The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	0	10421	4997979	holin	Vibrio_phage(50.0%)	4	NA	NA
WP_000089077.1|1629_3102_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001295527.1|3115_3703_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|3831_5865_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001378729.1|6437_10421_+	autotransporter adhesin EhaA	NA	A0A2L1IV18	Escherichia_phage	38.0	9.3e-124
>prophage 2
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	22414	26952	4997979		Bacillus_virus(50.0%)	4	NA	NA
WP_000447335.1|22414_23899_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	8.0e-12
WP_000818900.1|23891_24863_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000750340.1|24859_25816_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000692742.1|25902_26952_+	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.3	1.1e-71
>prophage 3
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	35332	40927	4997979		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000010276.1|35332_37219_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	9.1e-53
WP_000076236.1|37455_38715_+	cytosine permease	NA	NA	NA	NA	NA
WP_001299008.1|38704_39988_+	cytosine deaminase	NA	NA	NA	NA	NA
WP_000952482.1|40027_40927_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	3.2e-16
>prophage 4
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	45468	49748	4997979		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_000177903.1|45468_48543_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	98.8	0.0e+00
WP_000805902.1|48665_49748_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
>prophage 5
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	55158	57119	4997979		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000044314.1|55158_56109_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_001013499.1|56105_57119_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
>prophage 6
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	60197	61307	4997979		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|60197_61307_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 7
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	66603	67371	4997979		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939395.1|66603_67371_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.9	3.8e-26
>prophage 8
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	74316	75474	4997979		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830741.1|74316_75474_-	OXA-12 family class D beta-lactamase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 9
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	82889	84005	4997979		Bacillus_phage(100.0%)	1	NA	NA
WP_000484055.1|82889_84005_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.5e-18
>prophage 10
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	88348	98320	4997979		Bacillus_phage(60.0%)	7	NA	NA
WP_001298537.1|88348_89260_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001219319.1|89384_90293_+	fructokinase	NA	NA	NA	NA	NA
WP_001306939.1|90435_91620_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_000698839.1|91745_94889_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001221319.1|94885_96088_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000113933.1|96277_96967_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893578.1|97024_98320_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
>prophage 11
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	105272	114253	4997979	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|105272_106400_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|106422_106755_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|106782_108630_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|108640_109612_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|109740_110088_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|110264_111149_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001297136.1|111447_111987_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|112137_112587_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150470.1|112590_113694_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	6.9e-53
WP_001021161.1|113782_114253_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 12
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	138084	143131	4997979	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|138084_138708_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|138833_140108_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|140295_142650_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|142858_143131_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 13
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	146271	146967	4997979		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817227.1|146271_146967_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 14
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	150290	153837	4997979		Bacillus_phage(100.0%)	2	NA	NA
WP_001235609.1|150290_152063_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.6e-49
WP_001256174.1|152055_153837_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.4e-42
>prophage 15
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	162672	165822	4997979		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|162672_165822_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 16
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	172830	181392	4997979		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|172830_173382_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122008.1|173510_175442_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|175494_175824_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|175823_176429_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678208.1|176538_178413_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001220233.1|178593_179238_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250088.1|179473_180436_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801832.1|180432_181392_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	1.1e-14
>prophage 17
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	189586	192546	4997979		Escherichia_phage(50.0%)	2	NA	NA
WP_001344274.1|189586_189928_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	1.8e-39
WP_000078268.1|190041_192546_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.2	3.8e-115
>prophage 18
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	197085	197763	4997979		Bacillus_virus(100.0%)	1	NA	NA
WP_001157535.1|197085_197763_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 19
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	200899	208716	4997979		Planktothrix_phage(50.0%)	3	NA	NA
WP_001110573.1|200899_201586_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561869.1|201582_203997_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_096735628.1|204426_208716_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	41.5	2.1e-20
>prophage 20
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	215093	216875	4997979		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001096878.1|215093_216875_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.1	2.1e-38
>prophage 21
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	223066	224212	4997979		Streptococcus_phage(100.0%)	1	NA	NA
WP_000706355.1|223066_224212_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
>prophage 22
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	235689	302826	4997979	capsid,head,tail,portal,integrase,tRNA,transposase,terminase,lysis,protease	Enterobacteria_phage(42.59%)	74	245851:245897	291660:291706
WP_000912345.1|235689_237075_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|237110_237632_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|237739_237952_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|237953_238820_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_001369891.1|239300_239843_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988366.1|240062_240755_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001369975.1|240785_243395_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691049.1|243407_244415_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001250425.1|244425_244941_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|244943_245576_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
245851:245897	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001369915.1|245910_247074_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
WP_012599996.1|246929_247385_-	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	83.3	3.4e-62
WP_000206813.1|247300_247606_-	hypothetical protein	NA	U5P0J0	Shigella_phage	95.0	1.4e-48
WP_001242707.1|247605_247968_-	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
WP_000008170.1|247958_248495_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	97.8	9.0e-99
WP_000081287.1|248622_249447_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135682.1|249512_249875_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000559922.1|250345_250861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450738.1|251088_251715_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	2.5e-47
WP_000205494.1|251812_252013_+	cell division protein	NA	NA	NA	NA	NA
WP_000515870.1|252050_252602_+	hypothetical protein	NA	U5P4K1	Shigella_phage	98.9	1.7e-100
WP_001250269.1|252777_252957_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001369913.1|252946_253888_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.0	4.9e-140
WP_001573323.1|253884_254379_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	6.2e-86
WP_000210176.1|254378_254705_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	2.3e-52
WP_000767127.1|254701_255091_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_001061408.1|255110_255908_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	7.5e-150
WP_001358249.1|255915_256905_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.0	2.4e-190
WP_001204780.1|256922_257306_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000737283.1|257495_258593_-	porin	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_000670959.1|259181_259397_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	3.4e-33
WP_001135281.1|259396_259894_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|260110_260293_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|260383_260677_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|260967_261378_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|261663_261870_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|262034_262229_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453587.1|262617_263163_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027283.1|263137_265063_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|265059_265266_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001369921.1|265262_266864_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.9e-309
WP_000123273.1|266844_268164_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	2.6e-232
WP_001369910.1|268173_268506_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.1e-54
WP_000063218.1|268561_269587_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.4e-188
WP_000158868.1|269628_270024_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000753019.1|270035_270389_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000975051.1|270400_270979_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	3.5e-80
WP_000683105.1|270975_271371_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001345558.1|271378_272119_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	2.0e-128
WP_000479154.1|272134_272557_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	9.7e-72
WP_000459458.1|272538_272973_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_000840258.1|272965_275527_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.6	0.0e+00
WP_000847379.1|275523_275853_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152639.1|275852_276551_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000194780.1|276556_277300_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_071532093.1|277236_277869_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	1.4e-95
WP_000515725.1|277929_281343_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.2	0.0e+00
WP_001233071.1|281413_282013_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
WP_000279163.1|282077_285038_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	53.7	4.0e-55
WP_000885616.1|285037_285613_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000836768.1|286616_286850_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|286918_287032_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000239874.1|287397_288066_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937502.1|288122_288428_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226378.1|288611_290096_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|290282_291236_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177464.1|291749_292511_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
291660:291706	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224569.1|292693_293584_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_000662376.1|293584_296557_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383954.1|296543_298781_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000394594.1|299049_300186_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000333354.1|300649_300883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000092528.1|301187_301553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001369932.1|301554_302826_-	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	38.9	2.2e-18
>prophage 23
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	306857	311617	4997979		Ralstonia_phage(33.33%)	3	NA	NA
WP_000103149.1|306857_308759_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	1.7e-27
WP_000253805.1|309495_310944_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	3.9e-11
WP_000770941.1|310933_311617_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	34.7	2.3e-30
>prophage 24
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	314762	317906	4997979		Leptospira_phage(100.0%)	1	NA	NA
WP_000573940.1|314762_317906_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	2.2e-59
>prophage 25
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	329335	335378	4997979		Tupanvirus(50.0%)	3	NA	NA
WP_000077727.1|329335_333217_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.4	3.8e-61
WP_000096703.1|333432_334566_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140647.1|334562_335378_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 26
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	349924	351747	4997979		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502941.1|349924_350554_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
WP_000029802.1|350526_351747_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.0	1.2e-58
>prophage 27
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	354814	356929	4997979		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|354814_356380_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_000278505.1|356500_356929_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
>prophage 28
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	372341	372989	4997979		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|372341_372551_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939738.1|372605_372989_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 29
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	377804	380244	4997979		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|377804_379016_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231415.1|379155_380244_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 30
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	387254	389837	4997979	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001157890.1|387254_389837_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 31
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	396775	400308	4997979		Bathycoccus_sp._RCC1105_virus(50.0%)	3	NA	NA
WP_000367891.1|396775_398446_-	molecular chaperone HscC	NA	E5EQT9	Bathycoccus_sp._RCC1105_virus	35.7	1.8e-76
WP_001207519.1|398529_399465_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|399582_400308_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 32
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	408204	409284	4997979		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|408204_409284_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 33
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	413380	415045	4997979		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337088.1|413380_415045_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.1	1.4e-84
>prophage 34
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	419671	423485	4997979	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001023134.1|419671_421618_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
WP_001287154.1|421820_423485_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
>prophage 35
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	427634	428399	4997979		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773301.1|427634_428399_-	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	35.4	4.4e-06
>prophage 36
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	435054	435732	4997979		Bacillus_phage(100.0%)	1	NA	NA
WP_000186103.1|435054_435732_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	8.9e-27
>prophage 37
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	438985	447774	4997979		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000087967.1|438985_441034_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.8	4.2e-27
WP_000741137.1|441056_442730_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001272653.1|442729_442819_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424924.1|443131_443338_+	YbfA family protein	NA	NA	NA	NA	NA
WP_106901602.1|443580_447774_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	2.5e-26
>prophage 38
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	452237	455179	4997979		Hokovirus(50.0%)	2	NA	NA
WP_000207157.1|452237_453656_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.0	3.1e-61
WP_001032694.1|453697_455179_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
>prophage 39
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	458557	459349	4997979		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114025.1|458557_459349_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	28.8	3.7e-08
>prophage 40
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	495389	498909	4997979		Vibrio_phage(33.33%)	4	NA	NA
WP_000345410.1|495389_496109_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
WP_000951292.1|496105_497047_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000784351.1|497160_497541_-	periplasmic protein	NA	NA	NA	NA	NA
WP_001109196.1|497856_498909_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
>prophage 41
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	503265	509839	4997979		Tupanvirus(33.33%)	7	NA	NA
WP_001265438.1|503265_504282_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
WP_000096879.1|504542_506015_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	27.2	2.1e-12
