The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027442	Escherichia coli strain 2013C-3252 chromosome, complete genome	5636732	44717	103865	5636732	integrase,terminase,tail,holin,head,capsid,tRNA	Escherichia_phage(39.39%)	71	60161:60176	111334:111349
WP_000837924.1|44717_45851_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001295593.1|45991_46426_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001143784.1|47006_47648_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|47729_48359_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131659.1|48431_49007_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001023992.1|49119_49389_-|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_000268838.1|49390_50704_-	hypothetical protein	NA	A0A0P0ZD68	Stx2-converting_phage	98.6	6.3e-77
WP_001230550.1|50768_51368_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_000515042.1|51438_54936_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.3	0.0e+00
WP_000649829.1|55069_55597_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_064732755.1|55787_56420_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_000194763.1|56365_57109_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_001152159.1|57119_57818_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
WP_000807964.1|57817_58159_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_106907350.1|58151_61394_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.2	0.0e+00
60161:60176	attL	CACCGCTCATCAGACG	NA	NA	NA	NA
WP_001513217.1|61441_61651_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_001030063.1|61746_62121_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_032325206.1|62126_62843_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	8.0e-127
WP_000133388.1|62908_63253_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|63249_63696_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|63692_64043_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|64053_64380_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|66906_67128_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_024220401.1|67172_69110_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.2	0.0e+00
WP_001399867.1|69173_70835_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_000958380.1|70831_71395_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000829192.1|71683_72049_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000095744.1|72090_72291_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828070.1|72422_72749_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_012817877.1|73149_73335_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_001280923.1|73557_73689_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_000661712.1|73783_74479_-	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_000992086.1|74752_75286_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	1.3e-100
WP_000731221.1|75336_75681_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000284522.1|75685_75901_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000143077.1|76050_77904_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000466957.1|78478_78910_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000640158.1|79471_80026_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000247761.1|80022_80313_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000940319.1|80312_80912_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000138556.1|81411_82803_+	ATPase	NA	NA	NA	NA	NA
WP_000016656.1|82802_83792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100703.1|83759_84911_-	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000365100.1|85342_85588_-	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_000208018.1|85666_85828_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000224233.1|85838_86102_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_042350895.1|86103_86268_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000935420.1|86353_86566_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_001141110.1|86671_87094_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000450712.1|87109_87871_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_000788980.1|87893_88640_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_001304174.1|88646_89435_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000693803.1|89512_89935_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001072342.1|89931_90186_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233319.1|90265_90685_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001326317.1|90927_91107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001169151.1|91117_91273_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|91269_91758_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|92199_92421_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|92420_92591_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_001344816.1|92665_92941_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_000105140.1|93042_95643_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_000166313.1|95635_96445_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_001443846.1|96500_96650_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_001302840.1|96687_96876_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|96975_97191_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040839.1|97192_98428_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_001157407.1|98479_99415_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_032323876.1|99543_100917_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|101394_102378_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|102632_103865_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
111334:111349	attR	CGTCTGATGAGCGGTG	NA	NA	NA	NA
>prophage 2
NZ_CP027442	Escherichia coli strain 2013C-3252 chromosome, complete genome	5636732	180408	257811	5636732	integrase,terminase,tail,protease,transposase,holin,head,capsid	Stx2-converting_phage(37.04%)	84	194187:194214	257948:257975
WP_000422045.1|180408_181458_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559281.1|181677_182436_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_106907351.1|182432_183023_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|183062_183935_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001342101.1|184035_184656_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|184652_185534_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|185671_185716_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194584.1|185807_187370_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_032323871.1|187369_188965_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001342102.1|188968_190327_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.3	1.5e-36
WP_000209520.1|190338_191532_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443067.1|191531_192338_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|192718_192898_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|192983_193484_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079509.1|193529_194036_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
194187:194214	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_000147167.1|194537_194756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144877.1|197518_198109_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|198292_198940_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|199076_199223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|199650_199929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000938103.1|201096_201666_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|201731_202643_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|202749_202872_-	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001023357.1|206817_207087_-|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	100.0	3.8e-45
WP_001339397.1|207147_207825_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|207824_208172_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|208191_209763_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000216552.1|209795_211109_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.4	6.9e-76
WP_001228278.1|211260_211860_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	95.5	5.9e-107
WP_000902073.1|211927_212977_-	DUF1983 domain-containing protein	NA	Q9EYE7	Enterobacteria_phage	100.0	4.5e-195
WP_000099160.1|212999_214538_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|214586_214934_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839170.1|214930_215335_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	2.5e-69
WP_106907352.1|215412_217863_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	95.3	0.0e+00
WP_122996338.1|218101_218734_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.1	4.9e-104
WP_100005256.1|218679_219423_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	7.3e-147
WP_001341641.1|219433_220132_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	97.4	7.6e-130
WP_000807927.1|220131_220473_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	98.2	4.3e-62
WP_106907353.1|220465_223708_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	97.7	0.0e+00
WP_001453698.1|223759_223969_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030040.1|224064_224439_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.9e-64
WP_001275476.1|224444_225161_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
WP_000133388.1|225227_225572_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|225568_226015_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|226011_226362_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_001063096.1|229223_229445_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_044165196.1|229489_231427_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.1	0.0e+00
WP_106907354.1|231490_233152_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	98.7	0.0e+00
WP_000958380.1|233148_233712_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000829192.1|234000_234366_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_001428130.1|234407_234593_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	92.3	1.3e-20
WP_085948186.1|234786_235942_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000347013.1|235989_236130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|236486_236711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|236775_236982_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|237209_237356_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056803.1|237355_237922_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	99.5	2.9e-103
WP_000992088.1|238192_238726_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_000731221.1|238776_239121_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000284522.1|239125_239341_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000023141.1|239490_241344_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	96.6	0.0e+00
WP_032324106.1|242869_243559_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.5	1.8e-59
WP_000140002.1|243555_243921_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001265290.1|243921_244977_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	4.9e-88
WP_010917803.1|244978_245257_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|245326_245584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961821.1|245804_246017_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001449026.1|246295_247054_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|247752_247917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157825328.1|248680_249223_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|249134_250175_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705622.1|250146_250698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|250681_250909_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|250985_251393_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|251657_251957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|252029_252248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|252270_252678_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|252655_252889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001342117.1|252882_253050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449172.1|253449_253638_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199480.1|253634_253823_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048478.1|253918_256390_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|256454_256703_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|256680_257811_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
257948:257975	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 3
NZ_CP027442	Escherichia coli strain 2013C-3252 chromosome, complete genome	5636732	361847	435652	5636732	integrase,terminase,tail,transposase,holin,head,capsid,tRNA	Escherichia_phage(26.23%)	90	381232:381246	435754:435768
WP_001297484.1|361847_362954_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|362989_363631_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|363634_365005_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265481.1|365172_365844_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|365843_367304_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|367905_368187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001432354.1|368442_368985_-|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	5.1e-33
WP_000224599.1|369190_369604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380886.1|369616_369952_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907455.1|369964_371020_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.7	3.5e-70
WP_000796958.1|371019_371226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132079.1|371477_371702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233304.1|371828_372101_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126687.1|372111_372522_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000192401.1|372518_372770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000833618.1|372970_374371_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	9.6e-116
WP_000770175.1|374367_374667_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001204981.1|374672_374906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000336167.1|374898_375363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012816761.1|375352_376381_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000953272.1|376438_376627_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000085258.1|376992_378222_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	8.4e-132
WP_106907355.1|378470_379595_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359438.1|379740_380970_-	peptidase T	NA	NA	NA	NA	NA
WP_000531601.1|381219_382356_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
381232:381246	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799402.1|382339_383203_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_001435497.1|383435_383600_-|tail	tail fiber assembly domain protein	tail	K7PMH7	Enterobacteria_phage	87.5	2.2e-16
WP_001132151.1|383816_384407_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144080.1|384590_385241_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001299273.1|385315_386374_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_012816780.1|386501_387137_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_001118085.1|387204_387786_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_001131642.1|388076_388652_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001023455.1|388764_389034_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_106907356.1|389035_390349_-|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	98.2	2.9e-74
WP_032271866.1|390413_391037_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.9	8.7e-69
WP_106907357.1|391105_394582_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	97.4	0.0e+00
WP_047085664.1|394820_395453_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.7	2.5e-103
WP_000194787.1|395398_396142_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	2.1e-146
WP_001368648.1|396152_396851_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	6.8e-131
WP_000807964.1|396850_397192_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_106907358.1|397184_400427_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	92.4	0.0e+00
WP_106907359.1|400474_400654_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	6.0e-23
WP_085948186.1|400681_401838_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001030063.1|402046_402421_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_032325206.1|402426_403143_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	8.0e-127
WP_000133388.1|403208_403553_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|403549_403996_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|403992_404343_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|404353_404680_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|407206_407428_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_024220401.1|407472_409410_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.2	0.0e+00
WP_001399867.1|409473_411135_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_000958380.1|411131_411695_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000829192.1|411983_412349_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000095744.1|412390_412591_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828070.1|412722_413049_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_012816791.1|413449_413635_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_032140280.1|413856_413943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062854056.1|414497_415031_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.0	1.4e-99
WP_021569237.1|415081_415426_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	4.2e-57
WP_032272343.1|415430_415646_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.6	4.5e-33
WP_069358388.1|415795_417649_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	97.6	0.0e+00
WP_000871291.1|417908_418244_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_001340026.1|418524_418656_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	96.4	7.0e-05
WP_000611215.1|419454_420504_-	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	91.7	3.4e-190
WP_000917767.1|420654_420852_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000640017.1|421083_421626_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.9	1.9e-72
WP_000140024.1|421634_422000_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	1.6e-38
WP_001369253.1|422000_423056_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	2.4e-87
