The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027440	Escherichia coli strain 2012C-4502 chromosome, complete genome	4892666	34098	136362	4892666	capsid,lysis,integrase,portal,tRNA,head,tail,terminase,holin	Enterobacteria_phage(44.44%)	131	62794:62810	119977:119993
WP_000074972.1|34098_35217_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.6	1.5e-82
WP_000003742.1|35185_35455_-	excisionase	NA	NA	NA	NA	NA
WP_032284903.1|35516_37961_-	exonuclease	NA	V5UQJ3	Shigella_phage	57.9	4.2e-175
WP_000092784.1|38053_38242_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|38238_38427_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000559919.1|38955_39471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000380318.1|39584_39737_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_000166382.1|40022_40661_-	LexA family transcriptional regulator	NA	H9C160	Pectobacterium_phage	27.6	4.6e-17
WP_000747952.1|40752_40983_+	transcriptional regulator	NA	H9C161	Pectobacterium_phage	55.8	4.5e-07
WP_024213803.1|40979_41417_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	54.4	1.8e-28
WP_122996947.1|41503_42514_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	89.4	1.4e-172
WP_072130322.1|42425_42968_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_047082289.1|43001_43718_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.1	8.7e-73
WP_000017341.1|43714_44032_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	75.0	1.4e-35
WP_053294093.1|44028_44334_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	92.1	1.7e-49
WP_022581296.1|44481_44664_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	93.3	3.8e-25
WP_001289992.1|44829_45345_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	78.6	1.1e-37
WP_001398985.1|45578_45791_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	67.1	6.4e-16
WP_001341173.1|45957_46230_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	1.9e-12
WP_032284906.1|46231_47281_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	7.7e-110
WP_047081783.1|47293_47668_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.9e-34
WP_000762903.1|47664_48486_+	hypothetical protein	NA	K7P7B9	Enterobacteria_phage	59.7	2.9e-80
WP_047081785.1|48711_48909_+	hypothetical protein	NA	A0A0P0ZDH6	Stx2-converting_phage	98.5	1.2e-27
WP_064579151.1|49059_50118_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	99.7	2.1e-208
WP_000649753.1|50500_51460_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738072.1|51471_51741_+	Shiga toxin Stx2a subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
WP_106905018.1|52605_54543_+	SASA family carbohydrate esterase	NA	S5MDQ7	Escherichia_phage	94.0	0.0e+00
WP_000143458.1|54681_54861_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|54901_55147_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284490.1|55224_55440_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	98.6	2.0e-33
WP_039264424.1|55443_56235_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	86.7	4.0e-34
WP_001092874.1|56746_57280_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	1.4e-99
WP_062896309.1|57436_57619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071974579.1|57987_58194_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	63.2	4.6e-11
WP_000735655.1|58258_58483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001405844.1|58970_59477_+	DNA-packaging protein	NA	O64316	Escherichia_phage	48.5	1.6e-33
WP_106905019.1|59448_61377_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	2.2e-259
WP_000259002.1|61360_61567_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_106905020.1|61563_63156_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.5	4.5e-186
62794:62810	attL	TGCTGGCTGGAAGAGGC	NA	NA	NA	NA
WP_001253971.1|63145_64651_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	52.6	4.6e-100
WP_033811013.1|64687_65035_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.0e-22
WP_064549420.1|65092_66121_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	3.9e-114
WP_047081403.1|66172_66556_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204531.1|66548_66902_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.8e-40
WP_000974993.1|66917_67493_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	2.9e-50
WP_000683075.1|67489_67885_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	80.9	2.2e-57
WP_052903742.1|67892_68642_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	93.2	3.1e-129
WP_001299690.1|68657_69089_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_072032653.1|69115_69529_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	83.8	1.6e-42
WP_106905021.1|69509_72089_+|tail	phage tail tape measure protein	tail	S5MBY3	Escherichia_phage	85.8	0.0e+00
WP_000847279.1|72085_72415_+|tail	phage tail protein	tail	S5MW28	Escherichia_phage	100.0	5.6e-59
WP_001499019.1|72414_73113_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.7	2.1e-132
WP_106905022.1|73123_73867_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	95.5	4.9e-143
WP_072121435.1|73812_74445_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	90.5	4.3e-100
WP_106905023.1|74684_78371_+	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	88.1	0.0e+00
WP_000078853.1|78569_78710_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_106905024.1|78854_80513_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	53.4	5.9e-72
WP_000438830.1|80522_80735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001373129.1|80746_81421_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	90.1	3.3e-114
WP_022581964.1|81584_81914_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000799399.1|82079_82943_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_001563118.1|82926_84063_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359447.1|84312_85542_+	peptidase T	NA	NA	NA	NA	NA
WP_001563120.1|85687_86809_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000735412.1|86884_88345_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|88344_89016_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|89184_90555_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|90558_91200_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001317772.1|91235_92342_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|92395_92857_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248686.1|92866_93520_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_001563122.1|93691_94942_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|95055_96198_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|96187_96424_-	excisionase	NA	NA	NA	NA	NA
WP_000488406.1|96563_96803_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000763387.1|96850_97069_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	1.7e-35
WP_001386642.1|97167_97449_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000548513.1|97459_97651_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	95.2	4.0e-25
WP_039022789.1|97623_97806_-	DUF1317 domain-containing protein	NA	Q6H9Z1	Enterobacteria_phage	96.7	2.4e-27
WP_039022788.1|97802_98483_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	99.1	3.0e-131
WP_039022787.1|98479_99265_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	6.9e-148
WP_039022786.1|99270_99567_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	2.3e-48