WP_001147439.1|506082_506871_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|506999_507149_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000101990.1|507315_508089_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604034.1|508088_508778_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891683.1|508780_509839_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-20
>prophage 42
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	520102	521392	4997979		Klosneuvirus(100.0%)	1	NA	NA
WP_001367048.1|520102_521392_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
>prophage 43
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	527873	528782	4997979		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|527873_528782_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 44
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	540093	554903	4997979		Anomala_cuprea_entomopoxvirus(14.29%)	13	NA	NA
WP_000996092.1|540093_541830_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000743444.1|541822_542818_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001315358.1|542820_543492_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007102.1|543720_545085_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001145128.1|545316_545799_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
WP_001307069.1|545918_548069_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	5.7e-43
WP_000386546.1|548096_549059_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443512.1|549199_550285_+	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000849301.1|550512_550773_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146369.1|551037_551304_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000990177.1|551377_552055_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000430044.1|552096_554379_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000710619.1|554642_554903_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 45
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	558440	563665	4997979		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569080.1|558440_559163_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159065.1|559159_559819_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|559957_560704_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|561107_561611_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001315365.1|561909_562797_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|563031_563097_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|563149_563665_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 46
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	568662	570255	4997979		Tupanvirus(100.0%)	1	NA	NA
WP_000961458.1|568662_570255_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 47
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	574152	578283	4997979		Citrobacter_phage(50.0%)	3	NA	NA
WP_000209359.1|574152_576585_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001295295.1|576590_577490_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000424889.1|577620_578283_+	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.7	1.6e-25
>prophage 48
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	594806	596009	4997979		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|594806_596009_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 49
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	604575	613726	4997979		Vibrio_phage(25.0%)	11	NA	NA
WP_001195240.1|604575_604833_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|604992_605280_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189159.1|605263_605986_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|606046_606949_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|607036_607513_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126072.1|607864_608977_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996025.1|609071_610205_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.4	5.0e-30
WP_000105430.1|610214_611168_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061657.1|611164_612010_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|612069_612558_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149733.1|612598_613726_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
>prophage 50
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	617063	619801	4997979		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027205.1|617063_617792_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270740.1|618009_618525_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|618650_618974_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255144.1|618970_619801_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
>prophage 51
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	623388	625107	4997979		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815350.1|623388_625107_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
>prophage 52
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	634404	658167	4997979	tRNA,protease	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
WP_064579073.1|634404_636351_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|636423_636648_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|636970_637291_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|637321_639598_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|640282_640501_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|640785_641490_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202178.1|641531_643253_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	3.2e-20
WP_001043587.1|643253_645020_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_000537418.1|645142_646108_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|646652_647147_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077008.1|647281_651349_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|651507_652119_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|652129_653473_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|653563_654856_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850317.1|655094_657539_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.7	1.1e-220
WP_000213098.1|657549_658167_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 53
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	664476	667691	4997979		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|664476_665217_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|665408_667691_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
>prophage 54
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	671789	672878	4997979		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057149.1|671789_672878_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 55
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	677964	682505	4997979		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|677964_678249_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705706.1|678455_680720_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|680756_682505_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
>prophage 56
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	697210	708343	4997979	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_001295932.1|697210_697759_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109487.1|697785_698433_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462687.1|698654_699845_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977920.1|700029_701118_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000117881.1|701719_703120_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001297200.1|703288_704491_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193844.1|704756_707369_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001090514.1|707575_708343_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.7e-29
>prophage 57
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	724265	726173	4997979		Tupanvirus(100.0%)	1	NA	NA
WP_000053120.1|724265_726173_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	3.2e-53
>prophage 58
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	738783	740838	4997979		Bacillus_phage(100.0%)	1	NA	NA
WP_001315388.1|738783_740838_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
>prophage 59
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	745071	745731	4997979	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|745071_745731_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 60
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	764996	777251	4997979		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|764996_765209_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071528578.1|765219_765408_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001315395.1|765382_765613_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|765602_765776_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000829672.1|765823_766897_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_106901603.1|766968_769713_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_001264933.1|769795_770824_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|770796_771489_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230242.1|771618_772791_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001062102.1|772790_775337_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	5.9e-71
WP_000209854.1|775333_775933_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024561.1|776025_776331_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420629.1|776330_777251_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
>prophage 61
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	781242	786008	4997979		Escherichia_phage(66.67%)	3	NA	NA
WP_096843415.1|781242_782886_+	recombinase family protein	NA	A0A142LP20	Marinitoga_camini_virus	24.3	5.0e-07
WP_096843413.1|782882_783671_-	hypothetical protein	NA	A0A0A0RK63	Escherichia_phage	78.4	3.4e-78
WP_096843411.1|783827_786008_-	tape measure protein	NA	A0A0H3UDV5	Escherichia_phage	31.8	1.6e-61
>prophage 62
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	792994	795094	4997979		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|792994_793168_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001240629.1|793250_794579_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.9	5.3e-233
WP_001028087.1|794599_795094_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	2.1e-49
>prophage 63
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	809870	810794	4997979		Cronobacter_phage(100.0%)	1	NA	NA
WP_001307105.1|809870_810794_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	9.2e-91
>prophage 64
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	817613	820175	4997979	transposase	Bacillus_phage(50.0%)	2	NA	NA
WP_000409850.1|817613_818972_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	1.5e-20
WP_085947771.1|819012_820175_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 65
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	825045	825879	4997979		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|825045_825879_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 66
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	830012	830546	4997979		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857414.1|830012_830546_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	1.0e-25
>prophage 67
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	841133	842054	4997979		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|841133_842054_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 68
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	846716	846962	4997979		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|846716_846962_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 69
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	862808	863750	4997979		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|862808_863750_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 70
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	876108	877290	4997979		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|876108_876843_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|877053_877290_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 71
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	880562	882205	4997979		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257000.1|880562_881204_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267931.1|881200_882205_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 72
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	894536	894794	4997979		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|894536_894794_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 73
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	902083	905806	4997979		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033695.1|902083_902785_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
WP_001251389.1|902784_904029_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291270.1|904057_904969_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952736.1|904984_905806_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
>prophage 74
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	909252	1029261	4997979	capsid,head,plate,tail,portal,integrase,tRNA,terminase,protease,holin	Escherichia_phage(26.27%)	156	927848:927869	992812:992833
WP_000074972.1|909252_910371_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.6	1.5e-82
WP_054250470.1|910339_910609_-	excisionase	NA	NA	NA	NA	NA
WP_096560541.1|910670_913142_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	1.7e-54
WP_064579146.1|913237_913426_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|913422_913611_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000559918.1|914139_914655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000380318.1|914768_914921_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_032211256.1|915198_915486_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_064579147.1|915486_915678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064579148.1|915646_916108_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	55.4	1.2e-09
WP_000448216.1|916127_916499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021577226.1|916601_916883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693827.1|916886_917312_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_052909572.1|917380_918412_+	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	69.1	8.4e-85
WP_072130322.1|918323_918866_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_047082289.1|918899_919616_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.1	8.7e-73
WP_000017341.1|919612_919930_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	75.0	1.4e-35
WP_053294093.1|919926_920232_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	92.1	1.7e-49
WP_022581296.1|920379_920562_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	93.3	3.8e-25
WP_001289992.1|920727_921243_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	78.6	1.1e-37
WP_001398985.1|921476_921689_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	67.1	6.4e-16
WP_064579150.1|921855_922128_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	4.2e-12
WP_032284906.1|922129_923179_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	7.7e-110
WP_000904388.1|923191_923566_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	3.8e-35
WP_000762903.1|923562_924384_+	hypothetical protein	NA	K7P7B9	Enterobacteria_phage	59.7	2.9e-80
WP_000917741.1|924610_924808_+	hypothetical protein	NA	A0A0P0ZDH6	Stx2-converting_phage	100.0	8.0e-29
WP_064579151.1|924958_926017_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	99.7	2.1e-208
WP_000649753.1|926399_927359_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738072.1|927370_927640_+	Shiga toxin Stx2a subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
927848:927869	attL	CACCGGGAGGCACCCGGCACCA	NA	NA	NA	NA
WP_106901604.1|928504_930442_+	SASA family carbohydrate esterase	NA	S5MDQ7	Escherichia_phage	94.3	0.0e+00
WP_000143458.1|930580_930760_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|930800_931046_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284490.1|931123_931339_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	98.6	2.0e-33
WP_039264424.1|931342_932134_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	86.7	4.0e-34
WP_001092874.1|932645_933179_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	1.4e-99
WP_062896309.1|933335_933518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071974579.1|933886_934093_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	63.2	4.6e-11
WP_000735655.1|934157_934382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001405844.1|934869_935376_+	DNA-packaging protein	NA	O64316	Escherichia_phage	48.5	1.6e-33
WP_001499025.1|935347_937276_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	3.7e-259
WP_000259002.1|937259_937466_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_096549216.1|937462_939055_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.5	4.5e-186
WP_001253971.1|939044_940550_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	52.6	4.6e-100
WP_096549215.1|940586_940934_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	5.8e-22
WP_064549420.1|940991_942020_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	3.9e-114
WP_047081403.1|942071_942455_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204531.1|942447_942801_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.8e-40
WP_000974993.1|942816_943392_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	2.9e-50
WP_000683075.1|943388_943784_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	80.9	2.2e-57
WP_052903742.1|943791_944541_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	93.2	3.1e-129
WP_001299690.1|944556_944988_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_072032653.1|945014_945428_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	83.8	1.6e-42
WP_096549214.1|945408_947988_+|tail	phage tail tape measure protein	tail	S5MBY3	Escherichia_phage	86.0	0.0e+00
WP_000847280.1|947984_948314_+|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_106901605.1|948313_949012_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	99.1	1.2e-132
WP_106901606.1|949022_949766_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	96.4	1.6e-146
WP_072121435.1|949711_950344_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	90.5	4.3e-100
WP_106901607.1|950583_954270_+	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	88.0	0.0e+00
WP_000078853.1|954468_954609_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_050867622.1|954752_956411_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	53.4	5.9e-72
WP_000438830.1|956420_956633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001373129.1|956644_957319_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	90.1	3.3e-114
WP_022581964.1|957482_957812_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000799399.1|957977_958841_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|958824_959961_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000359432.1|960210_961440_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|961585_962707_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_032317082.1|962955_964185_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.6	3.4e-133
