|68275_68566_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	83.8	5.0e-27
WP_001444023.1|69031_69352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000066829.1|69487_69751_-	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	95.4	4.2e-41
WP_001295669.1|69833_70526_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
WP_000184665.1|70636_70864_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001182882.1|70894_71434_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
WP_047659237.1|71520_72450_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	67.0	6.8e-110
WP_047659230.1|72446_73148_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.9	2.1e-127
WP_072134425.1|73144_73324_+	MarR family transcriptional regulator	NA	M1FPD5	Enterobacteria_phage	96.6	5.4e-24
WP_047659229.1|73712_75608_+	NACHT domain-containing protein	NA	NA	NA	NA	NA
WP_021568450.1|76219_76834_+	hypothetical protein	NA	Q7Y5X0	Haemophilus_phage	41.7	6.4e-32
WP_000986835.1|76893_77145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047659228.1|77315_77771_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	2.7e-59
WP_047659227.1|77770_77941_+	prophage protein NinE	NA	K7P7K0	Enterobacteria_phage	69.8	3.1e-13
WP_000774504.1|77933_78224_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_106888932.1|78220_78583_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	1.2e-59
WP_000971055.1|78579_78720_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204780.1|78805_79189_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000737283.1|79378_80476_-	porin	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_000839596.1|81065_81281_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135277.1|81280_81778_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_000738423.1|82266_82560_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001307652.1|82919_83114_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_001598040.1|83502_84048_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	2.3e-94
WP_106888933.1|84022_85948_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_106888934.1|86148_87750_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.9e-309
WP_000123307.1|87730_89050_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.5	6.7e-236
WP_001297109.1|89059_89392_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_096096220.1|89447_90473_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	1.1e-188
WP_096096219.1|90514_90910_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.2	4.1e-56
WP_000752986.1|90921_91275_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	2.6e-62
WP_096096218.1|91286_91865_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	3.9e-79
WP_000683105.1|91861_92257_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001345558.1|92264_93005_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	2.0e-128
WP_000479169.1|93020_93443_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459457.1|93424_93859_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000847345.1|96408_96738_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001152612.1|96737_97436_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194781.1|97441_98185_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.3e-148
WP_000090917.1|98121_98754_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_106888935.1|98814_102213_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	86.0	0.0e+00
WP_001230388.1|102279_102879_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.5	1.5e-110
WP_000279098.1|102943_106342_+	hypothetical protein	NA	X2KTY7	Enterobacteria_phage	36.4	8.2e-12
WP_001366102.1|106341_106926_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	1.1e-102
WP_000239888.1|106980_107649_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937500.1|107705_108011_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226376.1|108194_109679_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|109865_110819_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000958660.1|111191_112349_-|integrase	prophage integrase IntS	integrase	K7P7E1	Enterobacteria_phage	98.7	4.1e-221
WP_000368131.1|112660_113593_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000776768.1|113886_114642_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000937840.1|114823_115882_-	hypothetical protein	NA	NA	NA	NA	NA
115603:115619	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001296861.1|116247_117588_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000030901.1|117959_118244_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_000531954.1|118423_119734_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000426164.1|119733_121878_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_001195819.1|122080_122566_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000033328.1|123240_123804_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001757542.1|123885_126531_+	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000482748.1|126550_127303_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000018471.1|127318_127828_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000714140.1|127824_128313_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000844745.1|128309_128849_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000698675.1|128850_129705_+	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730806.1|129777_130329_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001295704.1|130494_131427_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000918470.1|131461_132547_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001043812.1|132550_133375_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000447361.1|133374_134184_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_001089235.1|134183_134732_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000559764.1|134765_135044_+	YfcL family protein	NA	NA	NA	NA	NA
WP_000683799.1|135164_137171_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817178.1|137329_138550_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000127756.1|138833_140012_+	MFS transporter	NA	NA	NA	NA	NA
WP_000615813.1|140008_141004_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000699121.1|141102_142239_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
WP_001289162.1|142304_143318_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001283590.1|143317_144130_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP027368	Escherichia coli strain 2014C-3307 chromosome, complete genome	4965987	343634	353075	4965987		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569327.1|343634_344561_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|344565_345297_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|345277_345385_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|345444_346176_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|346397_348083_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|348079_348799_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|348845_349316_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|349356_349818_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_106888938.1|349857_351942_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.9	0.0e+00
WP_001292774.1|351938_353075_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 3
NZ_CP027368	Escherichia coli strain 2014C-3307 chromosome, complete genome	4965987	690633	761529	4965987	integrase,protease,tRNA,transposase,head,plate,tail	Shigella_phage(46.51%)	87	743526:743540	761582:761596
WP_001220997.1|690633_691329_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290576.1|691368_691950_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_000758422.1|692154_693840_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_001303529.1|693921_695037_+	ribonuclease D	NA	NA	NA	NA	NA
WP_001287035.1|695090_696056_-	carnitine monooxygenase subunit YeaX	NA	NA	NA	NA	NA
WP_000067832.1|696111_697236_-	carnitine monooxygenase subunit YeaW	NA	NA	NA	NA	NA
WP_000987525.1|697267_698878_-	BCCT family transporter YeaV	NA	NA	NA	NA	NA
WP_000978509.1|699128_700214_-	multifunctional D-malate/3-isopropylmalate/tartarate dehydrogenase	NA	NA	NA	NA	NA
WP_001061578.1|700316_701240_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000457202.1|701366_702005_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_001349736.1|702213_703176_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	1.8e-41
WP_001355765.1|703183_704392_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.0	7.3e-205
WP_000512153.1|704618_704867_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_001386836.1|704925_705000_-	protein YoaJ	NA	NA	NA	NA	NA
WP_001219350.1|705002_705101_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_106888947.1|705133_706159_-	diguanylate cyclase DgcP	NA	NA	NA	NA	NA