WP_000233576.1|99642_99849_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000957425.1|100492_101539_-	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	96.8	4.4e-198
WP_001221207.1|101532_101994_-	hypothetical protein	NA	G9L674	Escherichia_phage	98.7	1.1e-76
WP_000712397.1|102074_102767_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	85.3	1.5e-109
WP_000184665.1|102877_103105_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001182871.1|103135_103675_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.5e-61
WP_001361484.1|103761_104691_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	4.0e-110
WP_000788890.1|104687_105389_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.4	7.9e-127
WP_000145903.1|105385_105688_+	hypothetical protein	NA	A0A0N6WES4	Escherichia_phage	94.6	4.4e-42
WP_001070442.1|105755_106088_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_136746733.1|106135_106285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|106342_107869_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001445652.1|108333_108885_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|108894_109692_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|109808_109910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054342.1|109906_110362_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	5.4e-60
WP_000224916.1|110361_110532_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_000774484.1|110524_110815_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	4.3e-47
WP_001099712.1|110811_111174_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|111170_111311_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204780.1|111396_111780_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000737283.1|111968_113066_-	porin	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_000839596.1|113654_113870_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_039022779.1|113869_114367_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	2.7e-89
WP_001228695.1|114583_114766_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|114856_115150_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001415975.1|115509_115704_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000453592.1|116092_116638_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.1e-94
WP_039022778.1|116612_118538_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000198153.1|118534_118741_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_032315153.1|118737_120339_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	4.9e-310
119977:119993	attR	TGCTGGCTGGAAGAGGC	NA	NA	NA	NA
WP_039022777.1|120319_121639_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	98.9	8.1e-234
WP_001297109.1|121648_121981_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_106905025.1|122036_123062_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	4.6e-192
WP_039022775.1|123103_123502_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	2.0e-63
WP_000753007.1|123513_123867_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	99.1	4.4e-62
WP_039022774.1|123878_124457_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	6.6e-79
WP_000683105.1|124453_124849_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001349920.1|124856_125597_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000479153.1|125612_126035_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_039022773.1|126016_126451_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	3.4e-64
WP_039022772.1|126443_129005_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	91.4	0.0e+00
WP_000847332.1|129001_129331_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	99.1	5.6e-59
WP_001152612.1|129330_130029_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_039022771.1|130033_130777_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.7e-148
WP_106905026.1|130713_132132_+	DUF1983 domain-containing protein	NA	Q687E8	Enterobacteria_phage	73.8	4.6e-182
WP_039022769.1|132198_132798_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	3.3e-110
WP_088167353.1|132862_135778_+	hypothetical protein	NA	Q6H9S9	Enterobacteria_phage	99.1	5.0e-58
WP_039022689.1|135777_136362_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.3	2.8e-101
>prophage 2
NZ_CP027440	Escherichia coli strain 2012C-4502 chromosome, complete genome	4892666	244114	316471	4892666	protease,capsid,integrase,portal,head,tail,terminase,holin	Escherichia_phage(36.21%)	80	243043:243056	256902:256915
243043:243056	attL	TCACGGTATACGGA	NA	NA	NA	NA
WP_000113694.1|244114_245245_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	2.0e-103
WP_000113186.1|245222_245471_-	excisionase	NA	NA	NA	NA	NA
WP_106905031.1|245535_248007_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	1.2e-55
WP_096852359.1|248102_248291_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450223.1|248287_248476_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000380318.1|249632_249785_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_024213827.1|250080_250500_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	58.7	2.1e-18
WP_000019965.1|250579_250846_+	DNA-binding protein	NA	A0A2I6PIE5	Escherichia_phage	60.6	1.5e-17
WP_000705379.1|250829_251381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033885211.1|251352_252390_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	79.8	2.4e-79
WP_158707421.1|252301_252844_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.8	3.6e-79
WP_000450645.1|252877_253594_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	3.3e-72
WP_048267405.1|253626_253908_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	74.7	6.1e-30
WP_001376361.1|253904_254210_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.1	2.9e-49
WP_000137949.1|254359_254728_+	hypothetical protein	NA	A5LH60	Enterobacteria_phage	71.9	2.6e-41
WP_001367885.1|254724_255426_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	55.0	3.5e-34
WP_000902691.1|255659_255872_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	72.9	6.9e-18
WP_032296757.1|256039_256312_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	1.6e-11
WP_106905032.1|256313_257363_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	5.0e-109
256902:256915	attR	TCCGTATACCGTGA	NA	NA	NA	NA
WP_000904136.1|257375_257738_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.9	2.4e-34
WP_096853994.1|257730_258396_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	3.9e-59
WP_000342737.1|258649_259363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917733.1|259536_259734_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
WP_060612309.1|259884_260943_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.9	1.2e-206
WP_106905033.1|261423_261852_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000382066.1|262547_263273_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_106905034.1|265137_267102_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	78.6	1.2e-294
WP_000142780.1|267236_267416_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	93.2	5.4e-24
WP_001290206.1|267456_267702_+	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	98.8	3.2e-19
WP_000284506.1|267779_267995_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001041949.1|267998_268790_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_001092873.1|269301_269835_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	92.1	1.3e-94
