The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	0	54149	5584939	holin,tail,protease,head,terminase,capsid	Enterobacteria_phage(32.86%)	72	NA	NA
WP_000548528.1|102_294_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_000682304.1|266_449_-	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	100.0	7.4e-29
WP_000186781.1|445_1126_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	99.1	6.0e-132
WP_000100847.1|1122_1908_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995407.1|1913_2210_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	5.2e-48
WP_000361826.1|2285_2429_-	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	97.9	3.5e-18
WP_001198858.1|2421_2562_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	3.3e-21
WP_000065373.1|2634_3003_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	7.6e-65
WP_000095081.1|3183_3807_-	hypothetical protein	NA	A0A2D1GLY1	Escherichia_phage	96.6	2.8e-107
WP_000198445.1|3868_4252_-	hypothetical protein	NA	Q08J47	Stx2-converting_phage	100.0	3.9e-64
WP_000957426.1|4917_5964_-	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_001221211.1|5957_6419_-	hypothetical protein	NA	G9L674	Escherichia_phage	100.0	1.3e-77
WP_000885203.1|6486_6828_-	DUF3024 domain-containing protein	NA	A0A1I9LJN9	Stx_converting_phage	100.0	3.9e-63
WP_000428098.1|6888_7593_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
WP_000064148.1|7706_7940_+	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	100.0	8.0e-36
WP_000438542.1|8078_8375_+	hypothetical protein	NA	Q6H9X8	Enterobacteria_phage	100.0	5.2e-48
WP_000185456.1|8407_9346_+	replication protein	NA	C1JJ53	Enterobacteria_phage	100.0	2.8e-172
WP_106881367.1|9342_10044_+	Replication protein P	NA	Q6H9X6	Enterobacteria_phage	99.6	6.4e-129
WP_032324043.1|10040_10331_+	hypothetical protein	NA	A0A0N6WES4	Escherichia_phage	97.9	6.3e-46
WP_001000127.1|10401_10680_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000103679.1|10812_11028_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001281772.1|11038_11275_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000814576.1|11231_11678_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_000153280.1|11674_12202_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_001254256.1|12198_12381_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000211422.1|12655_13390_+	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	100.0	1.9e-123
WP_001004024.1|13464_14187_+	DNA-binding protein	NA	A0A0N7C231	Escherichia_phage	100.0	7.8e-130
WP_001107963.1|14186_14792_+	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
WP_000144759.1|14788_14983_+	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_032324021.1|14975_15410_+	antitermination protein	NA	Q5MBW8	Stx1-converting_phage	100.0	4.8e-82
WP_000691354.1|15916_16864_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|16873_17143_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000142998.1|17642_19580_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	100.0	0.0e+00
WP_000143463.1|19715_19895_+	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
WP_001290230.1|19935_20181_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|20258_20474_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_000087733.1|20478_21012_+	lysozyme	NA	G9L6J6	Escherichia_phage	100.0	1.0e-102
WP_000661712.1|21285_21981_+	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_001280922.1|22075_22207_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	90.7	8.5e-11
WP_071529499.1|22429_22615_+	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	96.7	1.3e-17
WP_001109019.1|22853_23405_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	100.0	4.5e-101
WP_000828068.1|23750_24077_+	TonB family protein	NA	H6WZK5	Escherichia_phage	99.1	1.5e-56
WP_032277401.1|24208_24409_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	95.5	2.8e-29
WP_000829192.1|24450_24816_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000958380.1|25104_25668_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_032323913.1|25664_27326_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.5	0.0e+00
WP_106881368.1|27389_29168_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	90.4	0.0e+00
WP_001063099.1|29212_29434_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125988.1|31959_32286_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|32295_32646_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|32642_33089_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|33085_33430_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_106881370.1|33495_34212_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.3	3.1e-126
WP_001030063.1|34217_34592_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001513217.1|34687_34897_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000807927.1|38178_38520_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	98.2	4.3e-62
WP_044703882.1|38519_39218_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	98.7	4.7e-132
WP_001429308.1|39223_39967_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
WP_162782328.1|39912_40545_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	9.3e-103
WP_106881373.1|40780_44263_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	95.0	0.0e+00
WP_032271866.1|44331_44955_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.9	8.7e-69
WP_106881528.1|45019_46333_+|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	97.9	8.5e-74
WP_001023455.1|46334_46604_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_001131642.1|46716_47292_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001118085.1|47582_48164_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_012816780.1|48231_48867_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_001299273.1|48994_50053_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144080.1|50127_50778_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132151.1|50961_51552_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001435497.1|51768_51933_+|tail	tail fiber assembly domain protein	tail	K7PMH7	Enterobacteria_phage	87.5	2.2e-16
WP_000799402.1|52165_53029_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|53012_54149_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
>prophage 2
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	59269	60640	5584939		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423729.1|59269_60640_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
>prophage 3
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	63776	67505	5584939		Enterobacteria_phage(66.67%)	5	NA	NA
WP_000444487.1|63776_65027_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001307134.1|65129_65453_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_032141808.1|65985_66096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|66148_66553_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|66773_67505_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
>prophage 4
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	73372	75694	5584939		Escherichia_phage(100.0%)	1	NA	NA
WP_001369554.1|73372_75694_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	43.0	3.0e-90
>prophage 5
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	84212	85900	5584939		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|84212_84632_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457626.1|84631_85900_+	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	2.3e-209
>prophage 6
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	112659	115411	5584939		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033352.1|112659_114339_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|114463_115411_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 7
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	118547	122555	5584939		Pseudomonas_phage(50.0%)	5	NA	NA
WP_000804726.1|118547_119630_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456467.1|119629_120463_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200378.1|120459_120852_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257045.1|120855_121665_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|121700_122555_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
>prophage 8
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	125656	125887	5584939		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146442.1|125656_125887_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	6.5e-06
>prophage 9
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	137140	147151	5584939		Escherichia_phage(25.0%)	10	NA	NA
WP_000702660.1|137140_138679_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571699.1|138675_139386_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|139385_140063_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555854.1|140788_141631_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.4e-13
WP_001307143.1|141680_142139_-	YchJ family protein	NA	NA	NA	NA	NA
WP_106881376.1|142251_143157_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193437.1|143248_144262_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|144463_145372_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287380.1|145515_145929_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068079.1|146533_147151_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
>prophage 10
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	156561	158576	5584939		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110945.1|156561_157575_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|157571_158576_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 11
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	166510	247165	5584939	holin,tail,protease,transposase,integrase,head,terminase,capsid	Stx2-converting_phage(38.18%)	87	166347:166374	230097:230124
166347:166374	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113674.1|166510_167641_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|167618_167867_-	excisionase	NA	NA	NA	NA	NA
WP_106881378.1|167931_170403_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000199480.1|170498_170687_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449172.1|170683_170872_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001342117.1|171271_171439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|171432_171666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|171643_172051_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|172073_172292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|172364_172664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|172928_173336_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|173412_173640_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705622.1|173623_174175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|174146_175187_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|175098_175641_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_001505071.1|176404_176569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|177267_178026_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|178304_178517_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001217394.1|178737_178995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|179064_179343_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001265290.1|179344_180400_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	4.9e-88
WP_000140002.1|180400_180766_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_032324106.1|180762_181452_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.5	1.8e-59
WP_000023141.1|182973_184827_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	96.6	0.0e+00
WP_000284522.1|184976_185192_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_032325202.1|185196_185541_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	96.5	7.9e-56
WP_000992088.1|185591_186125_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_001056803.1|186395_186962_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	99.5	2.9e-103
WP_000539792.1|186961_187108_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|187335_187542_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|187606_187831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000088311.1|187925_188228_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000336726.1|188263_189082_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_000347013.1|189454_189595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001428130.1|189724_189910_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	92.3	1.3e-20
WP_000829190.1|189951_190317_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	97.5	1.1e-63
WP_000958380.1|190610_191174_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_032323913.1|191170_192832_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.5	0.0e+00
WP_032325204.1|192895_194833_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.5	0.0e+00
WP_001063025.1|194877_195099_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125988.1|197624_197951_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|197961_198312_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|198308_198755_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|198751_199096_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_106881370.1|199161_199878_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.3	3.1e-126
WP_001030063.1|199883_200258_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001513217.1|200353_200563_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_032325323.1|200610_203853_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.8	0.0e+00
WP_000807927.1|203845_204187_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	98.2	4.3e-62
WP_044703882.1|204186_204885_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	98.7	4.7e-132
WP_001429308.1|204890_205634_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
WP_162782328.1|205579_206212_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	9.3e-103
WP_106881380.1|206447_208898_+	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	95.8	0.0e+00
WP_000839179.1|208975_209380_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|209376_209724_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099160.1|209772_211311_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000902073.1|211333_212383_+	DUF1983 domain-containing protein	NA	Q9EYE7	Enterobacteria_phage	100.0	4.5e-195
WP_001228278.1|212450_213050_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	95.5	5.9e-107
WP_000216552.1|213201_214515_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.4	6.9e-76
WP_000381395.1|214547_216119_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|216138_216486_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|216485_217163_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001023357.1|217223_217493_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	100.0	3.8e-45
WP_106409364.1|221438_221561_+	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|221667_222579_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|222644_223214_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_001303943.1|224381_224660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|225087_225234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|225370_226018_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|226201_226792_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_000147167.1|229554_229773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001079509.1|230274_230781_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
230097:230124	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|230826_231327_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|231412_231592_-	general stress protein	NA	NA	NA	NA	NA
WP_000443067.1|231972_232779_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|232778_233972_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_032323871.1|235344_236940_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194584.1|236939_238502_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|238593_238638_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|238775_239657_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001342101.1|239653_240274_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|240374_241247_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278906.1|241286_241877_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559281.1|241873_242632_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_000422045.1|242851_243901_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|243936_244188_-	YciN family protein	NA	NA	NA	NA	NA
WP_001297122.1|244567_247165_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
>prophage 12
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	252088	252679	5584939		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|252088_252679_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 13
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	260494	266154	5584939		Lactococcus_phage(50.0%)	4	NA	NA
WP_032323873.1|260494_262429_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	26.9	6.9e-32
WP_000506490.1|263770_264559_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000968850.1|264926_265280_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000573407.1|265347_266154_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 14
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	279069	280335	5584939		Klosneuvirus(100.0%)	1	NA	NA
WP_032323875.1|279069_280335_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.7e-23
>prophage 15
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	294326	295409	5584939		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057977.1|294326_295409_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 16
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	313589	314105	5584939		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945026.1|313589_314105_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.5	7.0e-24
>prophage 17
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	320430	379470	5584939	holin,tail,tRNA,integrase,head,terminase,capsid	Escherichia_phage(39.06%)	69	312948:312963	364116:364131
312948:312963	attL	CACCGCTCATCAGACG	NA	NA	NA	NA
WP_000628065.1|320430_321663_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|321917_322901_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_032323876.1|323378_324752_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157407.1|324880_325816_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040839.1|325867_327103_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_000079604.1|327104_327320_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|327419_327608_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001443846.1|327645_327795_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_000166313.1|327850_328660_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_000105153.1|328652_331253_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	6.7e-248
WP_001344816.1|331354_331630_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_001352098.1|331704_331875_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|331874_332096_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|332537_333026_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|333022_333178_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001326317.1|333188_333368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233319.1|333610_334030_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|334109_334364_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693803.1|334360_334783_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001304174.1|334860_335649_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000788980.1|335655_336402_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_000450712.1|336424_337186_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_001141110.1|337201_337624_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000935420.1|337729_337942_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_000224233.1|338193_338457_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000208018.1|338467_338629_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000365100.1|338707_338953_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_000016656.1|340502_341492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138556.1|341491_342883_-	ATPase	NA	NA	NA	NA	NA
WP_000940319.1|343382_343982_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000247761.1|343981_344272_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000640158.1|344268_344823_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_032324351.1|345384_345816_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	96.5	5.6e-67
WP_000143077.1|346390_348244_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000284522.1|348393_348609_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_032325202.1|348613_348958_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	96.5	7.9e-56
WP_000992086.1|349008_349542_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	1.3e-100
WP_000661712.1|349815_350511_+	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_001280923.1|350605_350737_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_012817877.1|350959_351145_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_000828070.1|351545_351872_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095744.1|352003_352204_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829192.1|352245_352611_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000958380.1|352899_353463_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_106881384.1|353459_353765_+|terminase	terminase	terminase	A0A0N7KZG0	Stx2-converting_phage	99.0	3.3e-53
WP_106881386.1|353761_355120_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.3	1.9e-262
WP_044165196.1|355183_357121_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.1	0.0e+00
WP_001063096.1|357165_357387_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_032325002.1|359912_360239_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	99.1	1.2e-53
WP_001007905.1|360249_360600_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_106881388.1|360596_361043_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	1.2e-75
WP_000133388.1|361039_361384_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_032325206.1|361449_362166_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	8.0e-127
WP_001030063.1|362171_362546_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_032325323.1|362897_366140_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.8	0.0e+00
364116:364131	attR	CGTCTGATGAGCGGTG	NA	NA	NA	NA
WP_000807927.1|366132_366474_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	98.2	4.3e-62
WP_032325187.1|366473_367172_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.0	1.5e-130
WP_069358375.1|367177_367921_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.8	2.9e-148
WP_162782329.1|367866_368499_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.2	4.6e-102
WP_000649829.1|368689_369217_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_000515042.1|369350_372848_+	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.3	0.0e+00
WP_001230550.1|372918_373518_+	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_106881392.1|373582_374797_+|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	95.5	5.6e-80
WP_001023992.1|374798_375068_+|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_001131659.1|375180_375756_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001443810.1|375828_376458_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001143784.1|376539_377181_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001295593.1|377761_378196_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837924.1|378336_379470_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
>prophage 18
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	384430	385420	5584939		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|384430_385420_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 19
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	416706	420609	5584939		Klosneuvirus(100.0%)	1	NA	NA
WP_000139556.1|416706_420609_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 20
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	424548	425497	5584939		Escherichia_phage(50.0%)	2	NA	NA
WP_001307188.1|424548_425079_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731833.1|425323_425497_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 21
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	437299	447472	5584939	transposase	Escherichia_phage(20.0%)	9	NA	NA
WP_000826406.1|437299_438508_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.3	9.2e-208
WP_001307190.1|438547_439762_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000429155.1|439814_440351_+	DNA-binding transcriptional regulator SutR	NA	NA	NA	NA	NA
WP_001341357.1|440423_442385_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.9	7.1e-24
WP_000494244.1|442476_442707_-	YncJ family protein	NA	NA	NA	NA	NA
WP_000813794.1|442928_443105_+	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_001270286.1|443150_443567_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000047456.1|445295_446441_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220396.1|446458_447472_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
>prophage 22
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	450853	451663	5584939		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000867987.1|450853_451663_+	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.0	7.7e-17
>prophage 23
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	455928	458031	5584939		Salmonella_phage(100.0%)	1	NA	NA
WP_000689355.1|455928_458031_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	1.1e-134
>prophage 24
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	462938	469323	5584939		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103194.1|462938_465047_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	1.9e-27
WP_106881394.1|465114_469323_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	44.2	8.3e-22
>prophage 25
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	475717	477262	5584939		Escherichia_phage(100.0%)	1	NA	NA
WP_000702560.1|475717_477262_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 26
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	484147	484438	5584939		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768384.1|484147_484438_-	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 27
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	490450	491892	5584939		Escherichia_phage(50.0%)	2	NA	NA
WP_000781370.1|490450_490735_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_032345297.1|490881_491892_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	4.7e-24
>prophage 28
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	495166	497072	5584939		Planktothrix_phage(100.0%)	2	NA	NA
WP_001285544.1|495166_496093_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	2.4e-14
WP_000193551.1|496085_497072_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	2.2e-18
>prophage 29
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	501388	505195	5584939		Klosneuvirus(50.0%)	2	NA	NA
WP_001427328.1|501388_503788_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_000426272.1|503812_505195_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 30
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	510474	517410	5584939		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_001345363.1|510474_513270_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	1.3e-18
WP_000832502.1|513314_515687_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_000628552.1|515724_517410_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.3	2.2e-10
>prophage 31
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	524719	633078	5584939	holin,tail,transposase,portal,head,integrase,terminase,capsid	Escherichia_phage(28.81%)	112	513262:513278	639715:639731
513262:513278	attL	TATCTCCATGCGAAAAC	NA	NA	NA	NA
WP_106881396.1|524719_525932_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.6	1.6e-167
WP_000520676.1|526199_527114_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000825452.1|527172_527676_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000876763.1|527688_528219_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000123648.1|528232_530884_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001195166.1|530925_531636_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001296758.1|531996_532560_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001125458.1|533511_534834_-	type II toxin-antitoxin system serine/threonine protein kinase toxin HipA	NA	NA	NA	NA	NA
WP_001296726.1|534833_535100_-	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_000127325.1|535322_535802_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	54.7	1.7e-43
WP_000154339.1|542698_543652_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001194888.1|543900_545436_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	1.7e-20
WP_000911171.1|545429_546458_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001222721.1|546457_547450_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000172466.1|547461_548484_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774200.1|548510_549380_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_072097594.1|549333_549840_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001341531.1|549843_550758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854640.1|550964_552416_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_000878965.1|552642_553590_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	9.6e-19
WP_001191027.1|554198_554558_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000257409.1|554557_555484_-	glutaminase B	NA	NA	NA	NA	NA
WP_001296740.1|555547_556936_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000366496.1|557036_557918_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001323836.1|557995_558454_+	putative protein YneK	NA	NA	NA	NA	NA
WP_001341528.1|558402_559110_+	putative protein YneK	NA	NA	NA	NA	NA
WP_000210799.1|559259_560450_+	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000885033.1|560474_561140_-	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000843419.1|561351_561786_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000091199.1|561805_562189_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803659.1|562220_562439_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000012618.1|562495_563935_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	1.1e-29