WP_000691905.1|706341_706596_+	DUF333 domain-containing lipoprotein YoaF	NA	NA	NA	NA	NA
WP_001297652.1|706617_706965_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_000128478.1|707019_708201_-	2-nitroimidazole transporter	NA	NA	NA	NA	NA
WP_000972252.1|708297_709119_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000460707.1|709075_709522_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_000999630.1|709691_709796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000138052.1|709796_710300_-|tRNA	mischarged aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_000766132.1|710342_711833_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
WP_000616433.1|712013_713489_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000219686.1|713635_714919_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_001019882.1|715031_716966_-	protein kinase YeaG	NA	NA	NA	NA	NA
WP_000163771.1|717401_718148_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_001186343.1|718237_719092_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
WP_001299317.1|719142_720027_-	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_000153502.1|720110_721106_-	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001284613.1|721447_721861_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_001046790.1|721902_722175_+	YeaC family protein	NA	NA	NA	NA	NA
WP_000528256.1|723168_723906_-	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	78.6	2.9e-103
WP_001443803.1|723859_724060_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001114107.1|724675_724921_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000221106.1|724956_725136_-	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	55.3	6.0e-07
WP_001432608.1|725193_727212_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	H6WZJ9	Escherichia_phage	62.0	7.4e-202
WP_000904930.1|727341_727902_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_001473653.1|728457_728979_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	51.4	6.0e-47
WP_000469163.1|729013_729925_-	hypothetical protein	NA	C9DGQ8	Escherichia_phage	47.5	2.2e-36
WP_000301578.1|729924_730485_-	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	49.1	3.9e-44
WP_001146835.1|730475_731558_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000763330.1|731557_731995_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_000980532.1|731987_732602_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000098808.1|732591_733716_-	hypothetical protein	NA	C9DGQ3	Escherichia_phage	48.5	7.7e-92
WP_000146118.1|733699_735049_-	DMT family permease	NA	C9DGQ2	Escherichia_phage	33.1	5.9e-54
WP_000113523.1|735035_737111_-	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	3.7e-71
WP_000213225.1|737237_737714_-	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000015473.1|737728_738094_-|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000606748.1|738102_739605_-|tail	tail protein	tail	C9DGP7	Escherichia_phage	51.5	1.5e-138
WP_000848437.1|739601_739847_-	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000627428.1|739847_740408_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	48.3	1.6e-42
WP_001104959.1|740404_740824_-	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	1.8e-33
WP_024017777.1|740820_741216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001142982.1|741259_742207_-|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_000850817.1|742206_743331_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.9	1.3e-78
WP_000094812.1|743507_743981_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	6.0e-38
743526:743540	attL	CTTTTTAAAGCGTTT	NA	NA	NA	NA
WP_000046906.1|744102_745434_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.8	2.7e-152
WP_000532587.1|745417_747007_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	8.5e-169
WP_001057670.1|747006_748671_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	2.4e-230
WP_000360582.1|748670_749252_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	56.8	5.5e-49
WP_001279083.1|749254_749545_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	4.7e-25
WP_000270158.1|749537_749849_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_000342749.1|749829_750057_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001122255.1|750067_750286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801859.1|750269_750698_-	endopeptidase	NA	NA	NA	NA	NA
WP_001125304.1|750732_751233_-	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_000852377.1|751304_751730_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001214359.1|751799_752309_-	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	41.9	2.0e-26
WP_000370523.1|752305_752602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086882.1|752591_752789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021231.1|752781_753114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000595948.1|753152_753338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973021.1|753334_753886_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000465562.1|753889_754405_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
WP_000564281.1|754404_754938_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.2	6.9e-67
WP_001129553.1|755580_756111_-	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000049304.1|756122_756416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049432.1|756420_756693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|756689_756971_-	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_001057199.1|756972_757227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000257930.1|757239_757461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000129790.1|757463_758396_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000289291.1|758467_760558_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	45.1	5.7e-165
WP_001310454.1|760559_760808_-	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_001432609.1|760998_761529_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	4.8e-36
761582:761596	attR	AAACGCTTTAAAAAG	NA	NA	NA	NA
>prophage 4
NZ_CP027368	Escherichia coli strain 2014C-3307 chromosome, complete genome	4965987	905182	1033104	4965987	integrase,holin,portal,protease,bacteriocin,tRNA,capsid,head,terminase,lysis	Shigella_phage(46.25%)	136	969057:969076	996784:996803
WP_001295400.1|905182_906457_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
WP_000789751.1|906518_907379_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_000765749.1|907422_908028_-	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_000100931.1|908133_909636_-	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_001030339.1|910246_910882_-	endonuclease III	NA	NA	NA	NA	NA
WP_001289657.1|910881_911577_-	electron transport complex subunit E	NA	NA	NA	NA	NA
WP_000920784.1|911580_912201_-	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_000915687.1|913262_915485_-	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_000991809.1|915477_916056_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_000133189.1|916055_916637_-	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_000214176.1|916713_917154_-	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000217950.1|917239_917455_-	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_001300888.1|917727_917853_-	division septum protein Blr	NA	NA	NA	NA	NA
WP_001282516.1|918095_919136_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000567488.1|919170_920172_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_000459406.1|920275_921448_-	bifunctional maltose regulon transcriptional repressor/cystathionine beta-lyase MalY	NA	NA	NA	NA	NA
WP_000125593.1|921457_923050_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_000179513.1|923224_924253_+	Mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_000483362.1|924364_925132_+	7-alpha-hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
WP_000969095.1|925360_925951_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000945924.1|926338_928150_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.7	0.0e+00
WP_001075893.1|928146_929520_+	glucuronide transporter	NA	NA	NA	NA	NA
WP_001043342.1|930867_932376_-	YdgA family protein	NA	NA	NA	NA	NA
WP_001170701.1|932476_933652_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000066639.1|933850_935497_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_001099102.1|935639_937043_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_000135186.1|937039_937969_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_001092519.1|939348_940068_-	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000524868.1|940196_940532_+	GlpM family protein	NA	NA	NA	NA	NA
WP_000513673.1|940528_941251_-	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_000412379.1|941287_942670_-	amino acid permease	NA	NA	NA	NA	NA