WP_000661712.1|270108_270804_+	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_001280928.1|270898_271030_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	95.3	4.5e-12
WP_136746989.1|271252_271459_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	63.2	1.6e-11
WP_106905035.1|271523_271748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000828070.1|272092_272419_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095744.1|272550_272751_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000057925.1|272792_273158_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	1.0e-61
WP_000958387.1|273446_274010_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001373204.1|274006_275668_+|terminase	terminase large subunit	terminase	Q6H9U9	Enterobacteria_phage	99.5	0.0e+00
WP_000172990.1|275731_277669_+|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.7	0.0e+00
WP_001063099.1|277713_277935_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_001365916.1|277880_280466_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	96.3	0.0e+00
WP_000126028.1|280462_280789_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	97.2	3.9e-52
WP_001007902.1|280799_281150_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	99.1	2.0e-59
WP_000573396.1|281146_281593_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	98.6	9.9e-75
WP_000133383.1|281589_281934_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	4.2e-57
WP_001275414.1|282000_282717_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	98.7	1.5e-125
WP_000710936.1|282731_283106_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	3.9e-64
WP_122993267.1|283201_283411_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	1.5e-33
WP_106905036.1|283459_286702_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	89.5	0.0e+00
WP_000343408.1|286694_287036_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	81.2	7.6e-51
WP_000738904.1|287234_288398_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	66.9	1.6e-140
WP_001365876.1|288608_289307_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.3	1.4e-131
WP_050878055.1|289317_290061_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	95.1	3.7e-143
WP_071532098.1|289958_290603_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	73.5	8.6e-88
WP_106905037.1|291513_295200_+	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	87.8	0.0e+00
WP_000078855.1|295398_295539_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	93.5	8.5e-17
WP_106905038.1|295683_296952_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	99.1	6.5e-55
WP_001049902.1|297020_297692_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	83.9	2.5e-106
WP_000211405.1|298099_298660_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	5.4e-54
WP_001079498.1|299305_299812_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_106905039.1|299857_300358_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|300443_300623_-	general stress protein	NA	NA	NA	NA	NA
WP_001586972.1|301003_301810_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|301809_303003_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_052920668.1|303014_304373_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000763552.1|304376_305972_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001563172.1|305971_307534_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|307625_307670_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_025210413.1|307807_308689_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|308685_309306_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_076796391.1|309333_311229_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|311439_312315_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_021580711.1|312484_313486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001563176.1|313496_313805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278883.1|313856_314447_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559277.1|314443_315202_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_000422061.1|315421_316471_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	32.0	3.5e-22
>prophage 3
NZ_CP027440	Escherichia coli strain 2012C-4502 chromosome, complete genome	4892666	397606	412190	4892666	tRNA,integrase,tail	Escherichia_phage(45.45%)	12	389478:389494	412835:412851
389478:389494	attL	TAAAATCGATAACGCCT	NA	NA	NA	NA
WP_106905446.1|397606_398839_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|399093_400077_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_106905052.1|400554_401928_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	1.5e-52
WP_001157377.1|402056_402992_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	2.8e-148
WP_000040839.1|403043_404279_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_000079604.1|404280_404496_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001595656.1|404595_404784_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	7.2e-27
WP_001317028.1|404776_404971_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_001230359.1|405909_406509_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.6e-110
WP_072025145.1|406573_409879_+|tail	phage tail protein	tail	K7PGT9	Enterobacteria_phage	69.6	1.6e-283
WP_072198520.1|409933_410086_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	87.2	3.6e-13
WP_032171209.1|410987_412190_-	Bcr/CflA family efflux MFS transporter	NA	S4TR35	Salmonella_phage	88.0	8.0e-188
412835:412851	attR	AGGCGTTATCGATTTTA	NA	NA	NA	NA
>prophage 4
NZ_CP027440	Escherichia coli strain 2012C-4502 chromosome, complete genome	4892666	589026	657633	4892666	capsid,lysis,integrase,portal,bacteriocin,terminase,holin	Shigella_phage(64.47%)	78	632229:632248	661173:661192
WP_000041658.1|589026_591453_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	3.8e-213
WP_000213043.1|593947_594061_+	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	72.0	2.1e-05
WP_106905067.1|594480_595110_+	phage antirepressor Ant	NA	A0A088CBR4	Shigella_phage	84.2	7.1e-95
WP_000763356.1|595157_595379_+	TraR/DksA family transcriptional regulator	NA	V5USD3	Shigella_phage	100.0	1.3e-35
WP_000020908.1|595375_595660_+	DUF4752 family protein	NA	A0A088CD82	Shigella_phage	100.0	1.2e-46
WP_024199259.1|595646_596597_+	ead/Ea22-like family protein	NA	A0A088CC42	Shigella_phage	100.0	2.8e-183
WP_000628744.1|597110_598037_+	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	100.0	7.3e-181
WP_000481379.1|598123_598315_-	hypothetical protein	NA	A0A088CD78	Shigella_phage	95.2	8.0e-26
WP_106905068.1|598438_606823_-	hypothetical protein	NA	G3CFQ0	Escherichia_phage	93.9	0.0e+00
WP_106888990.1|606891_608157_-	hypothetical protein	NA	A0A088CBK4	Shigella_phage	78.1	1.9e-179
WP_106888991.1|608167_608419_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_106888992.1|608428_608875_-	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	97.3	4.4e-75
WP_106888993.1|608877_609534_-	hypothetical protein	NA	G9L6L9	Escherichia_phage	97.2	3.2e-106
WP_106888994.1|609626_610028_-	hypothetical protein	NA	A0A2L1IV61	Escherichia_phage	97.7	3.0e-70
WP_106888995.1|610084_610225_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	97.8	4.5e-18
WP_106888996.1|610457_611189_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2L1IV31	Escherichia_phage	75.9	1.9e-99
