The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027437	Escherichia coli strain 2012C-4221 chromosome, complete genome	5012557	9079	84923	5012557	head,transposase,tail,holin,capsid,integrase,lysis,terminase,portal	Escherichia_phage(38.3%)	74	3372:3388	87834:87850
3372:3388	attL	GGATAGGGCGCTCGCGC	NA	NA	NA	NA
WP_106905840.1|9079_10428_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_000097484.1|10693_11506_-	propanediol utilization microcompartment protein PduB	NA	NA	NA	NA	NA
WP_001183614.1|11502_11787_-	propanediol utilization microcompartment protein PduA	NA	NA	NA	NA	NA
WP_001000044.1|12298_13108_+	propanediol diffusion facilitator PduF	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	26.0	2.0e-09
WP_000622043.1|13310_14225_+	regulatory protein PocR	NA	NA	NA	NA	NA
WP_000849050.1|14709_15147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000973152.1|15280_15826_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001297350.1|15822_16566_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_106905841.1|16577_17657_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001544679.1|17718_18654_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011472.1|19110_20028_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_085458839.1|20129_21080_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_137497613.1|21197_22841_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532923.1|23471_24188_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060231.1|24529_25984_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_001600080.1|26085_27402_-	shikimate transporter	NA	NA	NA	NA	NA
WP_106905842.1|27716_28769_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_158709024.1|29030_37013_-	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_001362605.1|37502_38300_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533619.1|38535_39561_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
WP_106905844.1|39560_39764_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_106905845.1|39822_42294_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	8.5e-59
WP_033552884.1|42414_42636_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	82.2	5.6e-31
WP_106905846.1|42681_43533_-	transcriptional regulator	NA	A0A0P0ZE80	Stx2-converting_phage	64.4	6.7e-64
WP_106905847.1|43905_44325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106905848.1|44308_44524_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	87.5	5.7e-12
WP_106905849.1|44525_44681_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.8e-07
WP_000379971.1|44847_45255_-	helix-turn-helix domain-containing protein	NA	K7PM82	Enterobacteria_phage	54.7	2.6e-13
WP_021293151.1|45338_45569_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000705377.1|45552_46104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158709025.1|46075_47116_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	85.6	4.3e-89
WP_158709026.1|47027_47570_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	3.7e-84
WP_106905851.1|47604_48375_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	69.9	5.5e-89
WP_033552631.1|48390_48825_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	61.6	5.2e-36
WP_106905852.1|49103_49466_+	eae-like protein	NA	A0A222YY85	Escherichia_phage	61.3	5.3e-26
WP_158709027.1|49859_50258_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	2.2e-57
WP_106906900.1|50355_50934_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	86.0	1.6e-69
WP_047087960.1|51170_51383_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	97.1	1.6e-27
WP_106905854.1|51645_51906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106905856.1|52247_53297_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	57.6	2.0e-113
WP_106905857.1|53310_54132_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.4	2.4e-82
WP_106905858.1|54376_55090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106905859.1|55451_56402_+	Shiga toxin Stx2 subunit A	NA	Q6DWN9	Enterobacteria_phage	88.9	6.2e-151
WP_106905860.1|56421_56685_+	Shiga toxin Stx2 subunit B	NA	Q5TJL5	Enterobacteria_phage	98.9	3.2e-41
WP_106905861.1|57173_59162_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	56.0	2.2e-190
WP_097749598.1|59302_59488_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	58.3	1.2e-10
WP_106905862.1|59510_59846_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_087906417.1|59923_60139_+|holin	holin	holin	G9L6J5	Escherichia_phage	97.2	1.7e-32
WP_106905863.1|60142_60772_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	60.4	1.4e-42
WP_106905864.1|60814_61348_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	91.5	1.5e-93
WP_158709028.1|61503_61686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106905865.1|61845_62304_+|lysis	lysis protein	lysis	A0A2L1IV55	Escherichia_phage	83.4	8.9e-63
WP_000654790.1|62720_63341_+	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	53.7	5.1e-53
WP_106905866.1|63282_64350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106905867.1|64770_65280_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	34.8	2.7e-12
WP_106905868.1|65251_67180_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	1.7e-259