WP_012817871.1|423057_423330_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	9.4e-12
WP_000882662.1|423497_423710_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000156210.1|424210_425308_+	hypothetical protein	NA	A0A0U2S621	Escherichia_phage	99.5	1.4e-210
WP_001204666.1|425267_425846_-	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	100.0	2.6e-104
WP_001002672.1|426151_426463_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	97.1	1.1e-59
WP_000004322.1|426455_426710_-	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	94.0	4.8e-42
WP_001151209.1|426706_427129_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	1.3e-63
WP_000095675.1|427169_428132_-	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000693943.1|428154_428580_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000471549.1|428576_428792_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000103687.1|428841_429558_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
WP_001448352.1|429830_429986_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	1.2e-06
WP_001171923.1|430145_430364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394528.1|430386_430761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122993340.1|430746_430893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|431293_431482_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199473.1|431478_431667_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_044165005.1|431762_434234_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	59.3	1.0e-59
WP_000003742.1|434295_434565_+	excisionase	NA	NA	NA	NA	NA
WP_000074983.1|434533_435652_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
435754:435768	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 4
NZ_CP027442	Escherichia coli strain 2013C-3252 chromosome, complete genome	5636732	555298	704262	5636732	integrase,terminase,tail,lysis,transposase,holin,head,capsid,portal	Enterobacteria_phage(33.55%)	193	651444:651463	701326:701345
WP_032337315.1|555298_555880_-	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	63.7	1.5e-62
WP_106420821.1|555870_556065_-	hypothetical protein	NA	A0A2R2Z347	Escherichia_phage	84.6	4.1e-09
WP_000767050.1|556009_556552_-	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
WP_001023995.1|556773_557043_-|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	7.1e-44
WP_106907361.1|557044_558358_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.3	3.9e-79
WP_001230449.1|558422_559022_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.6e-110
WP_044165468.1|559088_562565_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.8	0.0e+00
WP_047085664.1|562803_563436_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.7	2.5e-103
WP_000194787.1|563381_564125_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	2.1e-146
WP_001341641.1|564135_564834_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	97.4	7.6e-130
WP_000807927.1|564833_565175_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	98.2	4.3e-62
WP_106907362.1|565167_568410_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	97.5	0.0e+00
WP_001453698.1|568461_568671_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030040.1|568766_569141_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.9e-64
WP_001275476.1|569146_569863_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
WP_000133388.1|569929_570274_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|570270_570717_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|570713_571064_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|571073_571400_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063096.1|573926_574148_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_106907363.1|574192_576130_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	98.9	0.0e+00
WP_062890118.1|576193_577855_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.1	0.0e+00
WP_000958380.1|577851_578415_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_033800467.1|578706_579072_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	9.3e-63
WP_001448509.1|579113_579338_+	YlcI/YnfO family protein	NA	A0A0P0ZE23	Stx2-converting_phage	76.1	2.9e-19
WP_001302717.1|579419_579734_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_106907364.1|580197_580665_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	87.7	4.7e-67
WP_000455402.1|580672_580822_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	98.0	9.1e-17
WP_001056883.1|580821_581391_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	99.5	1.5e-104
WP_000087714.1|581665_582199_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
WP_001072901.1|582203_582419_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290230.1|582496_582742_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143463.1|582782_582962_-	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
WP_106907365.1|583098_585036_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	97.1	0.0e+00
WP_000466957.1|585513_585945_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000301785.1|586394_587108_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917770.1|587242_587440_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640048.1|587681_588212_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904103.1|588220_588580_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	1.8e-34
WP_001265113.1|588592_589639_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.5	1.4e-108
WP_001342259.1|589640_589913_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	5.2e-10
WP_001260977.1|590048_590306_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_000220601.1|590311_590611_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	100.0	1.8e-51
WP_000206830.1|590815_591160_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	1.7e-58
WP_001229296.1|591156_591522_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	100.0	5.1e-69
WP_000209152.1|591523_591742_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	100.0	6.6e-32
WP_001289353.1|591829_592465_-	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	100.0	1.3e-115
WP_001224662.1|592630_592813_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000935422.1|592846_593059_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	100.0	6.6e-37
WP_000403783.1|593109_593466_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
WP_001209480.1|593443_593905_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_001266133.1|593901_594198_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	5.8e-47
WP_001040234.1|594194_594587_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	62.6	1.0e-38
WP_000450641.1|594602_595328_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.4	1.2e-77
WP_072096947.1|595361_595904_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.5	1.8e-78
WP_000729535.1|595815_596826_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	88.8	4.9e-170
WP_000693932.1|596912_597350_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	55.0	1.6e-29
WP_001172789.1|597346_597607_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	64.8	4.8e-21
WP_000578360.1|597733_598126_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	39.6	1.7e-14
WP_001022415.1|598172_598532_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	93.3	3.6e-59
WP_000692026.1|598534_598837_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	43.3	3.7e-17
WP_024182289.1|599250_599451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171921.1|599543_599762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331716.1|599765_599930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032240573.1|600330_600519_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|600515_600704_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048499.1|600798_603249_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
WP_000273151.1|603316_603559_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|603536_604556_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_012817749.1|605359_606112_+	type III effector	NA	NA	NA	NA	NA
WP_001023445.1|606236_606506_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
WP_106907366.1|606507_607821_-|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	98.9	1.4e-76
WP_032271866.1|607885_608509_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.9	8.7e-69
WP_106907367.1|608577_612054_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	97.2	0.0e+00
WP_123010699.1|612299_612932_-|tail	tail assembly protein	tail	A0A0N7KZG2	Stx2-converting_phage	95.7	1.6e-94
WP_000194707.1|612877_613621_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	99.2	1.2e-149
WP_001443841.1|613631_614330_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	97.4	4.4e-130
WP_000847298.1|614329_614659_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000081792.1|614655_617268_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.0	0.0e+00
WP_000533442.1|617248_617662_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479051.1|617688_618111_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235067.1|618124_618877_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000683137.1|618884_619280_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_032325339.1|619276_619855_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	85.9	8.6e-79
WP_000752994.1|619866_620220_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000158897.1|620231_620627_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000063258.1|620668_621694_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001365129.1|621749_622082_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_033805059.1|622091_623411_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	2.2e-231
WP_001443752.1|623391_624993_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_000198153.1|624989_625196_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027330.1|625192_627118_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453587.1|627092_627638_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001300236.1|628034_628259_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_001302717.1|628340_628655_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|629180_629366_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|629588_629735_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|629734_630304_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|630574_631108_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|631158_631503_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000411802.1|631507_631714_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_032325211.1|632161_634012_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.0	0.0e+00
WP_001299632.1|634490_634922_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	98.6	7.8e-69
WP_000498121.1|635111_635321_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	65.2	2.5e-20
WP_000735807.1|635373_635598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047111.1|636442_637195_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	98.8	2.6e-136
WP_001375683.1|637208_638258_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.6	4.6e-115
WP_012817785.1|638259_638529_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	3.0e-10
WP_001452497.1|638582_638810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217944.1|639033_639405_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000042395.1|639397_639715_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000882662.1|639817_640030_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000211993.1|640244_640796_-	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	53.3	5.5e-43
WP_000215512.1|641147_641333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450895.1|641392_642154_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	63.6	2.4e-73
WP_000790460.1|642183_642924_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.1	4.7e-114
WP_000705368.1|643877_644399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920571.1|644382_644613_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000379972.1|644696_645104_+	helix-turn-helix domain-containing protein	NA	B1B6L9	Salmonella_phage	58.7	3.1e-14
WP_000380319.1|645270_645423_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_000394548.1|645434_646073_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|646073_646283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|646847_647036_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|647032_647221_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102128.1|647313_649776_+	exonuclease	NA	V5UQJ3	Shigella_phage	47.5	2.3e-125
WP_001368608.1|649863_650100_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001206148.1|650119_651415_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
651444:651463	attL	ATGACTCTTGAAATCCATAA	NA	NA	NA	NA
WP_120795384.1|652064_652178_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|652246_652480_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086514.1|652796_653387_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000885616.1|653484_654060_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001448491.1|654059_657020_-	membrane protein	NA	A0A0K2FIZ6	Escherichia_phage	54.1	4.0e-55
WP_001233114.1|657084_657684_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	2.5e-105
WP_000515505.1|657754_661168_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.0	0.0e+00
WP_000741589.1|661228_661876_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
WP_000140707.1|661773_662517_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.9	1.8e-145
WP_001152371.1|662522_663221_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.7	1.9e-133
WP_000447251.1|663230_663560_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	3.0e-60
WP_000372024.1|663559_666625_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|666596_666926_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001341514.1|666934_667321_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	97.7	5.2e-64
WP_000211132.1|667381_668125_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	8.1e-130
WP_001079398.1|668135_668537_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000677128.1|668533_669112_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	98.4	3.0e-100
WP_001283148.1|669123_669399_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.1e-44
WP_001097041.1|669391_669715_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	98.1	5.5e-51
WP_000985929.1|671772_673281_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	4.5e-289
WP_001072975.1|673280_673493_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000507036.1|673489_675589_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	96.6	0.0e+00
WP_001031435.1|676698_676905_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	3.9e-26
WP_000035577.1|677205_677616_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
WP_001019606.1|677767_677941_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|678112_678268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122134696.1|678347_678413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|678415_678604_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|678614_678827_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|679189_679687_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|679683_680217_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189915.1|680213_680525_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|680529_680745_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066483.1|681498_681714_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	4.5e-25
WP_000087756.1|682014_682227_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|682281_682371_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047133.1|682648_683401_-	antitermination protein	NA	Q8SBE4	Shigella_phage	94.8	1.3e-130
WP_001265198.1|683414_684464_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|684465_684744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|684810_685062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|685278_685434_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|685505_685793_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|685792_686032_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|686056_686362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001317460.1|686564_686897_+	protein flxA	NA	NA	NA	NA	NA
WP_000589012.1|687333_688674_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001151195.1|688707_689127_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.4	1.3e-55
WP_000054507.1|689167_690133_-	hypothetical protein	NA	U5P0A0	Shigella_phage	61.3	6.5e-55
WP_000705349.1|690113_690635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476993.1|690618_690846_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|690923_691331_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000379589.1|691523_691679_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000347171.1|691680_692256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|692742_692931_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083280.1|692927_693119_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_106907368.1|693212_694280_+	exonuclease	NA	NA	NA	NA	NA
WP_085948186.1|694336_695492_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_106907369.1|695520_696951_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	4.9e-59
WP_000381395.1|697146_698718_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|698737_699085_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|699084_699762_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000877011.1|700016_701297_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	61.8	4.3e-155
WP_001360138.1|701316_701427_-	hypothetical protein	NA	NA	NA	NA	NA
701326:701345	attR	ATGACTCTTGAAATCCATAA	NA	NA	NA	NA
WP_000836079.1|701484_702504_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001295394.1|702515_703730_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|703935_704262_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
>prophage 5
NZ_CP027442	Escherichia coli strain 2013C-3252 chromosome, complete genome	5636732	720547	737331	5636732	integrase,terminase,protease,head,capsid,portal	uncultured_Caudovirales_phage(90.91%)	24	726172:726187	748511:748526
WP_001260840.1|720547_721369_+|protease	serine protease	protease	NA	NA	NA	NA
WP_000046661.1|721407_721737_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_000276149.1|721723_722089_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_001303517.1|722195_722366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000133423.1|723402_723684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127891.1|723697_725359_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	2.0e-277