WP_106888997.1|611275_611893_-	hypothetical protein	NA	A0A2L1IV83	Escherichia_phage	96.6	1.0e-117
WP_106888998.1|611896_612178_-	hypothetical protein	NA	A0A2L1IV69	Escherichia_phage	93.5	1.1e-47
WP_106888999.1|612192_613461_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	97.6	5.3e-214
WP_106889000.1|613457_615083_-	hypothetical protein	NA	A0A0H4IT21	Shigella_phage	98.0	0.0e+00
WP_052901188.1|615161_615833_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	84.3	5.1e-107
WP_000118000.1|615901_617683_-	hypothetical protein	NA	A0A1I9LJS9	Stx_converting_phage	99.2	1.3e-61
WP_106889001.1|617679_618330_-	hypothetical protein	NA	A0A0H4J3F2	Shigella_phage	99.5	2.3e-120
WP_000829201.1|618329_618893_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	99.5	9.2e-102
WP_047081823.1|618876_619338_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	99.3	6.6e-74
WP_001140440.1|619388_619778_-	hypothetical protein	NA	A0A0H4IQ95	Shigella_phage	100.0	1.3e-62
WP_000214467.1|619832_621047_-|capsid	N4-gp56 family major capsid protein	capsid	A0A0N7KZY1	Escherichia_phage	100.0	1.7e-233
WP_047091030.1|621070_622078_-	hypothetical protein	NA	A0A0H4J3F0	Shigella_phage	100.0	3.0e-180
WP_106888966.1|622235_624380_-|portal	portal protein	portal	A0A0P0ZGR1	Escherichia_phage	98.5	0.0e+00
WP_000143994.1|624379_626086_-|terminase	terminase	terminase	A0A0H4IT14	Shigella_phage	100.0	0.0e+00
WP_106888965.1|626066_626873_-|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	99.6	2.2e-133
WP_001109015.1|627396_627939_-	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	100.0	1.1e-99
WP_001385819.1|628141_628579_-|lysis	lysis protein	lysis	A0A088CBQ1	Shigella_phage	97.9	2.5e-70
WP_000455400.1|628586_628736_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	98.0	5.3e-17
WP_000087453.1|629580_630114_-	lysozyme	NA	A0A088CC28	Shigella_phage	99.4	3.0e-102
WP_000284510.1|630118_630334_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_106888964.1|630411_630657_-	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	98.8	4.2e-19
WP_000143459.1|630697_630877_-	DUF1378 family protein	NA	A0A088CBQ0	Shigella_phage	100.0	2.2e-25
WP_106888963.1|631012_632953_-	SASA family carbohydrate esterase	NA	S5MDQ7	Escherichia_phage	92.6	0.0e+00
632229:632248	attL	AACAGCACATTTTTCGGGCT	NA	NA	NA	NA
WP_000752026.1|633445_633715_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|633724_634672_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_106888961.1|635247_635841_-	hypothetical protein	NA	V5UT42	Shigella_phage	99.0	7.6e-107
WP_001204882.1|635972_636353_-	antitermination protein	NA	A0A088CD47	Shigella_phage	99.2	5.3e-69
WP_000992060.1|636345_636540_-	protein ninH	NA	A0A088CC23	Shigella_phage	100.0	1.4e-30
WP_050866487.1|636539_636902_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	100.0	9.8e-65
WP_050866488.1|636898_637189_-	DUF1364 domain-containing protein	NA	V5URD2	Shigella_phage	100.0	3.8e-51
WP_001254268.1|637212_637404_-	NinE family protein	NA	A0A0P0ZDL7	Stx2-converting_phage	87.7	8.9e-25
WP_047199906.1|637400_637811_-	recombination protein NinB	NA	A0A088CBP6	Shigella_phage	100.0	4.2e-72
WP_047199905.1|637865_638534_-	antirepressor	NA	A0A088CD42	Shigella_phage	100.0	6.8e-120
WP_001624512.1|638878_639253_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_001624511.1|639272_639944_-	hypothetical protein	NA	A0A088CC21	Shigella_phage	100.0	1.4e-125
WP_106905069.1|639955_640381_-	hypothetical protein	NA	A0A088CBI9	Shigella_phage	98.6	1.8e-73
WP_001624509.1|640609_640939_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	100.0	3.0e-44
WP_047199903.1|640928_641237_+	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	100.0	1.4e-48
WP_050866385.1|641291_641537_-	hypothetical protein	NA	A0A088CC19	Shigella_phage	97.5	5.3e-38
WP_000060692.1|641535_642210_+	DUF4145 domain-containing protein	NA	V5URE2	Shigella_phage	100.0	1.3e-123
WP_001151119.1|642242_642674_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	100.0	2.5e-75
WP_000450880.1|642688_643459_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	100.0	6.6e-135
WP_050866384.1|644231_645314_-	DNA-binding protein	NA	V5URT9	Shigella_phage	99.4	7.0e-207
WP_000438870.1|645334_645553_-	hypothetical protein	NA	A0A088CC17	Shigella_phage	100.0	1.1e-21
WP_000084292.1|645567_645864_-	hypothetical protein	NA	A0A088CBI6	Shigella_phage	100.0	2.3e-48
WP_001068241.1|646007_646235_-	hypothetical protein	NA	A0A088CE43	Shigella_phage	100.0	5.4e-37
WP_000239215.1|646319_647090_+	helix-turn-helix transcriptional regulator	NA	A0A088CBP2	Shigella_phage	100.0	1.5e-147
WP_000088198.1|647484_647757_+	hypothetical protein	NA	A0A088CD31	Shigella_phage	100.0	3.3e-41
WP_000211195.1|647760_648474_+	hypothetical protein	NA	A0A088CC14	Shigella_phage	99.6	1.2e-127
WP_001005965.1|648505_648862_+	hypothetical protein	NA	A0A088CBI5	Shigella_phage	100.0	1.3e-56
WP_000560215.1|649193_649409_+	cell division protein FtsZ	NA	A0A088CE40	Shigella_phage	98.6	2.8e-35
WP_000660960.1|649499_649886_+	hypothetical protein	NA	A0A088CBP0	Shigella_phage	97.7	7.3e-66
WP_001271581.1|649994_652043_+	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	98.5	0.0e+00
WP_000995035.1|652039_652336_+	hypothetical protein	NA	V5URU8	Shigella_phage	99.0	3.3e-50
WP_000100858.1|652341_653127_+	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	99.6	1.8e-148
WP_000187058.1|653123_653804_+	YqaJ viral recombinase family protein	NA	V5UT69	Shigella_phage	100.0	2.1e-132
WP_000497813.1|653851_654103_+	DUF4222 domain-containing protein	NA	A0A088CBN9	Shigella_phage	100.0	1.3e-39
WP_124034985.1|654062_654509_+	helix-turn-helix domain-containing protein	NA	S5FM74	Shigella_phage	73.1	4.2e-41
WP_106905070.1|654364_655528_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	99.7	4.2e-226
WP_106905071.1|655565_656120_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.2	3.7e-63
WP_001599925.1|656121_656976_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_106905072.1|657018_657633_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.8	1.7e-29
661173:661192	attR	AACAGCACATTTTTCGGGCT	NA	NA	NA	NA
>prophage 5
NZ_CP027440	Escherichia coli strain 2012C-4502 chromosome, complete genome	4892666	1004346	1047699	4892666	capsid,lysis,integrase,portal,head,tail,plate,terminase	Salmonella_phage(69.39%)	55	1029564:1029578	1049423:1049437
WP_001563528.1|1004346_1006041_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.1	5.0e-18
WP_000009302.1|1006211_1006394_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922683.1|1006472_1007390_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212226.1|1007562_1008483_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_106905109.1|1008471_1008942_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	49.0	1.8e-34
WP_106905110.1|1008922_1010341_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.5	3.3e-100
WP_072859434.1|1010407_1011103_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.2	1.2e-07
WP_001313057.1|1011142_1011508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000972391.1|1012244_1012463_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_069891462.1|1012553_1013654_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.5	2.6e-177
WP_069891463.1|1013650_1014136_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	3.7e-67
WP_106905111.1|1014132_1017210_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.9	0.0e+00