WP_000769322.1|942855_943800_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001355841.1|944323_945856_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000014036.1|945866_947255_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_001364183.1|948361_949591_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	54.9	1.9e-131
WP_000953271.1|949965_950154_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
WP_000103621.1|950645_950825_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	58.6	1.5e-10
WP_000201463.1|951329_951509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000226782.1|951701_951899_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_050867507.1|951891_952104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033882705.1|952093_952333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064565559.1|952325_952559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204993.1|952551_952785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770163.1|952790_953090_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_050867509.1|953086_954496_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	58.9	3.4e-113
WP_024174166.1|954698_954950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294166.1|954946_955252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064549425.1|955261_955672_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233314.1|955682_955931_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001137341.1|956235_957393_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.1e-137
WP_000504062.1|957432_958005_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	2.7e-61
WP_159027732.1|958042_959218_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.7	1.2e-183
WP_001020660.1|959214_959553_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.9e-30
WP_000134113.1|959549_959846_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001145905.1|959845_960286_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000113645.1|960575_960932_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000127882.1|960915_962577_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.2	5.7e-277
WP_000133415.1|962590_962872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303517.1|963958_964129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000276149.1|964235_964601_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_000046661.1|964587_964917_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_001260849.1|964955_965777_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|965876_965960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|966052_966388_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091849.1|966784_968038_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|968144_969038_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
969057:969076	attL	AGCCCGAAAAATGTGCTGTT	NA	NA	NA	NA
WP_000225276.1|969172_970393_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|970517_971213_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|971165_972458_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|972617_973232_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|973274_974129_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000254426.1|974130_974685_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.7	1.4e-62
WP_001387389.1|974722_975886_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	99.7	3.8e-227
WP_124034985.1|975741_976188_-	helix-turn-helix domain-containing protein	NA	S5FM74	Shigella_phage	73.1	4.2e-41
WP_000497813.1|976147_976399_-	DUF4222 domain-containing protein	NA	A0A088CBN9	Shigella_phage	100.0	1.3e-39
WP_040077670.1|976446_977127_-	YqaJ viral recombinase family protein	NA	V5UT69	Shigella_phage	99.6	3.5e-132
WP_000100822.1|977123_977909_-	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	100.0	6.3e-149
WP_047199897.1|977914_978211_-	host-nuclease inhibitor protein Gam	NA	A0A088CC13	Shigella_phage	100.0	2.5e-50
WP_103951104.1|978207_980256_-	exodeoxyribonuclease VIII	NA	A0A088CD28	Shigella_phage	99.4	0.0e+00
WP_086214805.1|980364_980751_-	hypothetical protein	NA	V5USC5	Shigella_phage	78.1	6.2e-49
WP_077166534.1|980841_981057_-	cell division protein FtsZ	NA	A0A088CE40	Shigella_phage	98.6	2.2e-35
WP_001005965.1|981388_981745_-	hypothetical protein	NA	A0A088CBI5	Shigella_phage	100.0	1.3e-56
WP_106888957.1|981776_982490_-	hypothetical protein	NA	A0A088CC14	Shigella_phage	99.2	1.2e-127
WP_000088198.1|982493_982766_-	hypothetical protein	NA	A0A088CD31	Shigella_phage	100.0	3.3e-41
WP_000239215.1|983160_983931_-	helix-turn-helix transcriptional regulator	NA	A0A088CBP2	Shigella_phage	100.0	1.5e-147
WP_001068241.1|984015_984243_+	hypothetical protein	NA	A0A088CE43	Shigella_phage	100.0	5.4e-37
WP_000084292.1|984386_984683_+	hypothetical protein	NA	A0A088CBI6	Shigella_phage	100.0	2.3e-48
WP_000438870.1|984697_984916_+	hypothetical protein	NA	A0A088CC17	Shigella_phage	100.0	1.1e-21
WP_050866384.1|984936_986019_+	DNA-binding protein	NA	V5URT9	Shigella_phage	99.4	7.0e-207
WP_000790394.1|986025_986766_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	100.0	2.5e-139
WP_106888958.1|986791_987562_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	99.2	9.5e-134
WP_001151119.1|987576_988008_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	100.0	2.5e-75
WP_000060692.1|988040_988715_-	DUF4145 domain-containing protein	NA	V5URE2	Shigella_phage	100.0	1.3e-123
WP_000354190.1|988713_988959_+	hypothetical protein	NA	A0A088CC19	Shigella_phage	100.0	6.2e-39
WP_001240641.1|989006_989312_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	100.0	3.4e-50
WP_000597785.1|989311_989590_-	hypothetical protein	NA	A0A2L1IV28	Escherichia_phage	97.8	2.2e-48
WP_032330641.1|989924_990239_+	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	75.0	7.0e-35
WP_106888959.1|990504_991167_+	hypothetical protein	NA	A0A088CD42	Shigella_phage	74.9	8.3e-86
WP_001076834.1|991221_991632_+	recombination protein NinB	NA	A0A088CBP6	Shigella_phage	98.5	3.9e-70
WP_106888960.1|991628_991820_+	NinE family protein	NA	A0A0P0ZDL7	Stx2-converting_phage	87.7	5.8e-24
WP_000002239.1|991843_992134_+	DUF1364 domain-containing protein	NA	A0A088CE53	Shigella_phage	99.0	1.1e-50
WP_001008116.1|992130_992493_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A088CBJ1	Shigella_phage	99.2	3.2e-63
WP_000992060.1|992492_992687_+	protein ninH	NA	A0A088CC23	Shigella_phage	100.0	1.4e-30
WP_106888961.1|993190_993784_+	hypothetical protein	NA	V5UT42	Shigella_phage	99.0	7.6e-107
WP_000691354.1|994359_995307_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|995316_995586_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_106888963.1|996078_998019_+	SASA family carbohydrate esterase	NA	S5MDQ7	Escherichia_phage	92.6	0.0e+00
996784:996803	attR	AGCCCGAAAAATGTGCTGTT	NA	NA	NA	NA
WP_000143459.1|998154_998334_+	DUF1378 family protein	NA	A0A088CBQ0	Shigella_phage	100.0	2.2e-25
WP_106888964.1|998374_998620_+	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	98.8	4.2e-19
WP_000284510.1|998697_998913_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000087453.1|998917_999451_+	lysozyme	NA	A0A088CC28	Shigella_phage	99.4	3.0e-102
WP_000455400.1|1000295_1000445_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	98.0	5.3e-17
WP_001385819.1|1000452_1000890_+|lysis	lysis protein	lysis	A0A088CBQ1	Shigella_phage	97.9	2.5e-70
WP_001109015.1|1001092_1001635_+	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	100.0	1.1e-99
WP_106888965.1|1002158_1002965_+|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	99.6	2.2e-133
WP_106888966.1|1004648_1006793_+|portal	portal protein	portal	A0A0P0ZGR1	Escherichia_phage	98.5	0.0e+00
WP_106888967.1|1006949_1007159_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	1.8e-15
WP_001140442.1|1009247_1009637_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_001482112.1|1009686_1010148_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	99.3	1.3e-74
WP_000829200.1|1010131_1010695_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_000207922.1|1010694_1011345_+	hypothetical protein	NA	A0A0P0ZG46	Escherichia_phage	100.0	4.6e-121
WP_052901188.1|1013190_1013862_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	84.3	5.1e-107
WP_106889000.1|1013939_1015565_+	hypothetical protein	NA	A0A0H4IT21	Shigella_phage	98.0	0.0e+00
WP_106888968.1|1015561_1016830_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	99.8	1.9e-219
WP_000455635.1|1016844_1017123_+	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
WP_001301884.1|1017128_1017746_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000835361.1|1017836_1018571_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZH34	Escherichia_phage	100.0	9.7e-136
WP_000078907.1|1018801_1018942_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035557.1|1018998_1019400_+	hypothetical protein	NA	A0A088CC37	Shigella_phage	100.0	1.2e-71