WP_000113645.1|725342_725699_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_001145905.1|725988_726429_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
726172:726187	attL	ATTAATCGGGATAATG	NA	NA	NA	NA
WP_000134113.1|726428_726725_-	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001020674.1|726721_727060_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	8.7e-31
WP_001398592.1|727056_728232_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	80.2	4.8e-185
WP_000504055.1|728269_728842_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	4.7e-61
WP_001137345.1|728881_730039_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_001132080.1|730330_730555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233310.1|730680_730953_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126691.1|730963_731374_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000125509.1|731370_731616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000710169.1|731903_733721_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	48.3	7.5e-129
WP_001261490.1|733717_734017_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001113154.1|734023_734344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024184083.1|734336_734627_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001496008.1|734559_735486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000953271.1|735538_735727_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
WP_000085277.1|736101_737331_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.4	1.6e-130
748511:748526	attR	ATTAATCGGGATAATG	NA	NA	NA	NA
>prophage 6
NZ_CP027442	Escherichia coli strain 2013C-3252 chromosome, complete genome	5636732	933765	1067161	5636732	integrase,tail,protease,transposase,plate,lysis,head,holin,capsid,tRNA,portal	Escherichia_phage(34.65%)	163	1000210:1000225	1075555:1075570
WP_000826412.1|933765_934974_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.8	6.0e-207
WP_000604932.1|934981_935413_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	4.8e-42
WP_000513743.1|935428_935617_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_000939317.1|935620_935980_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457202.1|936152_936791_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_001061578.1|936917_937841_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000978494.1|937943_939029_+	multifunctional D-malate/3-isopropylmalate/tartarate dehydrogenase	NA	NA	NA	NA	NA
WP_000987525.1|939279_940890_+	BCCT family transporter YeaV	NA	NA	NA	NA	NA
WP_000067805.1|940921_942046_+	carnitine monooxygenase subunit YeaW	NA	NA	NA	NA	NA
WP_001287005.1|942101_943067_+	carnitine monooxygenase subunit YeaX	NA	NA	NA	NA	NA
WP_001342154.1|943120_944236_-	ribonuclease D	NA	NA	NA	NA	NA
WP_104770261.1|944317_946003_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	2.2e-34
WP_000290576.1|946207_946789_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001221003.1|946828_947524_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|947581_949492_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|949623_949968_+	RidA family protein	NA	NA	NA	NA	NA
WP_001307845.1|950330_950690_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|950809_950989_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000854972.1|951062_952424_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000456725.1|952427_953006_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000624298.1|953189_954554_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_001295494.1|954684_956283_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000394983.1|956286_957843_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
WP_000150551.1|958305_959277_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000406926.1|959339_960140_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000228655.1|960152_961004_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000156255.1|961058_961517_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_001296134.1|961945_962512_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000010107.1|962508_963318_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001062678.1|963483_963693_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_001295496.1|963705_963849_-	YobF family protein	NA	NA	NA	NA	NA
WP_001006866.1|964517_964805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714550.1|964879_965023_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001211011.1|965181_965421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262174.1|965563_966355_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001127210.1|966531_967905_+	MFS transporter	NA	NA	NA	NA	NA
WP_000984517.1|967950_968832_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001427396.1|969023_971072_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000431370.1|971091_971790_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|971886_972384_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207284.1|972513_973797_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001299674.1|973765_976399_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_000057024.1|976478_977918_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|978035_978272_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|978376_978568_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812724.1|978568_979225_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_001121225.1|980179_980830_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000491545.1|981054_981930_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	7.2e-162
WP_001023379.1|982070_982340_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
WP_032325224.1|982341_983655_-|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	99.3	2.8e-77
WP_001230428.1|983719_984319_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_000077537.1|985937_986468_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
WP_001310454.1|986658_986907_+	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000289290.1|986908_988999_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	45.4	8.8e-166
WP_000129791.1|989069_990002_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.7	2.4e-70
WP_000268103.1|990004_990226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057199.1|990238_990493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|990494_990776_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_000049432.1|990772_991045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049304.1|991049_991343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129553.1|991354_991885_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000323222.1|991982_992525_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	4.9e-28
WP_000564283.1|992528_993062_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.2	1.1e-67
WP_000465559.1|993061_993577_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	53.6	5.5e-45
WP_000977060.1|993580_994132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000621195.1|994128_994314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000021235.1|994352_994685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086887.1|994677_994875_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000370523.1|994864_995161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214362.1|995157_995667_+	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	42.4	6.7e-27
WP_000852377.1|995736_996162_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125304.1|996233_996734_+	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_115801859.1|996768_997197_+	endopeptidase	NA	NA	NA	NA	NA
WP_001122256.1|997180_997399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342746.1|997408_997636_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270159.1|997616_997925_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279084.1|997921_998212_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	62.1	1.0e-24
WP_000360581.1|998214_998796_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
1000210:1000225	attL	GGTGGTGAACGGTATC	NA	NA	NA	NA
WP_000532593.1|1000455_1002045_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.9	1.9e-168
WP_000046893.1|1002028_1003354_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	59.7	6.4e-154
WP_000094804.1|1003472_1003946_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	5.1e-37
WP_000850811.1|1004122_1005247_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.6	2.2e-78
WP_001142982.1|1005246_1006194_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_021497370.1|1006237_1006654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104956.1|1006650_1007070_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_000627431.1|1007066_1007627_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_000848437.1|1007627_1007873_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000606747.1|1007869_1009372_+|tail	tail protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000015473.1|1009380_1009746_+|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000213225.1|1009760_1010237_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000113525.1|1010363_1012439_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	2.1e-71
WP_061330372.1|1012425_1013775_+	multidrug DMT transporter permease	NA	C9DGQ2	Escherichia_phage	33.1	1.3e-53
WP_000098807.1|1013758_1014883_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000980532.1|1014872_1015487_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000763330.1|1015479_1015917_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_001146835.1|1015916_1016999_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000301577.1|1016989_1017550_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_000469162.1|1017549_1018461_+|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000420351.1|1018495_1019017_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_010917875.1|1019096_1019300_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000904930.1|1019522_1020083_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917876.1|1020182_1022222_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000144787.1|1022368_1022551_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_001114104.1|1022586_1022832_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_115801860.1|1022870_1023335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310452.1|1023449_1023650_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000528251.1|1023603_1024341_+	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
WP_136865658.1|1026810_1027443_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	4.6e-102
WP_032325227.1|1027388_1028132_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	99.2	4.5e-149
WP_001152185.1|1028142_1028841_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.7	3.1e-131
WP_000847304.1|1028840_1029170_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_032324121.1|1029166_1031746_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.1	0.0e+00
WP_000533431.1|1031726_1032140_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000479086.1|1032166_1032598_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_032325228.1|1032611_1033364_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	95.6	1.3e-130
WP_000683137.1|1033371_1033767_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000975096.1|1033763_1034342_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000752994.1|1034353_1034707_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000158897.1|1034718_1035114_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000063258.1|1035155_1036181_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001365129.1|1036236_1036569_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000123251.1|1036578_1037898_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_001443752.1|1037878_1039480_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_000198153.1|1039476_1039683_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_000453587.1|1041579_1042125_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001307652.1|1042513_1042708_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000881326.1|1042895_1043513_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_000092325.1|1043662_1044100_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_000075132.1|1044096_1044594_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000411802.1|1044593_1044800_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000143049.1|1045247_1047098_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000762928.1|1048268_1049090_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001217413.1|1049086_1049461_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.4e-34
WP_001265229.1|1049473_1050523_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|1050524_1050797_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|1050918_1051263_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|1051382_1051595_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|1051828_1052386_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|1052387_1052606_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|1052733_1053045_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|1053037_1053265_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|1053261_1053543_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450872.1|1053575_1054337_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	67.2	3.9e-79
WP_001444941.1|1055110_1056073_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.5	2.7e-69
WP_000693943.1|1056095_1056521_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|1056517_1056820_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_001169687.1|1056917_1057289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302048.1|1057309_1057501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|1057502_1057781_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001427316.1|1058067_1058220_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	2.3e-07
WP_000560218.1|1058640_1058862_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	1.8e-37
WP_001427414.1|1058861_1059032_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
WP_001307773.1|1059105_1059381_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	96.7	3.0e-42
WP_000105101.1|1059479_1062131_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	77.6	0.0e+00
WP_000166317.1|1062123_1062933_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	6.8e-106
WP_042853000.1|1062989_1063184_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_001356607.1|1063176_1063365_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_001443927.1|1063471_1063753_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
WP_001189091.1|1063718_1064795_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	5.3e-98
WP_000976492.1|1065187_1065529_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879280.1|1065541_1066414_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|1066417_1066792_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|1066930_1067161_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
1075555:1075570	attR	GATACCGTTCACCACC	NA	NA	NA	NA
>prophage 7
NZ_CP027442	Escherichia coli strain 2013C-3252 chromosome, complete genome	5636732	1113437	1187360	5636732	integrase,terminase,tail,plate,holin,head,capsid,tRNA,portal	Enterobacteria_phage(75.56%)	82	1150972:1151031	1188303:1188423
WP_000564746.1|1113437_1114409_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_032323745.1|1114573_1117003_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214304.1|1117027_1118128_-	cytochrome c	NA	NA	NA	NA	NA
WP_032323742.1|1118515_1119262_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001300190.1|1119275_1119842_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025336.1|1120057_1121791_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
WP_001297434.1|1121967_1122456_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259583.1|1122575_1122968_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067000.1|1122967_1125046_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_106907372.1|1125038_1126187_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983609.1|1126388_1127033_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|1127043_1127433_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036378.1|1127447_1128497_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204335.1|1128499_1129360_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483235.1|1129378_1130983_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	1.2e-13
WP_001342228.1|1131028_1132690_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|1132834_1133338_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001300654.1|1133358_1135323_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|1135327_1136254_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906335.1|1136250_1137138_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|1137264_1137843_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|1137845_1138196_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122426.1|1138975_1139404_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|1139410_1140835_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001295645.1|1140809_1141610_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100203.1|1141776_1142763_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187810.1|1142777_1144292_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548675.1|1144361_1145351_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000179469.1|1146147_1146651_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082123.1|1146729_1146981_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|1147095_1147182_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237869.1|1147444_1147768_+	lipoprotein, function unknown	NA	NA	NA	NA	NA
WP_000917208.1|1147938_1148436_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|1148473_1148713_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797573.1|1148903_1150115_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847902.1|1150176_1150842_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
1150972:1151031	attL	AAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCT	NA	NA	NA	NA
WP_001342226.1|1151198_1152200_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.2	9.3e-105
WP_000865208.1|1152205_1152553_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290352.1|1152582_1153233_-	membrane protein	NA	NA	NA	NA	NA
WP_000786769.1|1153248_1153653_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_001673482.1|1153742_1153880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|1153951_1154155_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000742491.1|1154176_1154527_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.0	1.2e-48