WP_001296721.1|565688_566000_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_001375402.1|566027_567350_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_000722571.1|567464_567776_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000577179.1|567974_568673_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000087216.1|568717_569617_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_001054196.1|569811_570999_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000901367.1|571125_571221_+	protein MgtS	NA	NA	NA	NA	NA
WP_000671731.1|573360_573753_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_001024559.1|574028_574547_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_001341522.1|574591_576637_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636571.1|576773_577520_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000215549.1|577608_578295_+	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_000214712.1|578472_578676_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527750.1|578711_580172_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.3	5.6e-42
WP_000347482.1|580260_581544_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_096846665.1|581603_581918_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_122993102.1|582288_583302_-	peptidase M85	NA	NA	NA	NA	NA
WP_122988840.1|583516_583594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023407.1|583704_583974_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_032325331.1|583975_585289_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	1.7e-77
WP_032325332.1|585353_585953_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_106881398.1|586019_589496_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.0	0.0e+00
WP_123010699.1|589741_590374_-|tail	tail assembly protein	tail	A0A0N7KZG2	Stx2-converting_phage	95.7	1.6e-94
WP_000194707.1|590319_591063_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	99.2	1.2e-149
WP_001443841.1|591073_591772_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	97.4	4.4e-130
WP_000847298.1|591771_592101_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_106875094.1|592097_594710_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.1	0.0e+00
WP_000533442.1|594690_595104_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479051.1|595130_595553_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235067.1|595566_596319_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000683137.1|596326_596722_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_032325339.1|596718_597297_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	85.9	8.6e-79
WP_000752994.1|597308_597662_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_022581670.1|597673_598069_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.2	5.3e-56
WP_000063258.1|598110_599136_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001365129.1|599191_599524_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000123292.1|599533_600853_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	1.5e-232
WP_001443752.1|600833_602435_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_000198153.1|602431_602638_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027330.1|602634_604560_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453587.1|604534_605080_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001303940.1|605468_605693_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|605774_606089_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|606614_606800_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|607022_607169_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_106881400.1|607168_607738_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	99.5	9.0e-105
WP_000992148.1|608008_608542_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|608592_608937_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000411802.1|608941_609148_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_032325211.1|609595_611446_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.0	0.0e+00
WP_001299632.1|611924_612356_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	98.6	7.8e-69
WP_000336726.1|612754_613573_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_000088311.1|613608_613911_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001047111.1|615141_615894_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	98.8	2.6e-136
WP_001375683.1|615907_616957_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.6	4.6e-115
WP_012817785.1|616958_617228_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	3.0e-10
WP_001452497.1|617281_617509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032325073.1|617732_618104_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000042395.1|618096_618414_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000882662.1|618516_618729_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000211993.1|618943_619495_-	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	53.3	5.5e-43
WP_000215512.1|619846_620032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450895.1|620091_620853_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	63.6	2.4e-73
WP_000790460.1|620882_621623_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.1	4.7e-114
WP_000054520.1|621629_622595_-	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	5.0e-55
WP_000705368.1|622575_623097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920571.1|623080_623311_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000379972.1|623394_623802_+	helix-turn-helix domain-containing protein	NA	B1B6L9	Salmonella_phage	58.7	3.1e-14
WP_000380319.1|623968_624121_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_000394548.1|624132_624771_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|624771_624981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|625545_625734_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|625730_625919_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102128.1|626011_628474_+	exonuclease	NA	V5UQJ3	Shigella_phage	47.5	2.3e-125
WP_001368608.1|628561_628798_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001206148.1|628817_630113_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
WP_072095801.1|630132_630243_-	transporter	NA	NA	NA	NA	NA
WP_000836079.1|630300_631320_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001295394.1|631331_632546_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|632751_633078_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
639715:639731	attR	TATCTCCATGCGAAAAC	NA	NA	NA	NA
>prophage 32
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	637959	642524	5584939		Escherichia_phage(100.0%)	4	NA	NA
WP_001342196.1|637959_640383_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
WP_000213028.1|640393_641011_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526492.1|641012_641867_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|641909_642524_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
>prophage 33
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	649363	666146	5584939	protease,portal,head,integrase,terminase,capsid	uncultured_Caudovirales_phage(100.0%)	23	654988:655003	677325:677340
WP_001260840.1|649363_650185_+|protease	serine protease	protease	NA	NA	NA	NA
WP_000046661.1|650223_650553_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_000276149.1|650539_650905_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_000133423.1|652218_652500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127891.1|652513_654175_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	2.0e-277
WP_000113645.1|654158_654515_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000174068.1|654638_654821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145905.1|654804_655245_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
654988:655003	attL	ATTAATCGGGATAATG	NA	NA	NA	NA
WP_000134113.1|655244_655541_-	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001020674.1|655537_655876_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	8.7e-31
WP_000267608.1|655872_657084_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.5	1.9e-189
WP_000504055.1|657085_657658_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	4.7e-61
WP_001137345.1|657697_658855_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_001132080.1|659146_659371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233310.1|659496_659769_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126691.1|659779_660190_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000125509.1|660186_660432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261490.1|662532_662832_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001113154.1|662838_663159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024184083.1|663151_663442_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001496008.1|663374_664301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000953271.1|664353_664542_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
WP_000085277.1|664916_666146_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.4	1.6e-130
677325:677340	attR	ATTAATCGGGATAATG	NA	NA	NA	NA
>prophage 34
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	675161	676463	5584939		Bacillus_phage(100.0%)	1	NA	NA
WP_000732497.1|675161_676463_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	4.2e-17
>prophage 35
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	686357	688169	5584939		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945880.1|686357_688169_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.8	0.0e+00
>prophage 36
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	708043	709318	5584939	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|708043_709318_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 37
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	716229	717728	5584939		Salmonella_phage(50.0%)	2	NA	NA
WP_001296937.1|716229_716751_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
WP_000250661.1|716831_717728_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	3.6e-07
>prophage 38
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	726530	735334	5584939		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101183.1|726530_727358_+	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|727485_728067_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701040.1|728212_729382_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|729547_729637_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|729935_730961_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269501.1|730957_731890_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182363.1|732002_733214_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098896.1|733504_734653_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_000493947.1|734692_735334_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 39
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	740837	743104	5584939		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587560.1|740837_741650_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001069997.1|741653_742439_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001310861.1|742435_743104_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
>prophage 40
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	753856	756477	5584939		Cedratvirus(50.0%)	3	NA	NA
WP_000948856.1|753856_754603_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	3.8e-10
WP_001297388.1|754612_756100_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367160.1|756108_756477_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
>prophage 41
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	775067	794661	5584939	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_000553696.1|775067_776768_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	1.6e-32
WP_000069375.1|776824_779203_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000368048.1|779535_780369_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082235.1|780525_781572_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	7.2e-84
WP_001270809.1|781703_781895_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175600.1|781898_783335_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001326034.1|783397_784111_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209780.1|784357_784822_-	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_000029479.1|784899_785649_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.3	1.6e-08
WP_001154187.1|785648_786200_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956529.1|786262_787243_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|787343_787643_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672359.1|787647_790035_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|790049_791033_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|791316_791361_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|791483_791840_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|791892_792090_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|792186_792729_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144192.1|792732_794661_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
>prophage 42
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	805958	808220	5584939		Tupanvirus(100.0%)	1	NA	NA
WP_000077848.1|805958_808220_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.8e-143
>prophage 43
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	814558	815386	5584939		Bacillus_virus(100.0%)	1	NA	NA
WP_000175041.1|814558_815386_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 44
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	822862	824083	5584939		Klosneuvirus(100.0%)	1	NA	NA
WP_000081962.1|822862_824083_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	1.1e-27
>prophage 45
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	830847	831501	5584939		Planktothrix_phage(100.0%)	1	NA	NA
WP_000882826.1|830847_831501_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.0	9.9e-15
>prophage 46
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	837099	839061	5584939		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235820.1|837099_839061_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	2.4e-40
>prophage 47
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	843987	844629	5584939		Tupanvirus(100.0%)	1	NA	NA
WP_001120527.1|843987_844629_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.9e-19
>prophage 48
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	847872	848727	5584939		Indivirus(100.0%)	1	NA	NA
WP_001186343.1|847872_848727_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 49
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	852045	856622	5584939		Bacillus_phage(100.0%)	3	NA	NA
WP_000219686.1|852045_853329_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000616411.1|853475_854951_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000766132.1|855131_856622_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 50
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	862573	958624	5584939	holin,tail,protease,tRNA,transposase,portal,head,lysis,integrase,capsid	Escherichia_phage(34.92%)	106	902079:902093	958627:958641
WP_071830504.1|862573_863782_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.5	1.7e-206
WP_000604932.1|863789_864221_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	4.8e-42
WP_000513743.1|864236_864425_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_000939317.1|864428_864788_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457202.1|864960_865599_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_001061578.1|865725_866649_-	DNA-binding transcriptional regulator DmlR	NA	NA	NA	NA	NA
WP_000978494.1|866751_867837_+	multifunctional D-malate/3-isopropylmalate/tartarate dehydrogenase	NA	NA	NA	NA	NA
WP_000987525.1|868087_869698_+	BCCT family transporter YeaV	NA	NA	NA	NA	NA
WP_000067805.1|869729_870854_+	carnitine monooxygenase subunit YeaW	NA	NA	NA	NA	NA
WP_001287005.1|870909_871875_+	carnitine monooxygenase subunit YeaX	NA	NA	NA	NA	NA
WP_001342154.1|871928_873044_-	ribonuclease D	NA	NA	NA	NA	NA
WP_000758422.1|873125_874811_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|875015_875597_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001221003.1|875636_876332_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|876389_878300_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|878431_878776_+	RidA family protein	NA	NA	NA	NA	NA
WP_001307845.1|879138_879498_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|879617_879797_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000854972.1|879870_881232_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000456725.1|881235_881814_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_032324016.1|881997_883362_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_001295494.1|883492_885091_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000394983.1|885094_886651_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
WP_000150551.1|887113_888085_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000406926.1|888147_888948_+	PTS mannose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000228655.1|888960_889812_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000156255.1|889866_890325_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_001296134.1|890753_891320_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000010107.1|891316_892126_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001062678.1|892291_892501_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_001295496.1|892513_892657_-	YobF family protein	NA	NA	NA	NA	NA
WP_001006866.1|893325_893613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714550.1|893687_893831_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001211011.1|893989_894229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262174.1|894371_895163_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001127210.1|895339_896713_+	MFS transporter	NA	NA	NA	NA	NA
WP_000984517.1|896758_897640_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001427396.1|897831_899880_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000431370.1|899899_900598_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|900694_901192_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
902079:902093	attL	CCCGCTACGCCTGCG	NA	NA	NA	NA
WP_001299674.1|902572_905206_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_000057024.1|905285_906725_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|906842_907079_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000929530.1|907099_907375_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812724.1|907375_908032_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_001121225.1|908986_909637_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000491545.1|909861_910737_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	7.2e-162
WP_001023379.1|910877_911147_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
WP_106881405.1|911148_912462_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	1.3e-77
WP_001230428.1|912526_913126_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_106881407.1|913193_916586_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	84.5	0.0e+00
WP_136865658.1|916831_917464_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	4.6e-102
WP_032325227.1|917409_918153_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	99.2	4.5e-149
WP_001152185.1|918163_918862_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.7	3.1e-131
WP_000847302.1|918861_919191_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	94.5	1.2e-53
WP_106881409.1|919187_921767_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.2	0.0e+00
WP_000533431.1|921747_922161_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_032325228.1|922632_923385_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	95.6	1.3e-130
WP_000683137.1|923392_923788_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000975099.1|923784_924363_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752994.1|924374_924728_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_022581670.1|924739_925135_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.2	5.3e-56
WP_000063258.1|925176_926202_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001365129.1|926257_926590_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000123292.1|926599_927919_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	1.5e-232
WP_001443752.1|927899_929501_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_000198153.1|929497_929704_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_000453587.1|931600_932146_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001307652.1|932534_932729_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000881326.1|932916_933534_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_000092325.1|933683_934121_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_000075132.1|934117_934615_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000411802.1|934614_934821_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000143049.1|935268_937119_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000762928.1|938289_939111_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001217413.1|939107_939482_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.4e-34
WP_001265229.1|939494_940544_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|940545_940818_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|940939_941284_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|941403_941616_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|941849_942407_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|942408_942627_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|942754_943066_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|943058_943286_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|943282_943564_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450872.1|943596_944358_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	67.2	3.9e-79
WP_001444941.1|945131_946094_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.5	2.7e-69
WP_000693943.1|946116_946542_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|946538_946841_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_001169687.1|946938_947310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302048.1|947330_947522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|947523_947802_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001427316.1|948088_948241_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	2.3e-07
WP_000560218.1|948661_948883_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	1.8e-37
WP_000245534.1|948876_949053_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.7	4.1e-24
WP_001307773.1|949126_949402_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	96.7	3.0e-42
WP_000166317.1|952143_952953_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	6.8e-106
WP_042853000.1|953009_953204_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_001356607.1|953196_953385_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_001443927.1|953491_953773_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
WP_001189091.1|953738_954815_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	5.3e-98
WP_000976492.1|955207_955549_-	YebY family protein	NA	NA	NA	NA	NA
WP_000204699.1|956436_956811_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|956949_957180_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|957281_957938_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|957961_958624_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
958627:958641	attR	CGCAGGCGTAGCGGG	NA	NA	NA	NA
>prophage 51
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	966680	968156	5584939		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|966680_968156_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 52
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	981734	982862	5584939		Planktothrix_phage(100.0%)	1	NA	NA
WP_000741722.1|981734_982862_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.5	3.6e-20
>prophage 53
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	990324	997388	5584939		Bacillus_virus(50.0%)	9	NA	NA
WP_001184054.1|990324_991647_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001300644.1|991662_992595_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|992673_993429_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571465.1|993425_994211_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|994357_995368_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580328.1|995376_995988_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|996126_996192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024917.1|996262_996865_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|996866_997388_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 54
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1001406	1077375	5584939	holin,tail,plate,tRNA,portal,integrase,head,terminase,capsid	Enterobacteria_phage(73.91%)	84	1040988:1041047	1078318:1078438
WP_000639271.1|1001406_1002225_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	4.9e-72
WP_000252979.1|1002277_1002673_+	membrane protein	NA	NA	NA	NA	NA
WP_000019588.1|1002713_1003457_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564746.1|1003453_1004425_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_032323745.1|1004589_1007019_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214304.1|1007043_1008144_-	cytochrome c	NA	NA	NA	NA	NA
WP_032323742.1|1008531_1009278_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001300190.1|1009291_1009858_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025336.1|1010073_1011807_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
WP_001297434.1|1011983_1012472_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259583.1|1012591_1012984_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067000.1|1012983_1015062_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278954.1|1015054_1016203_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983609.1|1016404_1017049_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|1017059_1017449_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036378.1|1017463_1018513_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204335.1|1018515_1019376_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483235.1|1019394_1020999_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	1.2e-13
WP_001342228.1|1021044_1022706_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|1022850_1023354_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001300654.1|1023374_1025339_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|1025343_1026270_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906335.1|1026266_1027154_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|1027280_1027859_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|1027861_1028212_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122426.1|1028991_1029420_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|1029426_1030851_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001295645.1|1030825_1031626_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000987895.1|1031792_1032782_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187810.1|1032793_1034308_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548675.1|1034377_1035367_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|1036163_1036667_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082123.1|1036745_1036997_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|1037111_1037198_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237869.1|1037460_1037784_+	lipoprotein, function unknown	NA	NA	NA	NA	NA
WP_000917208.1|1037954_1038452_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|1038489_1038729_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797573.1|1038919_1040131_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847902.1|1040192_1040858_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
1040988:1041047	attL	AAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCT	NA	NA	NA	NA
WP_001342226.1|1041214_1042216_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.2	9.3e-105
WP_000865208.1|1042221_1042569_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290352.1|1042598_1043249_-	membrane protein	NA	NA	NA	NA	NA
WP_000786769.1|1043264_1043669_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_001673482.1|1043758_1043896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|1043967_1044171_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000742491.1|1044192_1044543_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.0	1.2e-48
WP_000158976.1|1044553_1044832_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.2	6.9e-34
WP_000357025.1|1044843_1045086_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	3.4e-37
WP_032323740.1|1045082_1045196_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	5.2e-09
WP_000985152.1|1045282_1045486_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	9.5e-25
WP_000564224.1|1045809_1046199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001272083.1|1046195_1049036_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.6	0.0e+00
WP_000686499.1|1049112_1050072_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.0e-181
WP_000211289.1|1050076_1050388_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.2e-47
WP_001289969.1|1050451_1051042_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	50.7	1.8e-31
WP_000087812.1|1051531_1052578_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000613774.1|1052577_1054329_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
WP_001262641.1|1054483_1055320_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.9	7.9e-150
WP_001055094.1|1055343_1056396_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	3.2e-188
WP_000632311.1|1056441_1057242_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	1.5e-126
WP_000063100.1|1057343_1057838_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000864911.1|1057837_1058038_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	7.9e-32
WP_001342221.1|1058040_1058364_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000072343.1|1058360_1058753_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	98.5	2.9e-70
WP_000780555.1|1058749_1059157_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	4.2e-64
WP_001342220.1|1061195_1061663_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	94.8	6.7e-82
WP_032324046.1|1061655_1062291_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
WP_001271909.1|1062287_1062869_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	1.2e-101
WP_000213447.1|1062865_1063216_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111967.1|1063219_1064116_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.9e-154
WP_000071738.1|1064108_1064639_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	4.3e-93