WP_000259002.1|67163_67370_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_106905869.1|67366_68959_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	4.6e-183
WP_106905870.1|68948_70454_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	4.6e-100
WP_106905871.1|70490_70838_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	3.7e-21
WP_106905872.1|70895_71924_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	5.0e-114
WP_059321412.1|71976_72360_+	lipase chaperone	NA	NA	NA	NA	NA
WP_106905873.1|72352_72706_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	66.7	1.8e-39
WP_106905874.1|72717_73296_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	5.0e-79
WP_106905875.1|73292_73688_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	79.4	3.7e-57
WP_097447088.1|73695_74454_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	77.0	1.6e-104
WP_106905876.1|74472_74889_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	51.1	8.7e-25
WP_106905877.1|74915_75305_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	79.8	1.4e-40
WP_106905878.1|75297_77862_+|tail	phage tail tape measure protein	tail	S5MBY3	Escherichia_phage	80.3	0.0e+00
WP_096932784.1|77858_78188_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	89.9	1.7e-52
WP_106905879.1|78187_78886_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	91.4	3.8e-121
WP_106906902.1|78891_79635_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	91.1	1.0e-140
WP_158709080.1|79580_80177_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	74.3	4.7e-80
WP_106905882.1|83819_84923_+|tail	phage tail protein	tail	Q9LA62	Enterobacterial_phage	69.6	1.5e-34
87834:87850	attR	GGATAGGGCGCTCGCGC	NA	NA	NA	NA
>prophage 2
NZ_CP027437	Escherichia coli strain 2012C-4221 chromosome, complete genome	5012557	453813	521110	5012557	protease,tail,lysis,terminase,portal	Enterobacteria_phage(46.81%)	73	NA	NA
WP_001260850.1|453813_454635_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|454734_454818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106905954.1|454910_455246_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091836.1|455642_456896_-	MFS transporter	NA	NA	NA	NA	NA
WP_089705857.1|457002_457896_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024254027.1|458030_459251_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|459375_460071_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_106906907.1|460023_461316_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_059328078.1|461473_462088_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.8	7.3e-28
WP_059328079.1|462130_462985_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|462986_463604_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_074150141.1|463614_466038_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_001295396.1|468722_469028_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001445899.1|469135_469846_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138582.1|469848_470409_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705207.1|470443_470785_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001306081.1|470919_471246_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
WP_001295394.1|471451_472666_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_106905955.1|472677_473697_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	5.7e-17
WP_001389342.1|473754_473883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158709030.1|473884_475165_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.1	9.6e-155
WP_158709081.1|475199_475436_-	DUF1233 family excisionase	NA	S4TND0	Salmonella_phage	49.3	3.9e-14
WP_001583545.1|475523_477995_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_106905958.1|478088_478280_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|478276_478465_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001317493.1|479951_480734_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_021568046.1|480955_481621_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000887491.1|482179_482392_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_000980999.1|482608_482860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023147795.1|482926_483205_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_001265275.1|483206_484256_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.9	2.5e-113
WP_106905960.1|484269_485022_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	96.8	4.2e-134
WP_000203370.1|486182_486368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795389.1|486993_487083_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|487137_487350_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066485.1|487650_487866_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	7.7e-25
WP_000839590.1|488619_488835_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|488839_489151_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_106905961.1|489147_489681_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	92.7	5.5e-96