WP_000953271.1|964559_964748_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
WP_000182306.1|964991_965195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000103621.1|965252_965432_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	58.6	1.5e-10
WP_000190551.1|965937_966117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106901614.1|966309_966873_+	host cell division inhibitor Icd-like protein	NA	Q8SBF3	Shigella_phage	45.5	9.1e-17
WP_032279725.1|966859_967060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000728896.1|967065_967365_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833612.1|967361_968759_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.2	1.5e-113
WP_024200918.1|968961_969213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106901608.1|969209_969524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126663.1|969533_969944_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233314.1|969954_970203_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001142405.1|970343_970568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001137342.1|970859_972017_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.1e-137
WP_000504057.1|972056_972629_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	3.6e-61
WP_001398592.1|972666_973842_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	80.2	4.8e-185
WP_001020671.1|973838_974177_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	51.8	1.5e-30
WP_000134113.1|974173_974470_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001145905.1|974469_974910_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000089568.1|975199_975556_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	80.5	2.1e-51
WP_000127881.1|975539_977201_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.4	2.0e-277
WP_053921265.1|977214_977496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735412.1|978161_979622_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|979621_980293_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|980460_981831_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|981834_982476_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|982511_983618_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476089.1|983671_984133_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_064579186.1|984125_984803_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|984974_986225_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000885267.1|986631_988959_-	ATPase AAA	NA	NA	NA	NA	NA
WP_064579187.1|989277_990405_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	60.5	1.6e-121
WP_001527050.1|990385_990631_-	phage excisionase	NA	NA	NA	NA	NA
WP_000008212.1|990685_991222_-	HD family hydrolase	NA	U5P0T3	Shigella_phage	94.3	3.9e-94
WP_000081287.1|991350_992175_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135682.1|992240_992603_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_001514782.1|993203_993479_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	97.8	7.0e-47
992812:992833	attR	TGGTGCCGGGTGCCTCCCGGTG	NA	NA	NA	NA
WP_001369946.1|993487_993691_-	ClpX C4-type zinc finger	NA	A0A1C9IHZ4	Salmonella_phage	68.3	8.9e-15
WP_001369890.1|993967_994660_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	99.6	2.3e-126
WP_001191674.1|994757_995018_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001250269.1|995736_995916_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104988.1|995905_996847_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.4	8.6e-153
WP_074400771.1|996843_997338_+	PerC family transcriptional regulator	NA	S5MW49	Escherichia_phage	96.9	6.2e-86
WP_001369966.1|997337_997991_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.5e-127
WP_000210187.1|997987_998314_+	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	100.0	1.6e-53
WP_000767113.1|998310_998700_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061425.1|998719_999562_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	91.5	6.3e-139
WP_001205449.1|1000575_1000923_+	antitermination protein Q	NA	A0A0P0ZCW0	Stx2-converting_phage	85.0	8.0e-56
WP_001198055.1|1000936_1002028_-	MBL fold metallo-hydrolase	NA	Q332C0	Clostridium_botulinum_C_phage	35.4	5.3e-05
WP_001024069.1|1002051_1002624_-	hypothetical protein	NA	A0A1L2CVC4	Pectobacterium_phage	40.4	2.3e-07
WP_000143147.1|1002620_1003337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120498.1|1003712_1004039_+|holin	phage holin, lambda family	holin	S5FM86	Shigella_phage	98.1	3.4e-56
WP_001148537.1|1004042_1004519_+	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	98.7	8.3e-88
WP_001369893.1|1004502_1004895_+	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	89.2	6.5e-54
WP_001140095.1|1005347_1005698_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	6.8e-63
WP_000929173.1|1005824_1006319_+|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	100.0	1.3e-88
WP_072011717.1|1006552_1008049_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000605606.1|1008060_1008243_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000466253.1|1008242_1009484_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	2.6e-242
WP_001398562.1|1009461_1010112_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	7.3e-119
WP_000257511.1|1010126_1011332_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.5	1.2e-223
WP_000601360.1|1011381_1011582_+	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000927719.1|1011584_1011908_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000702388.1|1011904_1012315_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.8	5.9e-74
WP_000213502.1|1012289_1012796_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	100.0	1.7e-91
WP_000779292.1|1012792_1013353_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
WP_000497751.1|1013361_1013532_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000155716.1|1013515_1015012_+|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	99.2	1.2e-273
WP_000090998.1|1015011_1015368_+	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000811154.1|1015367_1015637_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	7.8e-43
WP_000807196.1|1015778_1017614_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.3	1.5e-307
WP_000219910.1|1017674_1019003_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_000999507.1|1018999_1020079_+	hypothetical protein	NA	U5P0H6	Shigella_phage	99.4	4.5e-206
WP_001259081.1|1020078_1020627_+|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	99.5	1.5e-96
WP_000424732.1|1020626_1021052_+	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_000785311.1|1021038_1022097_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.6	8.1e-200
WP_000383545.1|1022087_1022672_+	YmfQ family protein	NA	O22003	Shigella_phage	99.5	2.4e-113
WP_000554690.1|1022675_1023458_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	97.6	5.4e-92
WP_001057699.1|1023457_1024060_+|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	88.4	8.9e-95
WP_000416463.1|1024031_1024463_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	74.6	4.3e-43
WP_032193144.1|1024465_1024861_-	hypothetical protein	NA	F1BUP1	Erwinia_phage	37.8	6.0e-15
WP_000905000.1|1024890_1025445_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.9	4.4e-88
WP_000557907.1|1025551_1026385_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_000943926.1|1026618_1026783_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-24
WP_001307134.1|1026885_1027209_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_032141808.1|1027741_1027852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|1027904_1028309_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332302.1|1028529_1029261_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
>prophage 75
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1035128	1037450	4997979		Escherichia_phage(100.0%)	1	NA	NA
WP_001307136.1|1035128_1037450_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	42.8	1.5e-89
>prophage 76
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1045985	1047673	4997979		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|1045985_1046405_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457616.1|1046404_1047673_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
>prophage 77
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1074433	1077185	4997979		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033352.1|1074433_1076113_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|1076237_1077185_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 78
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1080321	1084329	4997979		Pseudomonas_phage(50.0%)	5	NA	NA
WP_000804726.1|1080321_1081404_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456467.1|1081403_1082237_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200392.1|1082233_1082626_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|1082629_1083439_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|1083474_1084329_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
>prophage 79
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1087965	1088196	4997979		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146442.1|1087965_1088196_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	6.5e-06
>prophage 80
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1099327	1109337	4997979		Escherichia_phage(25.0%)	10	NA	NA
WP_000702660.1|1099327_1100866_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571699.1|1100862_1101573_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|1101572_1102250_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555849.1|1102974_1103817_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001307143.1|1103866_1104325_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|1104437_1105343_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193437.1|1105434_1106448_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|1106649_1107558_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|1107701_1108115_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068079.1|1108719_1109337_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
>prophage 81
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1117746	1119761	4997979		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110945.1|1117746_1118760_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|1118756_1119761_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 82
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1127710	1200159	4997979	capsid,head,tail,portal,integrase,terminase,lysis,protease,holin	Escherichia_phage(26.42%)	79	1127532:1127559	1183090:1183117
1127532:1127559	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113693.1|1127710_1128841_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	4.0e-104
WP_000113183.1|1128818_1129067_-	excisionase	NA	NA	NA	NA	NA
WP_096560541.1|1129131_1131603_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	1.7e-54
WP_064579146.1|1131698_1131887_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|1131883_1132072_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001365839.1|1132846_1133215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380317.1|1133226_1133379_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001003380.1|1133568_1133976_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	5.5e-24
WP_000476991.1|1134053_1134281_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705131.1|1134264_1134786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054520.1|1134766_1135732_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	5.0e-55
WP_000790460.1|1135738_1136479_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.1	4.7e-114
WP_000450858.1|1136508_1137270_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	64.0	8.4e-74
WP_000215513.1|1137329_1137524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211993.1|1137865_1138417_+	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	53.3	5.5e-43
WP_000882661.1|1138631_1138844_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	5.6e-28
WP_000042395.1|1138946_1139264_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001452497.1|1139852_1140080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024199763.1|1140133_1140403_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	52.5	1.2e-11
WP_106901610.1|1140404_1141454_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.4e-110
WP_000904164.1|1141466_1141829_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.9	2.4e-34
WP_001064918.1|1141821_1142487_+	antiterminator	NA	I6PDF8	Cronobacter_phage	52.0	1.6e-60
WP_000342737.1|1142740_1143454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917733.1|1143627_1143825_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
WP_064579144.1|1143975_1145034_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	4.4e-206
WP_000271631.1|1145514_1145943_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000382067.1|1146639_1147365_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_062878147.1|1149229_1151194_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	78.3	8.0e-294
WP_000142780.1|1151328_1151508_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	93.2	5.4e-24
WP_001290230.1|1151548_1151794_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1151871_1152087_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_024200907.1|1152090_1152759_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	76.7	6.0e-60
WP_001063216.1|1152738_1153059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992036.1|1153184_1153718_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	97.2	7.4e-101
WP_072024677.1|1153874_1154057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024173692.1|1154205_1154673_+|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	87.1	7.9e-67
WP_000877795.1|1154853_1155399_+	hypothetical protein	NA	A0A0P0ZFJ1	Escherichia_phage	68.6	7.4e-64
WP_000828070.1|1155735_1156062_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095744.1|1156193_1156394_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829191.1|1156435_1156801_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	1.0e-61
WP_000958387.1|1157089_1157653_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001398587.1|1157649_1159311_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.6	0.0e+00
WP_000172990.1|1159374_1161312_+|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.7	0.0e+00
WP_001063099.1|1161356_1161578_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_001398586.1|1161523_1164109_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.0	0.0e+00
WP_000125990.1|1164105_1164432_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001029274.1|1164441_1164792_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	6.0e-59
WP_000573358.1|1164788_1165235_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	2.0e-75
WP_000133383.1|1165231_1165576_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	4.2e-57
WP_001275448.1|1165642_1166359_+|tail	major tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.2	2.3e-126
WP_000710952.1|1166373_1166748_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_122993267.1|1166843_1167053_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	1.5e-33
WP_000212883.1|1167100_1170343_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	87.7	0.0e+00
WP_000343412.1|1170335_1170677_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	82.1	2.6e-51
WP_000738904.1|1170875_1172039_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	66.9	1.6e-140
WP_001499019.1|1172249_1172948_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.7	2.1e-132
WP_106901611.1|1172958_1173702_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	93.9	4.6e-141
WP_122993618.1|1173647_1174280_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.0	1.9e-100
WP_106901612.1|1175190_1178886_+	DUF1983 domain-containing protein	NA	Q6H9T2	Enterobacteria_phage	84.2	0.0e+00
WP_001270059.1|1178954_1179578_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	59.9	9.0e-66
WP_064579137.1|1179727_1180915_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	97.3	1.5e-53
WP_001049908.1|1180983_1181655_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	83.0	2.8e-105
WP_001079499.1|1183267_1183774_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
1183090:1183117	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|1183819_1184320_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1184405_1184585_-	general stress protein	NA	NA	NA	NA	NA
WP_000443056.1|1184965_1185772_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209516.1|1185771_1186965_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_024177467.1|1186976_1188335_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
WP_000763511.1|1188338_1189934_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194592.1|1189933_1191496_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1191587_1191632_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|1191769_1192651_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1192647_1193268_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|1193368_1194241_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278906.1|1194280_1194871_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559280.1|1194867_1195626_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
WP_000422045.1|1195845_1196895_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|1196930_1197182_-	YciN family protein	NA	NA	NA	NA	NA
WP_001297122.1|1197561_1200159_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
>prophage 83
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1205083	1205674	4997979		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|1205083_1205674_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 84
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1213489	1219149	4997979		Lactococcus_phage(50.0%)	5	NA	NA
WP_000484984.1|1213489_1215424_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
WP_000437858.1|1215491_1216619_-	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|1216763_1217552_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000968857.1|1217921_1218275_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000573407.1|1218342_1219149_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 85
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1232064	1233330	4997979		Klosneuvirus(100.0%)	1	NA	NA
WP_000069226.1|1232064_1233330_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	3.5e-24
>prophage 86
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1247334	1248417	4997979		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057977.1|1247334_1248417_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 87
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1265035	1265551	4997979		Streptococcus_phage(100.0%)	1	NA	NA
WP_106901613.1|1265035_1265551_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.8e-24
>prophage 88
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1271877	1279147	4997979	tRNA	Bacillus_phage(20.0%)	6	NA	NA
WP_001398556.1|1271877_1273110_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1273364_1274348_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123745.1|1274825_1276199_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000081418.1|1276327_1277263_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_001082294.1|1277438_1277873_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_000837924.1|1278013_1279147_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