WP_000509481.1|1019494_1020151_+	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000455649.1|1020153_1020600_+	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
WP_000540391.1|1020609_1020861_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_106888969.1|1020871_1022137_+	hypothetical protein	NA	A0A0P0ZFI5	Escherichia_phage	99.8	6.9e-206
WP_106888970.1|1022206_1030588_+	hypothetical protein	NA	A0A0H4IT29	Shigella_phage	99.1	0.0e+00
WP_001273658.1|1031519_1031693_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001307098.1|1031775_1033104_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.9	1.1e-233
>prophage 5
NZ_CP027368	Escherichia coli strain 2014C-3307 chromosome, complete genome	4965987	1259825	1327688	4965987	integrase,holin,protease,capsid,tail,head,terminase,lysis	Escherichia_phage(27.45%)	75	1259662:1259686	1313883:1313907
1259662:1259686	attL	CAGTGTGGTACATGGATATCGATAC	NA	NA	NA	NA
WP_000113694.1|1259825_1260956_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	2.0e-103
WP_000113186.1|1260933_1261182_-	excisionase	NA	NA	NA	NA	NA
WP_052901065.1|1261246_1263718_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	2.0e-55
WP_000092839.1|1263813_1264002_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|1263998_1264187_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001365839.1|1264961_1265330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380317.1|1265341_1265494_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001003380.1|1265683_1266091_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	5.5e-24
WP_000476991.1|1266168_1266396_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705131.1|1266379_1266901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054520.1|1266881_1267847_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	5.0e-55
WP_000790460.1|1267853_1268594_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.1	4.7e-114
WP_106888975.1|1268623_1269385_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	64.0	1.4e-73
WP_000215513.1|1269444_1269639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211993.1|1269980_1270532_+	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	53.3	5.5e-43
WP_000882661.1|1270745_1270958_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	5.6e-28
WP_000042395.1|1271060_1271378_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001452497.1|1271966_1272194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024199763.1|1272247_1272517_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	52.5	1.2e-11
WP_050877448.1|1272518_1273568_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	4.5e-110
WP_000904164.1|1273580_1273943_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.9	2.4e-34
WP_001064918.1|1273935_1274601_+	antiterminator	NA	I6PDF8	Cronobacter_phage	52.0	1.6e-60
WP_000342737.1|1274853_1275567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917733.1|1275740_1275938_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
WP_064579144.1|1276088_1277147_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	4.4e-206
WP_000271629.1|1277627_1278056_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000382067.1|1278752_1279478_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_062878147.1|1281342_1283307_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	78.3	8.0e-294
WP_000142780.1|1283441_1283621_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	93.2	5.4e-24
WP_001290230.1|1283661_1283907_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1283984_1284200_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_039264424.1|1284203_1284995_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	86.7	4.0e-34
WP_001092874.1|1285506_1286040_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	1.4e-99
WP_072024677.1|1286196_1286379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024173692.1|1286527_1286995_+|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	87.1	7.9e-67
WP_000877795.1|1287175_1287721_+	hypothetical protein	NA	A0A0P0ZFJ1	Escherichia_phage	68.6	7.4e-64
WP_000828070.1|1288057_1288384_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095744.1|1288515_1288716_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829191.1|1288757_1289123_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	1.0e-61
WP_000958387.1|1289410_1289974_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001376400.1|1289970_1291632_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.8	0.0e+00
WP_000172990.1|1291695_1293633_+|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.7	0.0e+00
WP_001063099.1|1293677_1293899_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125990.1|1296425_1296752_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001029274.1|1296761_1297112_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	6.0e-59
WP_000573358.1|1297108_1297555_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	2.0e-75
WP_000133383.1|1297551_1297896_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	4.2e-57
WP_001275432.1|1297962_1298679_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	6.2e-127
WP_000710934.1|1298693_1299068_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	7.8e-65
WP_122993267.1|1299163_1299373_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	1.5e-33
WP_000212965.1|1299420_1302663_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	89.2	0.0e+00
WP_000343411.1|1302655_1302997_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	82.3	6.9e-52
WP_032308176.1|1302996_1303695_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.0	3.4e-130
WP_032308177.1|1303705_1304449_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	96.4	1.9e-147
WP_000246333.1|1304346_1304991_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	73.9	1.3e-88
WP_032308178.1|1305901_1309597_+	DUF1983 domain-containing protein	NA	Q6H9T2	Enterobacteria_phage	84.4	0.0e+00
WP_001270056.1|1309665_1310289_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	59.9	2.0e-65
WP_000216448.1|1310438_1311707_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	99.1	6.5e-55
WP_001049910.1|1311775_1312447_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	82.5	8.1e-105
WP_096891559.1|1312853_1313414_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.2	9.3e-54
WP_001079509.1|1314060_1314567_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
1313883:1313907	attR	CAGTGTGGTACATGGATATCGATAC	NA	NA	NA	NA
WP_001056491.1|1314612_1315113_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1315198_1315378_-	general stress protein	NA	NA	NA	NA	NA
WP_000443056.1|1315758_1316565_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|1316564_1317758_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001398955.1|1317769_1319128_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	1.5e-36
WP_000763511.1|1319131_1320727_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194591.1|1320726_1322289_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1322380_1322425_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|1322562_1323444_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1323440_1324061_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|1324161_1325034_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278904.1|1325073_1325664_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559282.1|1325660_1326419_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_000422043.1|1326638_1327688_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 6
NZ_CP027368	Escherichia coli strain 2014C-3307 chromosome, complete genome	4965987	1621935	1631319	4965987		Escherichia_phage(50.0%)	10	NA	NA
WP_000041535.1|1621935_1624362_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.9e-213
WP_001340362.1|1624422_1626846_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000213043.1|1626856_1626970_+	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	72.0	2.1e-05
WP_106888986.1|1627386_1627674_+	phage antirepressor Ant	NA	A0A0P0ZAZ7	Stx2-converting_phage	94.4	2.9e-43
WP_040078578.1|1627923_1628547_+	antirepressor	NA	A0A088CBR4	Shigella_phage	84.1	1.7e-96
WP_106888987.1|1628803_1629448_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	52.9	1.3e-56
WP_000763355.1|1629495_1629717_+	TraR/DksA family transcriptional regulator	NA	V5USD3	Shigella_phage	98.6	2.9e-35
WP_000020908.1|1629713_1629998_+	DUF4752 family protein	NA	A0A088CD82	Shigella_phage	100.0	1.2e-46
WP_042965387.1|1629984_1630821_+	ead/Ea22-like family protein	NA	A0A2I6TD51	Escherichia_phage	88.5	1.4e-127
WP_000256990.1|1631100_1631319_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	90.3	1.2e-28
>prophage 7
NZ_CP027368	Escherichia coli strain 2014C-3307 chromosome, complete genome	4965987	1640241	1691902	4965987	holin,integrase,portal,bacteriocin,capsid,terminase,lysis	Escherichia_phage(75.0%)	65	1622326:1622342	1699873:1699889