WP_001071769.1|489677_490175_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|490535_490748_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|490758_490947_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|490949_491015_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|491094_491250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019140.1|491421_491595_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000035577.1|491746_492157_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
WP_001031431.1|492457_492664_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_000373425.1|493218_493713_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_097521066.1|493712_495815_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.6	0.0e+00
WP_001072975.1|495811_496024_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_158709031.1|495951_497532_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	3.4e-287
WP_001360054.1|497476_499504_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.7	0.0e+00
WP_001097046.1|499590_499914_+	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	100.0	8.5e-52
WP_001283147.1|499906_500182_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.1e-44
WP_000677102.1|500193_500772_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
WP_097510371.1|500768_501170_+|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	99.2	2.4e-72
WP_106905962.1|501180_501924_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	96.8	5.2e-129
WP_001341514.1|501984_502371_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	97.7	5.2e-64
WP_106905963.1|502379_502709_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	98.2	9.3e-54
WP_106905964.1|502680_505746_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.6	0.0e+00
WP_000447253.1|505745_506075_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_061321215.1|506084_506783_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.7	1.1e-133
WP_032157801.1|506788_507532_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	3.3e-147
WP_000741589.1|507429_508077_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
WP_106905965.1|508137_511533_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	89.9	0.0e+00
WP_001230374.1|511599_512199_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	1.2e-110
WP_106906908.1|512263_515677_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	36.4	8.3e-12
WP_016233180.1|515676_516252_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	7.2e-102
WP_000087133.1|516349_516940_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	35.9	2.1e-24
WP_000836765.1|517258_517492_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	3.2e-32
WP_120795384.1|517560_517674_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_106905966.1|518277_519561_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_096132897.1|519649_521110_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.9	2.3e-43
>prophage 3
NZ_CP027437	Escherichia coli strain 2012C-4221 chromosome, complete genome	5012557	940742	953489	5012557	integrase,capsid	uncultured_Caudovirales_phage(42.86%)	17	934383:934397	954907:954921
934383:934397	attL	CCCTGTCGATGGACG	NA	NA	NA	NA
WP_106906054.1|940742_941798_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.8	1.9e-68
WP_106906055.1|941797_942004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106906057.1|942409_942682_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_106906058.1|942692_943103_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_106906059.1|943099_943342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106906919.1|943345_943669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106906060.1|943915_945325_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	59.4	1.3e-112
WP_106906061.1|945321_945621_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_106906062.1|945626_946109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106906063.1|946098_946716_-	host cell division inhibitor Icd-like protein	NA	A0A0P0ZG86	Escherichia_phage	75.5	3.7e-11
WP_000094457.1|946921_947119_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	43.1	9.5e-06
WP_106906064.1|947176_947401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000953271.1|947665_947854_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
WP_106906065.1|948228_949458_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.6	7.1e-131
WP_000456506.1|949706_950828_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359446.1|950876_952103_-	peptidase T	NA	NA	NA	NA	NA
WP_033869694.1|952352_953489_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
954907:954921	attR	CCCTGTCGATGGACG	NA	NA	NA	NA
>prophage 4
NZ_CP027437	Escherichia coli strain 2012C-4221 chromosome, complete genome	5012557	1575861	1620075	5012557	head,plate,protease,transposase,tail,holin,capsid,integrase,terminase,portal	Enterobacteria_phage(32.2%)	69	1578152:1578198	1620089:1620135
WP_000255956.1|1575861_1576884_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_001317493.1|1576880_1577663_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_106906192.1|1577763_1578108_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