>prophage 89
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1284106	1285096	4997979		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|1284106_1285096_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 90
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1316380	1320283	4997979		Klosneuvirus(100.0%)	1	NA	NA
WP_000139615.1|1316380_1320283_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 91
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1324222	1325171	4997979		Escherichia_phage(50.0%)	2	NA	NA
WP_001307188.1|1324222_1324753_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731833.1|1324997_1325171_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 92
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1340097	1347125	4997979		Phage_TP(33.33%)	6	NA	NA
WP_001301045.1|1340097_1342059_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.3	2.7e-23
WP_000494244.1|1342150_1342381_-	YncJ family protein	NA	NA	NA	NA	NA
WP_001270286.1|1342802_1343219_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000760588.1|1343297_1344704_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000047456.1|1344948_1346094_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220412.1|1346111_1347125_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	1.2e-27
>prophage 93
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1354257	1356360	4997979		Salmonella_phage(100.0%)	1	NA	NA
WP_000689355.1|1354257_1356360_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	1.1e-134
>prophage 94
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1373484	1375029	4997979		Escherichia_phage(100.0%)	1	NA	NA
WP_000702560.1|1373484_1375029_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 95
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1381914	1382205	4997979		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001295648.1|1381914_1382205_-	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.7e-25
>prophage 96
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1388217	1389659	4997979		Escherichia_phage(50.0%)	2	NA	NA
WP_000781370.1|1388217_1388502_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000642407.1|1388648_1389659_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
>prophage 97
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1392933	1394839	4997979		Planktothrix_phage(100.0%)	2	NA	NA
WP_001285539.1|1392933_1393860_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	2.4e-14
WP_000193551.1|1393852_1394839_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	2.2e-18
>prophage 98
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1399155	1402962	4997979		Klosneuvirus(50.0%)	2	NA	NA
WP_001307211.1|1399155_1401555_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_000426265.1|1401579_1402962_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 99
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1408236	1415171	4997979		Powai_lake_megavirus(50.0%)	2	NA	NA
WP_001317088.1|1408236_1411032_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	4.4e-19
WP_000628544.1|1413485_1415171_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	24.1	1.0e-10
>prophage 100
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1440582	1442118	4997979		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194881.1|1440582_1442118_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	9.8e-21
>prophage 101
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1449999	1451418	4997979		Bacillus_phage(100.0%)	1	NA	NA
WP_000558044.1|1449999_1451418_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 102
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1459164	1461294	4997979		Streptococcus_phage(50.0%)	3	NA	NA
WP_000091199.1|1459164_1459548_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803525.1|1459579_1459798_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000012620.1|1459854_1461294_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	8.2e-30
>prophage 103
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1468798	1469689	4997979		Bacillus_phage(100.0%)	1	NA	NA
WP_000592814.1|1468798_1469689_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
>prophage 104
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1475055	1490493	4997979		Escherichia_phage(44.44%)	15	NA	NA
WP_000214712.1|1475055_1475259_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527759.1|1475294_1476755_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.1	8.6e-43
WP_000151243.1|1476843_1478211_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000836072.1|1478268_1479288_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	1.6e-16
WP_001295394.1|1479299_1480514_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1480719_1481046_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|1481180_1481522_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1481556_1482117_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1482119_1482830_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|1482937_1483243_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041556.1|1483441_1485868_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
WP_001433342.1|1485928_1488352_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.8e-208
WP_000213028.1|1488362_1488980_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526492.1|1488981_1489836_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|1489878_1490493_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
>prophage 105
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1497332	1514777	4997979	capsid,head,portal,integrase,terminase,protease	uncultured_Caudovirales_phage(92.31%)	27	1503006:1503021	1525957:1525972
WP_001260849.1|1497332_1498154_+|protease	serine protease	protease	NA	NA	NA	NA
WP_000046661.1|1498192_1498522_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_000276149.1|1498508_1498874_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_001303517.1|1498980_1499151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000133415.1|1500237_1500519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087634806.1|1500532_1502194_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.4	1.5e-277
WP_000113645.1|1502177_1502534_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_001145905.1|1502822_1503263_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
1503006:1503021	attL	ATTAATCGGGATAATG	NA	NA	NA	NA
WP_000134113.1|1503262_1503559_-	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001020671.1|1503555_1503894_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	51.8	1.5e-30
WP_001398592.1|1503890_1505066_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	80.2	4.8e-185
WP_000504057.1|1505103_1505676_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	3.6e-61
WP_001137342.1|1505715_1506873_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.1e-137
WP_001142405.1|1507164_1507389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233314.1|1507529_1507778_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126663.1|1507788_1508199_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_106901608.1|1508208_1508523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024200918.1|1508519_1508771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000833612.1|1508973_1510371_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.2	1.5e-113
WP_000728896.1|1510367_1510667_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_032279725.1|1510672_1510873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106901614.1|1510859_1511423_-	host cell division inhibitor Icd-like protein	NA	Q8SBF3	Shigella_phage	45.5	9.1e-17
WP_000201463.1|1511615_1511795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000103621.1|1512300_1512480_+	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	58.6	1.5e-10
WP_000182306.1|1512537_1512741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000953271.1|1512984_1513173_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
WP_106901615.1|1513547_1514777_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	54.7	3.2e-131
1525957:1525972	attR	ATTAATCGGGATAATG	NA	NA	NA	NA
>prophage 106
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1523793	1525095	4997979		Bacillus_phage(100.0%)	1	NA	NA
WP_000732487.1|1523793_1525095_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	7.2e-17
>prophage 107
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1535171	1536983	4997979		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945871.1|1535171_1536983_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.8	0.0e+00
>prophage 108
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1556770	1558045	4997979	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|1556770_1558045_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 109
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1564956	1566455	4997979		Salmonella_phage(50.0%)	2	NA	NA
WP_001296937.1|1564956_1565478_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
WP_000250661.1|1565558_1566455_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	3.6e-07
>prophage 110
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1575258	1584050	4997979		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101193.1|1575258_1576074_+	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|1576201_1576783_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701040.1|1576928_1578098_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|1578263_1578353_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|1578651_1579677_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269501.1|1579673_1580606_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182362.1|1580718_1581930_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098911.1|1582220_1583369_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	4.2e-85
WP_000493947.1|1583408_1584050_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 111
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1589554	1591821	4997979		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587560.1|1589554_1590367_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001069997.1|1590370_1591156_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001310861.1|1591152_1591821_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
>prophage 112
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1600111	1605195	4997979		environmental_halophage(33.33%)	5	NA	NA
WP_000144565.1|1600111_1601332_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
WP_000908012.1|1601328_1602600_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948872.1|1602574_1603321_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	2.2e-10
WP_000089364.1|1603330_1604818_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367160.1|1604826_1605195_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
>prophage 113
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1623787	1643381	4997979	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_000553696.1|1623787_1625488_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	1.6e-32
WP_000069375.1|1625544_1627923_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000368046.1|1628255_1629089_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082204.1|1629245_1630292_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001270809.1|1630423_1630615_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175615.1|1630618_1632055_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001315654.1|1632117_1632831_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209776.1|1633077_1633542_-	endopeptidase	NA	S5MM68	Bacillus_phage	37.7	7.3e-12
WP_000029466.1|1633619_1634369_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154187.1|1634368_1634920_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956519.1|1634982_1635963_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|1636063_1636363_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672370.1|1636367_1638755_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018599.1|1638769_1639753_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|1640036_1640081_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|1640203_1640560_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|1640612_1640810_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|1640906_1641449_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144192.1|1641452_1643381_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
>prophage 114
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1654680	1656942	4997979		Tupanvirus(100.0%)	1	NA	NA
WP_000077844.1|1654680_1656942_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	3.0e-143
>prophage 115
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1663068	1663896	4997979		Bacillus_virus(100.0%)	1	NA	NA
WP_000175053.1|1663068_1663896_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	1.2e-73
>prophage 116
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1671372	1672593	4997979		Klosneuvirus(100.0%)	1	NA	NA
WP_000081983.1|1671372_1672593_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
>prophage 117
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1679357	1680011	4997979		Planktothrix_phage(100.0%)	1	NA	NA
WP_001315662.1|1679357_1680011_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.7	6.4e-14
>prophage 118
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1685609	1687571	4997979		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235800.1|1685609_1687571_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 119
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1692497	1693139	4997979		Tupanvirus(100.0%)	1	NA	NA
WP_001135062.1|1692497_1693139_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.9e-19
>prophage 120
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1696382	1697237	4997979		Indivirus(100.0%)	1	NA	NA
WP_001186343.1|1696382_1697237_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 121
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1700555	1705132	4997979		Bacillus_phage(100.0%)	3	NA	NA
WP_000219686.1|1700555_1701839_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000616433.1|1701985_1703461_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_001295489.1|1703641_1705132_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	1.1e-08
>prophage 122
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1711083	1712292	4997979	transposase	Salmonella_phage(100.0%)	1	NA	NA
WP_071531852.1|1711083_1712292_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	91.3	1.4e-208
>prophage 123
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1721635	1729748	4997979	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_001367067.1|1721635_1723327_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	1.2e-35
WP_000290564.1|1723531_1724113_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_024177468.1|1724152_1724848_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|1724905_1726816_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|1726947_1727292_+	RidA family protein	NA	NA	NA	NA	NA
WP_001300615.1|1727654_1728014_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|1728133_1728313_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000854972.1|1728386_1729748_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
>prophage 124
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1733610	1735167	4997979		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|1733610_1735167_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 125
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1740807	1741017	4997979		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|1740807_1741017_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 126
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1746348	1748397	4997979		Moraxella_phage(100.0%)	1	NA	NA
WP_001326055.1|1746348_1748397_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.3	1.2e-85
>prophage 127
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1755893	1760361	4997979		Escherichia_phage(33.33%)	5	NA	NA
WP_000812724.1|1755893_1756550_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_000976492.1|1756945_1757287_-	YebY family protein	NA	NA	NA	NA	NA
WP_000204699.1|1758174_1758549_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|1758687_1758918_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000944256.1|1759698_1760361_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 128
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1768417	1769893	4997979		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|1768417_1769893_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 129
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1776239	1780954	4997979		Bacillus_virus(66.67%)	7	NA	NA
WP_000202996.1|1776239_1776995_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571465.1|1776991_1777777_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|1777923_1778934_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|1778942_1779554_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|1779692_1779758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024930.1|1779828_1780431_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|1780432_1780954_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 130
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1784847	1786898	4997979		Escherichia_coli_phage(50.0%)	3	NA	NA
WP_000639274.1|1784847_1785666_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252979.1|1785718_1786114_+	membrane protein	NA	NA	NA	NA	NA
WP_000019588.1|1786154_1786898_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 131
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1793514	1795248	4997979	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025326.1|1793514_1795248_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 132
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1800500	1806144	4997979		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000763867.1|1800500_1800890_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036378.1|1800904_1801954_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204335.1|1801956_1802817_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483220.1|1802835_1804437_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	8.3e-15
WP_001297437.1|1804482_1806144_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
>prophage 133
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1816231	1817746	4997979		Staphylococcus_phage(100.0%)	1	NA	NA
WP_096843384.1|1816231_1817746_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 134
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1829738	1830491	4997979		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|1829738_1830491_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 135
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1842303	1842972	4997979		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000334601.1|1842303_1842972_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	7.3e-82
>prophage 136
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1856988	1869369	4997979		Bacillus_phage(28.57%)	12	NA	NA
WP_001350521.1|1856988_1858683_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|1858853_1859036_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922676.1|1859114_1860032_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212248.1|1860204_1861125_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786005.1|1861113_1861584_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.0e-33