1622326:1622342	attL	AGCTGGGATGAAGCCCT	NA	NA	NA	NA
WP_106888990.1|1640241_1641507_-	hypothetical protein	NA	A0A088CBK4	Shigella_phage	78.1	1.9e-179
WP_106888991.1|1641517_1641769_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_106888992.1|1641778_1642225_-	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	97.3	4.4e-75
WP_106888993.1|1642227_1642884_-	hypothetical protein	NA	G9L6L9	Escherichia_phage	97.2	3.2e-106
WP_106888994.1|1642976_1643378_-	hypothetical protein	NA	A0A2L1IV61	Escherichia_phage	97.7	3.0e-70
WP_106888995.1|1643434_1643575_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	97.8	4.5e-18
WP_106888996.1|1643807_1644539_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2L1IV31	Escherichia_phage	75.9	1.9e-99
WP_106888997.1|1644625_1645243_-	hypothetical protein	NA	A0A2L1IV83	Escherichia_phage	96.6	1.0e-117
WP_106888998.1|1645246_1645528_-	hypothetical protein	NA	A0A2L1IV69	Escherichia_phage	93.5	1.1e-47
WP_106888999.1|1645542_1646811_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	97.6	5.3e-214
WP_106889000.1|1646807_1648433_-	hypothetical protein	NA	A0A0H4IT21	Shigella_phage	98.0	0.0e+00
WP_052901188.1|1648511_1649183_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	84.3	5.1e-107
WP_000118000.1|1649251_1651033_-	hypothetical protein	NA	A0A1I9LJS9	Stx_converting_phage	99.2	1.3e-61
WP_106889001.1|1651029_1651680_-	hypothetical protein	NA	A0A0H4J3F2	Shigella_phage	99.5	2.3e-120
WP_000829201.1|1651679_1652243_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	99.5	9.2e-102
WP_047081823.1|1652226_1652688_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	99.3	6.6e-74
WP_001140440.1|1652738_1653128_-	hypothetical protein	NA	A0A0H4IQ95	Shigella_phage	100.0	1.3e-62
WP_000214467.1|1653182_1654397_-|capsid	N4-gp56 family major capsid protein	capsid	A0A0N7KZY1	Escherichia_phage	100.0	1.7e-233
WP_047091030.1|1654420_1655428_-	hypothetical protein	NA	A0A0H4J3F0	Shigella_phage	100.0	3.0e-180
WP_106888966.1|1655585_1657730_-|portal	portal protein	portal	A0A0P0ZGR1	Escherichia_phage	98.5	0.0e+00
WP_000143994.1|1657729_1659436_-|terminase	terminase	terminase	A0A0H4IT14	Shigella_phage	100.0	0.0e+00
WP_106888965.1|1659416_1660223_-|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	99.6	2.2e-133
WP_001109015.1|1660746_1661289_-	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	100.0	1.1e-99
WP_001385819.1|1661491_1661929_-|lysis	lysis protein	lysis	A0A088CBQ1	Shigella_phage	97.9	2.5e-70
WP_000455400.1|1661936_1662086_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	98.0	5.3e-17
WP_000087453.1|1662930_1663464_-	lysozyme	NA	A0A088CC28	Shigella_phage	99.4	3.0e-102
WP_000284510.1|1663468_1663684_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_106888964.1|1663761_1664007_-	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	98.8	4.2e-19
WP_000143459.1|1664047_1664227_-	DUF1378 family protein	NA	A0A088CBQ0	Shigella_phage	100.0	2.2e-25
WP_106889002.1|1664362_1666300_-	SASA family carbohydrate esterase	NA	S5MDQ7	Escherichia_phage	92.7	0.0e+00
WP_001204859.1|1667521_1667956_-	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_000144767.1|1667948_1668143_-	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_000813671.1|1668139_1668703_-	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
WP_000402092.1|1668710_1669160_-	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_001694414.1|1669159_1670131_-	toprim domain protein	NA	A0A0H4IPK0	Shigella_phage	100.0	1.9e-195
WP_021500588.1|1670120_1671641_-	DEAD/DEAH box helicase	NA	A0A2R2Z335	Escherichia_phage	99.8	8.3e-307
WP_001271433.1|1671634_1672012_-	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_001369601.1|1672178_1672373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240876.1|1672543_1672747_-	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001056250.1|1672842_1673556_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_000939558.1|1673650_1675120_+	SAM-dependent methyltransferase	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
WP_001064714.1|1675116_1676070_+	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_016051777.1|1676686_1677472_+	regulatory protein	NA	A0A0P0ZG86	Escherichia_phage	100.0	9.4e-145
WP_001369605.1|1677727_1678402_+	ORF6N domain-containing protein	NA	A0A0P0ZGP9	Escherichia_phage	100.0	1.3e-123
WP_000917252.1|1678472_1678685_+	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
WP_000934197.1|1678696_1678978_+	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	100.0	3.0e-45
WP_000995345.1|1678998_1679280_+	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_000459721.1|1679296_1680247_+	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	100.0	1.1e-179
WP_000187063.1|1680243_1680933_+	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	100.0	3.5e-135
WP_000344637.1|1680932_1681520_+	hypothetical protein	NA	A0A0N7KZV4	Escherichia_phage	100.0	1.2e-107
WP_001071603.1|1681594_1681942_+	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
WP_000080417.1|1682005_1682827_+	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_001159717.1|1682903_1683347_+	hypothetical protein	NA	A0A0H4IQ60	Shigella_phage	100.0	3.9e-79
WP_001453790.1|1683454_1684333_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	100.0	1.0e-179
WP_000157000.1|1684329_1684533_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	100.0	4.7e-32
WP_000476216.1|1684525_1684765_+	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	97.5	6.7e-38
WP_000036158.1|1684761_1685463_+	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	100.0	1.7e-134
WP_001694420.1|1685976_1686906_+	DUF551 domain-containing protein	NA	A0A0H4IU61	Shigella_phage	100.0	5.1e-182
WP_106889003.1|1687261_1687897_+	phage antirepressor Ant	NA	A0A0P0ZG08	Escherichia_phage	93.9	2.5e-111
WP_000809302.1|1687952_1688384_+	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000163448.1|1688380_1689007_+	adenine methylase	NA	G9L6F9	Escherichia_phage	100.0	1.8e-122
WP_001291843.1|1688966_1689179_+	DUF1382 family protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
WP_000497812.1|1689957_1690209_+	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_001208772.1|1690254_1690539_+	excisionase family protein	NA	A0A0P0ZGY2	Escherichia_phage	100.0	7.0e-50
WP_001401545.1|1690591_1691902_+|integrase	site-specific integrase	integrase	A0A0P0ZGT7	Escherichia_phage	100.0	2.4e-254
1699873:1699889	attR	AGGGCTTCATCCCAGCT	NA	NA	NA	NA
>prophage 8
NZ_CP027368	Escherichia coli strain 2014C-3307 chromosome, complete genome	4965987	1831654	1914298	4965987	integrase,portal,protease,tRNA,capsid,tail,head,plate,terminase,lysis	Salmonella_phage(63.46%)	92	1865130:1865144	1916009:1916023
WP_001241678.1|1831654_1832359_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|1832643_1832862_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|1833545_1835822_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|1835852_1836173_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_033800998.1|1836998_1837280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047083765.1|1837559_1837994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050867514.1|1838155_1838569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106889009.1|1838581_1838917_-|head	head decoration protein	head	NA	NA	NA	NA
WP_050867512.1|1838928_1839984_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.4	2.1e-70
WP_050867511.1|1839983_1840190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032307311.1|1840607_1841030_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_047083326.1|1841026_1841278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106889010.1|1841650_1843783_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	53.1	5.3e-174
WP_000770163.1|1843779_1844079_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001824715.1|1844084_1844312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024213440.1|1845312_1845507_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.1	7.7e-16
WP_000410785.1|1847559_1847784_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188193.1|1847856_1849803_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
WP_000746460.1|1849799_1850915_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001355621.1|1851065_1852022_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599806.1|1852018_1853677_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_000488716.1|1854102_1854798_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491142.1|1855253_1856153_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458817.1|1856296_1857949_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178673.1|1857960_1858929_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815352.1|1859061_1860780_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	8.9e-31