WP_000763311.1|1017202_1017322_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_007866361.1|1017336_1017639_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.0	2.7e-39
WP_001207660.1|1017693_1018209_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_000046120.1|1018218_1019391_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.1e-204
WP_000905032.1|1019533_1020100_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_106905112.1|1020130_1020664_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	67.9	4.5e-58
WP_106905113.1|1021236_1021680_-|tail	phage tail protein	tail	A0A0F7LDZ0	Escherichia_phage	50.3	1.6e-37
WP_106905114.1|1021682_1023185_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	78.4	8.0e-153
WP_106905115.1|1023181_1023787_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	4.4e-110
WP_000268280.1|1023779_1024688_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	7.8e-143
WP_000177590.1|1024674_1025034_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_000993775.1|1025030_1025609_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_000829146.1|1025677_1026124_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
WP_001039945.1|1026116_1026548_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	94.4	4.4e-72
WP_106905117.1|1026643_1027072_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.9	6.4e-47
WP_096976293.1|1027068_1027446_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	5.1e-16
WP_001341072.1|1027447_1027921_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
WP_000171568.1|1027940_1028156_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|1028159_1028363_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_053885588.1|1028362_1028827_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	5.5e-76
WP_106905118.1|1028922_1029573_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.4	1.6e-110
1029564:1029578	attL	TCAGGCTCATGAATT	NA	NA	NA	NA
WP_106905119.1|1029576_1030635_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.9e-180
WP_106905120.1|1030651_1031485_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	6.3e-123
WP_061351135.1|1031627_1033394_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_089633568.1|1033393_1034419_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	88.2	7.6e-171
WP_106905451.1|1034460_1036221_-	RNA-directed DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	28.5	6.2e-11
WP_001217575.1|1036682_1036916_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|1036926_1037115_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_106905121.1|1037268_1039710_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.3	0.0e+00
WP_105266190.1|1039706_1040717_-	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	43.4	4.5e-67
WP_106905122.1|1040713_1041562_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	92.4	5.9e-145
WP_000145290.1|1041558_1041861_-	DUF3850 domain-containing protein	NA	A0A0A8WI22	Clostridium_phage	42.1	9.8e-10
WP_000752613.1|1041857_1042085_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244228.1|1042084_1042318_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_001747374.1|1042385_1042727_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	97.3	6.6e-55
WP_106905123.1|1042844_1043141_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	94.2	7.6e-23
WP_000460893.1|1043148_1043658_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188450.1|1043722_1043926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106905452.1|1044071_1044641_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.4	1.1e-38
WP_000900883.1|1044657_1044849_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_097755933.1|1044959_1046081_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	54.9	3.0e-104
WP_106905124.1|1046121_1046607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106905125.1|1046712_1047699_+	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	49.0	6.6e-87
1049423:1049437	attR	TCAGGCTCATGAATT	NA	NA	NA	NA
>prophage 6
NZ_CP027440	Escherichia coli strain 2012C-4502 chromosome, complete genome	4892666	1818872	1826012	4892666		Escherichia_phage(83.33%)	6	NA	NA
WP_001561929.1|1818872_1821434_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	7.8e-31
WP_001561930.1|1821539_1822196_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	45.7	1.2e-49
WP_001298167.1|1822246_1823014_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	2.2e-69
WP_000847985.1|1823209_1824118_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001561931.1|1824114_1825377_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	3.7e-135
WP_001279001.1|1825373_1826012_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.8e-83
>prophage 7
NZ_CP027440	Escherichia coli strain 2012C-4502 chromosome, complete genome	4892666	3392287	3429864	4892666	protease,transposase,integrase,head,tail,plate	Shigella_phage(56.76%)	55	3400144:3400158	3431050:3431064
WP_000528256.1|3392287_3393025_-	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	78.6	2.9e-103
WP_001443803.1|3392978_3393179_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001114107.1|3393794_3394040_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000221106.1|3394075_3394255_-	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	55.3	6.0e-07
WP_044078958.1|3394312_3396331_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	H6WZJ9	Escherichia_phage	58.9	2.8e-201
WP_000904930.1|3396460_3397021_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_001370973.1|3397147_3397471_+	hypothetical protein	NA	A0A0U2SAV1	Escherichia_phage	56.4	1.2e-21
WP_000420351.1|3397505_3398027_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_010917875.1|3398106_3398310_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000301578.1|3398993_3399554_-	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	49.1	3.9e-44
WP_001146835.1|3399544_3400627_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
3400144:3400158	attL	CTGTCTGGTTGATGC	NA	NA	NA	NA
WP_000763330.1|3400626_3401064_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_000980532.1|3401056_3401671_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000098807.1|3401660_3402785_-|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000146118.1|3402768_3404118_-	DMT family permease	NA	C9DGQ2	Escherichia_phage	33.1	5.9e-54
WP_000113523.1|3404104_3406180_-	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	3.7e-71
WP_000213225.1|3406306_3406783_-	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000015474.1|3406797_3407163_-|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	1.5e-25
WP_000606747.1|3407171_3408674_-|tail	tail protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000848437.1|3408670_3408916_-	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000627431.1|3408916_3409477_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_001104956.1|3409473_3409893_-	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_001002040.1|3409889_3410243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001142979.1|3410286_3411234_-|head	head protein	head	A0A0C4UQR9	Shigella_phage	66.2	1.3e-121
WP_000850813.1|3411233_3412358_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.9	2.6e-79
WP_000094812.1|3412534_3413008_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	6.0e-38