1578152:1578198	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201826.1|1578620_1579574_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_106906193.1|1579823_1580573_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_106906194.1|1581118_1581262_-	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	72.9	2.7e-10
WP_106906195.1|1581407_1581926_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	55.9	2.5e-37
WP_001519518.1|1581925_1582528_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	4.3e-97
WP_023307735.1|1582499_1582943_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	73.5	7.6e-59
WP_023307734.1|1582944_1583583_-	hypothetical protein	NA	U5P0I1	Shigella_phage	68.0	8.6e-64
WP_000383548.1|1583586_1584171_-	YmfQ family protein	NA	O22003	Shigella_phage	100.0	1.1e-113
WP_106906196.1|1584161_1585220_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	1.2e-200
WP_042004576.1|1585206_1585632_-|tail	phage tail protein	tail	U5P0R9	Shigella_phage	99.3	3.9e-81
WP_042106194.1|1585631_1586180_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	8.7e-97
WP_000999527.1|1586179_1587259_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	6.9e-207
WP_106906197.1|1587255_1588632_-	DNA circularization protein	NA	U5P4I0	Shigella_phage	98.3	2.2e-253
WP_106906198.1|1588656_1590564_-|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	99.1	0.0e+00
WP_000571713.1|1590648_1590972_-|tail	phage tail assembly protein	tail	U5P0R5	Shigella_phage	99.1	1.1e-51
WP_000090998.1|1590968_1591325_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000155710.1|1591324_1592821_-|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	99.0	7.7e-273
WP_000497751.1|1592804_1592975_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_106906199.1|1592983_1593544_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	5.2e-105
WP_000224834.1|1593540_1594047_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.3	6.6e-83
WP_000702389.1|1594021_1594432_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.9	6.1e-71
WP_000927715.1|1594428_1594752_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	98.1	3.3e-56
WP_000601363.1|1594754_1594955_-	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	1.7e-26
WP_000257506.1|1595004_1596210_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.8	5.3e-224
WP_001193631.1|1596224_1596875_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_097402963.1|1596852_1598094_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	2.6e-242
WP_000605605.1|1598093_1598276_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	98.3	3.8e-25
WP_143366865.1|1598287_1599784_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.6	1.3e-299
WP_000929181.1|1600017_1600512_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
WP_106906201.1|1600637_1600988_-	HNH endonuclease	NA	Q8SBD7	Shigella_phage	97.4	1.0e-63
WP_109161702.1|1601040_1601235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001328141.1|1601765_1602158_-	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	91.5	3.7e-57
WP_052930995.1|1602141_1602618_-	glycoside hydrolase family 104 protein	NA	K7P890	Enterobacteria_phage	95.6	2.5e-84
WP_129468645.1|1602604_1602910_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	90.7	1.5e-42
WP_032172870.1|1602951_1603425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077861923.1|1603908_1604598_-	antiterminator	NA	I6PDF8	Cronobacter_phage	47.2	6.7e-54
WP_000971093.1|1604594_1604735_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_072716668.1|1604731_1605094_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	94.9	9.5e-60
WP_000774473.1|1605090_1605381_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	1.1e-47
WP_000211034.1|1605373_1605544_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053029.1|1605543_1605999_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.7e-61
WP_072097297.1|1605995_1606097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001348590.1|1606191_1606974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000338660.1|1607148_1607472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106906202.1|1607583_1609110_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	32.6	3.6e-31
WP_001299444.1|1609167_1609317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070442.1|1609364_1609697_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|1609764_1610067_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788793.1|1610063_1610765_-	Replication protein 14	NA	M1FJ72	Enterobacteria_phage	97.4	2.7e-127
WP_001435464.1|1610761_1611691_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	6.1e-111
WP_001182886.1|1611777_1612317_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	1.2e-61
WP_001067458.1|1612386_1612617_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_042107501.1|1612721_1613411_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	3.6e-92
WP_000380252.1|1613491_1614553_+	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_000866321.1|1614530_1614908_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000233576.1|1615388_1615595_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995433.1|1615670_1615967_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000100847.1|1615972_1616758_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_106906203.1|1616754_1617435_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	3.9e-131