WP_000158976.1|1154537_1154816_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.2	6.9e-34
WP_000357025.1|1154827_1155070_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	3.4e-37
WP_000021647.1|1155066_1155180_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	2.4e-09
WP_000985152.1|1155266_1155470_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	9.5e-25
WP_000564224.1|1155793_1156183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001272083.1|1156179_1159020_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.6	0.0e+00
WP_000686499.1|1159096_1160056_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.0e-181
WP_000211289.1|1160060_1160372_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.2e-47
WP_001289969.1|1160435_1161026_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	50.7	1.8e-31
WP_000087812.1|1161515_1162562_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000613774.1|1162561_1164313_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
WP_001262641.1|1164467_1165304_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.9	7.9e-150
WP_001055094.1|1165327_1166380_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	3.2e-188
WP_000632311.1|1166425_1167226_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	1.5e-126
WP_000063100.1|1167327_1167822_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000864911.1|1167821_1168022_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	7.9e-32
WP_001342221.1|1168024_1168348_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000072343.1|1168344_1168737_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	98.5	2.9e-70
WP_000780555.1|1168733_1169141_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	4.2e-64
WP_000202151.1|1169279_1171157_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	82.2	1.1e-305
WP_001342220.1|1171180_1171648_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	94.8	6.7e-82
WP_000356339.1|1171640_1172276_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_106907373.1|1172272_1172854_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	2.8e-101
WP_000213447.1|1172850_1173201_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111967.1|1173204_1174101_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.9e-154
WP_000071738.1|1174093_1174624_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	4.3e-93
WP_000108514.1|1174626_1176759_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.2	8.0e-130
WP_000144010.1|1176758_1177337_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	2.2e-95
WP_000954196.1|1177380_1177953_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000979950.1|1178109_1178598_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.1	7.5e-84
WP_000853455.1|1178610_1181418_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	96.7	0.0e+00
WP_000763327.1|1181404_1181533_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665308.1|1181568_1181934_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000290450.1|1181988_1182501_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005439.1|1182500_1183685_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.5	3.4e-223
WP_000132847.1|1183842_1184943_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	2.1e-203
WP_001317900.1|1185342_1186482_+	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_000488107.1|1186768_1187029_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078921.1|1187219_1187360_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	5.9e-18
1188303:1188423	attR	AAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA	NA	NA	NA	NA
>prophage 8
NZ_CP027442	Escherichia coli strain 2013C-3252 chromosome, complete genome	5636732	1345717	1352022	5636732		Enterobacteria_phage(50.0%)	6	NA	NA
WP_032187480.1|1345717_1346263_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.5	1.3e-49
WP_032187481.1|1346267_1347146_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	7.8e-108
WP_032187482.1|1347204_1348104_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	1.7e-28
WP_032187483.1|1348103_1349189_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.1	8.2e-99
WP_032187484.1|1349566_1350460_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.4	2.7e-47
WP_032187485.1|1350627_1352022_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	29.6	1.4e-18
>prophage 9
NZ_CP027442	Escherichia coli strain 2013C-3252 chromosome, complete genome	5636732	1443948	1453876	5636732	transposase	Enterobacteria_phage(62.5%)	9	NA	NA
WP_001292774.1|1443948_1445085_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_106907375.1|1445081_1447082_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001171523.1|1447413_1447794_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|1447790_1448138_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998019.1|1448187_1449573_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000950404.1|1450004_1450475_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.0e-81
WP_000598641.1|1450521_1451241_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1451237_1452923_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|1453144_1453876_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
>prophage 10
NZ_CP027442	Escherichia coli strain 2013C-3252 chromosome, complete genome	5636732	1524703	1626841	5636732	integrase,terminase,tail,protease,transposase,lysis,holin,head,portal	Enterobacteria_phage(37.5%)	116	1561852:1561870	1636057:1636075
WP_000101718.1|1524703_1525945_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	43.1	1.2e-98
WP_000387479.1|1526441_1526648_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001443784.1|1527331_1527892_+	host cell division inhibitor Icd-like protein	NA	Q8SBF3	Shigella_phage	45.5	9.0e-17
WP_001372127.1|1527881_1528103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204070.1|1528095_1528317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204970.1|1528318_1528552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770163.1|1528557_1528857_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833625.1|1528853_1530254_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.1	1.6e-115
WP_001080641.1|1530455_1530701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000391151.1|1530831_1531026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018604.1|1531029_1531191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001229487.1|1531318_1531807_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	42.3	4.6e-25
WP_000624042.1|1531969_1532893_+	hypothetical protein	NA	A0A0R6PHC6	Moraxella_phage	24.9	6.9e-14
WP_001113637.1|1536271_1536919_+	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_001211567.1|1536953_1538006_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_000824439.1|1538002_1538560_-	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_000982426.1|1538556_1540500_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_001026418.1|1540496_1540976_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000186540.1|1540972_1541182_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001295447.1|1541178_1541916_-	heme exporter protein CcmC	NA	NA	NA	NA	NA
WP_000971723.1|1541957_1542620_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000888560.1|1542616_1543234_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
WP_000528376.1|1543252_1543855_-	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000835177.1|1543864_1544314_-	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000013509.1|1544310_1545174_-	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000091291.1|1545160_1545856_-	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000778069.1|1545862_1548349_-	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000557378.1|1548345_1548609_-	chaperone NapD	NA	NA	NA	NA	NA
WP_000686723.1|1548598_1549093_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_000849214.1|1549501_1549990_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000758074.1|1550138_1551785_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000422231.1|1552002_1553646_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000884922.1|1553721_1554372_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000786386.1|1554371_1555436_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406116.1|1555509_1556565_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865576.1|1556676_1557768_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
WP_001249127.1|1558506_1561179_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_001061917.1|1561195_1561846_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
1561852:1561870	attL	TGTAGGCCAGATAAGACGC	NA	NA	NA	NA
WP_000876014.1|1561931_1564781_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_001225855.1|1565055_1565832_-	YfaP family protein	NA	NA	NA	NA	NA
WP_001104541.1|1565836_1567486_-	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_136768278.1|1567486_1571881_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_001025664.1|1572682_1574005_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.7	2.5e-227
WP_001448330.1|1574698_1575346_-	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	43.3	2.4e-37
WP_001023397.1|1575555_1575825_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	3.2e-44
WP_106907379.1|1575826_1577140_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	1.3e-77
WP_001228241.1|1577204_1577804_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.4e-100
WP_001230644.1|1577871_1578087_-	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	95.8	2.9e-32
WP_000099160.1|1578149_1579688_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|1579736_1580084_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|1580080_1580485_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_032325348.1|1580513_1583813_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	94.9	0.0e+00
WP_000090884.1|1583873_1584506_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_000194778.1|1584442_1585186_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	6.6e-148
WP_001152619.1|1585191_1585890_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_000847413.1|1585889_1586219_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	1.3e-52
WP_000082375.1|1586215_1588777_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.0	0.0e+00
WP_000533403.1|1588757_1589171_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479086.1|1589197_1589629_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_001143013.1|1589642_1590395_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_000683071.1|1590402_1590798_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_000975037.1|1590794_1591370_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_001204544.1|1591384_1591738_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000201528.1|1591730_1592105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522643.1|1592156_1593041_-	hypothetical protein	NA	C6ZCY2	Enterobacteria_phage	54.1	6.5e-94
WP_000256849.1|1593098_1593446_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	1.5e-22
WP_001254039.1|1593482_1594988_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_001430223.1|1594977_1596570_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	1.1e-184
WP_000258991.1|1596566_1596773_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	60.0	4.2e-12
WP_024017589.1|1596756_1598685_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	2.7e-262
WP_000235436.1|1598656_1599166_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001427981.1|1599560_1599755_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_000738423.1|1600114_1600408_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|1600498_1600681_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000075153.1|1600897_1601395_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	96.4	1.6e-89
WP_000284524.1|1601394_1601610_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|1601752_1602151_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|1602231_1602390_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|1602475_1603219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235460.1|1603471_1604095_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_001028854.1|1604091_1604757_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223927.1|1604753_1605356_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
WP_001108084.1|1605330_1605897_-	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_001429269.1|1606378_1608214_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	0.0e+00
WP_001254228.1|1608717_1608900_-	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_000153270.1|1608896_1609424_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_000810176.1|1609420_1609867_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	92.6	3.4e-75
WP_000229807.1|1609874_1610081_-	hypothetical protein	NA	G8C7M4	Escherichia_phage	97.1	1.8e-26
WP_000145926.1|1610153_1610444_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000788878.1|1610440_1611142_-	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	99.6	1.7e-129
WP_000185462.1|1611138_1612077_-	replication protein	NA	C1JJ53	Enterobacteria_phage	99.4	1.1e-171
WP_000035947.1|1612109_1612406_-	hypothetical protein	NA	A0A0N7C1W0	Escherichia_phage	96.9	1.3e-46
WP_000276885.1|1612515_1612701_-	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	100.0	1.2e-26
WP_001095982.1|1612781_1613432_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	100.0	4.9e-123
WP_000256573.1|1613746_1614052_+	hypothetical protein	NA	K7PJM7	Enterobacteria_phage	99.0	7.0e-48
WP_000930321.1|1614054_1614393_+	hypothetical protein	NA	K7PJW2	Enterobacteria_phage	99.1	5.8e-59
WP_000167595.1|1614526_1614997_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000065385.1|1615146_1615515_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	97.5	3.8e-64
WP_001198860.1|1615587_1615752_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000372926.1|1615720_1615885_+	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	98.1	3.2e-23
WP_000995439.1|1615939_1616236_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|1616241_1617027_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|1617023_1617701_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_001303590.1|1617700_1617883_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000548547.1|1617855_1618047_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001444000.1|1618057_1618339_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763358.1|1618437_1618659_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	95.9	1.6e-33
WP_001289868.1|1618655_1619261_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	96.9	1.7e-45
WP_001345188.1|1619257_1619608_+	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	80.2	3.3e-33
WP_000457736.1|1619682_1619925_+	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	96.2	3.7e-36
WP_001281192.1|1620043_1620388_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
WP_001444001.1|1620493_1620712_+	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
WP_000533670.1|1620689_1621760_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
WP_001215756.1|1621774_1622380_-	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_000012302.1|1622376_1624065_-	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
WP_001281242.1|1624213_1626841_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
1636057:1636075	attR	GCGTCTTATCTGGCCTACA	NA	NA	NA	NA
>prophage 11
NZ_CP027442	Escherichia coli strain 2013C-3252 chromosome, complete genome	5636732	2001923	2187791	5636732	integrase,terminase,tail,protease,transposase,holin,head,capsid,tRNA	Stx2-converting_phage(30.14%)	207	2085494:2085509	2195857:2195872
WP_001298974.1|2001923_2002661_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|2002792_2004127_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001341633.1|2004335_2005217_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|2005319_2005907_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|2005962_2006346_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|2006650_2007340_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|2007387_2008425_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|2008631_2009051_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001341635.1|2009119_2009818_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000083007.1|2009849_2012510_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|2012623_2013979_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001300818.1|2014024_2014348_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|2014344_2015643_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|2021496_2024070_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040115.1|2024199_2024931_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079094.1|2024927_2025908_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|2026042_2026780_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|2027050_2027392_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|2027495_2027543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200116.1|2027641_2028802_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|2028844_2029966_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168054.1|2029976_2031047_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000976004.1|2031256_2031622_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|2031771_2032290_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969036.1|2032279_2033506_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|2033521_2034004_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|2034080_2034428_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|2034469_2035237_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|2035267_2035816_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|2035834_2036083_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460032.1|2036331_2037693_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|2037859_2038651_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|2038671_2039958_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|2040012_2040606_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|2040728_2041607_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|2041692_2043354_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|2043502_2043844_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|2043905_2044196_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|2044185_2044662_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|2044793_2045276_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000938111.1|2047030_2048392_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.6	4.3e-52
WP_001370486.1|2048768_2052170_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.3	1.3e-219