WP_000108514.1|1064641_1066774_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.2	8.0e-130
WP_000144010.1|1066773_1067352_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	2.2e-95
WP_000954196.1|1067395_1067968_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000979950.1|1068124_1068613_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.1	7.5e-84
WP_000853455.1|1068625_1071433_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	96.7	0.0e+00
WP_000763327.1|1071419_1071548_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665308.1|1071583_1071949_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000290450.1|1072003_1072516_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005439.1|1072515_1073700_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.5	3.4e-223
WP_000132847.1|1073857_1074958_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	2.1e-203
WP_001317900.1|1075357_1076497_+	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_000488107.1|1076783_1077044_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078921.1|1077234_1077375_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	5.9e-18
1078318:1078438	attR	AAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA	NA	NA	NA	NA
>prophage 55
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1083630	1084383	5584939		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|1083630_1084383_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 56
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1096183	1096852	5584939		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000334596.1|1096183_1096852_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	1.6e-81
>prophage 57
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1114995	1123341	5584939		Burkholderia_phage(33.33%)	8	NA	NA
WP_000786008.1|1114995_1115466_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	4.4e-33
WP_001157285.1|1115446_1116865_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
WP_000365561.1|1116931_1117627_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_072147055.1|1117666_1118032_-	permease	NA	NA	NA	NA	NA
WP_000824375.1|1118598_1119762_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.2	7.2e-109
WP_000218213.1|1120352_1121204_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826740.1|1121311_1122670_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	8.7e-05
WP_001339045.1|1122669_1123341_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 58
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1126885	1127416	5584939		Escherichia_phage(100.0%)	1	NA	NA
WP_001079075.1|1126885_1127416_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	99.1	5.5e-56
>prophage 59
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1166060	1168373	5584939	transposase	Stx2-converting_phage(66.67%)	3	NA	NA
WP_106881417.1|1166060_1167596_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.1	3.8e-259
WP_000609174.1|1167645_1167993_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_042852135.1|1167989_1168373_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
>prophage 60
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1178095	1180254	5584939		Yersinia_phage(33.33%)	4	NA	NA
WP_001234530.1|1178095_1178917_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000860076.1|1178998_1179478_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	8.9e-13
WP_001186773.1|1179493_1179970_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|1180032_1180254_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 61
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1184595	1185762	5584939		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000830163.1|1184595_1185762_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.7	9.4e-226
>prophage 62
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1193406	1194306	5584939		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131756.1|1193406_1194306_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	92.1	7.0e-11
>prophage 63
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1201663	1222957	5584939		Moumouvirus(18.18%)	20	NA	NA
WP_000704847.1|1201663_1202830_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	1.3e-110
WP_000043483.1|1203078_1204485_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
WP_000868570.1|1204636_1205134_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_001217005.1|1205152_1206346_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001092356.1|1206345_1207500_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A2P1ELS7	Moumouvirus	54.5	2.9e-110
WP_001227588.1|1207477_1208347_-	SDR family oxidoreductase	NA	A0A2P1ELT6	Moumouvirus	32.6	6.3e-33
WP_000475915.1|1208339_1209371_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.4	3.5e-38
WP_162782324.1|1209383_1210484_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_158642092.1|1210501_1211752_-	O123/O186 family O-antigen polymerase	NA	NA	NA	NA	NA
WP_051581989.1|1211735_1212749_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.1	8.4e-05
WP_024199274.1|1212834_1213236_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_001021286.1|1213232_1213799_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001206706.1|1213798_1214773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761415.1|1214776_1215484_-	WbqC family protein	NA	NA	NA	NA	NA
WP_024199275.1|1215480_1216593_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A0F7LAY0	uncultured_marine_virus	32.3	1.5e-18
WP_001087732.1|1216615_1218061_-	O123/O186 family O-antigen flippase	NA	NA	NA	NA	NA
WP_000676155.1|1218178_1219048_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	62.2	2.6e-103
WP_042851992.1|1219048_1220122_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.4	4.3e-100
WP_000183059.1|1220494_1221388_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001115958.1|1221562_1222957_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.2	1.7e-19
>prophage 64
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1228862	1235656	5584939		Bacillus_phage(25.0%)	6	NA	NA
WP_001442154.1|1228862_1230233_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	2.2e-32
WP_000079286.1|1230425_1231862_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	7.4e-47
WP_021554472.1|1231864_1233088_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000479836.1|1233084_1233564_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043606.1|1233566_1234532_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	1.7e-87
WP_105282119.1|1234534_1235656_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 65
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1239900	1250376	5584939		uncultured_marine_virus(20.0%)	8	NA	NA
WP_000654503.1|1239900_1240740_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_000137146.1|1240917_1243080_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482901.1|1243082_1243526_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|1243531_1244671_-	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_001300971.1|1245329_1246913_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001252344.1|1247186_1249040_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|1249061_1249643_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|1249734_1250376_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 66
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1255101	1256454	5584939		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_106881423.1|1255101_1256454_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	7.1e-07
>prophage 67
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1270302	1276416	5584939	tRNA	Bacillus_phage(50.0%)	6	NA	NA
WP_000675141.1|1270302_1271706_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	1.0e-32
WP_000137877.1|1271702_1272425_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|1272615_1272948_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|1273094_1274456_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001394463.1|1274785_1275103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032323936.1|1275516_1276416_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
>prophage 68
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1285638	1289195	5584939		Serratia_phage(50.0%)	4	NA	NA
WP_000846217.1|1285638_1286643_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000011957.1|1286639_1287605_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|1287578_1288325_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001297420.1|1288376_1289195_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
>prophage 69
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1299841	1301875	5584939	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001295427.1|1299841_1301875_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 70
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1315573	1326178	5584939	transposase	Enterobacteria_phage(50.0%)	11	NA	NA
WP_001342301.1|1315573_1317574_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001171523.1|1317905_1318286_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|1318282_1318630_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998019.1|1318679_1320065_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000950404.1|1320496_1320967_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.0e-81
WP_000598641.1|1321013_1321733_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1321729_1323415_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|1323636_1324368_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216961.1|1324427_1324535_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|1324515_1325247_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569327.1|1325251_1326178_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 71
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1346511	1348032	5584939		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255042.1|1346511_1348032_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 72
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1351726	1355512	5584939		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|1351726_1352395_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425428.1|1352652_1353489_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489247.1|1353520_1355512_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
>prophage 73
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1359581	1360439	5584939		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|1359581_1360439_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 74
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1365712	1366531	5584939	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_000336726.1|1365712_1366531_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
>prophage 75
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1376201	1380502	5584939		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_000848223.1|1376201_1377668_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	2.3e-43
WP_032323917.1|1377785_1378772_+	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_001296828.1|1378810_1379524_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|1379935_1380502_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 76
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1386256	1499913	5584939	holin,tail,protease,transposase,portal,integrase,head,lysis,terminase	Enterobacteria_phage(37.8%)	126	1433607:1433622	1501460:1501475
WP_000194876.1|1386256_1387846_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-19
WP_000202798.1|1387849_1388194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213360.1|1388526_1389717_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_001234850.1|1389744_1390440_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578079.1|1390588_1392349_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_000494183.1|1392473_1392758_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|1392896_1393904_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
WP_001135667.1|1394085_1394313_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256205.1|1394332_1396093_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000101718.1|1396462_1397704_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	43.1	1.2e-98
WP_000387479.1|1398200_1398407_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001443784.1|1399090_1399651_+	host cell division inhibitor Icd-like protein	NA	Q8SBF3	Shigella_phage	45.5	9.0e-17
WP_032323919.1|1399640_1400075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204970.1|1400076_1400310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770163.1|1400315_1400615_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833625.1|1400611_1402012_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.1	1.6e-115
WP_001080641.1|1402213_1402459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000391151.1|1402589_1402784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018604.1|1402787_1402949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001229487.1|1403076_1403565_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	42.3	4.6e-25
WP_000624042.1|1403727_1404651_+	hypothetical protein	NA	A0A0R6PHC6	Moraxella_phage	24.9	6.9e-14
WP_001113637.1|1408029_1408677_+	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_001211567.1|1408711_1409764_-	cytochrome c-type biogenesis thiol:disulfide oxidoreductase CcmH	NA	NA	NA	NA	NA
WP_000824439.1|1409760_1410318_-	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_106881429.1|1410314_1412258_-	cytochrome c-type biogenesis heme lyase CcmF	NA	NA	NA	NA	NA
WP_001026418.1|1412254_1412734_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000186540.1|1412730_1412940_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001295447.1|1412936_1413674_-	heme exporter protein CcmC	NA	NA	NA	NA	NA
WP_000971723.1|1413715_1414378_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000528376.1|1415009_1415612_-	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000835177.1|1415621_1416071_-	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000013509.1|1416067_1416931_-	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000091291.1|1416917_1417613_-	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000778069.1|1417619_1420106_-	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000557378.1|1420102_1420366_-	chaperone NapD	NA	NA	NA	NA	NA
WP_000686723.1|1420355_1420850_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001296837.1|1420958_1421123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000849214.1|1421258_1421747_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_106881430.1|1421895_1423542_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000422231.1|1423759_1425403_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000786386.1|1426127_1427192_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406116.1|1427265_1428321_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865576.1|1428432_1429524_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
WP_001249127.1|1430262_1432935_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_001061917.1|1432951_1433602_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
1433607:1433622	attL	CTGTAGGCCAGATAAG	NA	NA	NA	NA
WP_000876014.1|1433687_1436537_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_001225855.1|1436811_1437588_-	YfaP family protein	NA	NA	NA	NA	NA
WP_001104541.1|1437592_1439242_-	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_001676637.1|1439242_1443637_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_001025664.1|1444438_1445761_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.7	2.5e-227
WP_001448330.1|1446454_1447102_-	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	43.3	2.4e-37
WP_001023397.1|1447311_1447581_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	3.2e-44
WP_032325347.1|1447582_1448896_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	1.3e-77
WP_001228241.1|1448960_1449560_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.4e-100
WP_001230644.1|1449627_1449843_-	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	95.8	2.9e-32
WP_000099160.1|1449905_1451444_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|1451492_1451840_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|1451836_1452241_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_106881431.1|1452269_1455569_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	94.7	0.0e+00
WP_000090884.1|1455629_1456262_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_001152619.1|1456947_1457646_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_000847413.1|1457645_1457975_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	1.3e-52
WP_000082375.1|1457971_1460533_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.0	0.0e+00
WP_000533403.1|1460513_1460927_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479086.1|1460953_1461385_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_001143013.1|1461398_1462151_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_000683071.1|1462158_1462554_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_000975037.1|1462550_1463126_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_001204544.1|1463140_1463494_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000201528.1|1463486_1463861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522643.1|1463912_1464797_-	hypothetical protein	NA	C6ZCY2	Enterobacteria_phage	54.1	6.5e-94
WP_000256849.1|1464854_1465202_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	1.5e-22
WP_001254039.1|1465238_1466744_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_001430223.1|1466733_1468326_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	1.1e-184
WP_000258991.1|1468322_1468529_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	60.0	4.2e-12
WP_000235451.1|1470410_1470920_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	33.3	1.2e-12
WP_001307652.1|1471315_1471510_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000881326.1|1471697_1472315_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_000092325.1|1472464_1472902_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_000075132.1|1472898_1473396_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000411802.1|1473395_1473602_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000499454.1|1476212_1476371_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|1476456_1477200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|1477384_1478074_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|1478088_1478211_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|1478549_1479509_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_000994516.1|1479720_1479909_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008193.1|1479905_1480268_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	2.7e-62
WP_000002261.1|1480264_1480555_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	2.9e-51
WP_001003989.1|1480554_1481277_-	DNA-binding protein	NA	K7P6K2	Enterobacteria_phage	99.6	5.4e-131
WP_001341811.1|1481269_1481479_-	protein ninF	NA	G9L691	Escherichia_phage	97.1	2.6e-30
WP_000924601.1|1481438_1481840_-	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_001254255.1|1481842_1482019_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_063516886.1|1482015_1482312_-	hypothetical protein	NA	K7PJW4	Enterobacteria_phage	98.1	2.2e-22
WP_000336726.1|1482217_1483036_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_000088311.1|1483071_1483374_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000344573.1|1483664_1484021_-	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	97.3	2.1e-59
WP_000088311.1|1484276_1484579_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000336726.1|1484614_1485433_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_000145926.1|1485584_1485875_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000788880.1|1485871_1486573_-	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.1	3.8e-129
WP_000185473.1|1486569_1487508_-	replication protein	NA	O48421	Enterobacteria_phage	99.7	1.4e-171
WP_000438538.1|1487540_1487840_-	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	99.0	4.8e-49
WP_000064150.1|1487978_1488212_-	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	97.4	4.0e-35
WP_000428099.1|1488325_1489030_+	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	99.6	4.3e-133
WP_000193240.1|1489298_1489661_+	hypothetical protein	NA	A0A1P8DTD0	Proteus_phage	51.4	6.2e-19
WP_000088201.1|1490267_1490540_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	7.4e-41
WP_000073663.1|1490563_1491103_-	superinfection exclusion protein B	NA	A0A192Y7Z0	Salmonella_phage	44.9	8.1e-39
WP_001341800.1|1491466_1492327_+	hypothetical protein	NA	K7P7J7	Enterobacteria_phage	99.3	2.4e-37
WP_000638547.1|1492351_1492483_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243354.1|1492467_1492620_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	98.0	1.5e-19
WP_000088311.1|1492856_1493159_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000336726.1|1493194_1494013_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_000031370.1|1494143_1494749_+	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	100.0	4.1e-108
WP_000951334.1|1494748_1495132_+	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	2.5e-66
WP_001111278.1|1495155_1495449_+	DUF2856 family protein	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
WP_001214436.1|1495459_1495624_+	DUF2737 family protein	NA	K7P7R0	Enterobacteria_phage	98.1	4.2e-23
WP_000812206.1|1495620_1496178_+	hypothetical protein	NA	E7C9P6	Salmonella_phage	64.3	3.2e-62
WP_000034231.1|1496174_1496732_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	83.6	4.6e-45
WP_000104414.1|1496733_1497351_+	hypothetical protein	NA	Q716F4	Shigella_phage	64.2	5.6e-36
WP_012817743.1|1497347_1497650_+	restriction alleviation protein, Lar family	NA	Q716F5	Shigella_phage	97.0	9.4e-53
WP_000002107.1|1497642_1497927_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	100.0	1.8e-50
WP_000545733.1|1497999_1498167_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_001281774.1|1498195_1498540_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	4.5e-59
WP_001303849.1|1498646_1498865_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533654.1|1498842_1499913_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	5.6e-201
1501460:1501475	attR	CTTATCTGGCCTACAG	NA	NA	NA	NA
>prophage 77
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1509716	1516289	5584939		Planktothrix_phage(33.33%)	7	NA	NA
WP_000891685.1|1509716_1510775_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-20
WP_000604034.1|1510777_1511467_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000113001.1|1511466_1512240_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|1512405_1512555_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_106881433.1|1512683_1513472_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_106881434.1|1513539_1515012_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	5.5e-13
WP_001265438.1|1515272_1516289_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
>prophage 78
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1520644	1524164	5584939		Klebsiella_phage(33.33%)	4	NA	NA
WP_001109199.1|1520644_1521697_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	2.0e-81
WP_000784351.1|1522012_1522393_+	periplasmic protein	NA	NA	NA	NA	NA
WP_000951292.1|1522506_1523448_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000345401.1|1523444_1524164_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	33.2	3.2e-22
>prophage 79
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1560254	1561046	5584939		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114037.1|1560254_1561046_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	27.0	3.7e-08
>prophage 80
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1564424	1567366	5584939		Acinetobacter_phage(50.0%)	2	NA	NA
WP_001032694.1|1564424_1565906_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
WP_000207138.1|1565947_1567366_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.6	1.1e-61
>prophage 81
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1571450	1584171	5584939		uncultured_Caudovirales_phage(25.0%)	8	NA	NA
WP_032325252.1|1571450_1575644_-	rhs element protein RhsC	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	2.5e-26
WP_000424924.1|1575886_1576093_-	YbfA family protein	NA	NA	NA	NA	NA
WP_001272653.1|1576405_1576495_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000730096.1|1576494_1578168_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_000087956.1|1578190_1580239_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.0	1.6e-26
WP_001297248.1|1580247_1580820_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_106881438.1|1580812_1583497_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.5	1.4e-11
WP_032323908.1|1583493_1584171_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	1.5e-26
>prophage 82
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1590826	1591591	5584939		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773279.1|1590826_1591591_+	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	2.9e-05
>prophage 83
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1595740	1599554	5584939	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_001287154.1|1595740_1597405_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
WP_001023104.1|1597607_1599554_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
>prophage 84
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1604180	1605845	5584939		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337066.1|1604180_1605845_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.3	6.1e-85
>prophage 85
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1609941	1611021	5584939		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|1609941_1611021_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 86
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1618917	1622450	5584939		Planktothrix_phage(50.0%)	3	NA	NA
WP_000631384.1|1618917_1619643_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_001207522.1|1619760_1620696_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000367892.1|1620779_1622450_+	molecular chaperone HscC	NA	E5EQT9	Bathycoccus_sp._RCC1105_virus	35.7	4.0e-76
>prophage 87
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1629388	1631971	5584939	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001157890.1|1629388_1631971_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 88
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1638981	1641421	5584939		Synechococcus_phage(50.0%)	2	NA	NA
WP_001231415.1|1638981_1640070_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092082.1|1640209_1641421_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 89
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1646236	1646884	5584939		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000939738.1|1646236_1646620_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|1646674_1646884_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 90
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1662309	1664424	5584939		Morganella_phage(50.0%)	2	NA	NA
WP_000278505.1|1662309_1662738_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
WP_000887629.1|1662858_1664424_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 91
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1667533	1669356	5584939		Streptococcus_phage(50.0%)	2	NA	NA
WP_000029833.1|1667533_1668754_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	1.0e-57
WP_000502941.1|1668726_1669356_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
>prophage 92
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1683896	1689939	5584939		Klosneuvirus(50.0%)	3	NA	NA
WP_001005919.1|1683896_1684712_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
WP_000096713.1|1684708_1685842_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000077704.1|1686057_1689939_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.4	3.8e-61
>prophage 93
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1701367	1704511	5584939		Leptospira_phage(100.0%)	1	NA	NA
WP_000573943.1|1701367_1704511_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.2	5.7e-60
>prophage 94
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1707781	1776728	5584939	tail,protease,transposase,portal,head,lysis,integrase,terminase,capsid	Enterobacteria_phage(58.33%)	77	1727869:1727915	1776742:1776788
WP_000770953.1|1707781_1708465_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000253805.1|1708454_1709903_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	3.9e-11
WP_032325246.1|1710639_1712541_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	8.6e-27
WP_001160804.1|1712568_1713030_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_106881440.1|1713049_1717786_+	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	38.9	1.8e-17
WP_000092528.1|1717787_1718153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000333355.1|1718457_1718895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001429848.1|1718938_1719262_+	sugar-binding protein	NA	NA	NA	NA	NA
WP_000420938.1|1719388_1720525_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383941.1|1720793_1723031_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_001375368.1|1723017_1725990_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224569.1|1725990_1726881_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177453.1|1727063_1727825_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
1727869:1727915	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201825.1|1728337_1729291_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226384.1|1729477_1730962_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000937502.1|1731145_1731451_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_000239881.1|1731507_1732176_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885569.1|1732230_1732815_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
WP_000279150.1|1732814_1735775_-	membrane protein	NA	A0A2D1UII2	Escherichia_phage	98.3	3.0e-58
WP_001230523.1|1735839_1736439_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.8e-108
WP_106881442.1|1736509_1739923_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.2	0.0e+00
WP_000090884.1|1739983_1740616_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_000194778.1|1740552_1741296_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	6.6e-148
WP_001152557.1|1741301_1742000_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	3.4e-130
WP_032324072.1|1741999_1742329_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	2.6e-56
WP_000840236.1|1742325_1744887_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.1	0.0e+00
