The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027548	Escherichia coli strain 2014C-3061 chromosome, complete genome	5303935	416561	475900	5303935	holin,integrase,terminase,head,transposase,tRNA,tail	Salmonella_phage(47.73%)	70	420708:420726	486153:486171
WP_000997403.1|416561_417599_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262716.1|417646_418336_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000627807.1|418640_419024_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189207.1|419079_419667_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001443508.1|419769_420651_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
420708:420726	attL	ATGCCGGATGCGGCGTGAA	NA	NA	NA	NA
WP_064482910.1|420887_421868_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000219193.1|422138_423473_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001298974.1|423604_424342_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_001094499.1|424326_425949_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_001303621.1|426204_426360_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001295364.1|426356_426932_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168459.1|426964_427615_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812053.1|427614_428571_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589068.1|428567_429047_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000790168.1|429244_431044_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|431059_432034_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|432306_432987_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000020739.1|432983_433889_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399393.1|433900_434629_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_001297412.1|434640_435372_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986029.1|435371_435752_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000128776.1|436172_436253_+	type I toxin-antitoxin system toxin ShoB	NA	NA	NA	NA	NA
WP_000054752.1|436446_436707_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_001138334.1|436921_438319_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001291430.1|438315_438516_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032314214.1|438512_439907_-	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	73.5	4.9e-213
WP_032314215.1|439950_440757_-	DNA-binding protein	NA	B1GS65	Salmonella_phage	54.8	7.4e-20
WP_000043908.1|441109_441439_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001382380.1|441407_441584_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000312948.1|441580_441850_-	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	64.7	1.5e-25
WP_000637724.1|441839_442139_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	63.2	2.7e-28
WP_032314216.1|442135_442351_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032314217.1|442356_444420_-	DNA polymerase	NA	Q775A3	Bordetella_phage	67.7	3.9e-275
WP_032314218.1|444446_445046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032314219.1|445072_445621_-	DUF2815 family protein	NA	Q775A5	Bordetella_phage	65.4	1.0e-65
WP_032314220.1|445636_446938_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	55.5	2.3e-132
WP_106904285.1|446940_447843_-	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
WP_000606440.1|448622_449315_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	48.5	3.8e-57
WP_000708850.1|449428_449611_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_032314221.1|449603_451790_+	replication protein	NA	B6SCY1	Bacteriophage	72.9	4.9e-175
WP_032314222.1|452076_452511_+	antitermination protein Q	NA	B6SD39	Bacteriophage	62.9	1.1e-41
WP_000781776.1|452914_453256_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	91.9	2.8e-53
WP_001194117.1|453259_453736_+	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	95.6	1.0e-85
WP_000779566.1|453719_454244_+	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	66.9	4.5e-42
WP_000162796.1|454305_454878_+|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	69.6	1.4e-60
WP_001130793.1|454880_456503_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.6	0.0e+00
WP_032314223.1|456502_457969_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.6	2.5e-260
WP_136759112.1|457859_458594_+|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	85.1	5.2e-97
WP_032314224.1|458608_459829_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	89.3	4.0e-203
WP_021580222.1|459832_460339_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	79.3	6.4e-70
WP_032314225.1|460350_461292_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.9	6.3e-156
WP_001107515.1|461333_461555_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	68.6	7.7e-12
WP_001125663.1|461520_461928_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.8	2.5e-69
WP_000008729.1|461924_462479_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	84.8	2.0e-80
WP_032314226.1|462465_462855_+|head,tail	head-tail adaptor	head,tail	A0A0M3ULK0	Salmonella_phage	95.3	5.6e-66
WP_000503647.1|462829_463393_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.7	1.3e-79
WP_023565717.1|463396_464542_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.5	1.8e-160
WP_000109249.1|464552_464993_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_032314228.1|464996_465449_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	73.3	2.7e-56
WP_032314230.1|465626_467615_+	lytic transglycosylase	NA	A0A0M4REK7	Salmonella_phage	74.3	3.7e-270
WP_001420197.1|467614_468202_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.5	6.9e-84
WP_000155113.1|468201_468504_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	90.0	4.1e-48
WP_032314231.1|468506_469568_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	80.3	4.5e-158
WP_032314234.1|469571_469913_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	85.3	1.8e-31
WP_032314235.1|470049_470781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032314236.1|470780_471203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032314237.1|471266_472019_+	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	65.9	1.6e-88
WP_001270636.1|472018_472372_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	88.9	2.0e-54
WP_032314239.1|473566_474247_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.3	1.0e-102
WP_033816087.1|475321_475900_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	1.3e-95
486153:486171	attR	TTCACGCCGCATCCGGCAT	NA	NA	NA	NA
>prophage 2
NZ_CP027548	Escherichia coli strain 2014C-3061 chromosome, complete genome	5303935	927824	1019061	5303935	holin,capsid,integrase,terminase,head,transposase,protease,tail	Stx2-converting_phage(33.96%)	119	951537:951565	999549:999577
WP_000569361.1|927824_928751_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|928755_929487_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|929467_929575_-	protein YohO	NA	NA	NA	NA	NA
WP_029208330.1|929634_930336_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.0e-102
WP_000063648.1|930356_931643_-|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|931676_931931_-	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556584.1|931949_932084_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	97.7	9.3e-21
WP_000457728.1|932087_932330_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000207998.1|932417_933248_-	DUF550 domain-containing protein	NA	Q6H9Z7	Enterobacteria_phage	91.4	6.6e-48
WP_000582233.1|933258_934014_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	92.8	3.2e-142
WP_001289866.1|934015_934654_-	ead/Ea22-like family protein	NA	Q6H9Z5	Enterobacteria_phage	97.2	5.2e-93
WP_000763376.1|934650_934872_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	98.6	2.9e-35
WP_001386642.1|934970_935252_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000548531.1|935262_935454_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000682315.1|935426_935609_-	DUF1317 domain-containing protein	NA	Q6H9Z1	Enterobacteria_phage	100.0	9.7e-29
WP_000186851.1|935605_936286_-	YqaJ viral recombinase family protein	NA	Q6H9Z0	Enterobacteria_phage	100.0	1.2e-132
WP_015971133.1|936282_937068_-	phage recombination protein Bet	NA	A0A0P0ZDB4	Stx2-converting_phage	100.0	4.8e-149
WP_000995439.1|937073_937370_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372941.1|937445_937589_-	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_001198861.1|937557_937722_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065377.1|937794_938163_-	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_000167595.1|938313_938784_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_001479835.1|938842_939226_-	hypothetical protein	NA	A0A0P0ZBT9	Stx2-converting_phage	100.0	2.3e-64
WP_106904294.1|939697_940102_-	hypothetical protein	NA	A0A0P0ZDD3	Stx2-converting_phage	99.3	6.2e-68
WP_001082382.1|940098_940755_-	transcriptional regulator	NA	A0A0P0ZCT8	Stx2-converting_phage	100.0	2.6e-116
WP_000866443.1|940751_941039_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	100.0	1.6e-49
WP_000428098.1|941175_941880_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
WP_000064148.1|941993_942227_+	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	100.0	8.0e-36
WP_000438541.1|942365_942662_+	hypothetical protein	NA	C1JJ56	Enterobacteria_phage	100.0	8.9e-48
WP_032314820.1|942694_943633_+	replication protein	NA	A0A0P0ZCK0	Stx2-converting_phage	100.0	1.4e-171
WP_032208536.1|943629_944331_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	98.7	6.4e-129
WP_000145907.1|944327_944618_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	99.0	1.6e-46
WP_001000127.1|944688_944967_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000103679.1|945098_945314_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001281772.1|945324_945561_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000814576.1|945517_945964_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_000153280.1|945960_946488_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_001254256.1|946484_946667_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000211422.1|946941_947676_+	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	100.0	1.9e-123
WP_001004024.1|947750_948473_+	DNA-binding protein	NA	A0A0N7C231	Escherichia_phage	100.0	7.8e-130
WP_001107963.1|948472_949078_+	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
WP_000144759.1|949074_949269_+	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_001204852.1|949261_949696_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	100.0	3.6e-82
WP_000691354.1|950202_951150_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|951159_951429_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
951537:951565	attL	GCATGGTGAATCCCCCTGTGCGGAGGGGC	NA	NA	NA	NA
WP_000142998.1|951928_953866_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	100.0	0.0e+00
WP_000143462.1|954001_954181_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_001290217.1|954221_954494_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
WP_000284518.1|954570_954786_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731236.1|954790_955135_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_001092890.1|955185_955719_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	100.0	1.6e-103
WP_001056806.1|955989_956559_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|956558_956705_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|956932_957118_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095749.1|957542_957770_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001303046.1|957811_958177_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958387.1|958466_959030_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_015971136.1|959026_960688_+|terminase	terminase large subunit	terminase	Q6H9U9	Enterobacteria_phage	100.0	0.0e+00
WP_000172990.1|960751_962689_+|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.7	0.0e+00
WP_001063099.1|962733_962955_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125990.1|965643_965970_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|965979_966330_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|966326_966773_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|966769_967114_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|967172_967889_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|967894_968269_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|968364_968574_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_015971141.1|968625_971868_+|tail	phage tail tape measure protein	tail	Q6H9T7	Enterobacteria_phage	100.0	0.0e+00