WP_001301673.1|2052761_2055110_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|2055129_2055219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023420.1|2055325_2055595_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_000268987.1|2055596_2056910_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	4.8e-77
WP_001230428.1|2056974_2057574_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_106907382.1|2057641_2061115_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.3	0.0e+00
WP_122996338.1|2061353_2061986_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.1	4.9e-104
WP_001341641.1|2062684_2063383_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	97.4	7.6e-130
WP_000807927.1|2063382_2063724_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	98.2	4.3e-62
WP_032325323.1|2063716_2066959_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.8	0.0e+00
WP_001513217.1|2067006_2067216_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_001030063.1|2067311_2067686_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_032325206.1|2067691_2068408_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	8.0e-127
WP_000133388.1|2068473_2068818_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2068814_2069261_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|2069257_2069608_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|2069618_2069945_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063099.1|2072471_2072693_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_032325321.1|2072737_2074516_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	90.1	0.0e+00
WP_032323913.1|2074579_2076241_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.5	0.0e+00
WP_000958380.1|2076237_2076801_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000829192.1|2077089_2077455_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_001428130.1|2077496_2077682_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	92.3	1.3e-20
WP_000347013.1|2077811_2077952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|2078308_2078533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|2078597_2078804_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|2079031_2079178_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056803.1|2079177_2079744_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	99.5	2.9e-103
WP_000087733.1|2080014_2080548_-	lysozyme	NA	G9L6J6	Escherichia_phage	100.0	1.0e-102
WP_001072901.1|2080552_2080768_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290221.1|2080844_2081117_-	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	97.8	9.1e-23
WP_000143458.1|2081157_2081337_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000142998.1|2081472_2083410_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	100.0	0.0e+00
WP_000752026.1|2083909_2084179_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|2084188_2085136_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
2085494:2085509	attL	TTTTTAAGATTTTGTT	NA	NA	NA	NA
WP_001204852.1|2085642_2086077_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	100.0	3.6e-82
WP_000144759.1|2086069_2086264_-	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_001107963.1|2086260_2086866_-	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
WP_001004024.1|2086865_2087588_-	DNA-binding protein	NA	A0A0N7C231	Escherichia_phage	100.0	7.8e-130
WP_000211425.1|2087662_2088397_-	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	99.6	9.4e-123
WP_001254256.1|2088671_2088854_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153280.1|2088850_2089378_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000814576.1|2089374_2089821_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_001281772.1|2089777_2090014_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|2090024_2090240_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001000127.1|2090372_2090651_-	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000145907.1|2090721_2091012_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	99.0	1.6e-46
WP_000788928.1|2091008_2091710_-	Replication protein P	NA	C1JJ58	Enterobacteria_phage	100.0	3.4e-130
WP_000185454.1|2091706_2092645_-	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
WP_000438541.1|2092677_2092974_-	hypothetical protein	NA	C1JJ56	Enterobacteria_phage	100.0	8.9e-48
WP_001180318.1|2093112_2093340_-	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250473.1|2093418_2094126_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_000885203.1|2094186_2094528_+	DUF3024 domain-containing protein	NA	A0A1I9LJN9	Stx_converting_phage	100.0	3.9e-63
WP_001221211.1|2094595_2095057_+	hypothetical protein	NA	G9L674	Escherichia_phage	100.0	1.3e-77
WP_000957426.1|2095050_2096097_+	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_000198444.1|2096752_2097136_+	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000167595.1|2097194_2097665_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000065377.1|2097815_2098184_+	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_001198863.1|2098256_2098421_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N7KZ85	Stx2-converting_phage	100.0	6.2e-27
WP_000372941.1|2098389_2098533_+	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_000995439.1|2098608_2098905_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100845.1|2098910_2099696_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_106907383.1|2099692_2100373_+	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	99.6	7.9e-132
WP_000682315.1|2100369_2100552_+	DUF1317 domain-containing protein	NA	Q6H9Z1	Enterobacteria_phage	100.0	9.7e-29
WP_000548531.1|2100524_2100716_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_077758510.1|2100726_2101008_+	cell division protein ZapA	NA	Q6H9Z3	Enterobacteria_phage	98.9	9.3e-47
WP_000763378.1|2101106_2101328_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	97.3	8.4e-35
WP_001289864.1|2101324_2101732_+	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	97.8	2.8e-68
WP_000582235.1|2101733_2102489_+	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	92.4	7.1e-142
WP_000208003.1|2102499_2103282_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	67.8	1.1e-47
WP_000376716.1|2103281_2103560_+	DUF4752 family protein	NA	K7P6P7	Enterobacteria_phage	98.9	5.4e-47
WP_001368678.1|2103717_2104017_+	hypothetical protein	NA	Q9G076	Enterobacteria_phage	100.0	2.4e-53
WP_000545713.1|2104052_2104220_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	1.2e-25
WP_001281197.1|2104248_2104593_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	99.1	2.0e-59
WP_001303849.1|2104710_2104929_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533665.1|2104906_2105980_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9G075	Enterobacteria_phage	98.9	2.0e-198
WP_001444338.1|2106074_2108819_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_000818472.1|2108890_2109964_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|2110011_2110185_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001316982.1|2110174_2110405_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|2110379_2110568_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|2110578_2110791_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_000087763.1|2111076_2111289_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_001295358.1|2111730_2112036_+	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_001247610.1|2112142_2112787_+	lipoprotein GfcB	NA	NA	NA	NA	NA
WP_001038062.1|2112783_2113530_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000742348.1|2113529_2115626_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001295357.1|2115671_2116811_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000057871.1|2116798_2117245_+	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_000208650.1|2117264_2119445_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_001300464.1|2119559_2120858_-	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000270305.1|2120937_2121030_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_000460810.1|2121042_2122179_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_071527988.1|2122190_2123687_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000004899.1|2123869_2124727_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000063972.1|2124723_2125122_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000003671.1|2125118_2125706_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186421.1|2125702_2126410_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107384.1|2126428_2128222_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|2128218_2129337_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_095585410.1|2129932_2130085_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.4	4.3e-14
WP_000938124.1|2130461_2131823_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	40.2	1.5e-49
WP_001023483.1|2132277_2132547_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	1.2e-43
WP_000381395.1|2132584_2134156_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|2134175_2134523_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|2134522_2135200_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_032325383.1|2135255_2136569_-|tail	tail fiber protein	tail	H6WZM9	Escherichia_phage	98.2	2.2e-77
WP_001230428.1|2136633_2137233_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_106907384.1|2137299_2140773_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.5	0.0e+00
WP_122996338.1|2141011_2141644_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.1	4.9e-104
WP_106907385.1|2141589_2142333_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	1.9e-147
WP_001341641.1|2142343_2143042_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	97.4	7.6e-130
WP_000807927.1|2143041_2143383_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	98.2	4.3e-62
WP_032325323.1|2143375_2146618_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.8	0.0e+00
WP_001513217.1|2146665_2146875_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_001030063.1|2146970_2147345_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_032325206.1|2147350_2148067_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	8.0e-127
WP_000133388.1|2148132_2148477_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2148473_2148920_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|2148916_2149267_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|2149277_2149604_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063099.1|2152130_2152352_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_032325321.1|2152396_2154175_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	90.1	0.0e+00
WP_032323913.1|2154238_2155900_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.5	0.0e+00
WP_000958380.1|2155896_2156460_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_025380422.1|2156748_2157114_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	5.8e-65
WP_000095736.1|2157155_2157383_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000736096.1|2157751_2157976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047091958.1|2158061_2158247_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.3	1.3e-17
WP_000992122.1|2158765_2159299_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_000731236.1|2159349_2159694_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000284519.1|2159698_2159914_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_001290231.1|2159990_2160263_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143462.1|2160303_2160483_-	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_106907365.1|2160619_2162557_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	97.1	0.0e+00
WP_001131907.1|2164589_2165138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205460.1|2165150_2165492_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001379493.1|2165509_2166499_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	7.3e-195
WP_024220650.1|2166506_2167316_-	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	97.8	4.5e-150
WP_000767117.1|2167335_2167725_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	100.0	7.1e-69
WP_000210187.1|2167721_2168048_-	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	100.0	1.6e-53
WP_000066917.1|2168044_2168698_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_001305611.1|2168697_2169192_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	99.4	1.5e-87
WP_000104954.1|2169188_2170130_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	4.3e-144
WP_001250269.1|2170119_2170299_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515845.1|2170474_2171026_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001191674.1|2171018_2171279_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001020634.1|2171376_2172069_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_000559922.1|2172388_2172904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135680.1|2173374_2173737_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081319.1|2173802_2174627_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	98.9	5.0e-149
WP_000008174.1|2174755_2175292_+	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	99.4	2.8e-100
WP_000335005.1|2175282_2176161_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	94.9	1.9e-170
WP_000158004.1|2176157_2176361_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	95.5	5.2e-31
WP_000034210.1|2176590_2176920_+	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	37.5	1.1e-25
WP_106907386.1|2176921_2177407_+	hypothetical protein	NA	A0A2L1IV16	Escherichia_phage	56.1	2.8e-30
WP_085948186.1|2177431_2178588_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000457722.1|2179136_2179379_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	82.5	1.8e-30
WP_000557643.1|2179382_2179529_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	90.9	1.7e-20
WP_000516611.1|2179701_2180877_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	91.2	4.6e-204
WP_001431537.1|2181359_2182268_+	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	100.0	2.3e-171
WP_001341819.1|2182566_2183796_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000448925.1|2183834_2184251_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_000214985.1|2184322_2186071_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	100.0	0.0e+00
WP_000577251.1|2186072_2187791_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	100.0	6.5e-308
2195857:2195872	attR	TTTTTAAGATTTTGTT	NA	NA	NA	NA
>prophage 12
NZ_CP027442	Escherichia coli strain 2013C-3252 chromosome, complete genome	5636732	2260572	2267712	5636732		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|2260572_2263134_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141347.1|2263239_2263896_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
WP_001297141.1|2263946_2264714_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|2264909_2265818_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|2265814_2267077_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|2267073_2267712_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 13
NZ_CP027442	Escherichia coli strain 2013C-3252 chromosome, complete genome	5636732	2419523	2426428	5636732	integrase,transposase	Stx2-converting_phage(50.0%)	6	2417480:2417496	2426563:2426579
2417480:2417496	attL	TGGAGCGGGCGAAGGGA	NA	NA	NA	NA
WP_000381395.1|2419523_2421095_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|2421114_2421462_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|2421461_2422139_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000082600.1|2422533_2423262_-	Rha family transcriptional regulator	NA	B5AX29	Iodobacteriophage	41.2	7.1e-14
WP_000852869.1|2424168_2424828_-	DUF4145 domain-containing protein	NA	M1PSB6	Streptococcus_phage	33.9	3.6e-33
WP_000935135.1|2424820_2426428_-|integrase	site-specific integrase	integrase	A0A059XK29	uncultured_phage	28.0	4.3e-11
2426563:2426579	attR	TGGAGCGGGCGAAGGGA	NA	NA	NA	NA
>prophage 14
NZ_CP027442	Escherichia coli strain 2013C-3252 chromosome, complete genome	5636732	3902677	3950600	5636732	integrase,protease,tRNA,transposase	Vibrio_phage(20.0%)	45	3883648:3883662	3909994:3910008
3883648:3883662	attL	TATGGATGATGAGAC	NA	NA	NA	NA
WP_071830505.1|3902677_3904297_+|transposase	ISL3-like element ISEc38 family transposase	transposase	NA	NA	NA	NA
WP_032325301.1|3904293_3905865_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.4	2.2e-294
WP_001218841.1|3905981_3907247_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_001188520.1|3907626_3908202_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000068905.1|3908238_3909936_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883338.1|3909911_3910250_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
3909994:3910008	attR	TATGGATGATGAGAC	NA	NA	NA	NA
WP_000961959.1|3910365_3911667_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000069437.1|3911784_3913221_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267448.1|3913557_3914034_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000015837.1|3914049_3915306_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001026276.1|3915581_3915875_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|3915918_3917565_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_000558209.1|3917702_3918056_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000399648.1|3918308_3919289_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001008073.1|3919537_3920407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000940530.1|3920796_3921825_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_000257278.1|3921866_3922433_+	elongation factor P	NA	NA	NA	NA	NA
WP_000977757.1|3922484_3922610_+	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000239596.1|3922720_3922867_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000118482.1|3923048_3923366_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001238378.1|3923362_3923896_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_001299193.1|3923984_3925118_-	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001299198.1|3925180_3925540_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_000208757.1|3925550_3925946_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000829498.1|3925956_3926691_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001192991.1|3926683_3928492_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000004771.1|3928816_3929794_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001346081.1|3930012_3931515_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000342867.1|3931566_3931881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276180.1|3931877_3932192_+	YjeO family protein	NA	NA	NA	NA	NA