WP_000459457.1|1744879_1745314_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479169.1|1745295_1745718_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_001342267.1|1745733_1746474_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000683110.1|1746481_1746877_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.9e-70
WP_000985132.1|1746873_1747452_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752961.1|1747442_1747817_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	8.0e-62
WP_000158868.1|1747828_1748224_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000063244.1|1748265_1749291_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
WP_001345004.1|1749346_1749679_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000088640.1|1749688_1750567_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.0	1.7e-147
WP_000624622.1|1751283_1751631_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|1751650_1753222_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001444138.1|1753694_1755296_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	8.5e-310
WP_000198149.1|1755292_1755499_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027295.1|1755495_1757421_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000453558.1|1757395_1757941_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001427981.1|1758329_1758524_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_000738423.1|1758883_1759177_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|1759267_1759450_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_032325290.1|1759666_1760164_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	1.6e-89
WP_000839596.1|1760163_1760379_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737278.1|1760967_1762050_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	80.6	7.8e-166
WP_001204791.1|1762238_1762622_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971074.1|1762707_1762848_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001099712.1|1762844_1763207_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774477.1|1763203_1763494_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	96.9	6.0e-49
WP_000224914.1|1763486_1763657_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053023.1|1763656_1764112_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.1e-60
WP_072097617.1|1764108_1764210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000520500.1|1764333_1764735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038620.1|1764713_1765130_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_001415151.1|1765429_1766038_-	hypothetical protein	NA	Q9T1Q5	Acyrthosiphon_pisum_secondary_endosymbiont_phage	67.3	1.5e-33
WP_000152742.1|1766790_1767138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000788789.1|1767342_1768044_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	3.8e-129
WP_001342088.1|1768040_1768970_-	replication protein	NA	M1FN81	Enterobacteria_phage	67.0	4.4e-109
WP_001182773.1|1769056_1769596_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_001067458.1|1769665_1769896_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000259990.1|1769934_1770690_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_000066829.1|1770771_1771035_+	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	95.4	4.2e-41
WP_001444023.1|1771170_1771491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206913.1|1771957_1772248_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	82.4	2.5e-26
WP_000995439.1|1772323_1772620_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|1772625_1773411_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000611716.1|1773407_1774088_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000149544.1|1774084_1774267_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000548537.1|1774239_1774431_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001443983.1|1774441_1774723_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000763390.1|1774821_1775040_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
WP_000488407.1|1775087_1775366_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000446905.1|1775337_1775709_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000051902.1|1775564_1776728_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
1776742:1776788	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 95
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1783817	1786948	5584939	tRNA	Enterococcus_phage(50.0%)	4	NA	NA
WP_000729154.1|1783817_1784684_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|1784685_1784898_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143540.1|1785005_1785527_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912342.1|1785562_1786948_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
>prophage 96
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1798367	1799513	5584939		Streptococcus_phage(100.0%)	1	NA	NA
WP_001315307.1|1798367_1799513_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.1e-48
>prophage 97
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1805702	1807484	5584939		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001342079.1|1805702_1807484_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	7.8e-38
>prophage 98
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1819794	1820481	5584939		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110573.1|1819794_1820481_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 99
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1823617	1824295	5584939		Bacillus_virus(100.0%)	1	NA	NA
WP_001157532.1|1823617_1824295_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.8	3.1e-27
>prophage 100
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1828834	1831794	5584939		uncultured_virus(50.0%)	2	NA	NA
WP_000078269.1|1828834_1831339_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	3.8e-115
WP_001342071.1|1831452_1831794_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	2.1e-40
>prophage 101
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1840037	1848599	5584939		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
WP_000801832.1|1840037_1840997_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	1.1e-14
WP_001250125.1|1840993_1841956_-	ferrochelatase	NA	NA	NA	NA	NA
WP_001220233.1|1842191_1842836_-	adenylate kinase	NA	NA	NA	NA	NA
WP_000678194.1|1843016_1844891_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001195025.1|1845000_1845606_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|1845605_1845935_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000122008.1|1845987_1847919_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000127356.1|1848047_1848599_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 102
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1856886	1860036	5584939		Leptospira_phage(100.0%)	1	NA	NA
WP_001132475.1|1856886_1860036_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 103
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1868871	1872418	5584939		Bacillus_phage(100.0%)	2	NA	NA
WP_001256174.1|1868871_1870653_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.4e-42
WP_001235581.1|1870645_1872418_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	2.0e-49
>prophage 104
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1875741	1876437	5584939		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817220.1|1875741_1876437_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.6	5.5e-88
>prophage 105
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1879565	1884612	5584939	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_001043542.1|1879565_1879838_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_001295325.1|1880046_1882401_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_106881448.1|1882588_1883863_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	5.1e-132
WP_000122253.1|1883988_1884612_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 106
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1908444	1917425	5584939	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_001021161.1|1908444_1908915_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_001150472.1|1909003_1910107_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	5.3e-53
WP_000543535.1|1910110_1910560_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001295327.1|1910710_1911250_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_001295328.1|1911548_1912433_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000974813.1|1912609_1912957_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_000046637.1|1913085_1914057_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934822.1|1914067_1915915_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|1915942_1916275_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667301.1|1916297_1917425_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.8	1.4e-88
>prophage 107
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1924377	1934348	5584939		Bacillus_phage(50.0%)	6	NA	NA
WP_000893609.1|1924377_1925673_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	2.9e-26
WP_000198399.1|1925730_1926420_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000698929.1|1927807_1930951_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001342329.1|1931076_1932261_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001219321.1|1932403_1933312_-	fructokinase	NA	NA	NA	NA	NA
WP_001298537.1|1933436_1934348_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
>prophage 108
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1938637	1939753	5584939		Bacillus_phage(100.0%)	1	NA	NA
WP_000484055.1|1938637_1939753_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.5e-18
>prophage 109
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1951754	1952621	5584939	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_000878222.1|1951754_1952621_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	5.1e-51
>prophage 110
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1956543	1957311	5584939		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939373.1|1956543_1957311_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	8.6e-26
>prophage 111
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1962608	1963718	5584939		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|1962608_1963718_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 112
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1966896	1968857	5584939		Micromonas_sp._RCC1109_virus(50.0%)	2	NA	NA
WP_001013499.1|1966896_1967910_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
WP_000044328.1|1967906_1968857_-	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	6.6e-36
>prophage 113
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1974267	1978547	5584939		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000805913.1|1974267_1975350_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	99.2	1.8e-191
WP_000177914.1|1975472_1978547_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	98.9	0.0e+00
>prophage 114
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1982387	1988084	5584939		Lactobacillus_phage(50.0%)	4	NA	NA
WP_000952485.1|1982387_1983287_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
WP_001299008.1|1983326_1984610_-	cytosine/isoguanine deaminase	NA	NA	NA	NA	NA
WP_000076236.1|1984599_1985859_-	cytosine permease	NA	NA	NA	NA	NA
WP_000010284.1|1986197_1988084_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	2.4e-53
>prophage 115
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	1996460	2000998	5584939		Tupanvirus(50.0%)	4	NA	NA
WP_000692744.1|1996460_1997510_-	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	1.4e-71
WP_000750340.1|1997596_1998553_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000818900.1|1998549_1999521_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000447335.1|1999513_2000998_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	8.0e-12
>prophage 116
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2012991	2023467	5584939	holin	Escherichia_phage(33.33%)	5	NA	NA
WP_001341217.1|2012991_2016975_-	autotransporter adhesin EhaA	NA	A0A2L1IV18	Escherichia_phage	38.1	2.5e-124
WP_000131044.1|2017547_2019581_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001295527.1|2019709_2020297_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089072.1|2020310_2021783_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159100.1|2021796_2023467_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	2.3e-60
>prophage 117
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2029042	2032347	5584939		Erysipelothrix_phage(50.0%)	4	NA	NA
WP_001046293.1|2029042_2030368_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
WP_000474084.1|2030476_2030713_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|2030724_2031318_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001299025.1|2031477_2032347_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
>prophage 118
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2048879	2050036	5584939	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_094185360.1|2048879_2050036_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
>prophage 119
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2058368	2062080	5584939		Streptococcus_phage(66.67%)	3	NA	NA
WP_000893255.1|2058368_2059622_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_001285288.1|2059633_2060737_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749860.1|2061024_2062080_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	3.5e-118
>prophage 120
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2066757	2067897	5584939		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000528862.1|2066757_2067897_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.7	1.2e-31
>prophage 121
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2091159	2094117	5584939		Catovirus(50.0%)	2	NA	NA
WP_001143094.1|2091159_2093604_+	glycosyltransferase	NA	A0A1V0SAN7	Catovirus	42.6	1.6e-33
WP_000859525.1|2093721_2094117_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.7	6.6e-30
>prophage 122
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2111318	2111897	5584939		Caulobacter_phage(100.0%)	1	NA	NA
WP_000284050.1|2111318_2111897_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
>prophage 123
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2125295	2128079	5584939		Cronobacter_phage(100.0%)	1	NA	NA
WP_000614344.1|2125295_2128079_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.5	3.1e-81
>prophage 124
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2138556	2146409	5584939		Bradyrhizobium_phage(25.0%)	9	NA	NA
WP_001297205.1|2138556_2139288_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|2139352_2139820_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001326291.1|2139816_2140539_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052720.1|2140572_2141328_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|2141399_2142758_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000155276.1|2142805_2143576_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|2143653_2144454_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648609.1|2144694_2145609_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997040.1|2145605_2146409_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	3.2e-39
>prophage 125
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2153067	2154099	5584939		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|2153067_2154099_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 126
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2168336	2172452	5584939		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_001294742.1|2168336_2171819_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.8e-209
WP_000569430.1|2171855_2172452_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
>prophage 127
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2199985	2200330	5584939		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|2199985_2200330_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 128
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2206241	2207039	5584939		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|2206241_2207039_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 129
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2212218	2219024	5584939	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_001369168.1|2212218_2214648_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.6	2.3e-40
WP_001294700.1|2214721_2215252_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396036.1|2215266_2215971_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|2216148_2216604_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000937432.1|2216640_2217567_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174639.1|2217605_2219024_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 130
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2228930	2229833	5584939		Sodalis_phage(100.0%)	1	NA	NA
WP_000339944.1|2228930_2229833_-	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	5.7e-61
>prophage 131
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2233095	2239563	5584939		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_000150637.1|2233095_2234022_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000651599.1|2234130_2234793_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683335.1|2234833_2235370_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_001341254.1|2235575_2237966_+	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_001189601.1|2238012_2239563_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
>prophage 132
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2247212	2248637	5584939		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|2247212_2248637_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 133
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2257264	2257816	5584939		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|2257264_2257816_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 134
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2262061	2263105	5584939		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|2262061_2263105_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 135
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2290357	2292082	5584939		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_106881455.1|2290357_2292082_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.1e-36
>prophage 136
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2304784	2305483	5584939		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916310.1|2304784_2305483_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.7	2.3e-22
>prophage 137
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2311815	2317238	5584939		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_000035672.1|2311815_2314167_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.6	6.0e-38
WP_001117011.1|2314331_2317238_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 138
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2324982	2327736	5584939		Microcystis_phage(50.0%)	5	NA	NA
WP_000257163.1|2324982_2325831_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
WP_000796358.1|2325855_2326455_+	DUF4291 domain-containing protein	NA	NA	NA	NA	NA
WP_001248979.1|2326490_2326958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000998542.1|2327056_2327236_-	antitoxin	NA	NA	NA	NA	NA
WP_000624375.1|2327256_2327736_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 139
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2335631	2341292	5584939		Vibrio_phage(50.0%)	4	NA	NA
WP_000787103.1|2335631_2337146_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
WP_000347117.1|2337176_2338319_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000349932.1|2338447_2339665_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000351348.1|2339738_2341292_+	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.4	2.1e-31
>prophage 140
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2346762	2347911	5584939		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|2346762_2347911_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 141
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2352317	2355134	5584939	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286856.1|2352317_2355134_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 142
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2362176	2371244	5584939		uncultured_Caudovirales_phage(20.0%)	9	NA	NA
WP_000681360.1|2362176_2363343_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	7.5e-90
WP_000935262.1|2363871_2364081_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_001118464.1|2364184_2365315_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000516135.1|2365403_2367320_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_000843559.1|2367696_2368101_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102383.1|2368126_2368840_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528538.1|2368988_2369555_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001094682.1|2369588_2370176_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130189.1|2370290_2371244_-	transaldolase	NA	A0A127KNC6	Cyanophage	30.9	4.8e-10
>prophage 143
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2383013	2385127	5584939		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_001219614.1|2383013_2384438_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.6e-09
WP_001188663.1|2384437_2385127_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
>prophage 144
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2388410	2393765	5584939		Bacillus_phage(33.33%)	3	NA	NA
WP_000409443.1|2388410_2390348_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|2390558_2392226_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093813.1|2392532_2393765_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
>prophage 145
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2400508	2401831	5584939		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|2400508_2401831_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 146
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2407870	2410746	5584939		Salmonella_phage(50.0%)	3	NA	NA
WP_000490275.1|2407870_2408032_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|2408158_2408764_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000175943.1|2409156_2410746_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
>prophage 147
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2418671	2419951	5584939		Salmonella_phage(50.0%)	2	NA	NA
WP_000098818.1|2418671_2419211_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
WP_000799911.1|2419213_2419951_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 148
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2430565	2432230	5584939		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000919568.1|2430565_2432230_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 149
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2448839	2452808	5584939		Synechococcus_phage(50.0%)	2	NA	NA
WP_032323778.1|2448839_2451272_+	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	25.0	1.0e-08
WP_023441788.1|2451302_2452808_+	type I restriction-modification system subunit M	NA	J7I0U9	Acinetobacter_phage	27.3	9.8e-34
>prophage 150
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2459370	2460315	5584939	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000181189.1|2459370_2460315_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	5.0e-60
>prophage 151
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2467816	2468371	5584939		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151863.1|2467816_2468371_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.0	6.0e-37
>prophage 152
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2474940	2476401	5584939		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208222.1|2474940_2476401_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.9	2.8e-49
>prophage 153
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2485528	2487205	5584939		Escherichia_phage(100.0%)	2	NA	NA
WP_000044711.1|2485528_2486125_-	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
WP_000790583.1|2486602_2487205_-	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
>prophage 154
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2490567	2491548	5584939		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000991415.1|2490567_2491548_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	55.6	6.1e-101
>prophage 155
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2495176	2496438	5584939		Klebsiella_phage(50.0%)	3	NA	NA
WP_000692345.1|2495176_2495398_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186774.1|2495460_2495937_-	RadC family protein	NA	NA	NA	NA	NA
WP_000849588.1|2495952_2496438_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
>prophage 156
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2508663	2597357	5584939	tRNA,transposase,integrase,protease	Stx2-converting_phage(37.14%)	77	2542441:2542454	2554585:2554598
WP_000099160.1|2508663_2510202_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|2510250_2510598_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001341328.1|2510719_2510998_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	100.0	1.1e-44
WP_077221339.1|2511447_2511726_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001344112.1|2512359_2512536_+	hemolysin activation protein	NA	NA	NA	NA	NA
WP_000624622.1|2513279_2513627_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|2513646_2515218_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001185332.1|2515527_2515800_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	46.9	8.3e-08
WP_000991130.1|2515801_2516356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214377.1|2516352_2517105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001084853.1|2518019_2518280_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	67.5	4.6e-24
WP_000761643.1|2518276_2518825_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.8	5.9e-29
WP_001014979.1|2518824_2519049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000842358.1|2519045_2519369_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_000016235.1|2519383_2521717_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.8	0.0e+00
WP_000594911.1|2522622_2523447_+	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
WP_000227281.1|2523495_2524068_-	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000177060.1|2525421_2525679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|2526236_2527004_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|2527004_2527961_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000125183.1|2527957_2528956_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000879164.1|2528952_2529855_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000188267.1|2529899_2532224_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_001068910.1|2532310_2533264_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000555341.1|2535531_2535789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000823243.1|2536521_2537880_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000998019.1|2538118_2539504_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000612591.1|2539553_2539901_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171523.1|2539897_2540278_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001221615.1|2540632_2541067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271003.1|2541054_2541456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221529.1|2541621_2542191_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
2542441:2542454	attL	TGGCGCTGTCGTTC	NA	NA	NA	NA
WP_000381395.1|2542930_2544502_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|2544521_2544869_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000336726.1|2545254_2546073_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_000088311.1|2546108_2546411_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000091133.1|2547102_2548689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356577.1|2548827_2549667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000772685.1|2549910_2551173_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.3	2.8e-74
WP_000061768.1|2551616_2552636_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.9e-44
WP_001332879.1|2552765_2554268_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	2.1e-84
WP_001295681.1|2554386_2555469_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
2554585:2554598	attR	GAACGACAGCGCCA	NA	NA	NA	NA
WP_000584109.1|2555468_2556569_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|2556835_2558347_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786398.1|2558700_2559144_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416407.1|2559143_2561999_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_001059398.1|2563441_2563945_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|2563990_2564407_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_000012897.1|2564568_2565582_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000583470.1|2567398_2567851_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000256681.1|2567995_2568589_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000500687.1|2568659_2569373_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000230273.1|2569503_2569899_+	RidA family protein	NA	NA	NA	NA	NA
WP_001296693.1|2570179_2570314_+	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000013046.1|2570317_2571253_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|2571265_2571727_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|2571799_2572186_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000399685.1|2572462_2573443_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000471889.1|2573670_2576367_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|2576507_2576561_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_032323928.1|2576745_2577693_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	3.5e-13
WP_001297258.1|2577811_2579233_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001341327.1|2579282_2580938_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_000187778.1|2581331_2583470_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001106238.1|2583628_2584093_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
WP_001341328.1|2584528_2584807_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	100.0	1.1e-44