WP_000807964.1|971860_972202_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001152217.1|972201_972900_+|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	99.6	2.8e-132
WP_106904295.1|972910_973654_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	1.3e-148
WP_136737377.1|973599_974232_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	97.1	5.1e-101
WP_106904296.1|974478_977955_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	97.2	0.0e+00
WP_001230383.1|978021_978621_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.0	1.4e-108
WP_106904297.1|978680_979952_+|tail	phage tail protein	tail	A0A0P0ZDE7	Stx2-converting_phage	93.1	2.2e-71
WP_001401301.1|979973_980222_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	96.3	2.8e-39
WP_159030173.1|980348_981524_-	Tir-cytoskeleton coupling protein TccP2	NA	NA	NA	NA	NA
WP_001443410.1|981969_982353_-	hypothetical protein	NA	Q6H9S1	Enterobacteria_phage	84.3	4.4e-55
WP_001299701.1|982657_983677_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.7e-85
WP_000273151.1|983654_983897_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_064482952.1|983964_986436_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	61.4	1.0e-59
WP_001090200.1|986528_986720_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|986716_986905_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000394557.1|987436_987811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379580.1|987822_987975_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.9e-07
WP_000103686.1|988247_988964_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	3.8e-52
WP_000471549.1|989013_989229_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693949.1|989225_989651_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262389.1|989722_990793_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	3.2e-63
WP_001151153.1|990833_991256_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	1.1e-64
WP_001266134.1|991252_991549_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	3.4e-47
WP_001209480.1|991545_992007_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403777.1|991984_992341_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_000935420.1|992391_992604_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_042350895.1|992689_992854_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000224233.1|992855_993119_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000207986.1|993129_993999_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_001278454.1|994114_994219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902696.1|994407_994620_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
WP_001341388.1|994787_995066_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265133.1|995067_996117_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_001217436.1|996129_996501_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000917737.1|998116_998314_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000261909.1|998451_999165_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000411814.1|1002232_1002439_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
999549:999577	attR	GCATGGTGAATCCCCCTGTGCGGAGGGGC	NA	NA	NA	NA
WP_000138558.1|1002694_1002967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|1003126_1003660_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|1003880_1003994_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|1004215_1004401_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|1004927_1005242_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|1005323_1005548_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_106904299.1|1005982_1007196_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.0	7.9e-167
WP_000847304.1|1009169_1009499_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001357740.1|1009498_1010197_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_053895436.1|1010207_1010951_+|tail	phage tail protein	tail	H6WZM4	Escherichia_phage	99.6	1.1e-150
WP_052915903.1|1010896_1011529_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	96.2	7.1e-103
WP_000649829.1|1011719_1012247_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_085947772.1|1013421_1014635_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_106904413.1|1017846_1019061_+|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	94.6	4.8e-79
>prophage 3
NZ_CP027548	Escherichia coli strain 2014C-3061 chromosome, complete genome	5303935	1191949	1283399	5303935	holin,portal,capsid,terminase,head,transposase,tail	Escherichia_phage(40.0%)	101	NA	NA
WP_106904303.1|1191949_1193162_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.6	5.5e-168
WP_001300307.1|1196441_1197239_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_106904304.1|1198052_1198433_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|1198429_1198777_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_096988654.1|1198826_1200365_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	2.0e-300
WP_000096346.1|1200949_1201153_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001090200.1|1203776_1203968_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1203964_1204153_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133037.1|1204723_1204933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394546.1|1204933_1205572_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001345283.1|1205583_1205736_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
WP_000362152.1|1206002_1206422_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
WP_000391948.1|1206521_1206803_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000693883.1|1206786_1207212_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262348.1|1207283_1208366_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.7e-64
WP_000788760.1|1208372_1209119_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.2	3.6e-114
WP_000450617.1|1209140_1209857_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
WP_042353845.1|1209889_1210171_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	72.5	3.9e-29
WP_000699809.1|1210167_1210395_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000034815.1|1210387_1210699_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	1.6e-55
WP_000683609.1|1210826_1211045_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|1211046_1211604_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|1211837_1212050_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|1212169_1212514_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|1212635_1212908_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|1212909_1213959_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217447.1|1213971_1214331_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_000640035.1|1214339_1214894_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|1215118_1215316_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|1215451_1216165_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000466957.1|1216615_1217047_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_153244796.1|1217396_1217540_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	97.4	3.7e-15
WP_064482878.1|1217525_1219463_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.7	0.0e+00
WP_000143464.1|1219599_1219779_+	DUF1378 family protein	NA	G9L6J3	Escherichia_phage	100.0	1.3e-25
WP_001290231.1|1219819_1220092_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284516.1|1220168_1220384_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	7.7e-33
WP_001092860.1|1220946_1221480_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	1.9e-101
WP_045904330.1|1221750_1222320_+	antirepressor	NA	A0A1I9LJR6	Stx_converting_phage	99.5	9.0e-105
WP_000539795.1|1222319_1222466_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|1222688_1222874_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|1223399_1223714_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|1223795_1224020_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_033816199.1|1224405_1224951_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_001027269.1|1224925_1226851_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|1226847_1227054_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_033816198.1|1227050_1228652_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
WP_000123236.1|1228632_1229952_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	9.0e-233
WP_001299443.1|1229961_1230294_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_032314870.1|1230349_1231375_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.1	4.4e-187
WP_000158899.1|1231416_1231812_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.0e-55
WP_000752996.1|1231823_1232177_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	1.5e-62
WP_033816197.1|1232188_1232767_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	3.9e-79
WP_000683137.1|1232763_1233159_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_033816257.1|1233166_1233919_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.8	1.4e-134
WP_000479105.1|1233932_1234364_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_062864850.1|1234390_1234795_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	3.4e-42
WP_106904305.1|1234775_1237355_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.1	0.0e+00
WP_000847298.1|1237351_1237681_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001152217.1|1237680_1238379_+|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	99.6	2.8e-132
WP_106904295.1|1238389_1239133_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	1.3e-148
WP_136737377.1|1239078_1239711_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	97.1	5.1e-101
WP_106904296.1|1239957_1243434_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	97.2	0.0e+00
WP_001230383.1|1243500_1244100_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.0	1.4e-108
WP_106904297.1|1244159_1245431_+|tail	phage tail protein	tail	A0A0P0ZDE7	Stx2-converting_phage	93.1	2.2e-71
WP_001401301.1|1245452_1245701_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	96.3	2.8e-39
WP_000022458.1|1246741_1247395_-	type III secretion system effector ADP-ribosyltransferase EspJ	NA	NA	NA	NA	NA
WP_001079090.1|1248530_1249061_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_001317164.1|1249403_1250075_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001240091.1|1250310_1250946_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_000740094.1|1250946_1251951_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_000920132.1|1252059_1252473_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_001339045.1|1252605_1253277_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826749.1|1253276_1254635_+	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	6.6e-05
WP_000218204.1|1254742_1255594_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000824367.1|1256185_1257259_-	porin	NA	Q1MVN1	Enterobacteria_phage	51.3	3.1e-98
WP_001313057.1|1257824_1258190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365559.1|1258229_1258925_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_001157238.1|1258991_1260410_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
WP_000786005.1|1260390_1260861_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.0e-33
WP_000922682.1|1261941_1262859_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009307.1|1262937_1263120_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000491497.1|1264980_1265796_-	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_000844800.1|1266093_1266321_-	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_071524607.1|1266429_1266672_+	protein DsrB	NA	NA	NA	NA	NA