WP_001236850.1|3932220_3935544_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_000934920.1|3935565_3936534_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_000041970.1|3936630_3937683_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_001295188.1|3937777_3938323_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_100699686.1|3939186_3939240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294203.1|3939222_3940362_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_001307537.1|3940360_3941908_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|3941879_3942341_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_000990321.1|3942359_3943697_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122520.1|3943706_3945554_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_001280349.1|3945546_3946497_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|3946582_3946891_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460361.1|3946967_3948248_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|3948333_3949593_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|3949595_3950600_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 15
NZ_CP027442	Escherichia coli strain 2013C-3252 chromosome, complete genome	5636732	3962312	4010817	5636732	protease,transposase	Stx2-converting_phage(37.5%)	51	NA	NA
WP_000811566.1|3962312_3962588_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254642.1|3962736_3963066_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569731.1|3963247_3963997_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|3963993_3964749_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|3964856_3965921_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001341647.1|3966275_3967673_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218360.1|3967688_3967994_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776505.1|3968003_3968468_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|3968481_3969132_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949511.1|3969141_3969996_+	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_001170812.1|3969995_3970682_+	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_000492914.1|3970810_3971086_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|3971412_3971808_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|3971814_3972129_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|3972133_3972361_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|3972402_3972852_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001341645.1|3972922_3973717_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_072097616.1|3974156_3974771_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.1	1.8e-42
WP_000440544.1|3974778_3975987_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	6.4e-209
WP_032324039.1|3976121_3976760_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|3976978_3977599_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228344.1|3977907_3979311_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_001062220.1|3979577_3980012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001345317.1|3980110_3981178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106907401.1|3981424_3982087_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001296686.1|3982194_3983160_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560553.1|3983267_3984128_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000084622.1|3984216_3984597_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589460.1|3984725_3986669_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886909.1|3986858_3987599_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000175289.1|3987588_3988146_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|3988470_3988677_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935042.1|3988738_3990082_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001295196.1|3990404_3991043_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269308.1|3991248_3992982_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060926.1|3992978_3996758_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|3996760_3997102_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223208.1|3997313_3997565_+	type II toxin-antitoxin system ChpS family antitoxin	NA	NA	NA	NA	NA
WP_000239579.1|3997558_3997909_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|3997988_3998519_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265933.1|3998828_3999785_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205813.1|3999924_4001427_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_001296689.1|4001440_4002463_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596015.1|4002449_4003445_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|4003477_4004476_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_001219792.1|4004651_4006025_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166267.1|4006180_4006732_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|4006825_4008178_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000099160.1|4008482_4010021_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|4010069_4010417_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001341328.1|4010538_4010817_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	100.0	1.1e-44
>prophage 16
NZ_CP027442	Escherichia coli strain 2013C-3252 chromosome, complete genome	5636732	4021902	4085403	5636732	integrase,tRNA,transposase	Stx2-converting_phage(46.15%)	59	4030690:4030705	4067137:4067152
WP_000399648.1|4021902_4022883_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000047539.1|4023159_4023546_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|4023618_4024080_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|4024092_4025028_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_001296693.1|4025031_4025166_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230273.1|4025446_4025842_-	RidA family protein	NA	NA	NA	NA	NA
WP_000500687.1|4025972_4026686_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000256681.1|4026756_4027350_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000583470.1|4027494_4027947_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_001074121.1|4028069_4029581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000012897.1|4029749_4030763_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
4030690:4030705	attL	TGCAGCAGGCTGTTGA	NA	NA	NA	NA
WP_000002953.1|4030924_4031341_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001059398.1|4031386_4031890_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000416407.1|4033332_4036188_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786398.1|4036187_4036631_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|4036984_4038496_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584109.1|4038762_4039863_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|4039862_4040945_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001332879.1|4041063_4042566_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	2.1e-84
WP_000061768.1|4042695_4043715_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.9e-44
WP_000772685.1|4044158_4045421_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.3	2.8e-74
WP_000356577.1|4045664_4046504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000091133.1|4046642_4048229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001339397.1|4048518_4049196_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|4049195_4049543_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|4049562_4051134_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001185332.1|4051443_4051716_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	46.9	8.3e-08
WP_000991130.1|4051717_4052272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214377.1|4052268_4053021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001084853.1|4053935_4054196_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	67.5	4.6e-24
WP_000761643.1|4054192_4054741_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.8	5.9e-29
WP_001014979.1|4054740_4054965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000842358.1|4054961_4055285_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_000016235.1|4055299_4057633_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.8	0.0e+00
WP_000594911.1|4058538_4059363_+	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
WP_000227281.1|4059411_4059984_-	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000177060.1|4061337_4061595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|4062152_4062920_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|4062920_4063877_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000125183.1|4063873_4064872_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000879164.1|4064868_4065771_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000188267.1|4065815_4068140_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
4067137:4067152	attR	TGCAGCAGGCTGTTGA	NA	NA	NA	NA
WP_106907402.1|4068226_4069180_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000555341.1|4071447_4071705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000823243.1|4072437_4073796_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000998019.1|4074034_4075420_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000612591.1|4075469_4075817_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171523.1|4075813_4076194_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001221615.1|4076548_4076983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271003.1|4076970_4077372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221529.1|4077537_4078107_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000381395.1|4078846_4080418_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|4080437_4080785_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|4080784_4081462_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001344112.1|4081529_4081706_-	hemolysin activation protein	NA	NA	NA	NA	NA
WP_077221339.1|4082339_4082618_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000839179.1|4083067_4083472_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|4083468_4083816_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099160.1|4083864_4085403_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
>prophage 17
NZ_CP027442	Escherichia coli strain 2013C-3252 chromosome, complete genome	5636732	4210211	4282313	5636732	integrase,tail,protease,transposase,plate,head,tRNA	Shigella_phage(47.83%)	86	4203066:4203105	4260781:4260820
4203066:4203105	attL	TTTGTAGGCCGGATAAGGCGTTCACGCCGCATCCGGCATT	NA	NA	NA	NA
WP_001188663.1|4210211_4210901_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_001056416.1|4211620_4212205_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	39.8	4.2e-17
WP_001310454.1|4212372_4212621_+	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_001512118.1|4212622_4214713_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	47.4	4.0e-166
WP_000129790.1|4214784_4215717_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000257930.1|4215719_4215941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057199.1|4215953_4216208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|4216209_4216491_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_000049432.1|4216487_4216760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049306.1|4216764_4217058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129553.1|4217069_4217600_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000323221.1|4217697_4218240_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	2.9e-28
WP_000578573.1|4218243_4218777_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	66.7	5.9e-66
WP_000465562.1|4218776_4219292_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
WP_000973023.1|4219295_4219847_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000633440.1|4219843_4220155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310341.1|4220169_4220520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310453.1|4220535_4220868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086886.1|4220860_4221058_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000378480.1|4221047_4221344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214366.1|4221340_4221850_+	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	41.9	1.1e-26
WP_000852377.1|4221919_4222345_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125304.1|4222416_4222917_+	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_115801859.1|4222951_4223380_+	endopeptidase	NA	NA	NA	NA	NA
WP_001122256.1|4223363_4223582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342747.1|4223591_4223819_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270159.1|4223799_4224108_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279082.1|4224104_4224395_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	4.7e-25
WP_000360581.1|4224397_4224979_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001057665.1|4224978_4226643_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	8.1e-231
WP_000532592.1|4226642_4228232_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	1.4e-168
WP_000046901.1|4228215_4229547_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.8	3.9e-151
WP_000094808.1|4229668_4230142_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	54.6	2.7e-38
WP_000850822.1|4230318_4231443_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.9	2.9e-78
WP_001142982.1|4231442_4232390_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_001002057.1|4232433_4232820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104956.1|4232816_4233236_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_000627431.1|4233232_4233793_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_000848437.1|4233793_4234039_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000606747.1|4234035_4235538_+|tail	tail protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000015473.1|4235546_4235912_+|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000213225.1|4235926_4236403_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000113525.1|4236529_4238605_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	2.1e-71
WP_061330372.1|4238591_4239941_+	multidrug DMT transporter permease	NA	C9DGQ2	Escherichia_phage	33.1	1.3e-53
WP_000098807.1|4239924_4241049_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000980532.1|4241038_4241653_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000763330.1|4241645_4242083_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_001146835.1|4242082_4243165_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000301577.1|4243155_4243716_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_000469162.1|4243715_4244627_+|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000420351.1|4244661_4245183_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_010917875.1|4245262_4245466_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_061330371.1|4245687_4246248_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.1	2.8e-74
WP_010917876.1|4246347_4248387_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000144787.1|4248533_4248716_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_001114104.1|4248751_4248997_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_115801860.1|4249035_4249500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001444515.1|4249614_4249815_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000528254.1|4249768_4250506_+	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	79.0	7.5e-104
WP_000920337.1|4251673_4253026_+	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001194358.1|4253085_4253802_-	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_001303782.1|4253897_4254038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001223181.1|4254437_4255124_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_012817731.1|4255337_4255403_+	thr operon leader peptide	NA	NA	NA	NA	NA
WP_001264699.1|4255484_4257947_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_000241648.1|4257948_4258881_+	homoserine kinase	NA	NA	NA	NA	NA
WP_000781063.1|4258881_4260168_+	threonine synthase	NA	NA	NA	NA	NA
WP_000738721.1|4260381_4260678_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_000906203.1|4260830_4261607_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
4260781:4260820	attR	TTTGTAGGCCGGATAAGGCGTTCACGCCGCATCCGGCATT	NA	NA	NA	NA
WP_001112563.1|4261676_4263107_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000130189.1|4263385_4264339_+	transaldolase	NA	A0A127KNC6	Cyanophage	30.9	4.8e-10
WP_001094682.1|4264453_4265041_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|4265075_4265642_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102383.1|4265790_4266504_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843559.1|4266529_4266934_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|4267310_4269227_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|4269315_4270446_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000935262.1|4270549_4270759_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_000681360.1|4271287_4272454_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	7.5e-90
WP_000062888.1|4272513_4273419_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_000871667.1|4273457_4274417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000181245.1|4276015_4277437_-	type III secretion system effector EspX1	NA	NA	NA	NA	NA
WP_001274021.1|4277920_4278184_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_001295417.1|4278286_4278505_+	DUF2575 family protein	NA	NA	NA	NA	NA
WP_000767331.1|4278512_4279454_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_001286856.1|4279496_4282313_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 18
NZ_CP027442	Escherichia coli strain 2013C-3252 chromosome, complete genome	5636732	4860603	4929477	5636732	integrase,terminase,tail,protease,lysis,transposase,head,capsid,tRNA,portal	Enterobacteria_phage(58.62%)	80	4870764:4870810	4920951:4920997
WP_000912342.1|4860603_4861989_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
WP_001143540.1|4862024_4862546_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|4862653_4862866_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|4862867_4863734_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|4864214_4864757_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988363.1|4864976_4865669_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000701359.1|4865699_4868309_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|4868287_4869328_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255226.1|4869338_4869854_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|4869856_4870489_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