WP_000566372.1|1860816_1861818_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136554.1|1861828_1863259_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|1863357_1864371_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255167.1|1864367_1865198_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
1865130:1865144	attL	AATGCCTTTTTCGCC	NA	NA	NA	NA
WP_001160737.1|1865194_1865518_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270734.1|1865643_1866159_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|1866376_1867105_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|1867122_1867854_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|1867860_1868577_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|1868576_1869245_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|1869536_1870268_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149732.1|1870442_1871570_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_000389260.1|1871610_1872099_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061657.1|1872158_1873004_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001093858.1|1873000_1873954_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000995994.1|1873963_1875097_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.9e-29
WP_000126065.1|1875191_1876304_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|1876655_1877132_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|1877219_1878122_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189152.1|1878182_1878905_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|1878888_1879176_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|1879335_1879593_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681108.1|1879622_1880000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024867.1|1880269_1881955_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|1882190_1882409_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001593256.1|1882499_1883600_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	85.5	4.5e-177
WP_106889012.1|1884078_1887156_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.6	0.0e+00
WP_000763311.1|1887148_1887268_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281016.1|1887282_1887585_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	8.2e-41
WP_001207660.1|1887639_1888155_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_032253870.1|1888164_1889337_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	4.6e-204
WP_000120166.1|1889468_1889903_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	40.6	4.2e-22
WP_032217052.1|1889902_1891633_-|tail	phage tail fiber protein	tail	A0A0M3ULH6	Salmonella_phage	62.8	4.7e-80
WP_061348707.1|1891629_1892235_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	7.5e-110
WP_061348708.1|1892227_1893136_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	9.2e-144
WP_000177574.1|1893122_1893482_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	87.4	4.2e-52
WP_032331041.1|1893478_1894057_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	7.2e-94
WP_044711059.1|1894160_1894967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061348709.1|1894908_1895355_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.5	1.6e-56
WP_097424227.1|1895347_1895779_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	91.6	1.9e-70
WP_000196201.1|1895874_1896303_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	88.7	2.8e-58
WP_061348711.1|1896299_1896815_-	lysozyme	NA	E5G6N1	Salmonella_phage	92.4	2.1e-89
WP_042106347.1|1896795_1897011_-	membrane protein	NA	E5G6N0	Salmonella_phage	78.9	6.9e-26
WP_000868175.1|1897014_1897218_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673524.1|1897217_1897682_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.4e-76
WP_042096894.1|1897777_1898428_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.4	1.2e-110
WP_000742503.1|1898431_1899490_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	8.4e-181
WP_061348712.1|1899506_1900340_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	84.8	5.3e-122
WP_106889013.1|1900482_1902249_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.1	0.0e+00
WP_061348713.1|1902248_1903274_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	90.0	4.0e-172
WP_052431344.1|1903322_1904117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044069624.1|1904191_1905199_-	ParA family protein	NA	Q7M293	Enterobacteria_phage	27.8	6.4e-21
WP_001059831.1|1905743_1906079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|1906271_1906505_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154431.1|1906515_1906704_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_106889014.1|1906856_1909271_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.3	0.0e+00
WP_095885227.1|1909267_1910125_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.9e-160
WP_000752613.1|1910121_1910349_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244216.1|1910348_1910582_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	9.2e-32
WP_001747374.1|1910649_1910991_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	97.3	6.6e-55
WP_095885228.1|1911108_1911405_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
WP_000460893.1|1911412_1911922_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_001247707.1|1911954_1912176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047320.1|1912301_1912871_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.9	2.9e-39
WP_001513672.1|1912886_1913078_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_106889015.1|1913266_1914298_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	55.8	5.6e-105
1916009:1916023	attR	GGCGAAAAAGGCATT	NA	NA	NA	NA
>prophage 9
NZ_CP027368	Escherichia coli strain 2014C-3307 chromosome, complete genome	4965987	3181894	3226909	4965987	integrase,holin,portal,tRNA,tail,terminase,lysis	Escherichia_phage(46.94%)	52	3181945:3181959	3221033:3221047
WP_000543828.1|3181894_3182932_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
3181945:3181959	attL	CAGCACCCGCTTTAT	NA	NA	NA	NA
WP_000332264.1|3183020_3184118_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	100.0	4.3e-212
WP_001217557.1|3184179_3184428_+	DinI family protein	NA	S5MQI1	Escherichia_phage	100.0	8.3e-39
WP_001373129.1|3184697_3185372_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	90.1	3.3e-114
WP_106889045.1|3185358_3185595_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000078855.1|3187403_3187544_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	93.5	8.5e-17
WP_106889046.1|3187742_3191429_-	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	88.0	0.0e+00
WP_136754566.1|3191669_3192302_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	89.0	3.7e-99
WP_047091036.1|3192247_3192991_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	98.0	1.7e-148
WP_001365876.1|3193001_3193700_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.3	1.4e-131
WP_000847298.1|3193699_3194029_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_047087056.1|3194025_3196671_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.2	0.0e+00
WP_000532074.1|3196714_3197023_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	100.0	7.8e-55
WP_000479054.1|3197049_3197472_-|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	100.0	5.1e-73
WP_000174601.1|3197487_3198237_-|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	99.6	4.7e-138
WP_000682704.1|3198244_3198643_-	hypothetical protein	NA	S5MW30	Escherichia_phage	100.0	2.7e-71
WP_000974964.1|3198652_3199279_-	hypothetical protein	NA	S5MBY4	Escherichia_phage	100.0	7.8e-102
WP_001281344.1|3199281_3199563_-	hypothetical protein	NA	S5MDP9	Escherichia_phage	100.0	7.2e-47
WP_001097058.1|3199555_3199882_-	DUF2190 family protein	NA	S5MQJ5	Escherichia_phage	100.0	6.1e-50
WP_000974564.1|3201937_3203440_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102415.1|3203439_3203652_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_047087055.1|3203648_3205772_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.6	0.0e+00
WP_000348565.1|3205768_3206245_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_032307093.1|3206697_3207165_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	86.5	4.8e-64
WP_106889047.1|3207169_3207694_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.3	1.3e-97
WP_000406285.1|3207818_3208106_+	hypothetical protein	NA	I6S632	Salmonella_phage	55.8	1.4e-21
WP_001371270.1|3208110_3208338_-	DUF1327 domain-containing protein	NA	Q5G8W5	Enterobacteria_phage	50.7	4.6e-12
WP_032307095.1|3208367_3208925_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	81.7	8.9e-49
WP_000284506.1|3208928_3209144_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290230.1|3209221_3209467_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|3209507_3209687_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000738072.1|3212293_3212563_-	Shiga toxin Stx2a subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