WP_000612626.1|2584928_2585276_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099160.1|2585324_2586863_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_001162171.1|2587167_2588520_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166267.1|2588613_2589165_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|2589320_2590694_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853753.1|2590869_2591868_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000596015.1|2591900_2592896_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001296689.1|2592882_2593905_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205813.1|2593918_2595421_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_000265933.1|2595560_2596517_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|2596826_2597357_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
>prophage 157
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2619358	2621189	5584939	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_032325300.1|2619358_2620567_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.5	2.4e-208
WP_072097616.1|2620574_2621189_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.1	1.8e-42
>prophage 158
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2632757	2691046	5584939	tRNA,transposase,integrase,protease	Vibrio_phage(15.38%)	56	2658254:2658268	2690315:2690329
WP_000811566.1|2632757_2633033_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001299838.1|2633149_2634775_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943991.1|2634858_2636022_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
WP_000101670.1|2636024_2636663_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|2636672_2637071_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012553.1|2637088_2637748_-	YjfK family protein	NA	NA	NA	NA	NA
WP_106881462.1|2638510_2638912_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|2639038_2639770_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076316.1|2639949_2642391_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177639.1|2642429_2642855_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|2643059_2644358_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|2644461_2644659_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|2644740_2645745_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_106881464.1|2645737_2647006_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460361.1|2647091_2648372_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|2648448_2648757_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280349.1|2648842_2649793_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122520.1|2649785_2651633_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_000990321.1|2651642_2652980_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|2652998_2653460_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_001307537.1|2653431_2654979_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001294203.1|2654977_2656117_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_100699686.1|2656099_2656153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|2657016_2657562_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|2657656_2658709_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
2658254:2658268	attL	CCGCTGGAAGAGGCG	NA	NA	NA	NA
WP_000934920.1|2658805_2659774_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236850.1|2659795_2663119_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001276180.1|2663147_2663462_-	YjeO family protein	NA	NA	NA	NA	NA
WP_000342867.1|2663458_2663773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001346081.1|2663824_2665327_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004771.1|2665545_2666523_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001192991.1|2666847_2668656_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|2668648_2669383_+	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_000208757.1|2669393_2669789_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_001299198.1|2669799_2670159_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001299193.1|2670221_2671355_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001238378.1|2671443_2671977_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_000118482.1|2671973_2672291_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000239596.1|2672472_2672619_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977757.1|2672729_2672855_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|2672906_2673473_-	elongation factor P	NA	NA	NA	NA	NA
WP_000940530.1|2673514_2674543_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_001008073.1|2674932_2675802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000399685.1|2676050_2677031_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000558209.1|2677283_2677637_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|2677774_2679421_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|2679464_2679758_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000015837.1|2680033_2681290_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267448.1|2681305_2681782_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000069437.1|2682118_2683555_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961959.1|2683672_2684974_+	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000883338.1|2685089_2685428_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000068905.1|2685403_2687101_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001188520.1|2687137_2687713_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001218841.1|2688092_2689358_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_032325301.1|2689474_2691046_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.4	2.2e-294
2690315:2690329	attR	CGCCTCTTCCAGCGG	NA	NA	NA	NA
>prophage 159
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2696581	2697571	5584939		Salmonella_phage(100.0%)	1	NA	NA
WP_000953025.1|2696581_2697571_+	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.5	6.3e-98
>prophage 160
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2732844	2734383	5584939		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000723928.1|2732844_2734383_+	type III secretion system LEE outer membrane ring protein EscC	NA	D0U184	Enterobacteria_phage	28.9	2.0e-10
>prophage 161
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2745157	2745736	5584939		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000491535.1|2745157_2745736_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	78.1	8.6e-79
>prophage 162
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2752736	2755948	5584939	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_000856834.1|2752736_2754194_+	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	1.8e-48
WP_001295074.1|2754430_2755948_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
>prophage 163
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2777144	2778647	5584939		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296882.1|2777144_2778647_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	7.0e-56
>prophage 164
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2783486	2784275	5584939		Cedratvirus(100.0%)	1	NA	NA
WP_001193391.1|2783486_2784275_+	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	8.5e-13
>prophage 165
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2789879	2791429	5584939		Bacillus_virus(50.0%)	2	NA	NA
WP_001075526.1|2789879_2790638_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	27.8	1.0e-15
WP_000611428.1|2790748_2791429_+	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	8.7e-06
>prophage 166
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2795414	2797400	5584939		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001066006.1|2795414_2797400_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	5.5e-149
>prophage 167
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2802645	2804793	5584939		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|2802645_2804793_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 168
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2814075	2816034	5584939		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078239.1|2814075_2816034_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 169
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2821619	2822969	5584939		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|2821619_2822969_-	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 170
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2826786	2830398	5584939		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|2826786_2827323_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_106881534.1|2827653_2830398_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	2.0e-303
>prophage 171
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2835736	2837152	5584939		Escherichia_phage(100.0%)	1	NA	NA
WP_000918363.1|2835736_2837152_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
>prophage 172
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2843742	2844351	5584939		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|2843742_2844351_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 173
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2853566	2854682	5584939		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|2853566_2854682_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 174
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2870688	2871480	5584939		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001130533.1|2870688_2871480_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	1.2e-46
>prophage 175
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2883360	2887044	5584939		Dickeya_phage(100.0%)	1	NA	NA
WP_000096066.1|2883360_2887044_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 176
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2902418	2904008	5584939		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187566.1|2902418_2904008_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 177
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2909376	2911140	5584939		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|2909376_2909649_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000940105.1|2909835_2910426_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362388.1|2910468_2911140_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 178
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2920356	2928685	5584939		Vibrio_phage(50.0%)	2	NA	NA
WP_000653944.1|2920356_2924580_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
WP_000263098.1|2924656_2928685_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 179
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2932801	2935854	5584939		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|2932801_2933986_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023081.1|2934903_2935854_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 180
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2944358	2946203	5584939		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591366.1|2944358_2946203_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 181
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2963238	2970485	5584939		Serratia_phage(33.33%)	6	NA	NA
WP_000184877.1|2963238_2965536_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|2965586_2965907_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004446.1|2965921_2967001_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001185113.1|2967309_2969412_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	8.7e-12
WP_000131554.1|2969439_2969811_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000424845.1|2969822_2970485_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
>prophage 182
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2986033	2990218	5584939		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000015408.1|2986033_2990218_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.0	1.0e-24
>prophage 183
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	2995855	3000358	5584939		Erwinia_phage(50.0%)	5	NA	NA
WP_001293341.1|2995855_2997187_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|2997253_2998180_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|2998272_2998758_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|2998842_2999088_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|2999512_3000358_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 184
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3011931	3016791	5584939		Feldmannia_irregularis_virus(33.33%)	4	NA	NA
WP_001033722.1|3011931_3012630_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|3012626_3014000_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_032324508.1|3014105_3014780_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001297064.1|3016170_3016791_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
>prophage 185
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3032615	3035666	5584939		Escherichia_phage(100.0%)	1	NA	NA
WP_011310337.1|3032615_3035666_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 186
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3045818	3048598	5584939		Escherichia_phage(50.0%)	3	NA	NA
WP_000059678.1|3045818_3046604_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
WP_000621656.1|3046637_3047534_-	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000718893.1|3047701_3048598_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
>prophage 187
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3063546	3066017	5584939		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000190577.1|3063546_3064596_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
WP_001188777.1|3064607_3066017_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 188
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3070095	3072882	5584939		uncultured_virus(100.0%)	1	NA	NA
WP_000250057.1|3070095_3072882_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.3e-71
>prophage 189
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3086562	3087177	5584939		Streptococcus_phage(100.0%)	1	NA	NA
WP_001308167.1|3086562_3087177_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	2.8e-19
>prophage 190
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3095967	3099254	5584939		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109943.1|3095967_3096744_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
WP_000459594.1|3096746_3097262_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001295260.1|3097265_3097535_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187530.1|3097613_3099254_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
>prophage 191
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3111666	3113496	5584939		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|3111666_3113496_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 192
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3120981	3124840	5584939		Bacillus_phage(100.0%)	3	NA	NA
WP_000383411.1|3120981_3123144_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.0	1.0e-116
WP_001213590.1|3123227_3123944_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000130691.1|3123943_3124840_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
>prophage 193
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3127876	3130677	5584939		Salmonella_phage(100.0%)	2	NA	NA
WP_001300182.1|3127876_3129355_+	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	54.7	1.8e-43
WP_000678272.1|3129351_3130677_+	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	34.1	5.3e-07
>prophage 194
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3146961	3153105	5584939		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000612044.1|3146961_3148092_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
WP_001145196.1|3148096_3148771_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000676056.1|3148748_3149630_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001226587.1|3149648_3150716_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	2.7e-102
WP_000006625.1|3150715_3151978_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_000866672.1|3151974_3153105_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.3	3.9e-27
>prophage 195
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3157146	3162558	5584939		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|3157146_3157476_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047503.1|3157606_3158872_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	7.0e-41
WP_106881472.1|3159005_3160490_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001238869.1|3160536_3162558_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
>prophage 196
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3171031	3172678	5584939		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012624.1|3171031_3172678_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	2.2e-66
>prophage 197
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3186069	3191922	5584939		Enterobacteria_phage(33.33%)	5	NA	NA
WP_001056273.1|3186069_3186960_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
WP_000211858.1|3186984_3187950_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000387752.1|3187954_3189460_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000715936.1|3189467_3189887_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000102345.1|3190053_3191922_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
>prophage 198
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3195090	3196083	5584939		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845134.1|3195090_3196083_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.3	6.5e-50
>prophage 199
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3208034	3211396	5584939		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000933736.1|3208034_3209405_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
WP_000334099.1|3209566_3211396_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
>prophage 200
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3218755	3222596	5584939		Cyanophage(50.0%)	4	NA	NA
WP_000867146.1|3218755_3219796_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000741620.1|3219882_3220842_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_001251991.1|3220841_3221732_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063125.1|3221822_3222596_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 201
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3233586	3234924	5584939		Moraxella_phage(100.0%)	1	NA	NA
WP_000082693.1|3233586_3234924_+	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 202
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3245122	3252491	5584939		Staphylococcus_phage(33.33%)	8	NA	NA
WP_001307474.1|3245122_3245380_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239730.1|3245343_3245703_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|3245719_3245860_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_120795392.1|3246089_3246170_-	protein YsdD	NA	NA	NA	NA	NA
WP_000059106.1|3246466_3247870_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673464.1|3247874_3248975_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000060112.1|3248974_3250048_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000072067.1|3250076_3252491_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
>prophage 203
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3257197	3258346	5584939		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|3257197_3258346_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 204
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3262772	3263726	5584939		Cyanophage(50.0%)	2	NA	NA
WP_001243437.1|3262772_3263186_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_001243431.1|3263297_3263726_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
>prophage 205
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3270079	3279241	5584939		Aeromonas_phage(25.0%)	10	NA	NA
WP_106881478.1|3270079_3271795_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	9.5e-41
WP_000828487.1|3271791_3273285_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.2	5.5e-29
WP_000511287.1|3273331_3273781_-	membrane protein	NA	NA	NA	NA	NA
WP_000703959.1|3273890_3274238_+	YidH family protein	NA	NA	NA	NA	NA
WP_001113432.1|3274227_3274590_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000148063.1|3274586_3275084_+	radical SAM protein	NA	NA	NA	NA	NA
WP_000828746.1|3275091_3276276_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000060506.1|3276694_3276784_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001315912.1|3277348_3277447_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000168497.1|3277552_3279241_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	1.6e-56
>prophage 206
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3286663	3287998	5584939		Moraxella_phage(100.0%)	1	NA	NA
WP_001349999.1|3286663_3287998_+	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 207
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3300114	3301506	5584939		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|3300114_3301506_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 208
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3306627	3313378	5584939		Bordetella_phage(25.0%)	6	NA	NA
WP_000280488.1|3306627_3308736_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|3308754_3309030_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001295237.1|3309084_3309708_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_032323841.1|3309965_3311648_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.5	1.1e-22
WP_000924289.1|3311644_3312262_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001297374.1|3312553_3313378_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	6.3e-91
>prophage 209
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3316751	3321314	5584939		Xanthomonas_phage(25.0%)	7	NA	NA
WP_000976070.1|3316751_3317210_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
WP_000050139.1|3317187_3318408_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_001297375.1|3318579_3319248_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000091955.1|3319464_3319701_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|3319721_3319889_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114533.1|3319986_3320796_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001171866.1|3320834_3321314_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
>prophage 210
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3333245	3343986	5584939		Synechococcus_phage(16.67%)	10	NA	NA
WP_000587764.1|3333245_3334178_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
WP_000842823.1|3334481_3335339_+	protein YibB	NA	NA	NA	NA	NA
WP_001213834.1|3335613_3336810_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000646014.1|3336819_3337845_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_000982091.1|3338095_3339130_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000483865.1|3339116_3340076_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214147.1|3340079_3341363_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000116566.1|3341372_3342917_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001156181.1|3343161_3343593_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024392.1|3343734_3343986_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 211
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3365791	3375929	5584939	tRNA	uncultured_Caudovirales_phage(66.67%)	6	NA	NA
WP_001346013.1|3365791_3366625_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	47.0	3.3e-23
WP_000072850.1|3366777_3367620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000015217.1|3367640_3371762_-	RHS element protein RhsA	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	4.6e-25
WP_000779792.1|3371990_3372599_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_000206271.1|3372696_3374088_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000582492.1|3374084_3375929_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	6.7e-16
>prophage 212
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3400117	3401659	5584939		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146482.1|3400117_3401659_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 213
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3406976	3407972	5584939		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182671.1|3406976_3407972_-	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	1.6e-11
>prophage 214
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3412195	3412408	5584939		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|3412195_3412408_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 215
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3416062	3418396	5584939		Escherichia_phage(100.0%)	1	NA	NA
WP_000013916.1|3416062_3418396_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.4	1.1e-71
>prophage 216
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3435425	3437410	5584939		Planktothrix_phage(50.0%)	2	NA	NA
WP_001196495.1|3435425_3436409_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	6.7e-15
WP_000107031.1|3436405_3437410_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	6.6e-18
>prophage 217
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3484870	3485518	5584939		Bacillus_virus(100.0%)	1	NA	NA
WP_001341943.1|3484870_3485518_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 218
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3490399	3492534	5584939		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000065769.1|3490399_3490825_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
WP_000922639.1|3490837_3492127_-	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000008957.1|3492180_3492534_-	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
>prophage 219
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3495878	3497921	5584939		Indivirus(100.0%)	1	NA	NA
WP_001341942.1|3495878_3497921_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	2.0e-45
>prophage 220
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3511526	3514262	5584939		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000149160.1|3511526_3514262_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 221
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3517637	3523289	5584939		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_106881484.1|3517637_3521873_-	rhs element protein RhsB	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.9	2.1e-25
WP_001190062.1|3522075_3522477_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000173630.1|3522482_3523289_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	2.6e-17
>prophage 222
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3531182	3535314	5584939		Dickeya_phage(50.0%)	4	NA	NA
WP_001100467.1|3531182_3531848_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
WP_000130621.1|3532068_3532314_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_000106580.1|3532415_3534614_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.1	1.9e-118
WP_000964718.1|3534687_3535314_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 223
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3538320	3541139	5584939		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000617723.1|3538320_3538989_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
WP_001042001.1|3538981_3540040_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|3540284_3541139_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 224
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3546872	3548355	5584939		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000082101.1|3546872_3547640_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
WP_000416895.1|3547641_3548355_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
>prophage 225
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3551895	3553706	5584939		Planktothrix_phage(50.0%)	2	NA	NA
WP_000907790.1|3551895_3552966_+	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
WP_000073591.1|3552962_3553706_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	1.9e-09
>prophage 226
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3573746	3576194	5584939		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|3573746_3576194_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 227
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3585423	3586650	5584939		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105463.1|3585423_3586650_+	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	60.0	3.4e-133
>prophage 228
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3591029	3593423	5584939		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|3591029_3593423_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 229
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3599392	3600271	5584939		Sodalis_phage(100.0%)	1	NA	NA
WP_000039063.1|3599392_3600271_-	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.9e-69
>prophage 230
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3606834	3610601	5584939		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|3606834_3607554_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253689.1|3607550_3608903_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001265681.1|3608978_3610601_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
>prophage 231
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3627577	3628414	5584939		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|3627577_3628414_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 232
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3652640	3662181	5584939		Acinetobacter_phage(25.0%)	9	NA	NA
WP_000601850.1|3652640_3653204_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	3.5e-61
WP_000963792.1|3653289_3654510_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001295162.1|3654576_3656667_-	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000242755.1|3656717_3657350_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001148908.1|3657651_3658056_+	OsmC family protein	NA	NA	NA	NA	NA
WP_001274680.1|3658110_3658980_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_000907085.1|3659033_3659252_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_000057356.1|3659245_3660268_-	hydrolase	NA	NA	NA	NA	NA
WP_000634798.1|3660267_3662181_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
>prophage 233
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3667751	3673325	5584939		uncultured_Caudovirales_phage(33.33%)	7	NA	NA
WP_001209710.1|3667751_3668138_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	5.6e-18
WP_000820720.1|3668137_3668497_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_000903377.1|3668504_3668792_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|3668917_3669292_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|3669388_3669859_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|3669955_3672070_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_000031783.1|3672140_3673325_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 234