4870764:4870810	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_000051902.1|4870823_4871987_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000446905.1|4871842_4872214_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000488407.1|4872185_4872464_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763390.1|4872511_4872730_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
WP_001443983.1|4872828_4873110_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000548537.1|4873120_4873312_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149544.1|4873284_4873467_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000611716.1|4873463_4874144_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000100847.1|4874140_4874926_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|4874931_4875228_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000206913.1|4875303_4875594_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	82.4	2.5e-26
WP_001444023.1|4876060_4876381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000066829.1|4876516_4876780_-	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	95.4	4.2e-41
WP_000858975.1|4876861_4877551_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|4877655_4877886_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182773.1|4877955_4878495_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_001342088.1|4878581_4879511_+	replication protein	NA	M1FN81	Enterobacteria_phage	67.0	4.4e-109
WP_000788789.1|4879507_4880209_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	3.8e-129
WP_000152742.1|4880413_4880761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001415151.1|4881513_4882122_+	hypothetical protein	NA	Q9T1Q5	Acyrthosiphon_pisum_secondary_endosymbiont_phage	67.3	1.5e-33
WP_001038620.1|4882421_4882838_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_000520500.1|4882816_4883218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072097617.1|4883341_4883443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053023.1|4883439_4883895_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.1e-60
WP_000224914.1|4883894_4884065_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774477.1|4884057_4884348_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	96.9	6.0e-49
WP_001099712.1|4884344_4884707_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971074.1|4884703_4884844_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001204791.1|4884929_4885313_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737278.1|4885501_4886584_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	80.6	7.8e-166
WP_000839596.1|4887172_4887388_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135274.1|4887387_4887885_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
WP_001228695.1|4888101_4888284_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|4888374_4888668_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_157825797.1|4888875_4889043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|4889008_4890222_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001427981.1|4890339_4890534_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_000453558.1|4890922_4891468_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027295.1|4891442_4893368_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198149.1|4893364_4893571_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001444138.1|4893567_4895169_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	8.5e-310
WP_000381395.1|4895641_4897213_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|4897232_4897580_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|4897579_4898257_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000088640.1|4898297_4899176_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.0	1.7e-147
WP_000063244.1|4899574_4900600_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
WP_000158868.1|4900641_4901037_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000752961.1|4901048_4901423_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	8.0e-62
WP_000985132.1|4901413_4901992_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683110.1|4901988_4902384_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.9e-70
WP_001342267.1|4902391_4903132_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000479169.1|4903147_4903570_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459457.1|4903551_4903986_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840236.1|4903978_4906540_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.1	0.0e+00
WP_000847347.1|4906536_4906866_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_001152557.1|4906865_4907564_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	3.4e-130
WP_000090884.1|4908249_4908882_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_000515439.1|4908942_4912356_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.2	0.0e+00
WP_001230523.1|4912426_4913026_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.8e-108
WP_000279150.1|4913090_4916051_+	membrane protein	NA	A0A2D1UII2	Escherichia_phage	98.3	3.0e-58
WP_000885569.1|4916050_4916635_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
WP_000239881.1|4916689_4917358_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937502.1|4917414_4917720_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226384.1|4917903_4919388_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|4919574_4920528_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177453.1|4921040_4921802_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
4920951:4920997	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224569.1|4921984_4922875_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001375368.1|4922875_4925848_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383941.1|4925834_4928072_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420938.1|4928340_4929477_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP027442	Escherichia coli strain 2013C-3252 chromosome, complete genome	5636732	5149001	5234650	5636732	integrase,terminase,tail,protease,lysis,transposase,holin,head,portal	Enterobacteria_phage(45.33%)	106	5147534:5147568	5233491:5233525
5147534:5147568	attL	GTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCA	NA	NA	NA	NA
WP_000533654.1|5149001_5150072_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	5.6e-201
WP_001303849.1|5150049_5150268_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_001281774.1|5150374_5150719_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	4.5e-59
WP_000545733.1|5150747_5150915_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_000002107.1|5150987_5151272_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	100.0	1.8e-50
WP_012817743.1|5151264_5151567_-	restriction alleviation protein, Lar family	NA	Q716F5	Shigella_phage	97.0	9.4e-53
WP_000104414.1|5151563_5152181_-	hypothetical protein	NA	Q716F4	Shigella_phage	64.2	5.6e-36
WP_000034231.1|5152182_5152740_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	83.6	4.6e-45
WP_000812206.1|5152736_5153294_-	hypothetical protein	NA	E7C9P6	Salmonella_phage	64.3	3.2e-62
WP_001214436.1|5153290_5153455_-	DUF2737 family protein	NA	K7P7R0	Enterobacteria_phage	98.1	4.2e-23
WP_001111278.1|5153465_5153759_-	DUF2856 family protein	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
WP_000951334.1|5153782_5154166_-	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	2.5e-66
WP_000031370.1|5154165_5154771_-	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	100.0	4.1e-108
WP_085948186.1|5155065_5156221_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001243354.1|5156294_5156447_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	98.0	1.5e-19
WP_000638547.1|5156431_5156563_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001341800.1|5156587_5157448_-	hypothetical protein	NA	K7P7J7	Enterobacteria_phage	99.3	2.4e-37
WP_000073663.1|5157811_5158351_+	superinfection exclusion protein B	NA	A0A192Y7Z0	Salmonella_phage	44.9	8.1e-39
WP_000088201.1|5158374_5158647_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	7.4e-41
WP_000193240.1|5159253_5159616_-	hypothetical protein	NA	A0A1P8DTD0	Proteus_phage	51.4	6.2e-19
WP_000428099.1|5159884_5160589_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	99.6	4.3e-133
WP_000064150.1|5160702_5160936_+	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	97.4	4.0e-35
WP_000438538.1|5161074_5161374_+	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	99.0	4.8e-49
WP_000185473.1|5161406_5162345_+	replication protein	NA	O48421	Enterobacteria_phage	99.7	1.4e-171
WP_000788880.1|5162341_5163043_+	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.1	3.8e-129
WP_000145926.1|5163039_5163330_+	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000344573.1|5163626_5163983_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	97.3	2.1e-59
WP_000814611.1|5163954_5164365_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	2.1e-71
WP_001254255.1|5164361_5164538_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000924601.1|5164540_5164942_+	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_001341811.1|5164901_5165111_+	protein ninF	NA	G9L691	Escherichia_phage	97.1	2.6e-30
WP_001003989.1|5165103_5165826_+	DNA-binding protein	NA	K7P6K2	Enterobacteria_phage	99.6	5.4e-131
WP_000002261.1|5165825_5166116_+	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	2.9e-51
WP_001008193.1|5166112_5166475_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	2.7e-62
WP_000994516.1|5166471_5166660_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_000750155.1|5166871_5167831_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|5168169_5168292_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|5168306_5168996_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|5169180_5169924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|5170009_5170168_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000411802.1|5172778_5172985_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075132.1|5172984_5173482_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092325.1|5173478_5173916_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_000881326.1|5174065_5174683_+	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_001307652.1|5174870_5175065_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000235451.1|5175460_5175970_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	33.3	1.2e-12
WP_009442816.1|5175941_5177870_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	2.7e-262
WP_000259002.1|5177853_5178060_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001432013.1|5178056_5179649_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.2e-184
WP_001254029.1|5179638_5179815_+	hypothetical protein	NA	E4WL22	Enterobacteria_phage	56.4	1.1e-08
WP_000839179.1|5179892_5180297_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612622.1|5180293_5180641_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	9.7e-62
WP_000099160.1|5180689_5182228_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_032284507.1|5182224_5182593_+	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	88.0	2.4e-50
WP_001143013.1|5182600_5183353_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_000479086.1|5183366_5183798_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_000533431.1|5183824_5184238_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000082320.1|5184218_5186798_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.3	0.0e+00
WP_000847304.1|5186794_5187124_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_032325234.1|5187123_5187822_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	98.3	2.4e-131
WP_001405642.1|5187832_5188576_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	5.6e-147
WP_096844540.1|5188521_5189154_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	3.5e-102
WP_000515142.1|5189399_5192876_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.8	0.0e+00
WP_001230449.1|5192943_5193543_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.6e-110
WP_000268998.1|5193607_5194822_+	short-chain dehydrogenase	NA	B6DZB7	Enterobacteria_phage	95.8	6.6e-81
WP_001023459.1|5194823_5195093_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_000950982.1|5195198_5196080_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_000652081.1|5196303_5197131_+	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.2	3.1e-154
WP_021351651.1|5197254_5197626_-	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_000381395.1|5198100_5199672_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|5199691_5200039_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|5200038_5200716_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001448642.1|5200776_5201352_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	77.5	1.6e-77
WP_001002868.1|5201552_5201933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354291.1|5202016_5202238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001121571.1|5202250_5202904_-	type III secretion system effector ADP-ribosyltransferase EspJ	NA	NA	NA	NA	NA
WP_000767389.1|5203407_5203884_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_001307065.1|5203942_5205232_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
WP_000951213.1|5205318_5206359_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_000118840.1|5206355_5207510_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000246805.1|5207496_5208252_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000044868.1|5208244_5208922_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000042533.1|5209500_5211522_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_001295302.1|5211713_5212622_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
WP_001295301.1|5213018_5214008_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_000084632.1|5214029_5214542_+	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_000080885.1|5214544_5215030_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000598619.1|5215022_5215268_+	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000852287.1|5215269_5215722_+	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000373624.1|5215858_5216563_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000446932.1|5216767_5217481_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_106907419.1|5217516_5218473_-	UPF0104 family protein	NA	NA	NA	NA	NA
WP_000650337.1|5218472_5219714_-	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_001113363.1|5219710_5220472_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000871982.1|5220604_5221015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000469031.1|5220976_5222083_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000070131.1|5222093_5223227_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000996091.1|5223219_5224956_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	1.3e-18
WP_001296990.1|5224948_5225944_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|5225946_5226618_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007094.1|5226846_5228211_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_000443534.1|5228441_5229527_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000386551.1|5229667_5230630_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001218655.1|5230657_5232808_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.8	4.8e-42
WP_001145128.1|5232927_5233410_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
WP_000399685.1|5233669_5234650_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
5233491:5233525	attR	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
>prophage 20
NZ_CP027442	Escherichia coli strain 2013C-3252 chromosome, complete genome	5636732	5416457	5477213	5636732	integrase,terminase,tail,protease,holin,head,capsid,portal	Enterobacteria_phage(33.33%)	75	5424944:5424959	5445531:5445546
WP_000156528.1|5416457_5418218_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|5418403_5418856_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|5418930_5419971_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|5420327_5420837_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839153.1|5421055_5421685_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|5421647_5423810_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|5423819_5424266_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001297106.1|5424388_5426443_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
5424944:5424959	attL	GCGGATTTTTTCCGCC	NA	NA	NA	NA
WP_000424181.1|5426474_5426933_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|5427028_5427691_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|5427863_5428277_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|5428321_5428639_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116301.1|5428696_5429887_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048244.1|5429981_5430260_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|5430256_5430586_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375138.1|5430676_5431336_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
WP_001299351.1|5431743_5432763_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|5432740_5432983_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_009448824.1|5433050_5435501_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
WP_001098307.1|5435594_5435786_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|5435782_5435971_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133037.1|5436538_5436748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|5436748_5437387_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001345283.1|5437398_5437551_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
WP_000362152.1|5437818_5438238_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
WP_000391948.1|5438337_5438619_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000693883.1|5438602_5439028_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_032325239.1|5439099_5440194_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.7	1.7e-64
WP_021498074.1|5440200_5440941_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_032324560.1|5440966_5441737_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	68.5	2.5e-86
WP_001151235.1|5441752_5442175_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_000935423.1|5442280_5442493_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	97.1	5.6e-36
WP_000209148.1|5442525_5442744_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	91.7	5.2e-29
WP_000224233.1|5442745_5443009_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000208016.1|5443019_5443889_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	79.2	8.5e-123
WP_001278454.1|5444004_5444109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018421.1|5444298_5444511_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_001341388.1|5444678_5444957_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265133.1|5444958_5446008_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