WP_032360617.1|3212574_3213534_-	Shiga toxin Stx2 subunit A	NA	Q776Q3	Enterobacteria_phage	99.7	2.1e-175
WP_000483502.1|3213916_3214975_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.9	2.0e-206
WP_000917735.1|3215126_3215324_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_001204806.1|3215539_3215920_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	100.0	4.9e-67
WP_106889049.1|3215937_3216927_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	8.1e-194
WP_001061444.1|3216934_3217744_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_000767113.1|3217763_3218153_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210155.1|3218149_3218476_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	7.8e-53
WP_000066917.1|3218472_3219126_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_106889050.1|3219220_3220048_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	91.2	2.9e-128
WP_000620696.1|3220044_3220269_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_047091769.1|3220265_3221414_-	peptidase	NA	A0A0P0ZE80	Stx2-converting_phage	84.1	1.3e-179
3221033:3221047	attR	CAGCACCCGCTTTAT	NA	NA	NA	NA
WP_000515856.1|3221410_3221962_-	hypothetical protein	NA	A0A0P0ZE62	Stx2-converting_phage	100.0	3.4e-101
WP_001191670.1|3221954_3222215_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZCZ7	Stx2-converting_phage	100.0	1.6e-40
WP_001020631.1|3222312_3223005_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	95.7	1.4e-120
WP_000135680.1|3223706_3224069_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_106889051.1|3224134_3224959_+	DUF2303 family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_047091546.1|3225087_3225612_+	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	97.7	1.0e-94
WP_047091545.1|3225720_3226587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093921.1|3226627_3226909_+	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	95.7	4.1e-42
>prophage 10
NZ_CP027368	Escherichia coli strain 2014C-3307 chromosome, complete genome	4965987	4674482	4681622	4965987		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|4674482_4675121_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|4675117_4676380_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|4676376_4677285_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|4677480_4678248_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141330.1|4678298_4678955_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272881.1|4679060_4681622_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.4	3.0e-30
>prophage 1
NZ_CP027369	Escherichia coli strain 2014C-3307 plasmid unnamed1, complete sequence	109641	141	108649	109641	portal,tail,integrase,capsid,tRNA	Salmonella_phage(84.82%)	122	96650:96667	106685:106702
WP_106889095.1|141_1320_-	DNA primase	NA	J9Q720	Salmonella_phage	93.2	3.1e-208
WP_049076695.1|1402_2743_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	93.5	2.6e-235
WP_061158042.1|2786_3527_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	89.2	4.9e-127
WP_086118711.1|3729_4089_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	96.9	3.3e-44
WP_000161228.1|4088_4757_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	91.4	1.7e-110
WP_086118716.1|4917_5613_-	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	68.9	2.2e-89
WP_085453123.1|5645_6068_-	hypothetical protein	NA	J9Q6E9	Salmonella_phage	87.9	4.4e-64
WP_047659388.1|6395_6647_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	77.1	2.8e-26
WP_086118712.1|6648_7341_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	94.3	2.3e-123
WP_000064177.1|7354_7678_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	87.9	1.9e-43
WP_106889140.1|7792_8458_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	89.5	2.2e-110
WP_000438829.1|8469_8682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106889096.1|9817_10555_-	collagen-like protein	NA	J9Q6E3	Salmonella_phage	71.1	5.5e-62
WP_106889097.1|10649_15257_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	78.0	0.0e+00
WP_014962316.1|15273_15864_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	95.9	2.9e-106
WP_106889098.1|15851_16649_-|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	93.6	1.1e-153
WP_106889099.1|16641_17340_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	96.1	1.5e-133
WP_106889100.1|17427_17763_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	84.5	5.7e-51
WP_001308875.1|22382_22652_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	94.8	1.7e-34
WP_052904348.1|22732_23050_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	94.3	1.6e-47
WP_052904346.1|23117_23858_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	89.0	1.5e-115
WP_052904344.1|23931_24315_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	81.1	2.1e-57
WP_052904343.1|24316_24790_-	hypothetical protein	NA	J9Q711	Salmonella_phage	89.8	1.2e-75
WP_106889101.1|24780_25125_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	94.7	3.3e-54
WP_052904339.1|25196_26030_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	89.2	6.2e-139
WP_052904337.1|26029_26464_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	81.2	1.3e-60
WP_106889102.1|26561_27482_-|capsid	phage major capsid protein	capsid	J9Q710	Salmonella_phage	87.3	1.3e-148
WP_106889103.1|27507_28404_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	87.9	3.6e-132
WP_106889104.1|28467_30000_-|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	92.5	1.4e-277
WP_001007301.1|30026_31283_-	hypothetical protein	NA	J9Q7Y2	Salmonella_phage	96.7	7.5e-245
WP_106889105.1|31282_31915_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	83.8	3.1e-90
WP_000176292.1|32110_32377_-	hypothetical protein	NA	J9Q757	Salmonella_phage	88.6	1.4e-36
WP_106889106.1|32386_33286_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.0	2.9e-166
WP_001113022.1|33282_33537_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	96.4	5.9e-40
WP_000049675.1|33529_34168_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.6	1.2e-110
WP_000161986.1|34164_34833_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	89.6	5.6e-106
WP_024170896.1|34832_35531_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	87.1	5.1e-110
WP_106889107.1|35595_37155_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.1	7.0e-277
WP_001291061.1|37157_37436_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	58.2	4.6e-22
WP_106889108.1|37468_38068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106889109.1|38208_39342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106889110.1|39464_40265_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	32.5	9.3e-07
WP_106889111.1|40367_40886_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	69.6	3.8e-54
WP_159027736.1|40895_41075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106889112.1|41489_42140_+	hypothetical protein	NA	J9Q754	Salmonella_phage	84.7	1.9e-98
WP_106889113.1|42187_42391_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	92.5	4.5e-27
WP_000497810.1|42411_42642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106889114.1|43254_43737_-	hypothetical protein	NA	J9Q805	Salmonella_phage	69.2	5.1e-61
WP_106889141.1|43941_44223_-	ABC transporter	NA	J9Q753	Salmonella_phage	79.6	9.4e-39
WP_106889115.1|44525_44921_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	54.6	1.8e-32
WP_106889116.1|45045_45357_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	63.1	1.7e-28
WP_000457884.1|45510_45840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001405018.1|47403_47625_-	hypothetical protein	NA	J9Q750	Salmonella_phage	52.2	8.7e-16
WP_106889117.1|47885_48578_-	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	67.1	4.6e-79
WP_001718028.1|48730_50764_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	24.1	2.2e-44
WP_000004356.1|50921_52022_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_000506720.1|52059_52449_-	DNA repair protein	NA	A0A077SK24	Escherichia_phage	93.0	8.6e-67
WP_032203392.1|52621_53146_-	toprim domain-containing protein	NA	A0A2D2W4T4	Escherichia_phage	48.5	3.8e-33
WP_106889142.1|53159_54011_-	hypothetical protein	NA	A0A0F6TJ66	Escherichia_coli_O157_typing_phage	91.4	4.9e-22
WP_053265198.1|54010_54232_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	50.0	2.5e-10
WP_106889118.1|54224_54959_-	DUF551 domain-containing protein	NA	A0A2I6TCG8	Escherichia_phage	82.9	6.2e-74
WP_048959289.1|54955_55279_-	carboxylate--amine ligase	NA	A0A222YZB4	Escherichia_phage	80.4	9.7e-40
WP_096097032.1|55280_55796_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	53.8	3.4e-42
WP_106889119.1|55782_56097_-	hypothetical protein	NA	B1GS43	Salmonella_phage	85.1	3.6e-39
WP_077817338.1|56093_56630_-	hypothetical protein	NA	A0A2I6TCH0	Escherichia_phage	55.5	2.0e-21