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3693202	3694674	5584939	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000004477.1|3693202_3694150_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	39.5	3.2e-06
WP_000114986.1|3694164_3694674_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	1.1e-18
>prophage 235
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3705009	3710475	5584939	transposase	Bacillus_virus(33.33%)	4	NA	NA
WP_000078339.1|3705009_3705768_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
WP_001297685.1|3705775_3706879_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_085948178.1|3707724_3708938_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000738579.1|3709449_3710475_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
>prophage 236
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3716979	3717864	5584939		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258900.1|3716979_3717864_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.1e-24
>prophage 237
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3723200	3727713	5584939		Escherichia_phage(50.0%)	4	NA	NA
WP_000843960.1|3723200_3724031_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.0	1.2e-09
WP_000275535.1|3724372_3725227_+	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_001341904.1|3725262_3726153_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000132907.1|3726213_3727713_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	5.8e-18
>prophage 238
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3737755	3738799	5584939		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|3737755_3738799_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 239
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3755295	3757820	5584939	protease	uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_000497723.1|3755295_3756363_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295271.1|3756452_3757820_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
>prophage 240
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3761786	3762284	5584939	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|3761786_3762284_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 241
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3765989	3767480	5584939		Burkholderia_virus(100.0%)	1	NA	NA
WP_000108459.1|3765989_3767480_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 242
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3777406	3792200	5584939		Staphylococcus_phage(28.57%)	16	NA	NA
WP_001176896.1|3777406_3778336_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_000809774.1|3778431_3780768_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299134.1|3780997_3781651_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000047091.1|3781647_3782376_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000620405.1|3782372_3783005_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|3783218_3783491_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|3783487_3784342_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000183676.1|3784387_3784879_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|3784996_3785284_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000809051.1|3785306_3786740_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|3786787_3787513_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000669785.1|3787519_3788077_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000030537.1|3788045_3788621_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030018.1|3788617_3789184_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	6.5e-55
WP_000922901.1|3790203_3791181_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000438245.1|3791390_3792200_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 243
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3796268	3797745	5584939		Vibrio_phage(50.0%)	2	NA	NA
WP_000445413.1|3796268_3796547_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
WP_001047336.1|3796773_3797745_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 244
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3804373	3807246	5584939	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107467.1|3804373_3806308_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000764731.1|3806397_3807246_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 245
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3811328	3817967	5584939		Dickeya_phage(50.0%)	4	NA	NA
WP_000207685.1|3811328_3812672_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_001300397.1|3813302_3813755_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031055.1|3813782_3815270_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133044.1|3815294_3817967_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
>prophage 246
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3823448	3825338	5584939		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001297428.1|3823448_3825338_+	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 247
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3832444	3840237	5584939		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
WP_000189314.1|3832444_3832747_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
WP_000449041.1|3832797_3833241_+	YhbP family protein	NA	NA	NA	NA	NA
WP_000037608.1|3833220_3833739_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_001298741.1|3833866_3834502_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000147635.1|3834574_3835615_+	permease	NA	NA	NA	NA	NA
WP_000646033.1|3835728_3836304_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158035.1|3836313_3836904_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000246855.1|3836923_3837319_-	YraN family protein	NA	NA	NA	NA	NA
WP_097503307.1|3837276_3839313_-	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000809253.1|3839376_3840237_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.3	2.1e-49
>prophage 248
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3863245	3864391	5584939		Streptococcus_phage(100.0%)	1	NA	NA
WP_001297158.1|3863245_3864391_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 249
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3872378	3874673	5584939		Tetraselmis_virus(100.0%)	1	NA	NA
WP_032323879.1|3872378_3874673_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	40.8	1.8e-156
>prophage 250
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3900675	3901641	5584939		Escherichia_phage(100.0%)	1	NA	NA
WP_032323880.1|3900675_3901641_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	32.7	3.0e-36
>prophage 251
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3914058	3930242	5584939	tRNA	Herpes_simplex_virus(16.67%)	12	NA	NA
WP_001082879.1|3914058_3917151_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	5.9e-158
WP_000212475.1|3917334_3918318_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_000450589.1|3918536_3918869_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000627213.1|3918910_3920401_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.8e-33
WP_000094682.1|3920707_3922228_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_000018000.1|3922381_3923005_-	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_106881490.1|3923322_3924045_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000228937.1|3924298_3924805_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000437371.1|3924883_3926725_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000918826.1|3926919_3928665_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_001144069.1|3928775_3928991_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264365.1|3929228_3930242_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
>prophage 252
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3936624	3937863	5584939	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708470.1|3936624_3937863_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.3	1.7e-92
>prophage 253
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3943000	3944434	5584939		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|3943000_3944434_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 254
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3953949	3964911	5584939		Staphylococcus_phage(20.0%)	12	NA	NA
WP_001076997.1|3953949_3954603_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
WP_000469266.1|3954863_3955034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295627.1|3955091_3955865_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000188373.1|3955980_3956796_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_000442860.1|3956833_3957994_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000831543.1|3957999_3958671_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000735278.1|3958818_3960300_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917117.1|3960504_3961134_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000833393.1|3961134_3961557_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000444756.1|3961581_3962409_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000105733.1|3962408_3962990_+	esterase YqiA	NA	NA	NA	NA	NA
WP_000195296.1|3963018_3964911_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
>prophage 255
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3968738	3979561	5584939		Stx_converting_phage(25.0%)	9	NA	NA
WP_000712658.1|3968738_3969131_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
WP_000183500.1|3969183_3969666_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001281899.1|3970211_3972470_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.1e-84
WP_000965712.1|3972702_3973440_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_000059395.1|3973514_3974927_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000095187.1|3975037_3977257_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000848528.1|3977299_3977557_-	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000691598.1|3977607_3978534_-	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000013149.1|3978733_3979561_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
>prophage 256
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	3985638	3986523	5584939		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018758.1|3985638_3986523_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 257
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4010016	4011189	5584939		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524974.1|4010016_4011189_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	2.5e-40
>prophage 258
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4025727	4026940	5584939	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_085948183.1|4025727_4026940_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.6	8.7e-166
>prophage 259
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4031716	4032982	5584939	integrase	Pseudomonas_phage(100.0%)	1	4025982:4025995	4037517:4037530
4025982:4025995	attL	CAGTAACGATATCC	NA	NA	NA	NA
WP_032324717.1|4031716_4032982_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	6.9e-81
WP_032324717.1|4031716_4032982_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	6.9e-81
4037517:4037530	attR	CAGTAACGATATCC	NA	NA	NA	NA
>prophage 260
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4058812	4059967	5584939		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|4058812_4059967_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 261
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4080968	4081646	5584939		Bacillus_virus(100.0%)	1	NA	NA
WP_000956871.1|4080968_4081646_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	1.1e-08
>prophage 262
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4099652	4100885	5584939		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|4099652_4100885_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 263
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4109413	4114781	5584939		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_000195029.1|4109413_4112287_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	4.8e-263
WP_000951964.1|4112547_4113291_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001341859.1|4113347_4114781_-	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	25.9	1.3e-30
>prophage 264
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4118705	4134097	5584939	tRNA	Brevibacillus_phage(14.29%)	14	NA	NA
WP_000806638.1|4118705_4119602_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
WP_000715214.1|4119626_4120337_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000813220.1|4120342_4122076_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	3.2e-60
WP_106881493.1|4122166_4123264_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003086.1|4123274_4124792_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	7.7e-87
WP_106881494.1|4124834_4125383_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_120795390.1|4125437_4125509_+	protein YqfH	NA	NA	NA	NA	NA
WP_001010156.1|4125505_4125631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295374.1|4125632_4127081_-	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001345944.1|4127516_4129436_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_000838428.1|4129435_4129924_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000012163.1|4129959_4131327_-	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_001295158.1|4131362_4132679_-	guanine deaminase	NA	NA	NA	NA	NA
WP_001280192.1|4132696_4134097_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 265
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4158376	4161546	5584939		Clostridium_phage(50.0%)	4	NA	NA
WP_001272558.1|4158376_4159132_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
WP_001570270.1|4159781_4159988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232281.1|4160021_4160342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001273866.1|4160994_4161546_-	recombinase family protein	NA	Q2A092	Sodalis_phage	44.4	5.4e-30
>prophage 266
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4169489	4179807	5584939	transposase,integrase	Stx2-converting_phage(42.86%)	8	4172750:4172766	4181835:4181851
WP_000365260.1|4169489_4171331_+	hypothetical protein	NA	A0A1Q1N989	Escherichia_phage	26.7	2.7e-33
WP_000023788.1|4171438_4172659_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
4172750:4172766	attL	TCCCTTCGCCCGCTCCA	NA	NA	NA	NA
WP_000935135.1|4172900_4174508_+|integrase	site-specific integrase	integrase	A0A059XK29	uncultured_phage	28.0	4.3e-11
WP_000852869.1|4174500_4175160_+	DUF4145 domain-containing protein	NA	M1PSB6	Streptococcus_phage	33.9	3.6e-33
WP_000082600.1|4176068_4176797_+	Rha family transcriptional regulator	NA	B5AX29	Iodobacteriophage	41.2	7.1e-14
WP_001339397.1|4177191_4177869_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|4177868_4178216_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|4178235_4179807_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
4181835:4181851	attR	TCCCTTCGCCCGCTCCA	NA	NA	NA	NA
>prophage 267
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4204527	4207022	5584939		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000603508.1|4204527_4205289_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	4.5e-19
WP_000256438.1|4205603_4207022_+	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
>prophage 268
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4216653	4223426	5584939		Moraxella_phage(33.33%)	6	NA	NA
WP_000895624.1|4216653_4217367_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_000082188.1|4217435_4218125_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564489.1|4218809_4219340_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957914.1|4219352_4221599_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000204658.1|4221749_4222625_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816232.1|4222631_4223426_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 269
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4228902	4249781	5584939	tRNA	Bacillus_phage(22.22%)	14	NA	NA
WP_001138192.1|4228902_4231791_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	6.9e-68
WP_001285982.1|4231783_4235326_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.8	2.6e-08
WP_000775978.1|4235325_4237152_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.7	2.0e-25
WP_000237947.1|4237213_4238545_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000016907.1|4238776_4240030_+	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000582832.1|4240288_4241113_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_000810575.1|4241144_4242725_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	35.7	2.0e-05
WP_000350900.1|4242724_4243933_+	putative C-S lyase	NA	NA	NA	NA	NA
WP_001066231.1|4243901_4244498_+	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	33.5	1.8e-23
WP_001341841.1|4244569_4245517_+	phosphoglycerate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	25.9	6.9e-17
WP_000678646.1|4246101_4247199_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000117728.1|4247275_4248082_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000184265.1|4248132_4248576_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_001299897.1|4248575_4249781_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	1.7e-73
>prophage 270
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4261307	4262153	5584939		Bacillus_phage(100.0%)	1	NA	NA
WP_001214598.1|4261307_4262153_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.6e-10
>prophage 271
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4266921	4267770	5584939		Vibrio_phage(100.0%)	1	NA	NA
WP_000100393.1|4266921_4267770_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	8.0e-41
>prophage 272
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4275304	4279419	5584939		Hokovirus(50.0%)	2	NA	NA
WP_032323900.1|4275304_4278061_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
WP_000046800.1|4278117_4279419_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	5.2e-39
>prophage 273
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4283451	4288371	5584939		Only_Syngen_Nebraska_virus(33.33%)	5	NA	NA
WP_000210878.1|4283451_4285089_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_000036723.1|4285176_4286475_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_001268451.1|4286534_4287407_-	YgcG family protein	NA	NA	NA	NA	NA
WP_001288227.1|4287420_4287561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001199970.1|4287699_4288371_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
>prophage 274
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4317785	4319818	5584939		Hokovirus(50.0%)	2	NA	NA
WP_001090394.1|4317785_4319213_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	3.7e-30
WP_001173673.1|4319212_4319818_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
>prophage 275
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4322928	4326644	5584939		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_001295182.1|4322928_4323690_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|4323683_4324310_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|4324449_4325589_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|4325651_4326644_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
>prophage 276
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4331858	4338998	5584939		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|4331858_4332497_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|4332493_4333756_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|4333752_4334661_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001272549.1|4334826_4335624_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_001141347.1|4335674_4336331_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
WP_001272924.1|4336436_4338998_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 277
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4358455	4359469	5584939		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001341827.1|4358455_4359469_+	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.3	3.9e-26
>prophage 278
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4367042	4368008	5584939		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287415.1|4367042_4368008_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 279
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4373474	4379034	5584939	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_000132231.1|4373474_4373972_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
WP_000963143.1|4374051_4375113_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000140519.1|4375355_4375856_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000047176.1|4375983_4378614_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|4378848_4379034_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 280
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4391851	4397147	5584939		Bacillus_virus(20.0%)	5	NA	NA
WP_000985494.1|4391851_4393054_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777938.1|4393408_4394368_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	5.9e-133
WP_000246514.1|4394377_4396522_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.0	7.1e-195
WP_000080947.1|4396494_4396905_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001223227.1|4396901_4397147_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 281
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4401082	4405207	5584939		Clostridium_phage(50.0%)	4	NA	NA
WP_000522424.1|4401082_4401532_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156811.1|4401532_4402195_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001325764.1|4402215_4403616_-	GABA permease	NA	NA	NA	NA	NA
WP_001087606.1|4403926_4405207_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	2.4e-33
>prophage 282
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4410465	4515225	5584939	holin,tail,tRNA,transposase,integrase,head,terminase,capsid	Stx2-converting_phage(33.33%)	103	4413525:4413539	4425885:4425899
WP_000169527.1|4410465_4410765_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000577251.1|4411779_4413498_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	100.0	6.5e-308
WP_000214985.1|4413499_4415248_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	100.0	0.0e+00
4413525:4413539	attL	TTGTCCAGAAAACTT	NA	NA	NA	NA
WP_000448925.1|4415319_4415736_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_001341819.1|4415774_4417004_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_001431537.1|4417302_4418211_-	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	100.0	2.3e-171
WP_000516611.1|4418693_4419869_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	91.2	4.6e-204
WP_000557643.1|4420041_4420188_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	90.9	1.7e-20
WP_000457722.1|4420191_4420434_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	82.5	1.8e-30
WP_000206753.1|4420518_4421382_-	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	53.6	3.2e-69
WP_000034210.1|4421383_4421713_-	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	37.5	1.1e-25
WP_000476199.1|4421709_4421949_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	96.2	3.7e-36
WP_032323951.1|4421941_4422145_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	94.0	1.2e-30
WP_032323952.1|4422141_4423020_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	94.5	1.2e-169
WP_000008174.1|4423010_4423547_-	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	99.4	2.8e-100
WP_000081319.1|4423675_4424500_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	98.9	5.0e-149
WP_000135680.1|4424565_4424928_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000559922.1|4425398_4425914_+	hypothetical protein	NA	NA	NA	NA	NA
4425885:4425899	attR	TTGTCCAGAAAACTT	NA	NA	NA	NA
WP_001020634.1|4426233_4426926_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_001191674.1|4427023_4427284_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_000515845.1|4427276_4427828_+	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001250269.1|4428003_4428183_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104954.1|4428172_4429114_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	4.3e-144
WP_001305611.1|4429110_4429605_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	99.4	1.5e-87
WP_000066917.1|4429604_4430258_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210187.1|4430254_4430581_+	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	100.0	1.6e-53
WP_000767117.1|4430577_4430967_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	100.0	7.1e-69
WP_024220650.1|4430986_4431796_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	97.8	4.5e-150
WP_001379493.1|4431803_4432793_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	7.3e-195
WP_001205460.1|4432810_4433152_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001131908.1|4433154_4433712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032212763.1|4435745_4437683_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.7	0.0e+00
WP_000143462.1|4437818_4437998_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_001290231.1|4438038_4438311_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284519.1|4438387_4438603_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731236.1|4438607_4438952_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992122.1|4439002_4439536_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_047091958.1|4440054_4440240_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.3	1.3e-17
WP_000736096.1|4440325_4440550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095736.1|4440918_4441146_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_025380422.1|4441187_4441553_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	5.8e-65
WP_000958380.1|4441841_4442405_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_032323913.1|4442401_4444063_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.5	0.0e+00
WP_032325321.1|4444126_4445905_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	90.1	0.0e+00
WP_001063099.1|4445949_4446171_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125996.1|4448697_4449024_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	99.1	1.6e-53
WP_001007889.1|4449034_4449385_+|head	phage head closure protein	head	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
WP_000573391.1|4449381_4449828_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133393.1|4449824_4450169_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275441.1|4450235_4450952_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000710952.1|4450966_4451341_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_122993730.1|4451436_4451646_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	92.8	2.6e-30
WP_000212998.1|4451696_4454939_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.5	0.0e+00
WP_000807927.1|4454931_4455273_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	98.2	4.3e-62
WP_001341641.1|4455272_4455971_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	97.4	7.6e-130
WP_122996338.1|4456669_4457302_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.1	4.9e-104
WP_162782327.1|4457540_4460636_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	96.8	0.0e+00
WP_000336726.1|4460676_4461495_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_000088311.1|4461530_4461833_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001228241.1|4462348_4462948_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.4e-100
WP_000268987.1|4463012_4464326_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	4.8e-77
WP_001023420.1|4464327_4464597_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_115801847.1|4464703_4464793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|4464812_4467161_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_032324038.1|4467752_4471154_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.3	1.0e-219
WP_000336726.1|4472329_4473148_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_000088311.1|4473183_4473486_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032324018.1|4475912_4476395_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.2	1.5e-28
WP_000600190.1|4476526_4477003_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|4476992_4477283_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|4477344_4477686_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|4477834_4479496_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|4479581_4480460_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|4480582_4481176_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|4481230_4482517_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001189257.1|4482537_4483404_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460032.1|4483495_4484857_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|4485105_4485354_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|4485372_4485921_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|4485951_4486719_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|4486760_4487108_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589828.1|4487184_4487667_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969036.1|4487682_4488909_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|4488898_4489417_-	YfiR family protein	NA	NA	NA	NA	NA
WP_000976004.1|4489566_4489932_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168054.1|4490141_4491212_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000225221.1|4491222_4492344_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200116.1|4492386_4493547_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|4493644_4493692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|4493795_4494137_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|4494407_4495145_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079094.1|4495279_4496260_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040115.1|4496256_4496988_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|4497117_4499691_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000841103.1|4505544_4506843_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_000464877.1|4506839_4507184_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|4507208_4508564_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000083007.1|4508677_4511338_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001341635.1|4511369_4512068_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|4512136_4512556_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|4512762_4513800_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262716.1|4513847_4514537_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000627807.1|4514841_4515225_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
>prophage 283
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4518339	4519674	5584939		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_000219193.1|4518339_4519674_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 284