WP_000046899.1|3413129_3414461_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.1	3.0e-151
WP_000532586.1|3414444_3416034_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	6.5e-169
WP_001057670.1|3416033_3417698_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	2.4e-230
WP_000360581.1|3417697_3418279_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001279079.1|3418281_3418572_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	2.1e-25
WP_000270159.1|3418568_3418877_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_000342749.1|3418857_3419085_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001122255.1|3419095_3419314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801859.1|3419297_3419726_-	endopeptidase	NA	NA	NA	NA	NA
WP_106905321.1|3419760_3420261_-	lysozyme	NA	B6SD29	Bacteriophage	42.6	1.3e-27
WP_000852377.1|3420332_3420758_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001214362.1|3420827_3421337_-	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	42.4	6.7e-27
WP_000370523.1|3421333_3421630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086882.1|3421619_3421817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021231.1|3421809_3422142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047381727.1|3422180_3422366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973021.1|3422362_3422914_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000465562.1|3422917_3423433_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
WP_000564281.1|3423432_3423966_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.2	6.9e-67
WP_000323221.1|3423969_3424512_-	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	2.9e-28
WP_001129553.1|3424609_3425140_-	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000049304.1|3425151_3425445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049432.1|3425449_3425722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|3425718_3426000_-	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_001057199.1|3426001_3426256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000257929.1|3426268_3426490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000129790.1|3426492_3427425_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000270206.1|3427496_3429587_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	46.8	3.4e-165
WP_001266279.1|3429597_3429864_-	transcriptional regulator	NA	M1PVU4	Vibrio_phage	46.0	1.4e-07
3431050:3431064	attR	CTGTCTGGTTGATGC	NA	NA	NA	NA
>prophage 8
NZ_CP027440	Escherichia coli strain 2012C-4502 chromosome, complete genome	4892666	3944317	4019049	4892666	transposase,plate,tRNA,protease	uncultured_Caudovirales_phage(22.22%)	59	NA	NA
WP_001314482.1|3944317_3945670_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|3945699_3948132_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|3948253_3948739_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139282.1|3948742_3949768_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|3949872_3950328_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|3950331_3951120_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_001561443.1|3951119_3952268_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_001561444.1|3952264_3952861_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.8	3.0e-26
WP_001294747.1|3952897_3956380_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	3.7e-209
WP_000055741.1|3956392_3957352_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020982.1|3957450_3959592_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|3959648_3960038_+	VOC family protein	NA	NA	NA	NA	NA
WP_001561445.1|3960102_3961401_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062315.1|3961449_3961710_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|3961696_3961897_-	YaeP family protein	NA	NA	NA	NA	NA
WP_106905354.1|3962062_3962608_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_106905355.1|3962604_3963027_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001357024.1|3963040_3963751_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_106905356.1|3963780_3964605_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_106905357.1|3964657_3966376_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094022.1|3966486_3967194_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001561450.1|3967190_3967595_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874226.1|3967712_3968528_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|3968567_3969221_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_001357021.1|3969213_3970245_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140178.1|3970432_3971005_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997036.1|3976756_3977560_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	7.1e-39
WP_000648583.1|3977556_3978471_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|3978711_3979512_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_001561451.1|3979588_3980359_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|3980405_3981764_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052730.1|3981835_3982591_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001308373.1|3982624_3983347_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|3983343_3983811_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_024185250.1|3983875_3984607_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	1.5e-40
WP_001561452.1|3985143_3985944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000500230.1|3986068_3986278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001561454.1|3986415_3986865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001561455.1|3986867_3987764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001561456.1|3987784_3988264_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001561457.1|3988290_3989640_-	type VI secretion system protein VasL	NA	NA	NA	NA	NA
WP_158707945.1|3989650_3993085_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_096122004.1|3993193_3994606_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_001561461.1|3994610_3995354_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001561463.1|3998147_3998909_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_001561464.1|3998913_4000245_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|4000247_4000772_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001561465.1|4000768_4002049_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001561466.1|4002073_4003156_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_106905359.1|4003119_4004970_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|4004973_4005387_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_001550644.1|4005393_4006869_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000718847.1|4006937_4007144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037390.1|4007178_4007679_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|4008375_4008894_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001561468.1|4009103_4011212_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.2	2.8e-26
WP_106905360.1|4011278_4015487_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.8	1.6e-20