WP_106906204.1|1617431_1617614_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	95.0	2.6e-26
WP_000548537.1|1617586_1617778_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001443983.1|1617788_1618070_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000763385.1|1618168_1618387_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_000488407.1|1618434_1618713_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_106906205.1|1618684_1619056_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	80.2	2.3e-45
WP_000051902.1|1618911_1620075_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
1620089:1620135	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 5
NZ_CP027437	Escherichia coli strain 2012C-4221 chromosome, complete genome	5012557	2292828	2333813	5012557	transposase,holin,integrase,lysis,terminase	Escherichia_phage(28.57%)	40	2286073:2286088	2341107:2341122
2286073:2286088	attL	TCACCGCTTTCGCCGC	NA	NA	NA	NA
WP_000490275.1|2292828_2292990_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|2293116_2293722_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202563.1|2294114_2295701_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_061356802.1|2295920_2296169_+	DinI family protein	NA	A5LH55	Enterobacteria_phage	96.3	2.7e-37
WP_106906338.1|2297172_2297949_+	toxin	NA	G1BEM3	Escherichia_phage	87.2	9.0e-116
WP_106906339.1|2297945_2298755_+	cytolethal distending toxin type III/V nuclease subunit CdtB	NA	G1BEM4	Escherichia_phage	95.5	3.3e-145
WP_106906340.1|2298769_2299315_+	toxin	NA	M1SNM4	Escherichia_phage	91.7	9.8e-93
WP_106906341.1|2299551_2302308_-	hypothetical protein	NA	A0A286S259	Klebsiella_phage	36.1	9.4e-83
WP_158709052.1|2302310_2302685_-	nitrite transporter	NA	NA	NA	NA	NA
WP_106906343.1|2302775_2303989_-|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.8	2.6e-101
WP_106906344.1|2304758_2305337_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	75.9	3.3e-62
WP_033552926.1|2305620_2305986_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	86.0	1.0e-53
WP_106906347.1|2307197_2307815_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.4	5.0e-93
WP_097447265.1|2307964_2308423_-|lysis	lysis protein	lysis	A0A2L1IV55	Escherichia_phage	81.5	4.1e-60
WP_106906348.1|2308721_2309255_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.6	2.8e-100
WP_087906417.1|2309929_2310145_-|holin	holin	holin	G9L6J5	Escherichia_phage	97.2	1.7e-32
WP_106906349.1|2310222_2310639_-	DUF826 domain-containing protein	NA	A0A0H4IT07	Shigella_phage	55.9	3.7e-07
WP_106906350.1|2310565_2310748_-	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	64.4	1.5e-13
WP_072017355.1|2313233_2313557_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	62.4	4.2e-35
WP_001317493.1|2315219_2316002_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_106906353.1|2318665_2319418_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	99.2	3.1e-137
WP_106906354.1|2319431_2320421_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	4.0e-193
WP_001072669.1|2320428_2321244_-	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.3	8.5e-149
WP_106906355.1|2321406_2321802_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	97.6	9.7e-66
WP_158709053.1|2321798_2322125_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_106906357.1|2322124_2322613_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	95.1	1.7e-80
WP_106906358.1|2322609_2323428_-	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.6	2.8e-123
WP_001447116.1|2323424_2323649_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	95.9	5.9e-36
WP_106906359.1|2323653_2324490_-	ash family protein	NA	Q8SBF3	Shigella_phage	98.6	6.7e-149
WP_106906360.1|2324486_2325038_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	98.4	1.2e-98
WP_106906361.1|2325060_2325309_-	cytoplasmic chaperone TorD	NA	NA	NA	NA	NA
WP_106906362.1|2325444_2326131_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	42.0	2.7e-39
WP_000500990.1|2327237_2327750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024226706.1|2328218_2328581_+	hypothetical protein	NA	U5P4J6	Shigella_phage	94.2	1.3e-56
WP_000081287.1|2328646_2329471_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008189.1|2329598_2330135_+	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	98.9	4.8e-100
WP_001242716.1|2330125_2330488_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	98.3	5.8e-65
WP_097450731.1|2330487_2331108_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	93.2	3.2e-116
WP_089633610.1|2331584_2332304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106906364.1|2332589_2333813_-|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	98.0	1.2e-234
2341107:2341122	attR	TCACCGCTTTCGCCGC	NA	NA	NA	NA
>prophage 6
NZ_CP027437	Escherichia coli strain 2012C-4221 chromosome, complete genome	5012557	4139059	4146199	5012557		Escherichia_phage(83.33%)	6	NA	NA
WP_001278992.1|4139059_4139698_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.8e-82
WP_064225921.1|4139694_4140957_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	3.7e-135