5445531:5445546	attR	GGCGGAAAAAATCCGC	NA	NA	NA	NA
WP_001217436.1|5446020_5446392_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|5446381_5446753_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265267.1|5446904_5447723_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917737.1|5448009_5448207_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000261909.1|5448344_5449058_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874348.1|5449825_5451676_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000411814.1|5452124_5452331_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_000138558.1|5452586_5452859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003111.1|5453018_5453552_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.9	1.4e-99
WP_000675931.1|5453772_5453886_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|5454107_5454293_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|5454820_5455135_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|5455216_5455441_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_000453587.1|5455837_5456383_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_106907423.1|5456357_5458283_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198153.1|5458279_5458486_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001415980.1|5458482_5460084_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	2.3e-307
WP_000123251.1|5460064_5461384_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_001365129.1|5461393_5461726_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000063258.1|5461781_5462807_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_000158897.1|5462848_5463244_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000752994.1|5463255_5463609_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_032325339.1|5463620_5464199_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	85.9	8.6e-79
WP_000683137.1|5464195_5464591_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000235067.1|5464598_5465351_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479051.1|5465364_5465787_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533442.1|5465813_5466227_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081792.1|5466207_5468820_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.0	0.0e+00
WP_000847298.1|5468816_5469146_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001443841.1|5469145_5469844_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	97.4	4.4e-130
WP_000194707.1|5469854_5470598_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	99.2	1.2e-149
WP_123010699.1|5470543_5471176_+|tail	tail assembly protein	tail	A0A0N7KZG2	Stx2-converting_phage	95.7	1.6e-94
WP_106907424.1|5471421_5474898_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	95.7	0.0e+00
WP_032325332.1|5474964_5475564_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_032325331.1|5475628_5476942_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	1.7e-77
WP_001023407.1|5476943_5477213_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
>prophage 1
NZ_CP027443	Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence	95157	0	91204	95157	head,protease,terminase,portal,integrase,tail,holin	Escherichia_phage(64.21%)	99	2249:2265	44911:44927
WP_000158003.1|569_773_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	94.0	6.8e-31
WP_000476202.1|765_1005_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	92.4	2.0e-34
WP_001018057.1|1700_1991_+	DUF4752 family protein	NA	A0A2I6TCB0	Escherichia_phage	82.3	1.2e-36
WP_000672530.1|1987_2722_+	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	54.0	6.5e-39
2249:2265	attL	CACGCATATCAGGAATA	NA	NA	NA	NA
WP_000215167.1|2718_3018_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	99.0	1.3e-57
WP_000161574.1|3019_3505_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	88.9	3.1e-45
WP_000951712.1|3506_3716_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	92.8	2.0e-33
WP_000207970.1|3712_4075_+	hypothetical protein	NA	A0A1B0V865	Salmonella_phage	98.3	4.0e-58
WP_000797279.1|4247_4436_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	98.4	1.4e-30
WP_000628758.1|4949_5519_+	DUF551 domain-containing protein	NA	G9L6B4	Escherichia_phage	95.7	1.4e-102
WP_000382636.1|5509_5767_+	hypothetical protein	NA	A0A077SLR0	Escherichia_phage	97.6	2.0e-40
WP_000002126.1|5766_6048_+	ASCH domain-containing protein	NA	A0A077SLL0	Escherichia_phage	100.0	3.4e-49
WP_000267998.1|6071_6365_+	hypothetical protein	NA	A0A077SK23	Escherichia_phage	99.0	4.2e-50
WP_000988652.1|6371_6746_+	hypothetical protein	NA	A0A077SL57	Escherichia_phage	100.0	1.2e-68
WP_001261541.1|7399_7762_+	hypothetical protein	NA	A0A1B0VBR1	Salmonella_phage	99.2	2.2e-56
WP_001062547.1|8837_9194_-	hypothetical protein	NA	A0A1B0VCG1	Salmonella_phage	99.2	3.1e-63
WP_001133673.1|9194_9779_-	hypothetical protein	NA	Q1MVE8	Enterobacteria_phage	99.0	1.5e-110
WP_000506724.1|9953_10343_+	DNA repair protein	NA	A0A077SK24	Escherichia_phage	99.2	6.4e-70
WP_001190712.1|10415_10637_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216045.1|10636_11017_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
WP_000113018.1|11021_11201_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	1.2e-23
WP_000648833.1|11228_12272_+	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	99.7	1.1e-206
WP_001326849.1|12360_12813_+	late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
WP_097463274.1|12898_14092_+|terminase	terminase	terminase	A0A077SL59	Escherichia_phage	96.0	1.7e-174
WP_000124153.1|14091_15576_+	hypothetical protein	NA	Q71T61	Escherichia_phage	99.8	2.1e-291
WP_000908421.1|15659_16136_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	80.3	3.4e-25
WP_001260629.1|16132_17251_+	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	88.2	7.0e-178
WP_000611655.1|17283_18135_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.3	2.3e-157
WP_000874157.1|18245_18455_-	hypothetical protein	NA	Q5XLQ8	Enterobacteria_phage	98.6	3.1e-31
WP_000542342.1|19059_19281_+	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	93.2	1.1e-31
WP_000481733.1|19300_19696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097463268.1|19692_20724_+|integrase	tyrosine-type recombinase/integrase	integrase	Q71TG5	Escherichia_phage	98.0	3.9e-191
WP_023441714.1|20774_21086_+	hypothetical protein	NA	Q5XLQ4	Enterobacteria_phage	93.2	4.8e-44
WP_103951623.1|21326_22439_-	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	86.0	1.5e-175
WP_000245704.1|22435_22657_-	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	80.8	3.7e-30
WP_001398228.1|23251_23893_+	hypothetical protein	NA	Q71TG2	Escherichia_phage	98.6	6.3e-115
WP_023442346.1|23968_26893_-	type III restriction-modification system endonuclease	NA	Q71TG1	Escherichia_phage	93.5	0.0e+00
WP_032244074.1|26895_28866_-	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	60.2	6.5e-203
WP_000747846.1|29025_29274_-	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_096892010.1|29586_31296_+|portal	phage portal protein	portal	A0A1B0V850	Salmonella_phage	99.5	0.0e+00
WP_000132943.1|31288_32308_+|head	head processing protein	head	Q1MVN5	Enterobacteria_phage	100.0	3.9e-183
WP_001345478.1|32599_33157_-	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
WP_106907430.1|33326_33815_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	98.8	3.2e-87
WP_023442342.1|34012_34801_+	hypothetical protein	NA	A0A1B0VDP8	Salmonella_phage	98.1	2.0e-142
WP_000413423.1|35047_35335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001165934.1|35538_35859_-	hypothetical protein	NA	A0A077SLG5	Escherichia_phage	100.0	1.0e-41
WP_097463266.1|35848_38836_-	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	98.7	0.0e+00
WP_000175491.1|38848_39214_-	hypothetical protein	NA	A0A1B0V846	Salmonella_phage	98.3	9.3e-47
WP_032346484.1|39210_41130_-	hypothetical protein	NA	A0A077SLK4	Escherichia_phage	96.6	0.0e+00
WP_001345482.1|41131_41734_-	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
WP_000580770.1|41720_42164_-	hypothetical protein	NA	A0A077SK09	Escherichia_phage	99.3	2.9e-82
WP_000887652.1|42160_42490_-|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_024177048.1|42380_42755_+	hypothetical protein	NA	A0A077SL44	Escherichia_phage	63.1	1.0e-24
WP_001369353.1|43245_43818_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_106907431.1|44440_47290_-|tail	phage tail protein	tail	Q71TP5	Escherichia_phage	93.9	0.0e+00
44911:44927	attR	CACGCATATCAGGAATA	NA	NA	NA	NA
WP_001286326.1|47301_47736_-	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	100.0	3.3e-75
WP_001189831.1|47814_48651_-	hypothetical protein	NA	A0A077SLH5	Escherichia_phage	98.9	1.7e-152
WP_000047923.1|48650_50084_-	bleomycin hydrolase	NA	A0A1B0VAD6	Salmonella_phage	100.0	3.7e-272
WP_000002800.1|50080_50437_-	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_106907432.1|50436_53829_-	lytic transglycosylase domain-containing protein	NA	Q1MVL3	Enterobacteria_phage	97.7	0.0e+00
WP_001702265.1|53910_54792_-	hypothetical protein	NA	Q71TC9	Escherichia_phage	99.7	4.8e-174
WP_000523978.1|54806_55418_-	hypothetical protein	NA	A0A077SLH8	Escherichia_phage	100.0	5.8e-110
WP_000188924.1|55428_55995_-	hypothetical protein	NA	Q1MVL0	Enterobacteria_phage	100.0	6.6e-100
WP_000846124.1|56053_56323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000245702.1|57657_57879_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	94.5	6.9e-37
WP_001749377.1|57875_58913_+	hypothetical protein	NA	Q71TN2	Escherichia_phage	92.8	7.0e-172
WP_001187875.1|59076_59877_+	protein kilA	NA	Q1MVK4	Enterobacteria_phage	100.0	1.9e-148
WP_106907433.1|59906_60752_+	Replication protein repL	NA	Q1MVK3	Enterobacteria_phage	98.6	3.2e-151
WP_001369095.1|60802_61048_+	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	45.0	3.5e-13
WP_001313475.1|61229_61385_+	type I toxin-antitoxin system toxin HokD	NA	A0A1I9LJU7	Stx_converting_phage	92.2	1.0e-15
WP_000509943.1|61501_62011_-	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	99.4	1.1e-90
WP_000035299.1|62022_62604_-	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	96.9	2.1e-101
WP_000041761.1|62639_63455_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.3	9.8e-113
WP_024222321.1|63464_65054_-	hypothetical protein	NA	Q1MVJ6	Enterobacteria_phage	99.4	1.4e-304
WP_000067713.1|65114_66821_-	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.8	0.0e+00
WP_000038868.1|67045_68047_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	99.7	3.7e-178
WP_001285362.1|68063_69260_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_001113737.1|70530_71415_-	RepB family plasmid replication initiator protein	NA	A0A1B0VDL5	Salmonella_phage	100.0	9.5e-162
WP_001281122.1|71748_72141_-	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	98.5	2.2e-70
WP_000336812.1|72152_72293_-	hypothetical protein	NA	Q71TL6	Escherichia_phage	100.0	6.3e-20
WP_000007769.1|72318_72741_-	hypothetical protein	NA	A0A1B0VCB0	Salmonella_phage	100.0	2.7e-58
WP_000890203.1|72780_73569_-	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	89.3	9.2e-108
WP_001369296.1|73577_73757_-	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	98.3	6.8e-27
WP_001177859.1|74031_74316_+	hypothetical protein	NA	Q71TA2	Escherichia_phage	98.9	1.7e-48
WP_000472523.1|74308_75214_+	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.3	5.9e-159
WP_158707523.1|75421_78499_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	98.5	0.0e+00
WP_106907434.1|80508_81336_+|protease	serine protease	protease	A0A077SLJ6	Escherichia_phage	99.3	3.1e-130
WP_001276599.1|81719_83084_+	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	100.0	2.1e-253
WP_039719950.1|83083_84082_+	hypothetical protein	NA	Q71TK3	Escherichia_phage	98.2	9.0e-193
WP_000535203.1|84128_84761_-	hypothetical protein	NA	A0A077SK50	Escherichia_phage	100.0	6.9e-90
WP_000212018.1|84753_85770_-	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	100.0	3.5e-192
WP_039719949.1|85771_86557_-	hypothetical protein	NA	A0A077SLJ8	Escherichia_phage	98.9	3.0e-143
WP_000896801.1|86543_87272_-	hypothetical protein	NA	A0A077SK19	Escherichia_phage	100.0	9.3e-139
WP_001141908.1|87275_88493_-	hypothetical protein	NA	A0A077SL53	Escherichia_phage	100.0	1.1e-224
WP_000235786.1|88502_88880_-	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_000840931.1|89026_89272_+	hypothetical protein	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
WP_023156914.1|89274_89853_+	VRR-NUC domain protein	NA	Q71T85	Escherichia_phage	99.5	4.4e-107
WP_000095381.1|89919_90075_+	hypothetical protein	NA	Q71TJ4	Escherichia_phage	96.1	2.7e-19
WP_000484110.1|90577_91204_+	norphogenetic protein	NA	Q71T82	Escherichia_phage	100.0	6.1e-123
>prophage 2
NZ_CP027443	Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence	95157	94214	94721	95157		Salmonella_phage(100.0%)	1	NA	NA
WP_000021764.1|94214_94721_+	hypothetical protein	NA	A0A1B0VAK0	Salmonella_phage	99.4	6.3e-94
>prophage 1
NZ_CP027444	Escherichia coli strain 2013C-3252 plasmid unnamed2, complete sequence	91399	1957	83946	91399	protease,transposase,integrase	Stx2-converting_phage(46.15%)	60	52466:52525	86415:87169
WP_000038351.1|1957_2848_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.8	4.4e-66
WP_001247865.1|2912_3179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218854.1|3271_3706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000117628.1|4433_4934_-	antirestriction protein ArdA	NA	NA	NA	NA	NA
WP_032313270.1|5395_5713_-	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	55.8	4.5e-05
WP_001276261.1|5989_6709_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001341455.1|6705_7188_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_000274418.1|7232_7667_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001443814.1|7678_7897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032324142.1|7896_8580_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	2.1e-28
WP_077249722.1|8963_9866_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000921957.1|10138_11098_+	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	40.9	5.4e-62
WP_000445934.1|11097_11493_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_085948186.1|12197_13354_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001172748.1|13720_14110_-	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_000592771.1|14153_16364_-	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_086163899.1|16472_16571_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	2.5e-07
WP_085953785.1|16536_17750_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	2.5e-168
WP_000361610.1|18555_19533_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_001341442.1|19695_19923_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	6.2e-33
WP_001341423.1|19976_20651_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|20647_20995_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_106881567.1|20998_22567_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	55.8	1.1e-157
WP_000091308.1|23390_23756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937603.1|23755_24943_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000422675.1|28921_29398_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	90.7	3.0e-45
WP_001443774.1|32524_32755_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000907857.1|43328_44360_-	replication initiation protein	NA	NA	NA	NA	NA
WP_000335839.1|45068_45710_+	transcription termination factor NusG	NA	NA	NA	NA	NA
WP_000154135.1|45850_46516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106881567.1|47175_48744_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	55.8	1.1e-157
WP_000631725.1|48747_49095_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|49091_49766_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001066949.1|49819_50206_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000704534.1|50333_51194_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.3e-09
WP_157776129.1|51682_51958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948186.1|51998_53155_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
52466:52525	attL	TCAGGTCCGCCACCCAGACCTGATTTGGTGCTGTAGGAGCGAACGTCTGGTTCAGCAGAT	NA	NA	NA	NA
WP_001165114.1|53222_53768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044768.1|53929_54346_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261287.1|54342_54573_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_106907436.1|55132_55546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001164205.1|55547_56330_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
WP_000864810.1|56502_56856_+	colicin M immunity protein	NA	NA	NA	NA	NA
WP_001213545.1|57268_58708_-	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_000987096.1|58711_60832_-	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	1.6e-45
WP_000217745.1|60881_63878_-	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000839950.1|63879_64395_-	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
WP_001302199.1|67044_67866_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|67865_68972_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|69065_70787_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_012680945.1|70860_71859_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_012917688.1|72162_73701_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.8	1.9e-295
WP_000612591.1|73750_74098_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000091308.1|74334_74700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937603.1|74699_75887_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_012917687.1|76165_77734_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
WP_000631725.1|77737_78085_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|78081_78756_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_136139077.1|78686_79106_+	DUF1449 family protein	NA	NA	NA	NA	NA
WP_001034100.1|80043_83946_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
86415:87169	attR	TCAGGTCCGCCACCCAGACCTGATTTGGTGCTGTAGGAGCGAACGTCTGGTTCAGCAGATTTGGCGCAACTGGCAGATTGTGGTTCGAGTTCGTAGTCGCTCTGAACTTGCGTTTCTGCTTACAGCGTAGCCTTAGCTCCTTACGAAGACGTGCCAGTCGGTCACGACCAACGATGATGCCATTCTCTGCCAGCTCCGTCTGGAGCCGCCGGGTTCCATATGTTTCGCGAGTGCGGATATGTGCCACCTTAATCTCCAGTTTTAGCCGCTCATCACTTTGTTTTCTGTCTGAGGGTTCATGCTGTACCCAGTTGTAATAACCGCTCCTGGATACACCAAATACCTGACACATCGCTTCAATGGGAAATTGTTGTCGCCATTGTTCGATTAACGCGTATTTTTCAGCGACTCCTGTGCAAAATACGCTGTTGCTTTTTTTAATATATCTCGCTCAAGGCGAGCTTCATTTAACGCCTTACGCAGTTGCAGAATTTCAGATTCCAGTTCAGCCACCGTGCGGGAACCAGGAGTACCGAGCCCTTTTCTGGCGGCGGTAACCCATTGTCCTAAAGTGCCTTCAGGAAGAGATAATCGGGAAGCGCCTTCACTGATCGAAAGTTGATTTTCAAGAACCGTTCTGACAGCTTCGGCTTTGAACTCTTTAGAGTAACGTTGGGTTTTTCTGCTCATTATTAGCTCCTTCTGATGCCATTCTATTTCAGGAAGGAGTGTCCGTTAAACTCAGGCTACCTCAT	NA	NA	NA	NA