WP_001001073.1|4015684_4015894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106905361.1|4017912_4019049_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP027440	Escherichia coli strain 2012C-4502 chromosome, complete genome	4892666	4259384	4375253	4892666	protease,transposase,capsid,integrase,portal,tRNA,head,terminase	uncultured_Caudovirales_phage(34.48%)	101	4284591:4284610	4340904:4340923
WP_000186633.1|4259384_4259864_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_000365161.1|4260067_4260862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000057523.1|4260994_4261297_+	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	80.0	1.3e-41
WP_000806442.1|4261332_4261674_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
WP_000083999.1|4261731_4264236_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.5	1.7e-115
WP_000883024.1|4264498_4265431_+	glutaminase A	NA	NA	NA	NA	NA
WP_000982144.1|4265433_4266726_+	amino acid permease	NA	NA	NA	NA	NA
WP_001026743.1|4266850_4267258_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001317660.1|4268263_4268686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001561552.1|4268771_4269788_-	adhesin/invasin-like protein	NA	NA	NA	NA	NA
WP_001001644.1|4270154_4270517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000970319.1|4270619_4271078_-	NfeD family protein	NA	NA	NA	NA	NA
WP_000904502.1|4271074_4271992_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_001157538.1|4272137_4272815_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	3.1e-27
WP_001295323.1|4272801_4273581_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_001295322.1|4273643_4274498_-	chaperedoxin	NA	NA	NA	NA	NA
WP_106905386.1|4274558_4275368_-	NADP(+)-dependent aldehyde reductase	NA	NA	NA	NA	NA
WP_001295836.1|4275357_4275981_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|4275951_4276638_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_001561554.1|4276634_4279049_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_085948812.1|4280967_4282175_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	5.0e-97
4284591:4284610	attL	TATTGATCCATTAGGATTAA	NA	NA	NA	NA
WP_000879780.1|4285018_4285510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001561562.1|4286511_4287606_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_106905388.1|4287674_4288601_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_106905389.1|4288830_4289313_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|4289390_4290206_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001309310.1|4290295_4292077_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	7.8e-38
WP_001599503.1|4292089_4292866_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765832.1|4292965_4293844_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_106905390.1|4294013_4295468_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_106905391.1|4295528_4296890_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_096122021.1|4296945_4298247_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_096122020.1|4298268_4299414_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.1e-48
WP_052937607.1|4299542_4300286_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_064562845.1|4300500_4301730_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.1	3.3e-128
WP_000953271.1|4302094_4302283_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
WP_158707943.1|4302335_4303082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044808774.1|4303107_4303308_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000551676.1|4303297_4303528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000549006.1|4303520_4303748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047087380.1|4303753_4304053_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_047087382.1|4304049_4305804_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.3	2.7e-91
WP_001359249.1|4306152_4306404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106905393.1|4306400_4306811_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233314.1|4306821_4307070_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_028985258.1|4307374_4308532_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	4.8e-137
WP_000504056.1|4308571_4309144_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	3.6e-61
WP_158707946.1|4309181_4310357_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.9	2.4e-184
WP_097464367.1|4310353_4310692_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	3.9e-31
WP_000134109.1|4310688_4310985_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	64.3	6.9e-32
WP_001145905.1|4310984_4311425_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000113645.1|4311713_4312070_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000127882.1|4312053_4313715_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.2	5.7e-277
WP_062881264.1|4313728_4314010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001561570.1|4314531_4315767_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_096122019.1|4315788_4316838_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_096122018.1|4317154_4318822_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_001561572.1|4318831_4320091_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_001561573.1|4320101_4320917_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_001558749.1|4320913_4321807_+	carbamate kinase	NA	NA	NA	NA	NA
WP_001561574.1|4322339_4323407_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|4323403_4323913_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212237.1|4324030_4324753_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000256006.1|4324755_4325250_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912345.1|4325423_4326809_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_053290598.1|4326844_4327366_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|4327473_4327686_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|4327687_4328554_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_001561584.1|4328908_4329217_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A088CD23	Shigella_phage	85.2	3.2e-40
WP_001561585.1|4329236_4329536_-|integrase	tyrosine-type recombinase/integrase	integrase	B9UDL9	Salmonella_phage	82.4	3.4e-31
WP_000239877.1|4329948_4330617_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001201835.1|4330848_4331802_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001224560.1|4332460_4333351_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001561588.1|4333351_4336324_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001561589.1|4336310_4338548_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_106905395.1|4338745_4339882_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001561591.1|4340272_4340554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073568922.1|4342503_4342917_-	hypothetical protein	NA	NA	NA	NA	NA
4340904:4340923	attR	TTAATCCTAATGGATCAATA	NA	NA	NA	NA
WP_001561594.1|4347747_4348209_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_001561595.1|4348236_4350138_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.8	1.4e-24
WP_106905396.1|4350881_4352330_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	25.7	3.0e-11
WP_000770953.1|4352319_4353003_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_001561597.1|4353159_4354542_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_073568923.1|4354565_4354898_+	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_001561599.1|4354913_4356137_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000573940.1|4356148_4359292_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	2.2e-59