WP_000103987.1|1266715_1267339_-	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_032314571.1|1267628_1268414_-	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000187358.1|1268422_1268692_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_001253441.1|1268701_1269439_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_001299290.1|1269438_1269804_-	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001282098.1|1269806_1270220_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001295641.1|1270216_1271221_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_000133124.1|1271225_1271690_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000807661.1|1272917_1273361_-	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_001282685.1|1274751_1275438_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000067950.1|1275430_1276426_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000994405.1|1276418_1278077_-	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_001274295.1|1278291_1278606_+	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001070440.1|1278939_1279272_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000734031.1|1279440_1279992_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000879833.1|1280001_1280799_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_064734585.1|1282190_1283399_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	1.3e-209
>prophage 4
NZ_CP027548	Escherichia coli strain 2014C-3061 chromosome, complete genome	5303935	1385817	1464105	5303935	holin,portal,integrase,terminase,tRNA,protease,tail	Escherichia_phage(35.09%)	87	1376107:1376122	1457451:1457466
1376107:1376122	attL	GAACGTCTGCTGCTGG	NA	NA	NA	NA
WP_000916763.1|1385817_1386048_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168747.1|1386186_1386561_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000976476.1|1387448_1387790_+	YebY family protein	NA	NA	NA	NA	NA
WP_001189081.1|1388182_1389259_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.1	5.8e-97
WP_001311878.1|1389224_1389506_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
WP_001356607.1|1389612_1389801_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_042853000.1|1389793_1389988_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_000166311.1|1390044_1390854_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_106904308.1|1390846_1393594_-	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	76.9	1.5e-258
WP_065336296.1|1394045_1394216_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	1.0e-16
WP_000560228.1|1394215_1394437_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.4e-37
WP_000935592.1|1394483_1395332_-	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	60.8	5.9e-60
WP_001169149.1|1395760_1395913_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	57.4	2.1e-08
WP_001253182.1|1396293_1396758_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	69.5	1.2e-54
WP_000171139.1|1396862_1397138_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	65.9	1.4e-23
WP_000702025.1|1397121_1397544_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	94.3	3.4e-69
WP_001428773.1|1397621_1398410_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.7	6.1e-43
WP_000789014.1|1398416_1399157_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	83.3	2.3e-116
WP_045896229.1|1399182_1399953_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.4	1.5e-86
WP_001118161.1|1399968_1400364_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_045896225.1|1400420_1401005_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	83.5	5.5e-33
WP_001278450.1|1401120_1401225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024184148.1|1401413_1401626_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	1.1e-26
WP_000940345.1|1402079_1402679_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	93.0	5.9e-107
WP_000228038.1|1402678_1402969_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	89.6	3.3e-47
WP_000640150.1|1402965_1403520_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	71.6	2.6e-72
WP_024222756.1|1403793_1404351_+	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	77.6	1.4e-46
WP_032313455.1|1405064_1407011_+	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	97.4	0.0e+00
WP_000142777.1|1407147_1407327_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.4e-24
WP_001290233.1|1407367_1407613_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	90.1	2.2e-15
WP_000284506.1|1407689_1407905_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087730.1|1407909_1408443_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	98.9	3.9e-102
WP_001056806.1|1408713_1409283_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1409282_1409429_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1409656_1409842_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348565.1|1410359_1410836_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077625.1|1410832_1412956_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102415.1|1412952_1413165_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974564.1|1413164_1414667_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001097065.1|1416722_1417049_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281347.1|1417041_1417323_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	98.9	1.3e-45
WP_001450644.1|1417325_1417949_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	98.6	2.9e-104
WP_000682716.1|1417961_1418360_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1418367_1419120_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_044707580.1|1419133_1419556_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	3.3e-72
WP_000533450.1|1419582_1419891_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	98.0	6.6e-54
WP_106904309.1|1419934_1422580_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.0	0.0e+00
WP_000847298.1|1422576_1422906_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_024236480.1|1422905_1423604_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	3.4e-130
WP_001443526.1|1423609_1424353_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.7	3.6e-146
WP_159030175.1|1424298_1424931_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	95.2	3.0e-101
WP_001230398.1|1428720_1429320_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	9.7e-110
WP_106904311.1|1429384_1430698_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.4	2.2e-82
WP_001023407.1|1430699_1430969_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000812720.1|1431697_1432354_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	1.2e-55
WP_001296140.1|1432354_1432546_-	YebW family protein	NA	NA	NA	NA	NA
WP_001295499.1|1432650_1432887_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001443441.1|1433004_1434444_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_032314101.1|1434523_1437157_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_106904312.1|1437125_1438409_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001043881.1|1438538_1439036_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_032314102.1|1439132_1439831_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001055778.1|1439850_1441899_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.2e-85
WP_000984517.1|1442090_1442972_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001127219.1|1443017_1444391_-	MFS transporter	NA	NA	NA	NA	NA
WP_001262182.1|1444567_1445359_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001211011.1|1445501_1445741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714550.1|1445899_1446043_+	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001006866.1|1446117_1446405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295496.1|1447073_1447217_+	YobF family protein	NA	NA	NA	NA	NA
WP_001062678.1|1447229_1447439_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_000010129.1|1447604_1448414_+	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001443443.1|1448410_1448989_-	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000156255.1|1449417_1449876_-	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_000228655.1|1449930_1450782_-	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000406926.1|1450794_1451595_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000150543.1|1451657_1452629_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000394983.1|1453091_1454648_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
WP_061354052.1|1454651_1456250_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000624298.1|1456380_1457745_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
1457451:1457466	attR	CCAGCAGCAGACGTTC	NA	NA	NA	NA
WP_000456730.1|1457928_1458507_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000854972.1|1458510_1459872_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000457334.1|1459945_1460125_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001300615.1|1460244_1460604_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|1460965_1461310_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128847.1|1461441_1463352_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001220981.1|1463409_1464105_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP027548	Escherichia coli strain 2014C-3061 chromosome, complete genome	5303935	1983190	2080555	5303935	holin,portal,integrase,terminase,head,transposase,protease,tail	Enterobacteria_phage(30.38%)	115	2030273:2030331	2076476:2076534
WP_000422045.1|1983190_1984240_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559280.1|1984459_1985218_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
WP_001278904.1|1985214_1985805_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|1985844_1986717_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|1986817_1987438_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|1987434_1988316_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|1988453_1988498_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194590.1|1988589_1990152_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|1990151_1991747_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_106904415.1|1991750_1993109_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.3	1.2e-35
WP_000209520.1|1993120_1994314_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443067.1|1994313_1995120_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|1995500_1995680_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|1995765_1996266_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079509.1|1996311_1996818_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_071529157.1|1997318_1997537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096846282.1|1999113_2000276_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	42.3	8.1e-52
WP_001386222.1|2000341_2000491_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000938103.1|2000537_2001107_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|2001171_2002083_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|2002189_2002312_-	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_106425100.1|2005393_2005588_-	hypothetical protein	NA	A0A2R2Z347	Escherichia_phage	87.2	8.2e-10
WP_000767050.1|2005532_2006075_-	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
WP_001023388.1|2006295_2006565_-	hypothetical protein	NA	A0A2R2Z347	Escherichia_phage	98.9	6.4e-45
WP_032314473.1|2006566_2007871_-|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	87.3	3.0e-71
WP_001216293.1|2007935_2008559_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.8	1.0e-69
WP_074390344.1|2008625_2009852_-	DUF1983 domain-containing protein	NA	Q6H9T2	Enterobacteria_phage	99.8	2.0e-218
WP_085947772.1|2009906_2011120_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_072023064.1|2011140_2011260_-|head	head protein	head	A0A0P0ZAJ3	Stx2-converting_phage	100.0	1.6e-11
WP_001417827.1|2011323_2012985_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_047661669.1|2012981_2013545_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.6	7.1e-86
WP_105466968.1|2014161_2015374_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.3	6.7e-166
WP_000074669.1|2015544_2015769_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303878.1|2015850_2016165_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_137524955.1|2016692_2016878_-	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	77.0	8.3e-20
WP_047661548.1|2017094_2017592_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	9.9e-92
WP_000411802.1|2017591_2017798_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000023143.1|2018245_2020096_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_001059384.1|2021614_2022304_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_032314810.1|2022326_2022665_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.4e-33