WP_001157239.1|1861564_1862983_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_000365566.1|1863049_1863745_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_001313057.1|1863784_1864150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824362.1|1864715_1865789_+	outer membrane protein F	NA	Q1MVN1	Enterobacteria_phage	51.6	6.2e-99
WP_000218214.1|1866381_1867233_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826773.1|1867339_1868698_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	8.7e-05
WP_001339045.1|1868697_1869369_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 137
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1872913	1873444	4997979		Escherichia_phage(100.0%)	1	NA	NA
WP_001079074.1|1872913_1873444_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
>prophage 138
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1898463	1899273	4997979		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_001000035.1|1898463_1899273_-	propanediol diffusion facilitator PduF	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	26.1	2.6e-09
>prophage 139
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1916765	1917932	4997979		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001296209.1|1916765_1917932_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
>prophage 140
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1925572	1926472	4997979		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|1925572_1926472_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 141
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1935174	1939069	4997979		Paramecium_bursaria_Chlorella_virus(33.33%)	3	NA	NA
WP_000704791.1|1935174_1936341_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.5	6.7e-115
WP_000043488.1|1936589_1937996_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.1e-37
WP_000866330.1|1938055_1939069_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	51.2	7.0e-92
>prophage 142
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1946868	1949331	4997979		Bacillus_phage(50.0%)	2	NA	NA
WP_000183060.1|1946868_1947762_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001116018.1|1947936_1949331_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 143
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1955139	1961842	4997979		Bacillus_phage(25.0%)	6	NA	NA
WP_001369831.1|1955139_1956510_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.2	1.7e-32
WP_000079285.1|1956611_1958048_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_000699721.1|1958050_1959274_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000479836.1|1959270_1959750_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043598.1|1959752_1960718_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	3.8e-87
WP_000048190.1|1960720_1961842_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 144
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1966085	1976561	4997979		uncultured_marine_virus(20.0%)	8	NA	NA
WP_000654516.1|1966085_1966925_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	1.3e-06
WP_000137136.1|1967102_1969265_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482901.1|1969267_1969711_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|1969716_1970856_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_001300971.1|1971514_1973098_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001252331.1|1973371_1975225_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|1975246_1975828_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|1975919_1976561_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 145
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1981225	1982578	4997979		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469734.1|1981225_1982578_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.2e-06
>prophage 146
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	1996019	2057787	4997979	capsid,head,plate,tail,portal,integrase,tRNA,terminase,lysis,holin	Escherichia_phage(51.06%)	72	2001077:2001104	2030510:2030537
WP_000675150.1|1996019_1997423_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137869.1|1997419_1998142_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.4e-30
WP_000929408.1|1998332_1998665_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|1998873_1999170_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|1999171_1999468_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476011.1|1999570_2000932_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
2001077:2001104	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|2001204_2001423_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_044527455.1|2001504_2002668_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	5.4e-205
WP_106901619.1|2002667_2003147_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	98.7	5.6e-84
WP_106901620.1|2003161_2005609_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.7	0.0e+00
WP_000785970.1|2005601_2005721_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|2005753_2006029_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_064550152.1|2006085_2006604_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	4.2e-93
WP_069907206.1|2006616_2007807_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	4.0e-224
WP_047087885.1|2007930_2008368_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	42.0	7.3e-22
WP_047087886.1|2008367_2010098_-|tail	phage tail fiber protein	tail	A0A0M3ULH6	Salmonella_phage	64.3	3.1e-84
WP_001285340.1|2010094_2010706_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	100.0	1.7e-117
WP_001121496.1|2010698_2011607_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	2.8e-161
WP_000127163.1|2011611_2011959_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_050877437.1|2011955_2012591_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	2.9e-112
WP_001001780.1|2012657_2013110_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_000917190.1|2013102_2013570_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	97.4	9.7e-81
WP_001300730.1|2013532_2013706_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_042028227.1|2013677_2014103_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	97.2	9.4e-67
WP_106901621.1|2014090_2014342_-	hypothetical protein	NA	A0A0F7LDU9	Escherichia_phage	56.0	1.1e-19
WP_001144101.1|2014356_2014854_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_064579185.1|2014853_2015135_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	98.9	4.8e-43
WP_000846409.1|2015138_2015342_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000988633.1|2015341_2015851_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_053294230.1|2015950_2016694_-|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	98.8	2.7e-125
WP_064579179.1|2016697_2017771_-|capsid	phage major capsid protein, P2 family	capsid	Q778Z0	Enterobacteria_phage	99.4	9.7e-201
WP_001085953.1|2017829_2018684_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
WP_106901622.1|2018857_2020630_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_044527448.1|2020629_2021664_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	4.2e-201
WP_071987867.1|2022016_2023171_-	DNA cytosine methyltransferase	NA	Q83VT0	Escherichia_phage	99.4	3.2e-210
WP_071526056.1|2023191_2023461_+	helix-turn-helix transcriptional regulator	NA	Q83VS9	Escherichia_phage	100.0	3.6e-40
WP_000866882.1|2023438_2024494_+	restriction endonuclease, SacI family	NA	Q83VS8	Escherichia_phage	100.0	2.2e-197
WP_044527447.1|2024587_2026858_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.2	0.0e+00
WP_000027664.1|2026847_2027123_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113258.1|2027119_2027344_-	hypothetical protein	NA	S4TRY6	Salmonella_phage	97.3	2.5e-34
WP_001277958.1|2027343_2027646_-	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	98.0	5.0e-46
WP_000557703.1|2027645_2027870_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217670.1|2027933_2028434_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000043869.1|2028611_2028887_-	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001306384.1|2029001_2029301_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000985256.1|2029416_2030430_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	1.4e-193
WP_106901623.1|2030694_2031012_-	hypothetical protein	NA	NA	NA	NA	NA
2030510:2030537	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807362.1|2031426_2032326_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178552.1|2032407_2033187_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_064579174.1|2033286_2034327_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490717.1|2034374_2035730_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000823272.1|2035733_2036018_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182899.1|2036048_2036501_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853892.1|2036510_2037773_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000129551.1|2038966_2040019_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858484.1|2040275_2041553_+	nucleoside permease	NA	NA	NA	NA	NA
WP_000846219.1|2041549_2042554_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	1.3e-13
WP_000011973.1|2042550_2043516_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|2043489_2044236_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001315719.1|2044287_2045106_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
WP_000822274.1|2045170_2045971_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195590.1|2045967_2046756_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|2046978_2047251_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134576.1|2047371_2048196_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153067.1|2048414_2048753_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_001026151.1|2048834_2049869_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000945406.1|2049882_2052363_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677395.1|2052378_2053053_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830468.1|2053133_2053676_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001324851.1|2053968_2054250_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|2054512_2055622_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001295427.1|2055753_2057787_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 147
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2070352	2130248	4997979	capsid,head,tail,portal,integrase,terminase,lysis,protease,holin	Enterobacteria_phage(41.27%)	70	2077299:2077319	2127754:2127774
WP_001292774.1|2070352_2071489_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_064579207.1|2071485_2073486_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001295429.1|2073610_2074072_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2074112_2074583_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2074629_2075349_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
2077299:2077319	attL	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001217533.1|2077544_2077793_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	86.6	1.0e-33
WP_064579209.1|2078062_2078737_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	89.7	5.6e-114
WP_000438829.1|2078748_2078961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064579206.1|2078970_2080683_-|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	51.7	5.9e-67
WP_000078853.1|2080827_2080968_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_106901624.1|2081166_2084853_-	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	87.9	0.0e+00
WP_106901625.1|2086351_2087095_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	99.2	8.3e-151
WP_001365876.1|2087105_2087804_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.3	1.4e-131
WP_042965107.1|2087803_2088145_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	81.4	1.5e-51
WP_000212873.1|2088137_2091380_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	89.5	0.0e+00
WP_122993267.1|2091428_2091638_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	1.5e-33
WP_000710936.1|2091733_2092108_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	3.9e-64
WP_001275414.1|2092122_2092839_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	98.7	1.5e-125
WP_000133383.1|2092905_2093250_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	4.2e-57
WP_000573396.1|2093246_2093693_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	98.6	9.9e-75
WP_001007902.1|2093689_2094040_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	99.1	2.0e-59
WP_000126028.1|2094050_2094377_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	97.2	3.9e-52
WP_001365916.1|2094373_2096959_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	96.3	0.0e+00
WP_001063099.1|2096904_2097126_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172990.1|2097170_2099108_-|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.7	0.0e+00
WP_001373204.1|2099171_2100833_-|terminase	terminase large subunit	terminase	Q6H9U9	Enterobacteria_phage	99.5	0.0e+00
WP_000958387.1|2100829_2101393_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_000829192.1|2101681_2102047_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000095744.1|2102088_2102289_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828070.1|2102420_2102747_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_106901626.1|2103083_2103707_-	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	67.6	3.5e-62
WP_074403983.1|2103818_2104286_-|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	88.4	4.2e-68
WP_001280928.1|2104288_2104420_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	95.3	4.5e-12
WP_000661712.1|2104514_2105210_-	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_001092873.1|2105483_2106017_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	92.1	1.3e-94
WP_001041949.1|2106528_2107320_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_000284490.1|2107323_2107539_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	98.6	2.0e-33
WP_001290230.1|2107616_2107862_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|2107902_2108082_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_064579199.1|2108219_2110157_-	SASA family carbohydrate esterase	NA	S5MDQ7	Escherichia_phage	93.8	0.0e+00
WP_000738072.1|2110658_2110928_-	Shiga toxin Stx2a subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
WP_000649751.1|2110939_2111899_-	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_064579085.1|2112281_2113340_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	98.3	1.3e-205
WP_000917756.1|2113490_2113688_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	6.8e-28
WP_001204809.1|2113903_2114284_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	99.2	1.4e-66
WP_001202275.1|2114302_2115292_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	4.7e-194
WP_001065352.1|2115344_2115602_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	71.1	1.2e-21
WP_040077785.1|2115598_2116999_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.4	4.9e-245
WP_000988196.1|2116995_2117874_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	96.0	2.0e-140
WP_039259893.1|2117884_2118877_-	hypothetical protein	NA	Q8W642	Enterobacteria_phage	90.1	1.3e-53
WP_021293441.1|2118873_2119200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000618002.1|2119196_2119421_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	52.1	9.8e-15
WP_028125921.1|2119417_2119612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096549041.1|2119608_2120340_-	hypothetical protein	NA	Q8W643	Enterobacteria_phage	72.0	1.8e-81
WP_074403962.1|2120272_2120449_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	85.7	3.1e-24
WP_064579084.1|2120468_2121176_-	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	76.1	3.6e-95
WP_000944728.1|2121257_2121491_-	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	77.0	1.2e-28
WP_000800142.1|2121647_2122337_+	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	87.8	6.8e-115
WP_000387834.1|2122484_2123177_+	helix-turn-helix transcriptional regulator	NA	A0A1B5FPB8	Escherichia_phage	63.6	1.0e-38
WP_000147360.1|2123182_2123383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000553978.1|2123580_2123763_+	hypothetical protein	NA	Q8W652	Enterobacteria_phage	50.9	1.1e-08
WP_032253186.1|2123768_2124341_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	70.7	1.0e-76
WP_052891987.1|2124710_2125538_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	97.1	4.5e-129
WP_001447615.1|2125578_2125950_+	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	95.9	1.4e-61
WP_001193437.1|2126141_2126396_+	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063636.1|2126429_2127716_+|integrase	site-specific integrase	integrase	Q6HA01	Enterobacteria_phage	100.0	1.2e-253
WP_042101647.1|2127751_2128438_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.8e-102
2127754:2127774	attR	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001216963.1|2128497_2128605_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2128585_2129317_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569325.1|2129321_2130248_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 148
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2150559	2152080	4997979		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255039.1|2150559_2152080_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 149
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2155774	2159560	4997979		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|2155774_2156443_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425462.1|2156700_2157537_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489233.1|2157568_2159560_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
>prophage 150
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2163629	2164487	4997979		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|2163629_2164487_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 151
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2178985	2183286	4997979		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_000848214.1|2178985_2180452_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.3	8.7e-43
WP_000198822.1|2180569_2181556_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000594599.1|2181594_2182308_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241012.1|2182719_2183286_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 152
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2189040	2196688	4997979		Vibrio_phage(50.0%)	7	NA	NA
WP_000194928.1|2189040_2190630_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
WP_000202798.1|2190633_2190978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213360.1|2191310_2192501_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_001234850.1|2192528_2193224_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578076.1|2193372_2195133_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_000494183.1|2195257_2195542_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|2195680_2196688_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
>prophage 153
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2208387	2209005	4997979		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|2208387_2209005_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 154
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2217772	2223571	4997979		Bacillus_phage(25.0%)	5	NA	NA