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4525445	4529188	5584939		Tupanvirus(50.0%)	3	NA	NA
WP_000790168.1|4525445_4527245_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|4527260_4528235_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|4528507_4529188_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 285
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4532646	4532907	5584939		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|4532646_4532907_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 286
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4537026	4548334	5584939		Bacillus_phage(50.0%)	7	NA	NA
WP_000970107.1|4537026_4540914_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.3	9.1e-132
WP_001341630.1|4541489_4542917_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.9e-16
WP_001215888.1|4543081_4543795_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001298983.1|4543784_4545119_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717694.1|4545179_4545518_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000883122.1|4545562_4546753_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919159.1|4547080_4548334_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 287
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4554098	4555610	5584939		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493455.1|4554098_4555610_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	9.6e-13
>prophage 288
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4570897	4577354	5584939		Faustovirus(20.0%)	8	NA	NA
WP_001295373.1|4570897_4572112_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|4572139_4572526_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|4572542_4572866_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000384411.1|4572961_4573477_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196613.1|4573493_4575344_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_001124469.1|4575345_4575681_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523616.1|4575692_4575893_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000133582.1|4576070_4577354_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.2e-34
>prophage 289
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4587239	4587671	5584939		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|4587239_4587671_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 290
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4596500	4602985	5584939		Escherichia_phage(66.67%)	7	NA	NA
WP_000937895.1|4596500_4597871_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.0	2.6e-41
WP_001299507.1|4598032_4599499_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138282.1|4599567_4601145_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_000755172.1|4601239_4601779_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	99.4	9.9e-45
WP_001317257.1|4601794_4602313_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	8.5e-62
WP_000076001.1|4602623_4602815_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_000017552.1|4602832_4602985_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
>prophage 291
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4609231	4613233	5584939		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_001028614.1|4609231_4609870_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
WP_001341612.1|4609869_4610907_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001295473.1|4611231_4611858_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198328.1|4611943_4613233_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
>prophage 292
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4634483	4635197	5584939		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|4634483_4635197_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 293
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4653244	4654195	5584939		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|4653244_4654195_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 294
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4672749	4677687	5584939		Deep-sea_thermophilic_phage(33.33%)	6	NA	NA
WP_000102891.1|4672749_4673619_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
WP_000406000.1|4673832_4674258_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_001325675.1|4674244_4674694_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000838945.1|4674754_4675330_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000084590.1|4675425_4676325_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_001315775.1|4676382_4677687_-	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
>prophage 295
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4681165	4696535	5584939		Streptococcus_phage(33.33%)	15	NA	NA
WP_000517439.1|4681165_4681957_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	8.9e-18
WP_000290223.1|4682127_4683144_+	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_000458406.1|4683143_4683977_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000852685.1|4683976_4684852_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000021040.1|4684841_4685939_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_001297645.1|4686072_4686984_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	3.5e-58
WP_000719943.1|4686986_4687355_-	YfeK family protein	NA	NA	NA	NA	NA
WP_000096660.1|4687459_4688311_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000522247.1|4688352_4688862_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000623136.1|4688902_4690630_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000487600.1|4690674_4690932_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034402.1|4691315_4692287_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000254843.1|4692471_4693233_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_001297862.1|4693462_4694449_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000443665.1|4694519_4696535_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	6.5e-150
>prophage 296
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4722229	4722964	5584939		Clostridioides_phage(100.0%)	1	NA	NA
WP_001341597.1|4722229_4722964_-	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	2.7e-13
>prophage 297
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4726782	4727703	5584939		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|4726782_4727703_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 298
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4731394	4738971	5584939		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_001283499.1|4731394_4733089_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
WP_000955028.1|4733158_4734103_+	transporter YfdV	NA	NA	NA	NA	NA
WP_001296867.1|4734176_4735322_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_001443604.1|4735377_4738971_-	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	1.7e-36
>prophage 299
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4745624	4747058	5584939		Bacillus_phage(100.0%)	1	NA	NA
WP_000194515.1|4745624_4747058_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 300
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4750528	4751790	5584939		Klebsiella_phage(50.0%)	3	NA	NA
WP_000692323.1|4750528_4750750_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186773.1|4750812_4751289_-	RadC family protein	NA	NA	NA	NA	NA
WP_000214413.1|4751304_4751790_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	4.0e-13
>prophage 301
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4764118	4766734	5584939	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_000381395.1|4764118_4765690_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|4765709_4766057_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|4766056_4766734_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
>prophage 302
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4774651	4777676	5584939	transposase	Acinetobacter_phage(50.0%)	3	NA	NA
WP_000336726.1|4774651_4775470_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_000088311.1|4775505_4775808_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000368131.1|4776743_4777676_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 303
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4795549	4796635	5584939		Pandoravirus(100.0%)	1	NA	NA
WP_000918470.1|4795549_4796635_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
>prophage 304
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4805190	4806327	5584939		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699121.1|4805190_4806327_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
>prophage 305
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4812803	4814321	5584939		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|4812803_4814321_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 306
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4818532	4820393	5584939		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_001293612.1|4818532_4819306_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_000156114.1|4819502_4820393_+	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	44.2	4.0e-67
>prophage 307
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4830952	4834180	5584939		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001203389.1|4830952_4831603_+	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	34.3	5.2e-08
WP_001012899.1|4831689_4833522_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000813860.1|4833580_4834180_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 308
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4870513	4875517	5584939		Tupanvirus(50.0%)	4	NA	NA
WP_000860259.1|4870513_4872496_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
WP_000461661.1|4872495_4873464_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.2	2.0e-35
WP_001427556.1|4873467_4874607_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	5.0e-30
WP_001297077.1|4874914_4875517_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
>prophage 309
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4878669	4988435	5584939	holin,tail,protease,transposase,portal,integrase,lysis,head,terminase	Enterobacteria_phage(38.1%)	123	4895919:4895953	4982616:4982650
WP_000140570.1|4878669_4879572_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
WP_001000358.1|4879765_4880956_-	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_001209922.1|4880952_4882212_-	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_000857257.1|4882201_4883830_-	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_000948732.1|4884102_4885461_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_000779084.1|4885465_4886542_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_000301050.1|4887004_4887655_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000135040.1|4887708_4887963_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000332036.1|4887962_4889093_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_001075177.1|4889181_4891467_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.1e-283
WP_106881540.1|4892162_4895897_+	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	26.5	2.0e-19
4895919:4895953	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000990754.1|4896024_4896747_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001281242.1|4896893_4899521_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
WP_000012302.1|4899669_4901358_+	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
WP_001215756.1|4901354_4901960_+	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_000533670.1|4901974_4903045_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
WP_001444001.1|4903022_4903241_-	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
WP_001281192.1|4903346_4903691_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
WP_000457736.1|4903809_4904052_-	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	96.2	3.7e-36
WP_001345188.1|4904126_4904477_-	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	80.2	3.3e-33
WP_001289868.1|4904473_4905079_-	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	96.9	1.7e-45
WP_000763358.1|4905075_4905297_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	95.9	1.6e-33
WP_001444000.1|4905395_4905677_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|4905687_4905879_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|4905851_4906034_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|4906033_4906711_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|4906707_4907493_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|4907498_4907795_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372926.1|4907849_4908014_-	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	98.1	3.2e-23
WP_001198860.1|4907982_4908147_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000065385.1|4908219_4908588_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	97.5	3.8e-64
WP_000167595.1|4908737_4909208_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000930321.1|4909341_4909680_-	hypothetical protein	NA	K7PJW2	Enterobacteria_phage	99.1	5.8e-59
WP_000256573.1|4909682_4909988_-	hypothetical protein	NA	K7PJM7	Enterobacteria_phage	99.0	7.0e-48
WP_001095982.1|4910302_4910953_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	100.0	4.9e-123
WP_000276885.1|4911033_4911219_+	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	100.0	1.2e-26
WP_000035947.1|4911328_4911625_+	hypothetical protein	NA	A0A0N7C1W0	Escherichia_phage	96.9	1.3e-46
WP_032325349.1|4911657_4912596_+	replication protein	NA	C1JJ53	Enterobacteria_phage	99.7	1.8e-171
WP_000788878.1|4912592_4913294_+	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	99.6	1.7e-129
WP_000145926.1|4913290_4913581_+	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000229807.1|4913653_4913860_+	hypothetical protein	NA	G8C7M4	Escherichia_phage	97.1	1.8e-26
WP_000810176.1|4913867_4914314_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	92.6	3.4e-75
WP_000153270.1|4914310_4914838_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_001254228.1|4914834_4915017_+	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_001429269.1|4915520_4917356_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	0.0e+00
WP_001108084.1|4917855_4918422_+	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_001223927.1|4918396_4918999_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
WP_001028854.1|4918995_4919661_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235460.1|4919657_4920281_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_001302581.1|4920533_4921277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|4921362_4921521_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|4921601_4922000_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|4922142_4922358_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075153.1|4922357_4922855_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	96.4	1.6e-89
WP_001228695.1|4923071_4923254_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|4923344_4923638_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001427981.1|4923997_4924192_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_000235436.1|4924586_4925096_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_024017589.1|4925067_4926996_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	2.7e-262
WP_000259002.1|4926979_4927186_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001432013.1|4927182_4928775_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.2e-184
WP_001254029.1|4928764_4928941_+	hypothetical protein	NA	E4WL22	Enterobacteria_phage	56.4	1.1e-08
WP_000839179.1|4929018_4929423_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|4929419_4929767_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099160.1|4929815_4931354_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_032284507.1|4931350_4931719_+	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	88.0	2.4e-50
WP_001143013.1|4931726_4932479_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_000479086.1|4932492_4932924_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_000533431.1|4932950_4933364_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000082320.1|4933344_4935924_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.3	0.0e+00
WP_000847304.1|4935920_4936250_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_032325234.1|4936249_4936948_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	98.3	2.4e-131
WP_001405642.1|4936958_4937702_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	5.6e-147
WP_096844540.1|4937647_4938280_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	3.5e-102
WP_106881502.1|4938525_4942002_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_001230449.1|4942069_4942669_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.6e-110
WP_000268998.1|4942733_4943948_+	short-chain dehydrogenase	NA	B6DZB7	Enterobacteria_phage	95.8	6.6e-81
WP_001023459.1|4943949_4944219_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_000950982.1|4944324_4945206_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_001428038.1|4945422_4946256_+	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.5	9.3e-151
WP_021351651.1|4946379_4946751_-	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_000381395.1|4947225_4948797_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|4948816_4949164_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|4949163_4949841_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001448642.1|4949901_4950477_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	77.5	1.6e-77
WP_001002868.1|4950677_4951058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354291.1|4951141_4951363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001121571.1|4951375_4952029_-	type III secretion system effector ADP-ribosyltransferase EspJ	NA	NA	NA	NA	NA
WP_000767389.1|4952532_4953009_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_001307065.1|4953067_4954357_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
WP_000951213.1|4954443_4955484_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_000118840.1|4955480_4956635_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000246805.1|4956621_4957377_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000044868.1|4957369_4958047_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000042533.1|4958625_4960647_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_001295302.1|4960838_4961747_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
WP_001295301.1|4962143_4963133_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_000084632.1|4963154_4963667_+	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_000080885.1|4963669_4964155_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000598619.1|4964147_4964393_+	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000852287.1|4964394_4964847_+	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000373624.1|4964983_4965688_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000446932.1|4965892_4966606_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000045454.1|4966641_4967598_-	UPF0104 family protein	NA	NA	NA	NA	NA
WP_000650337.1|4967597_4968839_-	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_001113363.1|4968835_4969597_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000871982.1|4969729_4970140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000469031.1|4970101_4971208_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000070131.1|4971218_4972352_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000996091.1|4972344_4974081_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	1.3e-18
WP_000976401.1|4974073_4975072_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|4975071_4975743_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007094.1|4975971_4977336_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_000443534.1|4977566_4978652_-	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000386551.1|4978792_4979755_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001218655.1|4979782_4981933_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.8	4.8e-42
WP_001145128.1|4982052_4982535_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
WP_000399648.1|4982794_4983775_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
4982616:4982650	attR	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000849301.1|4984044_4984305_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146345.1|4984569_4984836_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	2.0e-06
WP_000990177.1|4984909_4985587_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000430039.1|4985628_4987911_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000710619.1|4988174_4988435_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 310
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	4991975	4997200	5584939		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569080.1|4991975_4992698_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159066.1|4992694_4993354_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|4993492_4994239_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|4994642_4995146_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001119538.1|4995444_4996332_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|4996566_4996632_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|4996684_4997200_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 311
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	5004172	5006355	5584939		Mycobacterium_phage(50.0%)	2	NA	NA
WP_032345111.1|5004172_5005489_-	restriction endonuclease subunit M	NA	A0A222ZMD5	Mycobacterium_phage	38.0	1.2e-48
WP_032345110.1|5005713_5006355_+	recombinase family protein	NA	A0A222YWP5	Escherichia_phage	31.6	7.2e-10
>prophage 312
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	5009484	5012611	5584939		Bacillus_phage(50.0%)	2	NA	NA
WP_032346692.1|5009484_5010984_-	recombinase family protein	NA	A0A288WG85	Bacillus_phage	24.9	1.7e-14
WP_000923072.1|5011018_5012611_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	3.1e-62
>prophage 313
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	5016503	5020634	5584939		Citrobacter_phage(50.0%)	3	NA	NA
WP_000209359.1|5016503_5018936_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001295295.1|5018941_5019841_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001432715.1|5019971_5020634_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.1	5.7e-26
>prophage 314
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	5037055	5038258	5584939		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|5037055_5038258_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 315
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	5046824	5055974	5584939		Vibrio_phage(25.0%)	11	NA	NA
WP_001195240.1|5046824_5047082_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|5047241_5047529_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189159.1|5047512_5048235_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|5048295_5049198_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|5049285_5049762_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126055.1|5050112_5051225_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996018.1|5051319_5052453_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_001093858.1|5052462_5053416_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061657.1|5053412_5054258_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|5054317_5054806_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149732.1|5054846_5055974_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
>prophage 316
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	5059311	5062049	5584939		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027205.1|5059311_5060040_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270740.1|5060257_5060773_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160723.1|5060898_5061222_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255144.1|5061218_5062049_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
>prophage 317
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	5065636	5067355	5584939		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815362.1|5065636_5067355_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
>prophage 318
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	5076652	5100448	5584939	tRNA,protease	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
WP_000188180.1|5076652_5078599_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|5078671_5078896_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|5079218_5079539_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|5079569_5081846_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|5082529_5082748_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|5083032_5083737_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202168.1|5083778_5085500_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.1e-20
WP_001043619.1|5085500_5087267_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_000537421.1|5087389_5088355_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_000228473.1|5088898_5089393_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077075.1|5089527_5093634_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|5093788_5094400_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067740.1|5094410_5095754_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.6	3.6e-80
WP_000886683.1|5095844_5097137_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850306.1|5097375_5099820_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|5099830_5100448_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 319
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	5106757	5109972	5584939		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|5106757_5107498_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|5107689_5109972_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
>prophage 320
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	5114070	5115159	5584939		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057149.1|5114070_5115159_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 321
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	5120245	5124786	5584939		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|5120245_5120530_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705700.1|5120736_5123001_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|5123037_5124786_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
>prophage 322
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	5139491	5140040	5584939		Rhodobacter_phage(100.0%)	1	NA	NA
WP_001295932.1|5139491_5140040_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 323
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	5143589	5151903	5584939	tRNA	Enterobacteria_phage(25.0%)	5	NA	NA
WP_000977920.1|5143589_5144678_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000117881.1|5145279_5146680_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001297200.1|5146848_5148051_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193859.1|5148316_5150929_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	4.1e-19
WP_001090514.1|5151135_5151903_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.7e-29
>prophage 324
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	5167824	5169732	5584939		Tupanvirus(100.0%)	1	NA	NA
WP_000053122.1|5167824_5169732_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	3.2e-53
>prophage 325
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	5174399	5287379	5584939	holin,tail,protease,transposase,portal,integrase,head,terminase,capsid	Escherichia_phage(35.14%)	145	5234594:5234619	5285199:5285224
WP_000156528.1|5174399_5176160_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|5176345_5176798_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|5176872_5177913_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|5178269_5178779_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839153.1|5178997_5179627_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|5179589_5181752_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|5181761_5182208_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001297106.1|5182330_5184385_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
WP_000424181.1|5184416_5184875_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|5184970_5185633_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|5185805_5186219_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|5186263_5186581_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116301.1|5186638_5187829_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048244.1|5187923_5188202_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|5188198_5188528_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375138.1|5188618_5189278_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
WP_001299351.1|5189685_5190705_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|5190682_5190925_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_009448824.1|5190992_5193443_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
WP_001098307.1|5193536_5193728_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|5193724_5193913_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133037.1|5194480_5194690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|5194690_5195329_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001345283.1|5195340_5195493_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
WP_000362152.1|5195759_5196179_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
WP_000391948.1|5196278_5196560_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000693883.1|5196543_5196969_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_025380294.1|5197040_5198147_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.8e-64
WP_021498074.1|5198153_5198894_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_032324560.1|5198919_5199690_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	68.5	2.5e-86
WP_001151235.1|5199705_5200128_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_000935423.1|5200233_5200446_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	97.1	5.6e-36
WP_000209148.1|5200478_5200697_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	91.7	5.2e-29
WP_000224233.1|5200698_5200962_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000208016.1|5200972_5201842_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	79.2	8.5e-123
WP_001278454.1|5201957_5202062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018421.1|5202251_5202464_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_106881506.1|5202631_5202910_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	9.7e-12