WP_010917803.1|2023723_2024002_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|2024071_2024329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961821.1|2024549_2024762_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001449026.1|2025040_2025799_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_122368318.1|2026497_2026662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450692.1|2026658_2027393_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.7	7.7e-109
WP_157911289.1|2027426_2027969_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	8.3e-84
WP_032314809.1|2027880_2028921_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.7	5.1e-90
WP_000705622.1|2028892_2029444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|2029427_2029655_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2029731_2030139_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
2030273:2030331	attL	CATCAAGACACCGCACGGTGTTCTCAGCAAACAGTTCCGCTACCCGGCGTTAAGGGGAA	NA	NA	NA	NA
WP_001240336.1|2030403_2030703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|2030775_2030994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2031016_2031424_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|2031401_2031635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|2031628_2031796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2032195_2032384_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2032380_2032572_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_064482945.1|2032664_2035136_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	55.8	8.0e-57
WP_000113189.1|2035200_2035449_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|2035426_2036557_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000692020.1|2037580_2038171_-	protein kinase	NA	NA	NA	NA	NA
WP_001024006.1|2039303_2039573_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_106904330.1|2039574_2040888_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.7	4.2e-81
WP_001230435.1|2040952_2041552_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	8.2e-109
WP_106904331.1|2041619_2045093_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.3	0.0e+00
WP_123178851.1|2045333_2045963_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.1	1.7e-101
WP_000194802.1|2045908_2046652_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	2.4e-150
WP_001302134.1|2046662_2047361_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	98.3	5.2e-131
WP_000847298.1|2047360_2047690_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918238.1|2047686_2050332_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	94.4	0.0e+00
WP_000532073.1|2050375_2050684_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479062.1|2050710_2051133_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000235090.1|2051146_2051899_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|2051906_2052305_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974960.1|2052317_2052941_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	99.5	2.5e-100
WP_001281350.1|2052943_2053225_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|2053217_2053544_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_000974554.1|2055599_2057102_-|portal	phage portal protein	portal	S5MW34	Escherichia_phage	99.8	3.1e-290
WP_000102415.1|2057101_2057314_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077628.1|2057310_2059434_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.7	0.0e+00
WP_000373407.1|2059430_2059907_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_012816791.1|2060381_2060567_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_032313251.1|2061085_2061619_-	lysozyme	NA	A0A2R2Z343	Escherichia_phage	96.6	2.1e-100
WP_001015158.1|2061655_2062213_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	80.9	1.5e-48
WP_001072901.1|2062216_2062432_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290230.1|2062509_2062755_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|2062795_2062975_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000142977.1|2063109_2065056_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	99.1	0.0e+00
WP_000483509.1|2065650_2066709_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	2.6e-206
WP_000917735.1|2066859_2067057_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000762902.1|2067283_2068105_-	hypothetical protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
WP_000904171.1|2068101_2068476_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	4.2e-34
WP_001265156.1|2068488_2069538_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.9e-108
WP_012779355.1|2069539_2069818_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	4.8e-11
WP_001217394.1|2069887_2070145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|2070365_2070578_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001278450.1|2070766_2070871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000610377.1|2070986_2071349_-	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	97.5	2.8e-67
WP_000137941.1|2071345_2071717_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
WP_000063625.1|2071752_2071965_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_001302146.1|2072013_2072370_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	3.7e-56
WP_001118161.1|2072426_2072822_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_000537576.1|2072837_2073608_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	65.6	7.2e-81
WP_157837342.1|2073642_2074185_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	2.9e-84
WP_000020570.1|2074096_2075137_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.7	1.8e-90
WP_000705378.1|2075108_2075660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476986.1|2075643_2075871_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003379.1|2075948_2076356_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000379589.1|2076545_2076701_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
2076476:2076534	attR	CATCAAGACACCGCACGGTGTTCTCAGCAAACAGTTCCGCTACCCGGCGTTAAGGGGAA	NA	NA	NA	NA
WP_001171938.1|2076860_2077079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302137.1|2077082_2077247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450222.1|2077644_2077833_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000092782.1|2077829_2078018_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102168.1|2078110_2080555_+	exonuclease	NA	V5UQJ3	Shigella_phage	58.3	8.4e-176
>prophage 6
NZ_CP027548	Escherichia coli strain 2014C-3061 chromosome, complete genome	5303935	2295693	2384678	5303935	lysis,holin,capsid,bacteriocin,portal,integrase,terminase,transposase,protease,tail	Escherichia_phage(48.0%)	93	2321630:2321645	2386399:2386414
WP_085947598.1|2295693_2296855_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_033815865.1|2296896_2298255_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.5	7.3e-20
WP_000287458.1|2298841_2301265_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_000945561.1|2301273_2303292_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_001061095.1|2304610_2305024_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_000258765.1|2305073_2306138_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	1.1e-90
WP_001199458.1|2306481_2307753_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_000154413.1|2307758_2308886_-	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_000497942.1|2308943_2309774_-	FTR1 family protein	NA	NA	NA	NA	NA
WP_001018486.1|2310439_2311948_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000979516.1|2312106_2312316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032314678.1|2312370_2316333_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000191700.1|2316372_2317011_-	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_001297176.1|2317298_2318390_+	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_001307708.1|2318389_2319082_+	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_001126780.1|2319093_2319480_+	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_000777653.1|2319487_2320288_+	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001001171.1|2320297_2320888_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001028095.1|2320898_2321393_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_032314677.1|2321413_2322742_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.6	4.5e-232
2321630:2321645	attL	TTCTTTATTACCGGCG	NA	NA	NA	NA
WP_001273658.1|2322824_2322998_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_000203845.1|2323959_2324577_+	phage antirepressor Ant	NA	A0A0N6WET9	Escherichia_phage	89.0	2.8e-96
WP_000763353.1|2324624_2324846_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C094	Escherichia_phage	100.0	1.3e-35
WP_001024844.1|2324842_2325127_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	100.0	3.2e-47
WP_000426668.1|2326011_2326407_+	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	100.0	4.7e-68
WP_000935259.1|2326640_2326853_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756595.1|2326972_2327317_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	100.0	4.6e-56
WP_106904339.1|2336317_2337583_-	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	99.8	6.9e-206
WP_000540391.1|2337593_2337845_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455649.1|2337854_2338301_-	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
WP_000509481.1|2338303_2338960_-	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000035558.1|2339053_2339455_-	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000078907.1|2339511_2339652_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835360.1|2339884_2340619_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_001301884.1|2340709_2341327_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000455634.1|2341332_2341611_-	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_000197192.1|2341625_2342894_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_001146326.1|2342890_2344516_-	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	100.0	0.0e+00
WP_159030174.1|2344810_2344999_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	98.4	3.4e-29
WP_001358663.1|2345309_2346506_+|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_001024006.1|2346590_2346860_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_000117994.1|2346861_2348799_-|tail	tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_000829200.1|2349444_2350008_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_001290743.1|2349991_2350453_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_001140442.1|2350502_2350892_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_106904341.1|2350947_2352162_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	99.8	6.3e-233
WP_000345010.1|2352185_2353193_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000787036.1|2353350_2355495_-|portal	portal protein	portal	V5URY3	Shigella_phage	100.0	0.0e+00
WP_000143984.1|2355494_2357201_-	hypothetical protein	NA	G9L6K0	Escherichia_phage	99.8	0.0e+00
WP_001086073.1|2357181_2357988_-|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_000738505.1|2358396_2358690_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001082654.1|2358721_2359186_-|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000455406.1|2359193_2359343_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001056885.1|2359342_2359912_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000087461.1|2360186_2360720_-	lysozyme	NA	V5USG4	Shigella_phage	100.0	7.9e-103
WP_000284506.1|2360724_2360940_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290212.1|2361016_2361289_-	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000143458.1|2361329_2361509_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_106904342.1|2361643_2363581_-	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	99.4	0.0e+00
WP_001204880.1|2364802_2365237_-	antitermination protein	NA	G9L695	Escherichia_phage	100.0	2.8e-82
WP_000144764.1|2365229_2365424_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_064032103.1|2365420_2366032_-	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	100.0	1.1e-97
WP_001108081.1|2366006_2366573_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001502725.1|2367154_2368927_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	100.0	0.0e+00