WP_106905397.1|4359393_4360770_+	phenylalanine transporter	NA	NA	NA	NA	NA
WP_001153132.1|4360850_4362098_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_096121800.1|4362205_4362859_-	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_000360951.1|4362952_4363321_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000682518.1|4363385_4363634_-	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_001561603.1|4363699_4364818_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001561605.1|4366330_4366693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106905398.1|4366774_4367902_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_106905399.1|4367979_4369113_+	TolC family protein	NA	NA	NA	NA	NA
WP_106905468.1|4369174_4369849_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_106905400.1|4369845_4370475_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.6	1.2e-22
WP_106905401.1|4370483_4371704_+	apolipoprotein acyltransferase	NA	NA	NA	NA	NA
WP_157941584.1|4372910_4373048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096121820.1|4373130_4373751_-	enterobactin synthase subunit EntD	NA	NA	NA	NA	NA
WP_106905402.1|4373904_4375253_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.3	3.3e-73
>prophage 1
NZ_CP027441	Escherichia coli strain 2012C-4502 plasmid unnamed, complete sequence	173714	0	3350	173714		Rhodococcus_virus(50.0%)	4	NA	NA
WP_001247860.1|263_530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218847.1|622_1057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000117616.1|1788_2289_-	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	28.2	8.4e-06
WP_000978008.1|2753_3350_-	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	60.3	9.0e-15
>prophage 2
NZ_CP027441	Escherichia coli strain 2012C-4502 plasmid unnamed, complete sequence	173714	6665	7199	173714		Xanthomonas_phage(100.0%)	1	NA	NA
WP_001276132.1|6665_7199_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	71.8	2.3e-46
>prophage 3
NZ_CP027441	Escherichia coli strain 2012C-4502 plasmid unnamed, complete sequence	173714	10932	16104	173714		Cronobacter_phage(33.33%)	8	NA	NA
WP_000086114.1|10932_11616_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.1e-30
WP_032236829.1|11692_11998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001373099.1|12001_12904_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000618108.1|13322_13571_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	46.7	4.1e-14
WP_000109075.1|13567_14020_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A218MND2	uncultured_virus	52.0	1.1e-25
WP_106905470.1|14003_14996_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	59.5	1.4e-100
WP_001369986.1|15040_15274_+	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	56.6	2.0e-18
WP_000587689.1|15477_16104_+	ParA family plasmid-partitioning AAA ATPase	NA	E5FFJ3	Burkholderia_phage	31.1	2.0e-17
>prophage 4
NZ_CP027441	Escherichia coli strain 2012C-4502 plasmid unnamed, complete sequence	173714	25340	31764	173714	transposase,integrase	Enterobacteria_phage(40.0%)	8	24960:24975	34876:34891
24960:24975	attL	GATATATCAGACAGTT	NA	NA	NA	NA
WP_001373091.1|25340_25805_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	89.7	3.2e-44
WP_000950104.1|25756_26107_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	3.1e-39
WP_000080210.1|26137_27730_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.9e-174
WP_001278809.1|27934_28351_-	recombinase	NA	NA	NA	NA	NA
WP_000688510.1|28343_29324_-	Plasmid segregation protein parM	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	1.7e-79
WP_000030199.1|29738_30047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001144036.1|30133_30778_-	ParA family protein	NA	NA	NA	NA	NA
WP_000016966.1|30957_31764_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.6	1.2e-54
34876:34891	attR	GATATATCAGACAGTT	NA	NA	NA	NA
>prophage 5
NZ_CP027441	Escherichia coli strain 2012C-4502 plasmid unnamed, complete sequence	173714	36908	37886	173714		Salmonella_phage(100.0%)	1	NA	NA
WP_011310114.1|36908_37886_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	64.5	5.5e-102
>prophage 6
NZ_CP027441	Escherichia coli strain 2012C-4502 plasmid unnamed, complete sequence	173714	42800	44921	173714		Bacillus_phage(100.0%)	1	NA	NA
WP_072094473.1|42800_44921_-	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.4	9.3e-46
>prophage 7
NZ_CP027441	Escherichia coli strain 2012C-4502 plasmid unnamed, complete sequence	173714	64349	71126	173714	transposase,protease	Macacine_betaherpesvirus(33.33%)	7	NA	NA
WP_077632745.1|64349_64814_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	60.1	7.7e-46
WP_000203483.1|64929_65241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000264906.1|65268_65460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997727.1|65469_65835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044686870.1|65968_66178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047083528.1|66340_70243_-|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.5	5.0e-239
WP_000598953.1|70739_71126_-	thermonuclease	NA	A0A0R6PHV6	Moraxella_phage	33.9	1.1e-10
>prophage 8
NZ_CP027441	Escherichia coli strain 2012C-4502 plasmid unnamed, complete sequence	173714	74386	84613	173714		Yersinia_phage(20.0%)	6	NA	NA
WP_077173497.1|74386_75880_+	autoagglutinating adhesin Saa	NA	A0A2C9CZB7	Yersinia_phage	34.9	1.9e-05
WP_001223214.1|77487_79575_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	32.2	6.8e-09
WP_001212725.1|79835_80258_-	Exc2 family lipoprotein	NA	NA	NA	NA	NA
WP_001373081.1|81308_81734_-	subtilase AB5 cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	45.2	2.1e-26
WP_000912970.1|81750_82794_-	subtilase AB5 cytotoxin subunit A	NA	A0A1B0T6A2	Bacillus_phage	28.3	3.5e-06
WP_000435654.1|84187_84613_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	74.2	9.5e-35
>prophage 9
NZ_CP027441	Escherichia coli strain 2012C-4502 plasmid unnamed, complete sequence	173714	91949	101435	173714		Moraxella_phage(100.0%)	1	NA	NA
WP_044686884.1|91949_101435_-	contact-dependent inhibition toxin CdiA	NA	A0A0R6PJK4	Moraxella_phage	33.3	1.9e-29
>prophage 10
NZ_CP027441	Escherichia coli strain 2012C-4502 plasmid unnamed, complete sequence	173714	120035	122532	173714		Ralstonia_phage(50.0%)	3	NA	NA
WP_000870986.1|120035_120509_+	lytic transglycosylase domain-containing protein	NA	A0A0A8J856	Ralstonia_phage	36.3	2.9e-08
WP_000478595.1|120527_121163_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_001168070.1|121167_122532_+	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	K7P7Q7	Enterobacteria_phage	39.6	4.9e-24
>prophage 11
NZ_CP027441	Escherichia coli strain 2012C-4502 plasmid unnamed, complete sequence	173714	129191	133214	173714		Morganella_phage(100.0%)	1	NA	NA
WP_000842441.1|129191_133214_+	DNA primase	NA	A0A1W6JPG0	Morganella_phage	31.6	5.9e-17
>prophage 12
NZ_CP027441	Escherichia coli strain 2012C-4502 plasmid unnamed, complete sequence	173714	154532	159472	173714	protease	Moraxella_phage(50.0%)	2	NA	NA
WP_000598953.1|154532_154919_+	thermonuclease	NA	A0A0R6PHV6	Moraxella_phage	33.9	1.1e-10
WP_106879217.1|155392_159472_+|protease	serine protease autotransporter EpeA	protease	Q9LA58	Enterobacterial_phage	43.9	7.4e-302