WP_094276190.1|56629_57172_-	hypothetical protein	NA	J9Q748	Salmonella_phage	87.4	1.4e-86
WP_094276189.1|57168_57810_-	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	87.8	1.3e-99
WP_106889120.1|57929_58310_-	hypothetical protein	NA	J9Q801	Salmonella_phage	65.1	5.5e-26
WP_052904845.1|58309_59014_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	76.9	7.2e-88
WP_106889121.1|59075_60761_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	90.7	4.0e-310
WP_052904287.1|60864_61479_-	hypothetical protein	NA	A0A0E3GMH9	Enterobacteria_phage	81.4	7.4e-97
WP_052904286.1|61820_62390_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	60.9	1.8e-52
WP_064758587.1|62529_62688_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_052904285.1|62684_63113_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	83.7	2.8e-58
WP_052904284.1|63206_63395_-	hypothetical protein	NA	J9Q800	Salmonella_phage	64.0	9.4e-11
WP_001348724.1|63404_63899_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	55.4	5.2e-24
WP_106889122.1|64047_64638_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	82.7	4.1e-92
WP_106889123.1|65219_65450_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	85.5	2.0e-31
WP_033803590.1|65636_66230_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	85.8	1.7e-98
WP_106889124.1|66412_67222_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	53.6	2.0e-65
WP_053265183.1|67382_67937_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	79.2	2.0e-80
WP_001718079.1|67946_68366_-	hypothetical protein	NA	J9Q743	Salmonella_phage	71.9	3.2e-51
WP_000386469.1|68427_69072_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	81.3	7.8e-97
WP_096097038.1|69071_69548_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	89.9	2.9e-80
WP_106889125.1|69544_69958_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	86.9	5.6e-64
WP_094308012.1|69959_71087_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	87.5	3.0e-192
WP_106889126.1|71232_72102_-	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	80.6	2.4e-133
WP_103809002.1|72179_73322_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	88.4	1.3e-195
WP_106889127.1|73427_75743_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	84.2	0.0e+00
WP_000037962.1|75816_76386_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	86.8	1.1e-91
WP_106889128.1|76395_77139_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	47.2	2.6e-51
WP_106889129.1|77128_79045_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	72.9	1.4e-247
WP_085949095.1|79041_79233_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	74.6	8.3e-23
WP_052904856.1|79274_80360_-	exonuclease	NA	J9Q7S9	Salmonella_phage	87.0	8.9e-186
WP_000364573.1|80613_81258_-	hypothetical protein	NA	J9Q739	Salmonella_phage	86.3	2.9e-107
WP_000105080.1|81579_82674_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	45.4	1.3e-75
WP_001229345.1|83253_83466_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	3.4e-33
WP_000644408.1|83465_83801_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	73.9	6.6e-39
WP_106889130.1|84016_84292_-	hypothetical protein	NA	J9Q738	Salmonella_phage	74.7	1.2e-33
WP_094171764.1|84347_84764_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	76.9	1.5e-61
WP_014962292.1|84836_85226_-	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	82.5	4.3e-58
WP_052904860.1|85246_85987_-	hypothetical protein	NA	G4KK93	Yersinia_phage	32.7	5.7e-27
WP_106889131.1|86033_86858_-	hypothetical protein	NA	A0A0U4IID7	Pseudomonas_phage	25.3	7.1e-18
WP_000715581.1|86953_87784_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	94.9	3.1e-122
WP_021533191.1|87787_87988_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	59.1	7.2e-09
WP_106889132.1|88080_90420_-	recombinase RecA	NA	J9Q736	Salmonella_phage	85.1	1.8e-29
WP_000920224.1|90422_90689_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	77.3	2.6e-30
WP_001755518.1|90688_91633_-	5'-3' exonuclease SAM fold family protein	NA	J9Q7S6	Salmonella_phage	88.9	1.0e-161
WP_001717300.1|91693_92722_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	86.3	1.4e-143
WP_000627054.1|92839_93271_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	86.7	1.5e-64
WP_106889133.1|93396_96915_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	94.0	0.0e+00
96650:96667	attL	AATGATTCCATACATCTC	NA	NA	NA	NA
WP_096842486.1|97095_98331_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	81.0	2.0e-197
WP_106889135.1|98426_100535_-	cobalamin biosynthesis protein CobT	NA	J9Q7G6	Salmonella_phage	66.2	4.8e-228
WP_052904258.1|100634_100847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052904257.1|101094_101481_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_052904867.1|101475_102579_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	33.8	1.3e-27
WP_106889136.1|102786_104700_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	49.9	6.6e-176
WP_106889137.1|106261_106552_-	C-type natriuretic protein	NA	J9Q7S1	Salmonella_phage	77.1	1.5e-36
WP_106889138.1|106697_106913_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	72.5	7.4e-20
106685:106702	attR	GAGATGTATGGAATCATT	NA	NA	NA	NA
WP_016607331.1|106896_107076_-	hypothetical protein	NA	J9Q729	Salmonella_phage	70.7	8.4e-17
WP_106889139.1|107072_108395_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	90.9	1.0e-239
WP_000989357.1|108391_108649_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	59.0	3.9e-15
>prophage 1
NZ_CP027370	Escherichia coli strain 2014C-3307 plasmid unnamed2	176149	29419	88302	176149	transposase,integrase	Stx2-converting_phage(30.77%)	39	23117:23133	95360:95376
23117:23133	attL	TGTTGTGCATCAAGAAC	NA	NA	NA	NA
WP_047086367.1|29419_31012_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	4.6e-175
WP_001278818.1|31216_31633_-	recombinase	NA	NA	NA	NA	NA
WP_096955086.1|31625_32606_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	2.9e-79
WP_000030199.1|33020_33329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001144036.1|33415_34060_-	ParA family protein	NA	NA	NA	NA	NA
WP_000016966.1|34240_35047_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.6	1.2e-54
WP_001159871.1|35047_35353_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813639.1|35354_35573_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_047086508.1|36168_36429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194569.1|36425_37016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142427.1|37033_37381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001373114.1|37863_38235_-	colicin	NA	NA	NA	NA	NA
WP_000850414.1|38294_39026_-	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_011310114.1|40191_41169_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	64.5	5.5e-102
WP_072130327.1|43610_43850_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_047086509.1|43979_44474_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047086510.1|44593_46033_-	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_072094473.1|46036_48157_-	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.4	9.3e-46
WP_047086513.1|48206_51203_-	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000839942.1|51204_51720_-	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
WP_000899427.1|52145_52949_-	OmpA family protein	NA	NA	NA	NA	NA
WP_047086514.1|52973_57308_-	hemagglutinin	NA	NA	NA	NA	NA
WP_000070403.1|57320_57611_-	major pilus subunit operon regulatory protein PapB	NA	NA	NA	NA	NA
WP_159027738.1|59903_60053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106889144.1|61410_62540_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	95.9	4.6e-169
WP_106889145.1|62596_62893_-	flagellar biosynthesis protein FlgM	NA	NA	NA	NA	NA
WP_106889146.1|63123_63489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106889147.1|70065_71559_+	autoagglutinating adhesin Saa	NA	A0A2C9CZB7	Yersinia_phage	34.9	1.9e-05
WP_001367773.1|74136_76224_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	32.2	6.8e-09
WP_047087018.1|76484_76907_-	Exc2 family lipoprotein	NA	NA	NA	NA	NA
WP_106889148.1|77091_78606_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	96.9	2.3e-288
WP_000612591.1|78655_79003_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171547.1|78999_79380_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	5.5e-66
WP_032315087.1|79873_80014_-	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_001398505.1|80345_80588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099205956.1|80711_81868_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	2.6e-66
WP_052920681.1|87187_87379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096557575.1|87409_87721_+	flagellar biosynthesis protein FlgM	NA	NA	NA	NA	NA
WP_001442266.1|87972_88302_+|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	55.6	1.8e-28
95360:95376	attR	GTTCTTGATGCACAACA	NA	NA	NA	NA