WP_000847985.1|4140953_4141862_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_106906674.1|4142057_4142825_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_106906675.1|4142875_4143532_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	3.6e-49
WP_001272887.1|4143637_4146199_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	4.6e-31
>prophage 7
NZ_CP027437	Escherichia coli strain 2012C-4221 chromosome, complete genome	5012557	4239259	4331848	5012557	tRNA,protease,tail,holin,integrase,terminase,portal	Escherichia_phage(36.54%)	99	4236428:4236446	4345766:4345784
4236428:4236446	attL	TTGCCAGCGCCAGGTTGAT	NA	NA	NA	NA
WP_000264776.1|4239259_4240027_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|4240068_4240416_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_054496130.1|4240490_4240973_-	OmpA family protein	NA	NA	NA	NA	NA
WP_089706597.1|4240988_4242215_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|4242204_4242723_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001314943.1|4242872_4243238_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168045.1|4243446_4244517_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225210.1|4244527_4245649_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_064226296.1|4245691_4246852_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|4246950_4246998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097749545.1|4247163_4248153_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	55.9	9.5e-102
WP_097749566.1|4248243_4248552_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	55.1	4.8e-20
WP_097749546.1|4248668_4249127_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_106906694.1|4249299_4249485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158709068.1|4249539_4250124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157924812.1|4250281_4250437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106906695.1|4250448_4251024_+	3'-5' exoribonuclease	NA	NA	NA	NA	NA
WP_097749551.1|4251025_4251244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106906696.1|4251240_4253283_+	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	33.4	1.9e-51
WP_097749553.1|4253275_4253497_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106906697.1|4253480_4254284_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	47.2	8.1e-51
WP_106906698.1|4254299_4254722_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	4.4e-64
WP_106906699.1|4254779_4255136_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	96.6	4.3e-57
WP_086522857.1|4255187_4255400_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	90.0	7.6e-33
WP_106906700.1|4255435_4256065_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	76.8	4.1e-18
WP_106906701.1|4256149_4256401_+	DUF4222 domain-containing protein	NA	G9L6F5	Escherichia_phage	48.1	8.4e-15
WP_158709069.1|4256583_4257207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106906702.1|4257203_4259126_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	36.9	4.1e-109
WP_097749561.1|4259277_4259523_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	38.2	2.1e-10
WP_106906703.1|4259533_4260613_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	39.1	1.5e-60
WP_106906704.1|4260614_4261319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106906705.1|4261513_4261711_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	96.9	3.4e-27
WP_106906706.1|4261862_4262930_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	88.8	4.6e-187
WP_106906707.1|4265125_4266349_+	hypothetical protein	NA	S5MDQ7	Escherichia_phage	40.6	1.3e-76
WP_106906708.1|4266481_4266667_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	60.0	1.1e-11
WP_106906709.1|4266689_4267025_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_087906417.1|4267102_4267318_+|holin	holin	holin	G9L6J5	Escherichia_phage	97.2	1.7e-32
WP_106906710.1|4267995_4268529_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	91.5	8.7e-94
WP_033553196.1|4268749_4268863_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	97.3	8.7e-12
WP_158709070.1|4269084_4269270_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	78.7	2.3e-17
WP_106906712.1|4269970_4270447_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	95.6	8.3e-80
WP_106906713.1|4270443_4272567_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	96.7	0.0e+00
WP_122998037.1|4272563_4272776_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	82.9	7.6e-25
WP_106906714.1|4272775_4274278_+|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	92.8	2.9e-272
WP_158709087.1|4274267_4276238_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	93.8	0.0e+00
WP_106906715.1|4276325_4276652_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	88.8	2.5e-43
WP_097447091.1|4276644_4276926_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	82.8	6.7e-37
WP_097447090.1|4276928_4277552_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	91.3	7.1e-95
WP_106906716.1|4277563_4277962_+|tail	phage tail protein	tail	S5MW30	Escherichia_phage	90.2	8.3e-65
WP_097447088.1|4277969_4278728_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	77.0	1.6e-104