WP_000422188.1|2217772_2219416_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000884922.1|2219491_2220142_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000710368.1|2220141_2221206_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406098.1|2221279_2222335_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865609.1|2222446_2223571_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.8	2.4e-117
>prophage 155
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2227848	2230698	4997979		Hokovirus(100.0%)	1	NA	NA
WP_000876014.1|2227848_2230698_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
>prophage 156
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2240398	2243026	4997979		Bacillus_virus(100.0%)	1	NA	NA
WP_001281242.1|2240398_2243026_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
>prophage 157
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2248452	2254454	4997979		Pseudomonas_phage(50.0%)	5	NA	NA
WP_001075170.1|2248452_2250738_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_000332036.1|2250826_2251957_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_000135040.1|2251956_2252211_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301050.1|2252264_2252915_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000779084.1|2253377_2254454_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 158
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2260347	2261250	4997979	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000140553.1|2260347_2261250_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.4	9.6e-69
>prophage 159
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2264402	2269406	4997979		Tupanvirus(50.0%)	4	NA	NA
WP_001297077.1|2264402_2265005_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
WP_001342601.1|2265312_2266452_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.9e-29
WP_000461661.1|2266455_2267424_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.2	2.0e-35
WP_000860259.1|2267423_2269406_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
>prophage 160
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2303821	2307049	4997979		Salmonella_phage(50.0%)	3	NA	NA
WP_000813860.1|2303821_2304421_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012899.1|2304479_2306312_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203389.1|2306398_2307049_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	34.3	5.2e-08
>prophage 161
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2317608	2319481	4997979		Sodalis_phage(50.0%)	2	NA	NA
WP_000156113.1|2317608_2318511_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	44.5	8.2e-68
WP_001293612.1|2318707_2319481_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 162
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2323692	2325210	4997979		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|2323692_2325210_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 163
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2331686	2332823	4997979		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699123.1|2331686_2332823_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
>prophage 164
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2341378	2342464	4997979		Pandoravirus(100.0%)	1	NA	NA
WP_000918470.1|2341378_2342464_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
>prophage 165
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2361626	2362559	4997979		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000368131.1|2361626_2362559_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 166
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2365599	2367033	4997979		Bacillus_phage(100.0%)	1	NA	NA
WP_000194515.1|2365599_2367033_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 167
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2373674	2381251	4997979		Hokovirus(50.0%)	4	NA	NA
WP_001317243.1|2373674_2377268_+	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	1.7e-36
WP_001296867.1|2377323_2378469_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|2378542_2379487_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283499.1|2379556_2381251_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
>prophage 168
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2384980	2385901	4997979		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|2384980_2385901_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 169
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2389719	2390454	4997979		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|2389719_2390454_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 170
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2416304	2431674	4997979		Streptococcus_phage(33.33%)	15	NA	NA
WP_000443665.1|2416304_2418320_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	6.5e-150
WP_001297862.1|2418390_2419377_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254843.1|2419606_2420368_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|2420552_2421524_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|2421907_2422165_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623136.1|2422209_2423937_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|2423977_2424487_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096660.1|2424528_2425380_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719943.1|2425484_2425853_+	YfeK family protein	NA	NA	NA	NA	NA
WP_001297645.1|2425855_2426767_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	3.5e-58
WP_000021040.1|2426900_2427998_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_000852686.1|2427987_2428863_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458405.1|2428862_2429696_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290216.1|2429695_2430712_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000517431.1|2430882_2431674_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
>prophage 171
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2435152	2440090	4997979		Mycobacterium_phage(33.33%)	6	NA	NA
WP_001315775.1|2435152_2436457_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
WP_000084590.1|2436514_2437414_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838945.1|2437509_2438085_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001300381.1|2438145_2438595_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|2438581_2439007_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102886.1|2439220_2440090_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
>prophage 172
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2458644	2459595	4997979		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|2458644_2459595_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 173
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2477641	2478355	4997979		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|2477641_2478355_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 174
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2499398	2503400	4997979		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198328.1|2499398_2500688_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_001295473.1|2500773_2501400_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001299062.1|2501724_2502762_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.0	6.3e-72
WP_001028614.1|2502761_2503400_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
>prophage 175
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2509834	2516129	4997979		Escherichia_phage(60.0%)	6	NA	NA
WP_001344399.1|2509834_2510008_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
WP_000669402.1|2510321_2510837_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.0e-62
WP_000755179.1|2510852_2511392_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.3	4.1e-43
WP_000138282.1|2511484_2513062_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001299507.1|2513130_2514597_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000937933.1|2514758_2516129_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	4.0e-42
>prophage 176
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2524958	2525390	4997979		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|2524958_2525390_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 177
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2535275	2541732	4997979		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133582.1|2535275_2536559_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.2e-34
WP_000523616.1|2536736_2536937_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124469.1|2536948_2537284_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196613.1|2537285_2539136_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384411.1|2539152_2539668_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|2539763_2540087_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|2540103_2540490_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|2540517_2541732_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 178
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2556896	2558408	4997979		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493473.1|2556896_2558408_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
>prophage 179
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2564166	2575474	4997979		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|2564166_2565420_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883122.1|2565747_2566938_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|2566982_2567321_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001298983.1|2567381_2568716_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215888.1|2568705_2569419_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001297612.1|2569583_2571011_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_000970122.1|2571586_2575474_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	7.7e-131
>prophage 180
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2579593	2579854	4997979		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|2579593_2579854_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 181
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2583312	2587054	4997979		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|2583312_2583993_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|2584264_2585239_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|2585254_2587054_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 182
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2592825	2599084	4997979	tRNA	Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
WP_000219193.1|2592825_2594160_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000365855.1|2594368_2595250_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|2595352_2595940_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|2595995_2596379_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|2596683_2597373_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997404.1|2597420_2598458_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|2598664_2599084_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 183
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2604377	2605676	4997979		Burkholderia_virus(100.0%)	1	NA	NA
WP_000852115.1|2604377_2605676_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	2.2e-45
>prophage 184
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2611543	2614117	4997979		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|2611543_2614117_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 185
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2620023	2621094	4997979		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168044.1|2620023_2621094_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 186
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2634728	2643380	4997979	integrase,transposase	Acinetobacter_phage(50.0%)	6	2633314:2633327	2639876:2639889
2633314:2633327	attL	AGTAAACAGCAAAA	NA	NA	NA	NA
WP_000162574.1|2634728_2635211_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000113814.1|2635993_2637235_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.3	2.6e-101
WP_001317263.1|2637373_2638468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085951104.1|2639725_2640887_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	2.6e-50
2639876:2639889	attR	AGTAAACAGCAAAA	NA	NA	NA	NA
WP_000532680.1|2640901_2642200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947771.1|2642217_2643380_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 187
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2650176	2653112	4997979	transposase	Vibrio_phage(33.33%)	5	NA	NA
WP_001367084.1|2650176_2650416_+	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	49.2	2.5e-08
WP_001283984.1|2650581_2650881_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_085950812.1|2650901_2652114_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	56.8	2.4e-99
WP_001120794.1|2652619_2652739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524581.1|2652893_2653112_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	68.0	6.0e-09
>prophage 188
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2662563	2666688	4997979		Klosneuvirus(50.0%)	4	NA	NA
WP_001087606.1|2662563_2663844_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	2.4e-33
WP_001325764.1|2664154_2665555_+	GABA permease	NA	NA	NA	NA	NA
WP_000156811.1|2665575_2666238_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522424.1|2666238_2666688_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 189
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2670623	2675919	4997979		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|2670623_2670869_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080944.1|2670865_2671276_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	2.7e-18
WP_000246542.1|2671248_2673393_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.4	3.8e-196
WP_000777968.1|2673402_2674362_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	2.2e-132
WP_001299852.1|2674716_2675919_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 190
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2689104	2694664	4997979	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|2689104_2689290_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047176.1|2689524_2692155_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140506.1|2692282_2692783_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|2693025_2694087_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132231.1|2694166_2694664_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 191
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2700130	2701096	4997979		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287415.1|2700130_2701096_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 192
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2708669	2709683	4997979		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001300105.1|2708669_2709683_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	1.0e-26
>prophage 193
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2727508	2734648	4997979		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|2727508_2730070_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141340.1|2730175_2730832_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001369870.1|2730882_2731650_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	9.7e-70
WP_000847985.1|2731845_2732754_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590384.1|2732750_2734013_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
WP_001278994.1|2734009_2734648_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 194
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2739862	2743578	4997979		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000081550.1|2739862_2740855_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|2740917_2742057_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|2742196_2742823_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|2742816_2743578_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 195
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2746690	2748723	4997979		Tupanvirus(50.0%)	2	NA	NA
WP_001173673.1|2746690_2747296_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_001090346.1|2747295_2748723_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.6	2.8e-30
>prophage 196
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2768672	2774515	4997979		Vibrio_phage(33.33%)	6	NA	NA
WP_001199982.1|2768672_2769344_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
WP_001379137.1|2769516_2770119_+	LemA family protein	NA	NA	NA	NA	NA
WP_000793004.1|2770132_2771038_+	YgcG family protein	NA	NA	NA	NA	NA
WP_000034929.1|2771073_2771436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000036723.1|2771491_2772790_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|2772877_2774515_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 197
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2778547	2785595	4997979		Erysipelothrix_phage(33.33%)	4	NA	NA
WP_000046790.1|2778547_2779849_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	2.0e-38
WP_000186455.1|2779905_2782662_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	4.9e-55
WP_000098271.1|2782893_2784234_-	glucarate dehydratase	NA	NA	NA	NA	NA
WP_000211812.1|2784254_2785595_-	glucarate dehydratase	NA	Q6A202	Oenococcus_phage	24.3	3.5e-06
>prophage 198
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2790196	2791045	4997979		Vibrio_phage(100.0%)	1	NA	NA
WP_000100394.1|2790196_2791045_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	1.0e-40
>prophage 199
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2795903	2796659	4997979		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|2795903_2796659_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 200
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2808185	2823572	4997979	tRNA	environmental_halophage(16.67%)	9	NA	NA
WP_001347723.1|2808185_2809391_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.2	7.8e-74
WP_000184251.1|2809390_2809834_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117728.1|2809884_2810691_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000678646.1|2810767_2811865_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000016907.1|2812444_2813698_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237948.1|2813929_2815261_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775946.1|2815322_2817149_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	7.8e-25
WP_001285985.1|2817148_2820691_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.8	1.5e-08
WP_001138163.1|2820683_2823572_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	1.2e-67
>prophage 201
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2829049	2835822	4997979		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|2829049_2829844_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|2829850_2830726_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957914.1|2830876_2833123_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|2833135_2833666_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082188.1|2834350_2835040_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|2835108_2835822_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 202
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2845453	2847941	4997979		Aichi_virus(50.0%)	2	NA	NA