WP_001265133.1|5202911_5203961_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_001217436.1|5203973_5204345_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|5204334_5204706_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265267.1|5204857_5205676_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917737.1|5205962_5206160_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000261909.1|5206297_5207011_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874348.1|5207778_5209629_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000411814.1|5210077_5210284_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_000138558.1|5210539_5210812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003111.1|5210971_5211505_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.9	1.4e-99
WP_000675931.1|5211725_5211839_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|5212060_5212246_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|5212773_5213088_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|5213169_5213394_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_000453587.1|5213790_5214336_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027379.1|5214310_5216236_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198153.1|5216232_5216439_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001443752.1|5216435_5218037_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_000123292.1|5218017_5219337_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	1.5e-232
WP_001365129.1|5219346_5219679_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000063258.1|5219734_5220760_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_022581670.1|5220801_5221197_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.2	5.3e-56
WP_000752994.1|5221208_5221562_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000683137.1|5222147_5222543_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000235067.1|5222550_5223303_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479051.1|5223316_5223739_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533442.1|5223765_5224179_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_106875094.1|5224159_5226772_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.1	0.0e+00
WP_000847298.1|5226768_5227098_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001443841.1|5227097_5227796_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	97.4	4.4e-130
WP_000194707.1|5227806_5228550_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	99.2	1.2e-149
WP_123010699.1|5228495_5229128_+|tail	tail assembly protein	tail	A0A0N7KZG2	Stx2-converting_phage	95.7	1.6e-94
WP_106881508.1|5229373_5232850_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	97.2	0.0e+00
WP_032271866.1|5232918_5233542_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.9	8.7e-69
WP_106881528.1|5233606_5234920_+|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	97.9	8.5e-74
5234594:5234619	attL	CCGGCAGGCCCACAGGGACCGAAAGG	NA	NA	NA	NA
WP_001023445.1|5234921_5235191_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
WP_012817749.1|5235315_5236068_-	type III effector	NA	NA	NA	NA	NA
WP_001299351.1|5236871_5237891_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|5237868_5238111_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_106881510.1|5238178_5240629_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
WP_000199475.1|5240723_5240912_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_032240573.1|5240908_5241097_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001331716.1|5241497_5241662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171921.1|5241665_5241884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024182289.1|5241976_5242177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000692026.1|5242590_5242893_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	43.3	3.7e-17
WP_001022415.1|5242895_5243255_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	93.3	3.6e-59
WP_000578360.1|5243301_5243694_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	39.6	1.7e-14
WP_001172789.1|5243820_5244081_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	64.8	4.8e-21
WP_000693932.1|5244077_5244515_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	55.0	1.6e-29
WP_000729535.1|5244601_5245612_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	88.8	4.9e-170
WP_072096947.1|5245523_5246066_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.5	1.8e-78
WP_000450641.1|5246099_5246825_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.4	1.2e-77
WP_001040234.1|5246840_5247233_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	62.6	1.0e-38
WP_001266133.1|5247229_5247526_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	5.8e-47
WP_001209480.1|5247522_5247984_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403783.1|5247961_5248318_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
WP_000935422.1|5248368_5248581_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	100.0	6.6e-37
WP_001224662.1|5248614_5248797_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_001289353.1|5248962_5249598_+	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	100.0	1.3e-115
WP_000209152.1|5249685_5249904_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	100.0	6.6e-32
WP_001229296.1|5249905_5250271_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	100.0	5.1e-69
WP_000206830.1|5250267_5250612_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	1.7e-58
WP_000220601.1|5250816_5251116_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	100.0	1.8e-51
WP_001260977.1|5251121_5251379_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_001342259.1|5251514_5251787_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	5.2e-10
WP_106881512.1|5251788_5252835_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	9.3e-108
WP_000904103.1|5252847_5253207_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	1.8e-34
WP_000640048.1|5253215_5253746_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917770.1|5253987_5254185_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301785.1|5254319_5255033_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000466957.1|5255482_5255914_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000088311.1|5258117_5258420_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000336726.1|5258455_5259274_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_122368378.1|5259327_5259597_+	hypothetical protein	NA	A0A0P0ZBP4	Stx2-converting_phage	98.9	2.1e-43
WP_000143463.1|5259732_5259912_+	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
WP_001290230.1|5259952_5260198_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|5260275_5260491_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_000087714.1|5260495_5261029_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
WP_001056883.1|5261303_5261873_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	99.5	1.5e-104
WP_000455402.1|5261872_5262022_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	98.0	9.1e-17
WP_001208680.1|5262249_5262435_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|5262962_5263277_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_044722025.1|5263358_5263583_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	3.8e-19
WP_000829192.1|5263624_5263990_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000958380.1|5264277_5264841_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_032323913.1|5264837_5266499_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.5	0.0e+00
WP_032325204.1|5266562_5268500_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.5	0.0e+00
WP_001063025.1|5268544_5268766_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125988.1|5271291_5271618_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|5271627_5271978_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|5271974_5272421_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|5272417_5272762_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_106881370.1|5272827_5273544_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.3	3.1e-126
WP_001030063.1|5273549_5273924_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001513217.1|5274019_5274229_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_032325323.1|5274276_5277519_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.8	0.0e+00
WP_000807927.1|5277511_5277853_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	98.2	4.3e-62
WP_044703882.1|5277852_5278551_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	98.7	4.7e-132
WP_162782328.1|5279244_5279877_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	9.3e-103
WP_106881514.1|5280112_5283589_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	97.3	0.0e+00
WP_001230429.1|5283655_5284255_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.3e-111
WP_000279017.1|5284319_5285633_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	7.4e-78
5285199:5285224	attR	CCGGCAGGCCCACAGGGACCGAAAGG	NA	NA	NA	NA
WP_001023995.1|5285634_5285904_+|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	7.1e-44
WP_000767050.1|5286125_5286668_+	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
WP_106420821.1|5286612_5286807_+	hypothetical protein	NA	A0A2R2Z347	Escherichia_phage	84.6	4.1e-09
WP_001131653.1|5286797_5287379_+	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	64.2	5.1e-63
>prophage 326
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	5290416	5296881	5584939		Bacillus_phage(33.33%)	6	NA	NA
WP_001120112.1|5290416_5291109_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230242.1|5291248_5292421_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001062101.1|5292420_5294967_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	1.0e-70
WP_000209869.1|5294963_5295563_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024561.1|5295655_5295961_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420629.1|5295960_5296881_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
>prophage 327
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	5301187	5303287	5584939		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|5301187_5301361_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001240628.1|5301443_5302772_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	1.0e-231
WP_001028095.1|5302792_5303287_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
>prophage 328
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	5318187	5355123	5584939	transposase,integrase	Stx2-converting_phage(41.67%)	34	5313238:5313252	5323614:5323628
5313238:5313252	attL	TTCTGGCGGCGGTAA	NA	NA	NA	NA
WP_001307105.1|5318187_5319111_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	9.2e-91
WP_001297190.1|5319922_5320378_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000279869.1|5321002_5322205_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
WP_106881519.1|5322391_5323465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000088311.1|5323480_5323783_+|transposase	transposase	transposase	NA	NA	NA	NA
5323614:5323628	attR	TTACCGCCGCCAGAA	NA	NA	NA	NA
WP_000336726.1|5323818_5324637_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_106881520.1|5324633_5325476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303889.1|5326587_5326884_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000579535.1|5327110_5327308_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000335695.1|5327526_5328960_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000282084.1|5329780_5330344_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000233452.1|5330498_5332859_+	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_000998025.1|5333615_5335148_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	7.1e-298
WP_000612591.1|5335197_5335545_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|5335541_5335922_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_032210650.1|5336412_5337267_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	7.0e-69
WP_028913479.1|5337313_5337919_+	conjugal transfer protein TraT	NA	NA	NA	NA	NA
WP_001303891.1|5337966_5338218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304211.1|5338241_5338532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000024297.1|5339216_5339576_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000591994.1|5339668_5341288_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000886249.1|5342167_5342947_+	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000424145.1|5342956_5343259_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_000612148.1|5343267_5343588_+	urease subunit beta	NA	NA	NA	NA	NA
WP_000467898.1|5343613_5345284_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_000966485.1|5345293_5345758_+	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_001142971.1|5345758_5346433_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_001021388.1|5346444_5347062_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_000803992.1|5348271_5348535_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001135715.1|5348836_5348977_+	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_000397130.1|5349847_5350519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000435663.1|5352706_5353132_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_000624701.1|5353128_5353479_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000088522.1|5353509_5355123_+|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
>prophage 329
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	5361488	5371982	5584939		Acinetobacter_phage(33.33%)	9	NA	NA
WP_001280118.1|5361488_5362631_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_000254140.1|5364020_5364602_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001054789.1|5364601_5365759_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007449.1|5365781_5366237_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|5366259_5367300_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|5367348_5367927_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301248.1|5367995_5368571_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_001053349.1|5368991_5369378_+	protein TerF	NA	NA	NA	NA	NA
WP_001223350.1|5369891_5371982_-	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
>prophage 330
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	5388012	5393157	5584939	transposase	Flavobacterium_phage(25.0%)	7	NA	NA
WP_071830510.1|5388012_5388315_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A218M763	Flavobacterium_phage	50.0	1.5e-10
WP_071830509.1|5388371_5389244_+	DUF3440 domain-containing protein	NA	A0A068F1U8	Mycobacterium_phage	33.3	3.9e-43
WP_000502849.1|5389228_5389867_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.5	1.5e-55
WP_000226520.1|5389945_5390215_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001333354.1|5390235_5390880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000088311.1|5392000_5392303_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000336726.1|5392338_5393157_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
>prophage 331
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	5404065	5404491	5584939		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000422760.1|5404065_5404491_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	89.7	1.5e-43
>prophage 332
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	5414197	5416368	5584939		Yersinia_phage(33.33%)	4	NA	NA
WP_001234682.1|5414197_5415016_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.4	1.0e-45
WP_000214398.1|5415106_5415592_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	2.6e-12
WP_001186738.1|5415607_5416084_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|5416146_5416368_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 333
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	5422385	5423219	5584939		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|5422385_5423219_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 334
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	5427352	5427886	5584939		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857399.1|5427352_5427886_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	7.8e-26
>prophage 335
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	5437194	5438115	5584939		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|5437194_5438115_-	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 336
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	5442777	5443023	5584939		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|5442777_5443023_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 337
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	5458869	5459811	5584939		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|5458869_5459811_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 338
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	5472168	5473349	5584939		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008538.1|5472168_5472903_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	2.2e-15
WP_000103754.1|5473112_5473349_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 339
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	5476621	5478264	5584939		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257000.1|5476621_5477263_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267931.1|5477259_5478264_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 340
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	5490587	5490845	5584939		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|5490587_5490845_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 341
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	5498134	5501857	5584939		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033694.1|5498134_5498836_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
WP_001251348.1|5498835_5500080_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291270.1|5500108_5501020_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952736.1|5501035_5501857_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
>prophage 342
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	5505303	5555825	5584939	holin,tail,transposase,integrase,head,terminase,capsid	Stx2-converting_phage(34.62%)	61	5500397:5500411	5506878:5506892
5500397:5500411	attL	GATCGCGATGTACGC	NA	NA	NA	NA
WP_000074983.1|5505303_5506422_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
WP_000003742.1|5506390_5506660_-	excisionase	NA	NA	NA	NA	NA
WP_044165005.1|5506721_5509193_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	59.3	1.0e-59
5506878:5506892	attR	GCGTACATCGCGATC	NA	NA	NA	NA
WP_000199473.1|5509288_5509477_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|5509473_5509662_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_122993340.1|5510062_5510209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394528.1|5510194_5510569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171923.1|5510591_5510810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001448352.1|5510969_5511125_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	1.2e-06
WP_000103687.1|5511397_5512114_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
WP_000471549.1|5512163_5512379_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693943.1|5512375_5512801_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095675.1|5512823_5513786_+	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_001151209.1|5513826_5514249_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	1.3e-63
WP_000004322.1|5514245_5514500_+	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	94.0	4.8e-42
WP_001002672.1|5514492_5514804_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	97.1	1.1e-59
WP_001204666.1|5515109_5515688_+	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	100.0	2.6e-104
WP_000156210.1|5515647_5516745_-	hypothetical protein	NA	A0A0U2S621	Escherichia_phage	99.5	1.4e-210
WP_000882662.1|5517245_5517458_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_012817871.1|5517625_5517898_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	9.4e-12
WP_032323995.1|5517899_5518838_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	44.5	6.7e-73
WP_000140024.1|5518838_5519204_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	1.6e-38
WP_000640017.1|5519212_5519755_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.9	1.9e-72
WP_000917767.1|5519986_5520184_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000611215.1|5520334_5521384_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	91.7	3.4e-190
WP_001340026.1|5522182_5522314_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	96.4	7.0e-05
WP_032324172.1|5522594_5522930_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	75.2	1.5e-43
WP_106881522.1|5523189_5525043_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	97.6	0.0e+00
WP_032272343.1|5525192_5525408_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.6	4.5e-33
WP_021569237.1|5525412_5525757_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	4.2e-57
WP_062854056.1|5525807_5526341_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.0	1.4e-99
WP_032140280.1|5526895_5526982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|5527204_5527390_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000828072.1|5527790_5528117_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	3.4e-56
WP_000095732.1|5528248_5528449_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	95.5	3.7e-29
WP_000279801.1|5528490_5528856_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	2.3e-61
WP_000958380.1|5529146_5529710_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_032323913.1|5529706_5531368_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.5	0.0e+00
WP_032325204.1|5531431_5533369_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.5	0.0e+00
WP_001063025.1|5533413_5533635_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_032325002.1|5536161_5536488_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	99.1	1.2e-53
WP_001007905.1|5536498_5536849_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|5536845_5537292_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|5537288_5537633_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_106881370.1|5537698_5538415_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.3	3.1e-126
WP_001030063.1|5538420_5538795_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001513217.1|5538890_5539100_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_032325323.1|5539147_5542390_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.8	0.0e+00
WP_000807927.1|5542382_5542724_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	98.2	4.3e-62
WP_044703882.1|5542723_5543422_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	98.7	4.7e-132
WP_001429308.1|5543427_5544171_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
WP_162782328.1|5544116_5544749_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	9.3e-103
WP_106881524.1|5544984_5548458_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.8	0.0e+00
WP_001230429.1|5548524_5549124_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.3e-111
WP_106881526.1|5549188_5550502_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.9	4.8e-77
WP_001339397.1|5550557_5551235_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|5551234_5551582_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|5551601_5553173_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001023483.1|5553210_5553480_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	1.2e-43
WP_000938124.1|5553934_5555296_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	40.2	1.5e-49
WP_095585410.1|5555672_5555825_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.4	4.3e-14
>prophage 343
NZ_CP027555	Escherichia coli strain 2013C-3513 chromosome, complete genome	5584939	5574966	5584651	5584939	integrase	Enterobacteria_phage(33.33%)	16	5569987:5570000	5580877:5580890
5569987:5570000	attL	TGTTACTGGTCGAT	NA	NA	NA	NA
WP_000066490.1|5574966_5575179_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|5575189_5575378_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001316982.1|5575352_5575583_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|5575572_5575746_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818472.1|5575793_5576867_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001444338.1|5576938_5579683_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_000533665.1|5579777_5580851_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9G075	Enterobacteria_phage	98.9	2.0e-198
WP_001303849.1|5580828_5581047_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
5580877:5580890	attR	TGTTACTGGTCGAT	NA	NA	NA	NA
WP_001281197.1|5581164_5581509_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	99.1	2.0e-59
WP_000545713.1|5581537_5581705_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	1.2e-25
WP_001368678.1|5581740_5582040_-	hypothetical protein	NA	Q9G076	Enterobacteria_phage	100.0	2.4e-53
WP_000376716.1|5582197_5582476_-	DUF4752 family protein	NA	K7P6P7	Enterobacteria_phage	98.9	5.4e-47
WP_000208003.1|5582475_5583258_-	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	67.8	1.1e-47
WP_000582235.1|5583268_5584024_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	92.4	7.1e-142
WP_001289864.1|5584025_5584433_-	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	97.8	2.8e-68
WP_000763378.1|5584429_5584651_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	97.3	8.4e-35
>prophage 1
NZ_CP027556	Escherichia coli strain 2013C-3513 plasmid unnamed2	91046	2277	87402	91046	protease,transposase,integrase	Stx2-converting_phage(40.0%)	66	NA	NA
WP_000038351.1|2277_3168_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.8	4.4e-66
WP_001247865.1|3232_3499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218854.1|3591_4026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000284691.1|4022_4238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000117628.1|4753_5254_-	antirestriction protein ArdA	NA	NA	NA	NA	NA
WP_032313270.1|5715_6033_-	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	55.8	4.5e-05
WP_001276261.1|6309_7029_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001341455.1|7025_7508_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_000274418.1|7552_7987_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001443814.1|7998_8217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032324142.1|8216_8900_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	2.1e-28
WP_012680995.1|8975_9287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001431782.1|9283_9721_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000921957.1|10459_11419_+	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	40.9	5.4e-62
WP_000445934.1|11418_11814_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_000336726.1|12518_13337_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_000088311.1|13372_13675_-|transposase	transposase	transposase	Q716C1	Shigella_phage	31.3	1.1e-05
WP_001172748.1|14041_14431_-	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_000592771.1|14474_16685_-	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_086163899.1|16793_16892_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	2.5e-07
WP_106881565.1|16857_18071_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	98.6	3.5e-167
WP_000361610.1|18876_19854_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_001341442.1|20016_20244_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	6.2e-33
WP_001341423.1|20297_20972_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|20968_21316_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_106881567.1|21319_22888_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	55.8	1.1e-157
WP_000091308.1|23711_24077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937603.1|24076_25264_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000422675.1|29250_29727_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	90.7	3.0e-45
WP_001443774.1|32853_33084_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000907857.1|43657_44689_-	replication initiation protein	NA	NA	NA	NA	NA
WP_000335839.1|45397_46039_+	transcription termination factor NusG	NA	NA	NA	NA	NA
WP_000154135.1|46179_46845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106881567.1|47504_49073_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	55.8	1.1e-157
WP_000631725.1|49076_49424_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|49420_50095_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001066949.1|50148_50535_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000704534.1|50662_51523_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.3e-09
WP_157776129.1|52011_52287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000336726.1|52327_53146_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_000088311.1|53181_53484_-|transposase	transposase	transposase	Q716C1	Shigella_phage	31.3	1.1e-05
WP_001165114.1|53551_54097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044768.1|54258_54675_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261287.1|54671_54902_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_106881569.1|55461_55848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001164205.1|55849_56632_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
WP_000864810.1|56804_57158_+	colicin M immunity protein	NA	NA	NA	NA	NA
WP_001213545.1|57570_59010_-	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_000987096.1|59013_61134_-	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	1.6e-45
WP_000217745.1|61183_64180_-	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000839950.1|64181_64697_-	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
WP_000975743.1|68163_69270_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|69363_71085_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_012680945.1|71158_72157_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_012917688.1|72460_73999_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.8	1.9e-295
WP_000612591.1|74048_74396_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000091308.1|74632_74998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937603.1|74997_76185_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_106881567.1|76463_78032_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	55.8	1.1e-157
WP_000631725.1|78035_78383_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|78379_79054_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_136139077.1|78984_79404_+	DUF1449 family protein	NA	NA	NA	NA	NA
WP_001034100.1|80341_84244_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_136138333.1|85047_85461_-	DUF1449 family protein	NA	NA	NA	NA	NA
WP_085953672.1|85459_86672_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.3	7.1e-168
WP_000088311.1|87099_87402_-|transposase	transposase	transposase	Q716C1	Shigella_phage	31.3	1.1e-05