WP_106906717.1|4278746_4279163_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	50.4	5.7e-24
WP_106906718.1|4279189_4279471_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	78.3	5.1e-37
WP_106906719.1|4279460_4282058_+|tail	phage tail tape measure protein	tail	S5MBY3	Escherichia_phage	83.7	0.0e+00
WP_106906720.1|4282054_4282384_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	90.8	7.8e-53
WP_106906721.1|4282383_4283082_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	91.4	6.4e-121
WP_106906957.1|4283087_4283831_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	93.1	7.0e-142
WP_158709088.1|4283776_4284373_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	72.9	1.1e-81
WP_106906724.1|4288001_4288601_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	87.4	8.9e-95
WP_106906725.1|4288665_4289859_+|tail	phage tail protein	tail	Q9LA62	Enterobacterial_phage	68.8	9.2e-35
WP_106906726.1|4289869_4290475_+	DUF4376 domain-containing protein	NA	A0A2L1IV45	Escherichia_phage	44.7	3.5e-38
WP_097749596.1|4290721_4290910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097749594.1|4291135_4291276_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	89.1	7.2e-16
WP_106906727.1|4291417_4291714_+	zinc-ribbon domain and TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	71.9	2.1e-17
WP_000178456.1|4291960_4292302_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|4292572_4293310_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079112.1|4293444_4294425_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040140.1|4294421_4295153_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|4295282_4297856_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000841106.1|4303631_4304930_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.7	2.8e-45
WP_001221086.1|4304926_4305250_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|4305295_4306651_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_089558813.1|4306764_4309425_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001308860.1|4309456_4310155_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|4310223_4310643_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997382.1|4310849_4311887_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262720.1|4311934_4312624_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	3.5e-55
WP_000627804.1|4312927_4313311_+	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_106906728.1|4313365_4313953_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001521087.1|4314055_4314937_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|4314969_4316304_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001295363.1|4316435_4317173_+|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
WP_106906729.1|4317157_4318780_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_001303621.1|4319035_4319191_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001295364.1|4319187_4319763_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168459.1|4319795_4320446_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_029403571.1|4320445_4321402_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_106906730.1|4321398_4321878_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000790168.1|4322075_4323875_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|4323890_4324865_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|4325137_4325818_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_106906731.1|4325814_4326720_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399393.1|4326731_4327460_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_001309669.1|4327471_4328203_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986029.1|4328202_4328583_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000128776.1|4329004_4329085_+	type I toxin-antitoxin system toxin ShoB	NA	NA	NA	NA	NA
WP_001196285.1|4329278_4329539_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	8.4e-18
WP_001296301.1|4329594_4330443_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001590519.1|4330651_4331287_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001295367.1|4331311_4331848_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
4345766:4345784	attR	TTGCCAGCGCCAGGTTGAT	NA	NA	NA	NA
>prophage 8
NZ_CP027437	Escherichia coli strain 2012C-4221 chromosome, complete genome	5012557	4849451	4859046	5012557	transposase	Enterobacteria_phage(71.43%)	8	NA	NA
WP_001240399.1|4849451_4850183_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001295431.1|4850404_4852090_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|4852086_4852806_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|4852852_4853323_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_047669483.1|4853363_4853825_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	1.6e-75
WP_001317493.1|4854344_4855127_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_000255956.1|4855123_4856146_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_106906857.1|4857909_4859046_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	3.2e-162
>prophage 1
NZ_CP027439	Escherichia coli strain 2012C-4221 plasmid unnamed2, complete sequence	107188	0	4936	107188		Tupanvirus(100.0%)	3	NA	NA