WP_001254228.1|2369430_2369613_-	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_000153270.1|2369609_2370137_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_000810176.1|2370133_2370580_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	92.6	3.4e-75
WP_000229807.1|2370587_2370794_-	hypothetical protein	NA	G8C7M4	Escherichia_phage	97.1	1.8e-26
WP_000145926.1|2370866_2371157_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000788878.1|2371153_2371855_-	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	99.6	1.7e-129
WP_000185462.1|2371851_2372790_-	replication protein	NA	C1JJ53	Enterobacteria_phage	99.4	1.1e-171
WP_000438528.1|2372822_2373119_-	hypothetical protein	NA	Q08J40	Stx2-converting_phage	100.0	5.2e-48
WP_001054987.1|2373225_2373450_-	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	86.3	1.4e-29
WP_000092876.1|2373594_2374269_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	84.4	3.1e-104
WP_000885926.1|2374306_2374648_+	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	99.1	2.5e-62
WP_000035314.1|2375179_2375371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001450670.1|2376126_2376468_+	hypothetical protein	NA	F1C5C1	Cronobacter_phage	66.4	2.5e-30
WP_000095080.1|2376479_2377103_+	hypothetical protein	NA	A0A2D1GLY1	Escherichia_phage	97.1	9.5e-108
WP_001198861.1|2377324_2377489_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372941.1|2377457_2377601_+	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_000995439.1|2377676_2377973_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100845.1|2377978_2378764_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000186866.1|2378760_2379441_+	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	100.0	2.1e-132
WP_000682315.1|2379437_2379620_+	DUF1317 domain-containing protein	NA	Q6H9Z1	Enterobacteria_phage	100.0	9.7e-29
WP_000548531.1|2379592_2379784_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_077758510.1|2379794_2380076_+	cell division protein ZapA	NA	Q6H9Z3	Enterobacteria_phage	98.9	9.3e-47
WP_000774248.1|2380174_2380396_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	100.0	3.8e-35
WP_033815964.1|2380392_2381031_+	ead/Ea22-like family protein	NA	Q6H9Z5	Enterobacteria_phage	98.3	6.1e-94
WP_106904343.1|2381032_2381224_+	hypothetical protein	NA	G9L660	Escherichia_phage	92.1	4.4e-24
WP_000022062.1|2382276_2382558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303965.1|2382645_2382945_+	hypothetical protein	NA	G9L655	Escherichia_phage	100.0	2.4e-53
WP_001208773.1|2383030_2383315_+	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_000013654.1|2383367_2384678_+|integrase	site-specific integrase	integrase	A0A1I9LJL6	Stx_converting_phage	100.0	3.2e-254
2386399:2386414	attR	CGCCGGTAATAAAGAA	NA	NA	NA	NA
>prophage 7
NZ_CP027548	Escherichia coli strain 2014C-3061 chromosome, complete genome	5303935	2415167	2468582	5303935	holin,capsid,portal,terminase,head,protease,tail	Enterobacteria_phage(39.13%)	63	NA	NA
WP_032314674.1|2415167_2415755_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|2415751_2416459_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107384.1|2416477_2418271_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|2418267_2419386_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_032175067.1|2420004_2420388_+	hypothetical protein	NA	Q6H9S1	Enterobacteria_phage	83.5	2.2e-54
WP_106904344.1|2420833_2421748_+	molecular chaperone Tir	NA	NA	NA	NA	NA
WP_032314673.1|2421938_2422577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032314672.1|2422641_2423622_-	NleB family type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	50.5	3.5e-88
WP_032314671.1|2423798_2424068_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	5.4e-44
WP_064482948.1|2424069_2425383_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.4	2.2e-82
WP_001360257.1|2425447_2426071_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.4	1.7e-69
WP_106904345.1|2426139_2429616_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	98.3	0.0e+00
WP_126347159.1|2429851_2430484_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	91.4	5.0e-96
WP_000194707.1|2430429_2431173_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	99.2	1.2e-149
WP_001443841.1|2431183_2431882_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	97.4	4.4e-130
WP_000847298.1|2431881_2432211_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_062864825.1|2432207_2434820_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000533442.1|2434800_2435214_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479051.1|2435240_2435663_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235067.1|2435676_2436429_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000683137.1|2436436_2436832_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000975098.1|2436828_2437407_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	5.0e-79
WP_000752994.1|2437418_2437772_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000158897.1|2437783_2438179_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000063258.1|2438220_2439246_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001365129.1|2439301_2439634_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000123251.1|2439643_2440963_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_106904346.1|2440943_2442545_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	6.1e-308
WP_000198153.1|2442541_2442748_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027379.1|2442744_2444670_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_106904347.1|2444644_2445190_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	5.2e-94
WP_001329960.1|2445578_2445764_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000347012.1|2445900_2446038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092861.1|2447153_2447687_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	5.3e-99
WP_000731214.1|2447729_2448719_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	64.4	6.8e-108
WP_000411813.1|2448723_2448930_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	1.2e-30
WP_106904348.1|2449227_2451078_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000261909.1|2451845_2452559_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917737.1|2452696_2452894_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_032314867.1|2453180_2453999_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090265.1|2454150_2454522_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_001217436.1|2454511_2454883_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265141.1|2454895_2455945_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.5e-110
WP_001341388.1|2455946_2456225_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001013636.1|2456392_2456605_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_000955173.1|2456649_2456787_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|2457152_2457926_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|2458277_2458691_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000451007.1|2458706_2459477_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_000788742.1|2459498_2460245_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.6	5.6e-115
WP_001205821.1|2460251_2461367_-	hypothetical protein	NA	V5URT9	Shigella_phage	68.4	3.4e-132
WP_000273724.1|2461445_2461901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|2462107_2462533_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|2462516_2462789_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|2462897_2463299_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|2463326_2463518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|2463517_2463805_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000380316.1|2464081_2464234_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394543.1|2464245_2464884_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	3.3e-07
WP_001133037.1|2464884_2465094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|2465661_2465850_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|2465846_2466038_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_009448824.1|2466131_2468582_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
>prophage 8
NZ_CP027548	Escherichia coli strain 2014C-3061 chromosome, complete genome	5303935	2574438	2625372	5303935	capsid,integrase,terminase,tRNA,protease,tail	uncultured_Caudovirales_phage(10.0%)	55	2578884:2578903	2619465:2619484
WP_001241678.1|2574438_2575143_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|2575427_2575646_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|2576330_2578607_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|2578637_2578958_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
2578884:2578903	attL	TGGCGGTTTTAGCGCGTCGC	NA	NA	NA	NA
WP_000562896.1|2579936_2580860_-|capsid	phage capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.1	3.4e-13
WP_001229493.1|2581022_2581511_-|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	42.3	3.5e-25
WP_001018605.1|2581640_2581802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000391152.1|2581805_2582000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106904350.1|2582130_2582376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761784.1|2582727_2584476_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	39.6	8.6e-90
WP_000770151.1|2584472_2584772_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001302929.1|2584777_2585020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000659213.1|2585009_2585201_-	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	52.8	2.2e-07
WP_001368837.1|2585379_2585583_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000201464.1|2585782_2585962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001075374.1|2586096_2586321_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	1.9e-18
WP_000775337.1|2586412_2587186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000085207.1|2587182_2588406_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	53.2	1.6e-127
WP_000410785.1|2588810_2589035_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_032314545.1|2589107_2591054_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746460.1|2591050_2592166_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001397058.1|2592316_2593273_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_106904351.1|2593269_2594928_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001328199.1|2595354_2596050_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491142.1|2596545_2597445_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458832.1|2597588_2599241_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_032314543.1|2599252_2600221_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_106904352.1|2600353_2602072_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	23.8	5.8e-30
WP_016246997.1|2602108_2603110_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136554.1|2603120_2604551_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|2604649_2605663_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255144.1|2605659_2606490_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|2606486_2606810_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270740.1|2606935_2607451_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|2607668_2608397_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|2608414_2609146_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|2609152_2609869_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|2609868_2610537_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|2610827_2611559_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149738.1|2611733_2612861_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	4.6e-28
WP_000389260.1|2612901_2613390_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061658.1|2613449_2614295_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001093858.1|2614291_2615245_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_032314541.1|2615254_2616388_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.9e-29
WP_032314540.1|2616482_2617595_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|2617945_2618422_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|2618509_2619412_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_032314539.1|2619472_2620195_-	nitroreductase NfsA	NA	NA	NA	NA	NA
2619465:2619484	attR	TGGCGGTTTTAGCGCGTCGC	NA	NA	NA	NA