WP_000256438.1|2845453_2846872_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603518.1|2847179_2847941_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 203
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2870768	2871524	4997979		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|2870768_2871524_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 204
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2895803	2911195	4997979	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280215.1|2895803_2897204_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001295158.1|2897221_2898538_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012163.1|2898573_2899941_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_000838428.1|2899976_2900465_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_001367088.1|2900464_2902384_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001295374.1|2902819_2904268_+	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001010156.1|2904269_2904395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|2904391_2904463_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192804.1|2904517_2905066_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003068.1|2905108_2906626_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|2906635_2907734_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813215.1|2907824_2909558_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	3.2e-60
WP_000715214.1|2909563_2910274_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|2910298_2911195_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 205
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2915000	2920368	4997979		Pandoravirus(50.0%)	3	NA	NA
WP_001363803.1|2915000_2916434_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	2.6e-31
WP_000951964.1|2916490_2917234_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000195047.1|2917494_2920368_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	1.1e-262
>prophage 206
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2928895	2930128	4997979		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|2928895_2930128_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 207
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2948134	2948812	4997979		Bacillus_virus(100.0%)	1	NA	NA
WP_000956871.1|2948134_2948812_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	1.1e-08
>prophage 208
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2962387	2963542	4997979		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|2962387_2963542_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 209
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2986324	2987590	4997979	integrase	Pseudomonas_phage(100.0%)	1	2976983:2976998	2990908:2990923
2976983:2976998	attL	CTCCTGAACGATAATT	NA	NA	NA	NA
WP_064579089.1|2986324_2987590_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.6	5.0e-79
WP_064579089.1|2986324_2987590_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.6	5.0e-79
2990908:2990923	attR	AATTATCGTTCAGGAG	NA	NA	NA	NA
>prophage 210
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	2992104	2993931	4997979		Bacillus_phage(100.0%)	1	NA	NA
WP_001106666.1|2992104_2993931_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	26.9	9.8e-20
>prophage 211
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3004952	3010962	4997979	transposase	Acinetobacter_phage(100.0%)	3	NA	NA
WP_085947918.1|3004952_3006045_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.8e-51
WP_001223359.1|3006684_3008772_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	32.2	3.4e-08
WP_000593011.1|3009117_3010962_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	31.3	8.1e-14
>prophage 212
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3013980	3015117	4997979		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001228923.1|3013980_3015117_-	porin	NA	Q1MVN1	Enterobacteria_phage	56.3	1.4e-117
>prophage 213
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3018889	3027662	4997979		Enterobacterial_phage(33.33%)	8	NA	NA
WP_072161482.1|3018889_3022981_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	43.8	1.5e-297
WP_000997728.1|3023486_3023852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000264910.1|3023861_3024053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000323309.1|3024086_3024296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001378814.1|3024793_3025438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000226517.1|3025458_3025728_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000502848.1|3025806_3026445_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.5	1.5e-55
WP_001285503.1|3026429_3027662_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.8	7.7e-61
>prophage 214
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3034253	3034829	4997979		Enterobacterial_phage(100.0%)	1	NA	NA
WP_000737515.1|3034253_3034829_-	Ail/Lom family protein	NA	Q9LA63	Enterobacterial_phage	32.2	6.0e-16
>prophage 215
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3039984	3051126	4997979		Moraxella_phage(100.0%)	3	NA	NA
WP_033811935.1|3039984_3048921_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	40.2	1.9e-55
WP_001243916.1|3048936_3049464_-	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_001379178.1|3049473_3051126_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	28.4	1.5e-38
>prophage 216
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3070087	3072246	4997979		Yersinia_phage(33.33%)	4	NA	NA
WP_001234620.1|3070087_3070906_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
WP_000849580.1|3070960_3071446_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	1.2e-12
WP_001186727.1|3071461_3071938_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692350.1|3072024_3072246_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
>prophage 217
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3105616	3106789	4997979		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524972.1|3105616_3106789_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	4.2e-40
>prophage 218
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3130326	3131211	4997979		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018758.1|3130326_3131211_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 219
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3137287	3148110	4997979		Staphylococcus_phage(25.0%)	9	NA	NA
WP_000013149.1|3137287_3138115_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
WP_000691598.1|3138314_3139241_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848528.1|3139291_3139549_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095187.1|3139591_3141811_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059395.1|3141921_3143334_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965717.1|3143408_3144146_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_001281881.1|3144378_3146637_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
WP_000183499.1|3147182_3147665_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000712658.1|3147717_3148110_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 220
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3160222	3171184	4997979		Bacillus_virus(20.0%)	12	NA	NA
WP_000195296.1|3160222_3162115_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
WP_000105733.1|3162143_3162725_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444747.1|3162724_3163552_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|3163576_3163999_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|3163999_3164629_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735278.1|3164833_3166315_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|3166462_3167134_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|3167139_3168300_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000188373.1|3168337_3169153_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_001295627.1|3169268_3170042_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000469266.1|3170099_3170270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076997.1|3170530_3171184_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 221
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3180699	3182133	4997979		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|3180699_3182133_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 222
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3187270	3188509	4997979	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708471.1|3187270_3188509_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.3	5.0e-92
>prophage 223
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3194891	3211085	4997979	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264365.1|3194891_3195905_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
WP_001144069.1|3196141_3196357_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|3196467_3198213_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437371.1|3198407_3200249_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|3200327_3200834_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_073547302.1|3201087_3201810_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018003.1|3202138_3202762_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000094682.1|3202915_3204436_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_158707531.1|3204742_3206233_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.4	1.8e-32
WP_000450589.1|3206274_3206607_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212465.1|3206825_3207809_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001082882.1|3207992_3211085_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	1.0e-157
>prophage 224
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3223506	3224472	4997979		Escherichia_phage(100.0%)	1	NA	NA
WP_001098805.1|3223506_3224472_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 225
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3250705	3253000	4997979		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|3250705_3253000_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 226
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3261093	3262239	4997979		Streptococcus_phage(100.0%)	1	NA	NA
WP_001299416.1|3261093_3262239_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 227
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3285246	3293039	4997979		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809253.1|3285246_3286107_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.3	2.1e-49
WP_000249144.1|3286170_3288207_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000246855.1|3288164_3288560_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158035.1|3288579_3289170_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646033.1|3289179_3289755_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147619.1|3289868_3290909_-	permease	NA	NA	NA	NA	NA
WP_001315854.1|3290981_3291617_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037608.1|3291744_3292263_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000449451.1|3292242_3292686_-	YhbP family protein	NA	NA	NA	NA	NA
WP_001345969.1|3292736_3293039_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	1.7e-14
>prophage 228
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3300145	3302035	4997979		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|3300145_3302035_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 229
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3307516	3314155	4997979		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133043.1|3307516_3310189_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	1.5e-24
WP_001031057.1|3310213_3311701_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|3311728_3312181_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207685.1|3312811_3314155_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 230
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3318237	3321110	4997979	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|3318237_3319086_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|3319175_3321110_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 231
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3327738	3329216	4997979		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|3327738_3328710_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445413.1|3328937_3329216_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
>prophage 232
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3333284	3348078	4997979		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|3333284_3334094_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922872.1|3334303_3335281_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|3335294_3336281_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030005.1|3336301_3336868_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|3336864_3337440_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|3337408_3337966_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|3337972_3338698_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|3338745_3340179_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|3340201_3340489_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|3340606_3341098_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|3341143_3341998_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|3341994_3342267_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620387.1|3342479_3343112_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047091.1|3343108_3343837_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001299134.1|3343833_3344487_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809758.1|3344716_3347053_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.0	1.1e-39
WP_024200910.1|3347103_3348078_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	9.2e-17
>prophage 233
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3354827	3359575	4997979		Salmonella_phage(50.0%)	5	NA	NA
WP_000445142.1|3354827_3355955_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.7e-73
WP_000979880.1|3356014_3356479_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000209027.1|3356475_3357351_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054239.1|3357347_3358037_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108460.1|3358084_3359575_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 234
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3363279	3363777	4997979	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|3363279_3363777_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 235
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3367743	3370268	4997979	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001295271.1|3367743_3369111_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497724.1|3369200_3370268_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 236
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3386763	3387807	4997979		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|3386763_3387807_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 237
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3398372	3399257	4997979		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258900.1|3398372_3399257_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.1e-24
>prophage 238
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3405761	3409915	4997979		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738575.1|3405761_3406787_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.5	6.9e-71
WP_000019655.1|3406854_3408036_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001299298.1|3408045_3409149_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078338.1|3409156_3409915_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
>prophage 239
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3420419	3421891	4997979	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|3420419_3420929_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004432.1|3420943_3421891_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 240
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3441768	3447342	4997979		Tupanvirus(33.33%)	7	NA	NA
WP_000031783.1|3441768_3442953_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|3443023_3445138_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|3445234_3445705_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|3445801_3446176_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903377.1|3446301_3446589_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820724.1|3446596_3446956_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_001209710.1|3446955_3447342_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	5.6e-18
>prophage 241
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3452912	3462453	4997979		Tupanvirus(25.0%)	9	NA	NA
WP_000634798.1|3452912_3454826_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
WP_000057405.1|3454825_3455848_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|3455841_3456060_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|3456113_3456983_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|3457037_3457442_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|3457743_3458376_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001295162.1|3458426_3460517_+	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000963785.1|3460583_3461804_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601847.1|3461889_3462453_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
>prophage 242
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3486679	3487516	4997979		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|3486679_3487516_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 243
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3504491	3509003	4997979		Bacillus_phage(66.67%)	5	NA	NA
WP_001265681.1|3504491_3506114_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
WP_000493756.1|3506230_3506548_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000650976.1|3506606_3506903_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001253696.1|3506934_3508287_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|3508283_3509003_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 244
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3515566	3516445	4997979		Sodalis_phage(100.0%)	1	NA	NA
WP_000039063.1|3515566_3516445_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.9e-69
>prophage 245
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3522414	3524808	4997979		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|3522414_3524808_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 246
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3529187	3530414	4997979		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105493.1|3529187_3530414_-	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	60.0	5.2e-134
>prophage 247
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3539641	3542089	4997979		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|3539641_3542089_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 248
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3562097	3563908	4997979		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073609.1|3562097_3562841_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	8.3e-10
WP_000907788.1|3562837_3563908_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 249