WP_106907053.1|2031_2925_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106907055.1|3067_3838_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_106907163.1|3880_4936_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	45.9	9.5e-84
>prophage 2
NZ_CP027439	Escherichia coli strain 2012C-4221 plasmid unnamed2, complete sequence	107188	9823	29139	107188	integrase,transposase	Trichoplusia_ni_ascovirus(10.0%)	24	10593:10606	24604:24617
WP_106907061.1|9823_10600_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.5	5.8e-14
10593:10606	attL	ACCGACATAAATAT	NA	NA	NA	NA
WP_106907063.1|10630_10924_-	Dabb family protein	NA	NA	NA	NA	NA
WP_106907065.1|10935_11997_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	41.5	6.4e-72
WP_106907067.1|12145_13105_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000344277.1|13740_14070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106907069.1|14617_15830_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	2.9e-100
WP_000429590.1|16086_16521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001418814.1|16517_17300_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.3	6.0e-51
WP_078405668.1|18129_18441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000171282.1|18601_19003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106907072.1|19645_19903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000616196.1|19998_20445_-	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	55.3	1.8e-28
WP_106907074.1|20562_21042_+	peptidase M14	NA	NA	NA	NA	NA
WP_077631139.1|21293_21491_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000222786.1|21653_21941_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	49.5	3.4e-20
WP_001120171.1|21937_22189_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_106907077.1|22412_22952_+	type II toxin-antitoxin system antitoxin, RelB/DinJ family	NA	NA	NA	NA	NA
WP_000172786.1|23337_24204_+	ParA family protein	NA	NA	NA	NA	NA
WP_106907079.1|24203_25235_+	ParB/RepB/Spo0J family partition protein	NA	S5WII0	Leptospira_phage	25.7	4.9e-08
24604:24617	attR	ATATTTATGTCGGT	NA	NA	NA	NA
WP_000843285.1|25234_25672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153645668.1|25668_25992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106907081.1|26074_27349_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.8	1.7e-156
WP_047089913.1|27348_27771_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.2	5.4e-30
WP_000066222.1|28251_29139_+	RepB family plasmid replication initiator protein	NA	A0A1B0VDL5	Salmonella_phage	45.5	1.8e-64
>prophage 3
NZ_CP027439	Escherichia coli strain 2012C-4221 plasmid unnamed2, complete sequence	107188	33315	41364	107188		Thalassomonas_phage(25.0%)	11	NA	NA
WP_001346267.1|33315_33879_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	8.0e-21
WP_106907088.1|34728_35262_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.9	1.2e-45
WP_021564200.1|35324_35558_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_106907090.1|35621_37580_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.4	3.3e-21
WP_000845926.1|37634_38069_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_106907092.1|38065_38785_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001312861.1|39064_39223_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_101357018.1|39655_39844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024173136.1|39844_40081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000107538.1|40137_40425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158709101.1|40542_41364_+	DUF932 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	37.8	9.8e-44
>prophage 4
NZ_CP027439	Escherichia coli strain 2012C-4221 plasmid unnamed2, complete sequence	107188	49515	49737	107188		Vibrio_virus(100.0%)	1	NA	NA
WP_106907100.1|49515_49737_+	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	40.8	7.4e-07
>prophage 5
NZ_CP027439	Escherichia coli strain 2012C-4221 plasmid unnamed2, complete sequence	107188	73859	76276	107188		Xanthomonas_phage(50.0%)	4	NA	NA
WP_050947963.1|73859_74606_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	31.5	1.4e-09
WP_033803061.1|74660_75221_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001299730.1|75356_75569_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106907127.1|75814_76276_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	38.1	1.6e-19
>prophage 6
NZ_CP027439	Escherichia coli strain 2012C-4221 plasmid unnamed2, complete sequence	107188	94280	95148	107188		Enterobacterial_phage(100.0%)	2	NA	NA
WP_106907145.1|94280_94616_+	hypothetical protein	NA	Q9LA58	Enterobacterial_phage	54.5	2.3e-23
WP_106907147.1|94704_95148_+	hypothetical protein	NA	Q9LA58	Enterobacterial_phage	40.8	1.2e-19
>prophage 7
NZ_CP027439	Escherichia coli strain 2012C-4221 plasmid unnamed2, complete sequence	107188	102859	104435	107188		Acanthamoeba_polyphaga_moumouvirus(50.0%)	2	NA	NA
WP_106907157.1|102859_103909_+	NAD(P)-dependent alcohol dehydrogenase	NA	L7RC95	Acanthamoeba_polyphaga_moumouvirus	42.6	2.7e-78
WP_106907159.1|104180_104435_+	DUF1471 domain-containing protein	NA	A0A1B2IE60	Erwinia_phage	59.6	1.3e-07