WP_001201560.1|2620178_2620466_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|2620625_2620883_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681112.1|2620912_2621290_-	membrane protein	NA	NA	NA	NA	NA
WP_001024876.1|2621559_2623245_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|2623480_2623699_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_032314538.1|2623789_2624890_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.0	2.2e-176
WP_032314536.1|2624886_2625372_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	1.1e-66
>prophage 9
NZ_CP027548	Escherichia coli strain 2014C-3061 chromosome, complete genome	5303935	2628438	2657562	5303935	lysis,capsid,portal,integrase,terminase,head,plate,tail	Salmonella_phage(85.71%)	37	2649126:2649140	2660767:2660781
WP_000763311.1|2628438_2628558_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|2628572_2628875_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207660.1|2628929_2629445_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_007866350.1|2629454_2630627_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	4.6e-204
WP_032314535.1|2631018_2632140_+	acyltransferase	NA	Q6QI96	Burkholderia_phage	28.2	3.1e-32
WP_032314534.1|2632320_2632740_-|tail	phage tail fiber protein	tail	A0A0F7LDZ0	Escherichia_phage	60.0	8.0e-26
WP_106904353.1|2632741_2634163_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	83.0	3.4e-161
WP_032314532.1|2634159_2634765_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	91.5	7.5e-110
WP_000268301.1|2634757_2635666_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.1	4.1e-144
WP_032314531.1|2635652_2636012_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.2	8.8e-50
WP_024220192.1|2636008_2636587_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	9.4e-94
WP_032314530.1|2636655_2637102_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
WP_021546575.1|2637094_2637526_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	1.3e-71
WP_032314528.1|2637621_2638050_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.2	1.4e-46
WP_016245845.1|2638046_2638424_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.0e-16
WP_001442491.1|2638425_2638899_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
WP_000171568.1|2638918_2639134_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|2639137_2639341_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673530.1|2639340_2639805_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.9e-76
WP_021563628.1|2639900_2640551_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	1.5e-111
WP_032314526.1|2640554_2641613_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
WP_032314525.1|2641629_2642463_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	89.9	1.6e-118
WP_032314523.1|2642605_2644372_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.3	0.0e+00
WP_032314522.1|2644371_2645403_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.9	2.9e-170
WP_001059831.1|2647854_2648190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032314521.1|2648382_2648616_-	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	6.1e-36
WP_001154431.1|2648626_2648815_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_032314520.1|2648967_2651382_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.6	0.0e+00
2649126:2649140	attL	GCTGTCGCTGATGGT	NA	NA	NA	NA
WP_000104175.1|2651378_2652236_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	92.6	5.4e-154
WP_000752619.1|2652232_2652460_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_001244230.1|2652459_2652693_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.1e-32
WP_000963473.1|2652760_2653102_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956182.1|2653065_2653266_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000460897.1|2653273_2653783_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000188448.1|2653815_2654037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025649891.1|2654749_2656426_+	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	67.0	7.5e-83
WP_000290933.1|2656509_2657562_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
2660767:2660781	attR	ACCATCAGCGACAGC	NA	NA	NA	NA
>prophage 10
NZ_CP027548	Escherichia coli strain 2014C-3061 chromosome, complete genome	5303935	2956555	2996790	5303935	transposase,protease,integrase,holin	Enterobacteria_phage(55.56%)	47	2972361:2972407	2996804:2996850
WP_105466968.1|2956555_2957769_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.3	6.7e-166
WP_074390353.1|2957831_2962052_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.3	8.6e-19
WP_001443483.1|2962085_2962349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032314806.1|2962361_2963252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420919.1|2963880_2965017_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383934.1|2965285_2967523_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_001396984.1|2967509_2970482_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224569.1|2970482_2971373_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177453.1|2971555_2972317_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
2972361:2972407	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201825.1|2972829_2973783_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226375.1|2973969_2975454_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000075135.1|2975859_2976357_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	1.3e-91
WP_000411802.1|2976356_2976563_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_085947772.1|2977372_2978586_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_080029467.1|2978606_2980121_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.6	5.6e-287
WP_000499454.1|2980418_2980577_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|2980662_2981406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032314960.1|2981658_2982282_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	1.4e-111
WP_001028854.1|2982278_2982944_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108059.1|2982940_2983561_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.6	4.1e-95
WP_000567000.1|2983553_2983724_-	protein ninF	NA	Q716C4	Shigella_phage	98.2	4.6e-25
WP_001254218.1|2983720_2983903_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000153280.1|2983899_2984427_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000736903.1|2984423_2984864_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000145940.1|2984937_2985228_-	protein ren	NA	K7P7K7	Enterobacteria_phage	99.0	8.2e-46
WP_001372464.1|2985224_2985926_-	replication P family protein	NA	K7P6G2	Enterobacteria_phage	99.6	3.8e-129
WP_000185506.1|2985922_2986822_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	99.7	5.5e-173
WP_000251067.1|2986854_2987148_-	hypothetical protein	NA	A2SY75	Escherichia_phage	99.0	1.4e-45
WP_000437875.1|2987266_2987467_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274762.1|2987567_2988281_+	LexA family transcriptional regulator	NA	A4KWS0	Enterobacteria_phage	100.0	1.1e-131
WP_001207141.1|2988331_2988766_+	hypothetical protein	NA	A4KWT5	Enterobacteria_phage	99.3	6.0e-77
WP_001278659.1|2988762_2989365_+	hypothetical protein	NA	A4KWT4	Enterobacteria_phage	96.6	7.6e-46
WP_001443534.1|2989792_2990116_+	antitermination protein	NA	K7P718	Enterobacteria_phage	98.1	4.2e-51
WP_000213977.1|2990813_2991014_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	4.2e-33
WP_000065358.1|2991196_2991565_+	DUF2528 family protein	NA	K7PGR6	Enterobacteria_phage	97.5	6.5e-64
WP_001198861.1|2991637_2991802_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372941.1|2991770_2991914_+	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_000995433.1|2991988_2992285_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000100847.1|2992290_2993076_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_106904363.1|2993072_2993801_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.7	1.2e-130
WP_000682294.1|2993781_2993943_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	96.0	7.7e-22
WP_000129285.1|2993935_2994493_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_001386642.1|2994503_2994785_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763390.1|2994883_2995102_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
WP_000488407.1|2995149_2995428_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000446905.1|2995399_2995771_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_001299447.1|2995626_2996790_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
2996804:2996850	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 11
NZ_CP027548	Escherichia coli strain 2014C-3061 chromosome, complete genome	5303935	3241058	3302768	5303935	holin,transposase,capsid,integrase	Enterobacteria_phage(25.0%)	52	3264047:3264064	3281068:3281085
WP_000131043.1|3241058_3243092_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001299022.1|3243220_3243808_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089075.1|3243821_3245294_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159099.1|3245307_3246978_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	3.6e-61
WP_001209103.1|3247190_3247859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370300.1|3248101_3248797_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_001102114.1|3250226_3250946_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|3251472_3252327_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001046293.1|3252552_3253878_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
WP_000474084.1|3253986_3254223_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_032314451.1|3254234_3254828_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001396940.1|3254987_3255857_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
WP_032314452.1|3256105_3256963_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032314453.1|3257083_3261337_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000662258.1|3262452_3262554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803990.1|3262917_3263181_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3263180_3263321_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147277.1|3263355_3263583_-	hypothetical protein	NA	NA	NA	NA	NA
3264047:3264064	attL	GTTCCTGACCAATATAAA	NA	NA	NA	NA
WP_001296902.1|3264405_3264948_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|3265022_3265610_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3265667_3266336_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131094.1|3266361_3268887_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001323478.1|3268876_3270520_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001303809.1|3271510_3271840_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|3272087_3272702_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070694.1|3273119_3273809_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643323.1|3273805_3274762_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000667027.1|3274758_3276957_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	3.3e-38
WP_000121330.1|3276966_3277923_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111349.1|3277901_3278312_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_032314454.1|3278540_3279875_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000179449.1|3279956_3280670_-	hypothetical protein	NA	I7I023	Enterobacteria_phage	49.3	1.9e-48
WP_032314455.1|3280704_3282534_-	hypothetical protein	NA	I7HJD8	Enterobacteria_phage	29.4	1.6e-30
3281068:3281085	attR	TTTATATTGGTCAGGAAC	NA	NA	NA	NA
WP_001308407.1|3282552_3282753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032314456.1|3282839_3283868_-|capsid	phage capsid E family protein	capsid	NA	NA	NA	NA
WP_074014476.1|3283883_3284081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947598.1|3284130_3285292_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_032314825.1|3285503_3285716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032314826.1|3286060_3286396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106904371.1|3286397_3286808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032314827.1|3286937_3287216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032314829.1|3288164_3288353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032314830.1|3290381_3290921_+	recombinase family protein	NA	Q2A092	Sodalis_phage	42.1	1.6e-26
WP_000893255.1|3292335_3293589_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_001285288.1|3293600_3294704_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749865.1|3294991_3296047_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
WP_000174677.1|3296085_3296487_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_032314831.1|3296544_3297789_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|3297880_3298339_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293016.1|3298599_3300057_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_000602103.1|3300113_3300728_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001358663.1|3301571_3302768_+|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP027548	Escherichia coli strain 2014C-3061 chromosome, complete genome	5303935	3329850	3375235	5303935	transposase,plate,tRNA	Cronobacter_phage(14.29%)	36	NA	NA
WP_000611742.1|3329850_3330264_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|3330267_3332118_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|3332081_3333164_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113725.1|3333188_3334469_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|3334465_3334990_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246415.1|3334992_3336324_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343302.1|3336328_3337090_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_096853466.1|3337098_3339888_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.2	3.4e-80
WP_000088862.1|3339884_3340628_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240530.1|3340632_3342045_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122996272.1|3342153_3345588_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_089647483.1|3346173_3347386_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.3	7.1e-168
WP_096844020.1|3347370_3348264_+	VasL domain-containing protein	NA	NA	NA	NA	NA
WP_001284199.1|3348287_3348770_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_032314855.1|3348813_3349728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236649.1|3349737_3350217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297205.1|3351674_3352406_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|3352470_3352938_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297210.1|3352934_3353657_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052720.1|3353690_3354446_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|3354517_3355876_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211688.1|3355924_3356695_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|3356772_3357573_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648606.1|3357813_3358728_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997010.1|3358724_3359528_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_001140175.1|3365427_3366003_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|3366190_3367222_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|3367214_3367868_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|3367907_3368723_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|3368840_3369245_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094018.1|3369241_3369949_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260721.1|3370059_3371778_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032314432.1|3371830_3372655_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000399648.1|3372858_3373839_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000239173.1|3374088_3374799_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635545.1|3374812_3375235_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
>prophage 13
NZ_CP027548	Escherichia coli strain 2014C-3061 chromosome, complete genome	5303935	3590819	3666964	5303935	holin,capsid,portal,integrase,terminase,head,tRNA,tail	Enterobacteria_phage(37.5%)	86	3632429:3632443	3668150:3668164
WP_001223164.1|3590819_3591506_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001303782.1|3591905_3592046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|3592141_3592858_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_000920323.1|3592917_3594270_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001219604.1|3594327_3595752_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	1.2e-09
WP_001188666.1|3595751_3596441_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	2.0e-29
WP_000875487.1|3596453_3596927_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|3597137_3598007_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942344.1|3598003_3598651_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_106904416.1|3598702_3599215_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000068679.1|3599256_3599583_-	trp operon repressor	NA	NA	NA	NA	NA
WP_032314751.1|3599672_3601610_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|3601820_3603488_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093810.1|3603794_3605027_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_001029698.1|3605047_3606430_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132955.1|3606478_3607447_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_000124615.1|3607552_3608197_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_000105889.1|3608224_3609241_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000224877.1|3609696_3610416_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816471.1|3610495_3611719_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477808.1|3611770_3613093_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	1.4e-79
WP_001295412.1|3613219_3613999_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001143248.1|3614256_3615807_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001088395.1|3615778_3616642_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_000563066.1|3616754_3617537_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001299799.1|3617533_3618607_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|3618728_3618890_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|3619016_3619622_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202564.1|3620014_3621601_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001217539.1|3621820_3622069_+	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_001372053.1|3622495_3622609_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	77.8	1.4e-06
WP_000836769.1|3622677_3622911_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	6.4e-33
WP_000086527.1|3623290_3623881_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_032314750.1|3623978_3624554_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	9.4e-102
WP_033815940.1|3624553_3627907_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_064217532.1|3627971_3628571_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	6.3e-109
WP_062874753.1|3628637_3632036_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.3	0.0e+00
WP_000090873.1|3632095_3632728_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	6.5e-96
3632429:3632443	attL	GGCAATGGCGGCAGC	NA	NA	NA	NA
WP_064482969.1|3632664_3633408_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	1.5e-144
WP_106904376.1|3633418_3634117_-|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	99.1	1.1e-131
WP_033816191.1|3634116_3634446_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	4.7e-58
WP_062874814.1|3634442_3637004_-|tail	phage tail tape measure protein	tail	S5MBY3	Escherichia_phage	87.8	0.0e+00
WP_000459457.1|3636996_3637431_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|3637412_3637835_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001345558.1|3637850_3638591_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	2.0e-128
WP_000683138.1|3638598_3638994_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	5.0e-70
WP_033816197.1|3638990_3639569_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	3.9e-79
WP_000753019.1|3639580_3639934_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000158899.1|3639945_3640341_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.0e-55
WP_032314870.1|3640382_3641408_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.1	4.4e-187
WP_001299443.1|3641463_3641796_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000123236.1|3641805_3643125_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	9.0e-233
WP_033816198.1|3643105_3644707_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
WP_000198149.1|3644703_3644910_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027269.1|3644906_3646832_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_033816199.1|3646806_3647352_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_001300120.1|3647740_3647935_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000548592.1|3648185_3648392_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_001019207.1|3648687_3648861_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001443523.1|3649033_3649189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071528545.1|3649336_3649525_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|3649535_3649748_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071778.1|3650111_3650609_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_001101173.1|3650605_3651139_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
WP_001306174.1|3651252_3651513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074390338.1|3651460_3652012_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	90.5	2.9e-36
WP_000839581.1|3652016_3652232_-|holin	holin	holin	A5LH82	Enterobacteria_phage	90.1	7.9e-30
WP_000066486.1|3652984_3653200_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	75.0	5.9e-25
WP_000087755.1|3653500_3653713_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_122632654.1|3653767_3653857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001047103.1|3654135_3654888_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.4	3.4e-136
WP_032314364.1|3655897_3656695_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	1.2e-150
WP_000767115.1|3656714_3657104_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	99.2	3.5e-68
WP_000210173.1|3657100_3657427_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.0e-53
WP_000066918.1|3657423_3658077_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	99.5	3.3e-127
WP_001331408.1|3658076_3658571_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	8.1e-86
WP_000104943.1|3658567_3659509_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.0	4.9e-140
WP_001250269.1|3659498_3659678_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001440240.1|3659853_3660405_-	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	5.8e-101
WP_032314368.1|3660397_3660658_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	97.7	1.0e-39
WP_032314369.1|3660755_3661448_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	99.1	9.5e-125
WP_000549626.1|3661794_3662001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016389.1|3661972_3662407_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_021537118.1|3662951_3663488_+	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	98.3	5.3e-99
WP_021537117.1|3664449_3665469_+	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_032314370.1|3665740_3666964_-|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	98.8	1.2e-236
3668150:3668164	attR	GGCAATGGCGGCAGC	NA	NA	NA	NA
>prophage 14
NZ_CP027548	Escherichia coli strain 2014C-3061 chromosome, complete genome	5303935	3852729	3920203	5303935	transposase,tRNA,protease,integrase	Stx2-converting_phage(23.53%)	61	3892559:3892618	3921387:3922154
WP_000811566.1|3852729_3853005_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_106904383.1|3853121_3854747_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000101670.1|3855996_3856635_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|3856644_3857043_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012553.1|3857060_3857720_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|3857770_3858469_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220137.1|3858487_3858889_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|3859013_3859745_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076316.1|3859924_3862366_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177639.1|3862404_3862830_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527962.1|3863034_3864333_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.6	8.4e-66
WP_001089295.1|3864436_3864634_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|3864715_3865720_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|3865722_3866982_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|3867067_3868348_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|3868423_3868732_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280345.1|3868817_3869768_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_032314392.1|3869760_3871608_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_000990333.1|3871617_3872955_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|3872973_3873435_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_001295189.1|3873406_3874954_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001294219.1|3874952_3876092_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010723271.1|3876074_3876128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|3876870_3877416_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|3877510_3878563_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_000934920.1|3878659_3879628_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236850.1|3879649_3882973_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001276180.1|3883001_3883316_-	YjeO family protein	NA	NA	NA	NA	NA
WP_000342867.1|3883312_3883627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001397586.1|3883678_3885181_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004771.1|3885399_3886377_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001192973.1|3886701_3888510_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|3888502_3889237_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000208757.1|3889247_3889643_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_001299198.1|3889653_3890013_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001299465.1|3890075_3891209_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001238378.1|3891297_3891831_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_000118482.1|3891827_3892145_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000239596.1|3892326_3892473_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
3892559:3892618	attL	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTC	NA	NA	NA	NA
WP_000977757.1|3893360_3893486_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|3893537_3894104_-	elongation factor P	NA	NA	NA	NA	NA
WP_000940530.1|3894145_3895174_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_064482910.1|3895419_3896400_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001008047.1|3896842_3897712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000558209.1|3897761_3898115_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|3898252_3899899_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|3899942_3900236_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000015871.1|3900511_3901768_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267448.1|3901783_3902260_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000069437.1|3902596_3904033_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961959.1|3904150_3905452_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000883400.1|3905567_3905906_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000068903.1|3905881_3907579_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001188520.1|3907615_3908191_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001218802.1|3908570_3909833_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	1.2e-77
WP_000422741.1|3911095_3911521_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|3911517_3911868_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_032314460.1|3913180_3914752_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	2.9e-169
WP_000624626.1|3914771_3915119_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	7.5e-46
WP_000993931.1|3915118_3915769_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	44.9	1.8e-16
WP_001034103.1|3916303_3920203_-|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	1.6e-237
3921387:3922154	attR	GACAAAGTCATCGGGCATTATCTGAACATAAAACACTATCAATAAGTTGGAGTCATTACCGTTTTTCCCGACGCATTTTTTCCACGACTTTCGCAACCAGCTGTTTACCAATCCCCTGCCCTTTCAGGCTTTCATCGACATCGGTATGTTCGATAATCGCTAAATTCTCTCCGGTCGGCACAAAGACAATTTCAGCGATTTGCTTGCCCTGTTCGTCATTAATGTAAAATTTATTGTGGCCTTCGCGTATTTCCATTTTACCCTCGCTTATTTATGACGGTATTTCAGCGCGCCGCTCGGGCACGTATCAATCACTTTAACCACAGTGACGACGTCGACTTCATCCGGCATGATCCACGGCTTTCGTTTGAGATTAAATAACTTGCCGTTGCCACGTACGCAATTGCCAGAATGCTGACATATCGCAGTGTTGAAATAGACATCGATCTTTTCGCCGGTATAACAGCGATAACCCTCGTCCAGTAGCGCCTGATCCATGACTTTCCCTCTCTCATCAGTATGATTATCGCTATAAGCATAGCCCTGGAATCTTCATACAGCACTGGCAGTTTCCGTTGCCAGAGTCTCTTCCCCTATATAGCCAATCATTCTTACTCCCTTTGAATTACCCGCCTCATCAGAGATAATGCTTAAGAAATTTGTCACACAAGGAAGCTGATGAGACATTCATTGCCCTACCGCATGTTACGCAAACGTCCGATGAAATTGAGTACCACAGTGATCTTAATGGTCAGCGCGGTACTGTTC	NA	NA	NA	NA
>prophage 15
NZ_CP027548	Escherichia coli strain 2014C-3061 chromosome, complete genome	5303935	5055355	5101347	5303935	transposase,tRNA,protease,integrase	Escherichia_phage(18.75%)	43	5046171:5046186	5087010:5087025
5046171:5046186	attL	CGACCTGTGCCGGAAT	NA	NA	NA	NA
WP_000450589.1|5055355_5055688_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000627220.1|5055729_5057220_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.2e-33
WP_000094682.1|5057526_5059047_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_000018003.1|5059200_5059824_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001065896.1|5060100_5060865_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_024226841.1|5061161_5062478_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	28.4	3.9e-34
WP_000268401.1|5062607_5063204_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	89.4	2.0e-99
WP_105466968.1|5064519_5065732_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.3	6.7e-166
WP_028913479.1|5067314_5067920_+	conjugal transfer protein TraT	NA	NA	NA	NA	NA
WP_001303891.1|5067967_5068219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304211.1|5068242_5068533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000024297.1|5069218_5069578_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000591995.1|5069670_5071290_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_106904303.1|5071480_5072694_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.6	5.5e-168
WP_000134927.1|5072827_5073103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029785359.1|5073483_5074263_+	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000424145.1|5074272_5074575_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_000612150.1|5074583_5074904_+	urease subunit beta	NA	NA	NA	NA	NA
WP_000065682.1|5074896_5076600_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_032314756.1|5076609_5077074_+	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_001142971.1|5077074_5077749_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_001021388.1|5077760_5078378_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_000803992.1|5079589_5079853_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001135715.1|5080154_5080295_+	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_032314754.1|5081164_5081836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000435660.1|5084173_5084599_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	74.2	9.5e-35
WP_000624701.1|5084595_5084946_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_047661550.1|5084976_5086590_+|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.9	2.3e-166
WP_000957249.1|5087493_5087874_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
5087010:5087025	attR	CGACCTGTGCCGGAAT	NA	NA	NA	NA
WP_000042916.1|5087860_5088190_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_001176766.1|5088450_5088918_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506898.1|5088935_5090144_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_032314753.1|5090154_5091111_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001182418.1|5091110_5092190_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_001040060.1|5092191_5092965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280118.1|5092957_5094100_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_000254140.1|5095489_5096071_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001054789.1|5096070_5097228_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007449.1|5097250_5097706_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|5097728_5098769_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|5098817_5099396_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301248.1|5099464_5100040_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_001358663.1|5100150_5101347_-|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP027549	Escherichia coli strain 2014C-3061 plasmid unnamed, complete sequence	94116	4922	57713	94116	holin,transposase	Stx2-converting_phage(38.46%)	43	NA	NA
WP_033815853.1|4922_6119_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001302199.1|7933_8755_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_106904419.1|8754_9861_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|9954_11676_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_077629919.1|11749_12748_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_062904993.1|13051_14590_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.4	1.2e-297
WP_000612591.1|14639_14987_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|14983_15364_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_032257629.1|15524_15737_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024199488.1|16089_16377_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	41.8	5.5e-10
WP_000770130.1|18217_20878_+	peptidase M66	NA	NA	NA	NA	NA
WP_001368871.1|20961_21837_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_013009342.1|21837_23808_+	variant type II secretion system secretin EtpD	NA	A7BJX1	Enterobacteria_phage	27.6	2.0e-26
WP_001418198.1|23804_25307_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001173149.1|25308_26532_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001231213.1|26562_26997_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_000082928.1|26993_27545_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_001420206.1|27559_27907_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_106904420.1|27903_28503_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_071526091.1|29514_30687_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_000998852.1|30673_31189_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_000088802.1|31240_32074_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_001222320.1|32167_32569_+	GspS family T2SS pilot lipoprotein variant EptO	NA	NA	NA	NA	NA
WP_000083841.1|33679_33928_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_032314843.1|35259_35529_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	48.1	9.0e-15
WP_085959024.1|35531_36745_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_001358663.1|37069_38266_-|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_000411809.1|38640_38847_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_000731192.1|38851_39196_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
WP_072164699.1|39934_40117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001208680.1|40484_40670_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001303878.1|41194_41509_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_033815850.1|42290_43166_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	92.8	5.2e-152
WP_032313096.1|44430_44640_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	5.9e-06
WP_000273581.1|44555_44993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000526859.1|45241_45421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033815853.1|49901_51098_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000091308.1|51097_51463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050438831.1|51508_51799_+	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
WP_000059852.1|51785_52331_+	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_001443292.1|52260_52623_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_000982838.1|52619_53996_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_085947772.1|56500_57713_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