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3567448	3568931	4997979		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416895.1|3567448_3568162_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_000082101.1|3568163_3568931_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 250
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3575412	3578231	4997979		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|3575412_3576267_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|3576511_3577570_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|3577562_3578231_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 251
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3581237	3585369	4997979		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|3581237_3581864_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_000106507.1|3581937_3584136_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.1	5.5e-118
WP_000130621.1|3584237_3584483_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100467.1|3584703_3585369_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
>prophage 252
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3593262	3599145	4997979		Bacillus_virus(50.0%)	5	NA	NA
WP_000173666.1|3593262_3594069_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	4.5e-17
WP_001190062.1|3594074_3594476_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000593555.1|3594595_3594955_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001314210.1|3595285_3596410_-	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_000149132.1|3596409_3599145_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 253
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3612576	3614619	4997979		Indivirus(100.0%)	1	NA	NA
WP_001295214.1|3612576_3614619_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	3.4e-45
>prophage 254
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3617964	3620099	4997979		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000008957.1|3617964_3618318_+	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
WP_000922639.1|3618371_3619661_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000065786.1|3619673_3620099_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.5e-51
>prophage 255
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3624975	3625623	4997979		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|3624975_3625623_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 256
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3672603	3674588	4997979		Bacillus_virus(50.0%)	2	NA	NA
WP_000107018.1|3672603_3673608_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	8.6e-18
WP_001196486.1|3673604_3674588_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
>prophage 257
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3684802	3687136	4997979		Escherichia_phage(100.0%)	1	NA	NA
WP_000013918.1|3684802_3687136_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	3.1e-71
>prophage 258
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3690790	3691003	4997979		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|3690790_3691003_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 259
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3695227	3696223	4997979		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182653.1|3695227_3696223_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 260
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3701541	3703083	4997979		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146482.1|3701541_3703083_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 261
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3731507	3742198	4997979	tRNA	uncultured_Caudovirales_phage(66.67%)	7	NA	NA
WP_000582482.1|3731507_3733352_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.5e-15
WP_000206275.1|3733348_3734740_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000779792.1|3734837_3735446_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_073547314.1|3735674_3739910_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	7.3e-26
WP_001271686.1|3739881_3740265_+	protein YhhH	NA	NA	NA	NA	NA
WP_000072855.1|3740369_3741212_+	lyase	NA	NA	NA	NA	NA
WP_001346013.1|3741364_3742198_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	47.0	3.3e-23
>prophage 262
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3764294	3773800	4997979		Rhizobium_phage(16.67%)	9	NA	NA
WP_000024392.1|3764294_3764546_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001315904.1|3764686_3765118_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116566.1|3765362_3766907_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214147.1|3766916_3768200_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483856.1|3768203_3769163_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982091.1|3769149_3770184_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000646014.1|3770422_3771448_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213834.1|3771457_3772654_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000587750.1|3772867_3773800_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
>prophage 263
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3777199	3779293	4997979		Catovirus(50.0%)	2	NA	NA
WP_000064012.1|3777199_3778183_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	2.4e-12
WP_000364782.1|3778267_3779293_-	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.5	1.4e-10
>prophage 264
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3786731	3791294	4997979		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171866.1|3786731_3787211_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
WP_001114533.1|3787249_3788059_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|3788156_3788324_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|3788344_3788581_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001298959.1|3788797_3789466_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000050139.1|3789637_3790858_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_001298007.1|3790838_3791294_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
>prophage 265
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3794667	3801418	4997979		Morganella_phage(25.0%)	6	NA	NA
WP_001297374.1|3794667_3795492_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	6.3e-91
WP_000924289.1|3795783_3796401_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_000870053.1|3796397_3798080_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	1.9e-22
WP_001295237.1|3798337_3798961_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|3799015_3799291_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|3799309_3801418_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 266
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3806539	3807931	4997979		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|3806539_3807931_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 267
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3814073	3824695	4997979	integrase	Enterobacteria_phage(88.89%)	12	3813891:3813913	3825180:3825202
3813891:3813913	attL	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
WP_001218979.1|3814073_3815243_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	88.1	1.7e-198
WP_064579111.1|3815262_3817122_+	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	22.1	8.2e-14
WP_000186475.1|3817118_3817544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000446137.1|3817871_3818444_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	3.8e-95
WP_000638634.1|3818517_3819018_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283021.1|3819014_3819749_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
WP_001149160.1|3820300_3820567_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_064579108.1|3820563_3821163_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	80.3	1.1e-49
WP_001244665.1|3821155_3821443_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459318.1|3821435_3821891_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_000856729.1|3822026_3822347_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_106901637.1|3822361_3824695_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.5	0.0e+00
3825180:3825202	attR	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
>prophage 268
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3831338	3832673	4997979		Moraxella_phage(100.0%)	1	NA	NA
WP_001349999.1|3831338_3832673_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 269
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3839977	3849138	4997979		Micromonas_sp._RCC1109_virus(25.0%)	10	NA	NA
WP_000168480.1|3839977_3841666_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	4.2e-57
WP_001315912.1|3841771_3841870_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000060506.1|3842434_3842524_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_000828746.1|3842941_3844126_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000148039.1|3844133_3844631_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|3844627_3844990_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|3844979_3845327_-	YidH family protein	NA	NA	NA	NA	NA
WP_000511287.1|3845436_3845886_+	membrane protein	NA	NA	NA	NA	NA
WP_000828483.1|3845932_3847426_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.4	1.1e-29
WP_001087147.1|3847422_3849138_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
>prophage 270
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3855491	3856445	4997979		Synechococcus_phage(50.0%)	2	NA	NA
WP_001243431.1|3855491_3855920_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|3856031_3856445_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 271
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3860872	3862021	4997979		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|3860872_3862021_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 272
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3866727	3874096	4997979		Bacillus_virus(33.33%)	8	NA	NA
WP_000072071.1|3866727_3869142_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.1	1.8e-114
WP_000060116.1|3869170_3870244_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|3870243_3871344_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|3871348_3872752_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_120795392.1|3873048_3873129_+	protein YsdD	NA	NA	NA	NA	NA
WP_000831330.1|3873358_3873499_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|3873515_3873875_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|3873838_3874096_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 273
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3884295	3885633	4997979		Moraxella_phage(100.0%)	1	NA	NA
WP_001299598.1|3884295_3885633_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 274
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3896622	3900463	4997979		Bacillus_phage(50.0%)	4	NA	NA
WP_000063125.1|3896622_3897396_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251991.1|3897486_3898377_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|3898376_3899336_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|3899422_3900463_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
>prophage 275
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3905994	3909356	4997979		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000334099.1|3905994_3907824_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
WP_000933736.1|3907985_3909356_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
>prophage 276
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3921308	3922301	4997979		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845103.1|3921308_3922301_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	1.7e-50
>prophage 277
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3927930	3931321	4997979		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000387753.1|3927930_3929436_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	4.6e-15
WP_000211858.1|3929440_3930406_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|3930430_3931321_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 278
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3944711	3946358	4997979		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012633.1|3944711_3946358_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	3.9e-68
>prophage 279
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3956110	3961522	4997979		Bacillus_phage(33.33%)	4	NA	NA
WP_001238869.1|3956110_3958132_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
WP_001299253.1|3958178_3959663_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|3959796_3961062_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|3961192_3961522_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 280
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3965564	3971708	4997979		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866670.1|3965564_3966695_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
WP_000006621.1|3966691_3967954_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_001226604.1|3967953_3969021_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	3.5e-102
WP_000676056.1|3969039_3969921_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001145196.1|3969898_3970573_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612044.1|3970577_3971708_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 281
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3988005	3990794	4997979		Salmonella_phage(100.0%)	2	NA	NA
WP_000678270.1|3988005_3989319_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	33.6	4.7e-08
WP_001389394.1|3989315_3990794_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	54.7	1.8e-43
>prophage 282
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	3993830	3997689	4997979		Bacillus_phage(100.0%)	3	NA	NA
WP_000130691.1|3993830_3994727_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213584.1|3994726_3995443_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383406.1|3995526_3997689_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 283
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4005175	4007005	4997979		Catovirus(100.0%)	1	NA	NA
WP_001346040.1|4005175_4007005_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	9.7e-84
>prophage 284
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4019417	4022704	4997979		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187530.1|4019417_4021058_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
WP_001315927.1|4021136_4021406_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459594.1|4021409_4021925_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|4021927_4022704_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 285
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4031494	4032109	4997979		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|4031494_4032109_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 286
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4045800	4048587	4997979		uncultured_virus(100.0%)	1	NA	NA
WP_000250006.1|4045800_4048587_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 287
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4052665	4055136	4997979		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001188777.1|4052665_4054075_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|4054086_4055136_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 288
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4062452	4067183	4997979		Escherichia_phage(33.33%)	5	NA	NA
WP_000022286.1|4062452_4063241_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	1.3e-21
WP_000160872.1|4063280_4064177_-	sugar kinase	NA	NA	NA	NA	NA
WP_001299483.1|4064349_4065228_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	73.6	2.7e-47
WP_000094544.1|4065252_4066140_+	aldolase	NA	NA	NA	NA	NA
WP_000357967.1|4066172_4067183_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	22.2	1.3e-05
>prophage 289
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4072613	4148886	4997979	capsid,head,plate,tail,portal,integrase,tRNA,terminase,lysis,protease,holin	Escherichia_phage(45.65%)	88	4103219:4103265	4132941:4132987
WP_000560983.1|4072613_4073051_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|4073095_4074037_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001162704.1|4074100_4075009_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000897305.1|4075237_4075549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356397.1|4075549_4075840_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001295676.1|4076444_4076663_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001087409.1|4076881_4077124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027706.1|4077453_4078383_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829013.1|4078379_4079015_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331377.1|4079011_4079914_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_011310337.1|4079926_4082977_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000753589.1|4083170_4084004_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_001317404.1|4084156_4085197_+	YiiG family protein	NA	NA	NA	NA	NA
WP_033811809.1|4085246_4086995_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_001019466.1|4086994_4088065_-	aminopeptidase	NA	NA	NA	NA	NA
WP_000446005.1|4088054_4089506_-	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000729591.1|4089516_4089963_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000619503.1|4090275_4090590_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179766.1|4090599_4091424_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_001325794.1|4091598_4092858_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144056.1|4092854_4094324_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217137.1|4094611_4095448_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_001297062.1|4095431_4096370_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063527.1|4096366_4097401_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001297064.1|4097685_4098306_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001387204.1|4098603_4099548_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270260.1|4099696_4100371_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|4100476_4101850_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|4101846_4102545_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|4102694_4103195_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4103219:4103265	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000023384.1|4103380_4104361_-|integrase	tyrosine-type recombinase/integrase	integrase	U5N0A8	Enterobacteria_phage	100.0	4.7e-186
WP_001192857.1|4104430_4104724_-	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
WP_000453534.1|4104876_4105149_+	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_000217670.1|4105318_4105819_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|4105882_4106107_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277961.1|4106106_4106409_+	DUF5405 family protein	NA	Q7Y4C1	Escherichia_virus	99.0	3.8e-46
WP_001113264.1|4106408_4106633_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027664.1|4106629_4106905_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_042973449.1|4106894_4109192_+	replication endonuclease	NA	U5N0W3	Enterobacteria_phage	99.5	0.0e+00
WP_000825552.1|4109267_4109813_-	cytolethal distending toxin type V subunit CdtC	NA	G1BEM5	Escherichia_phage	100.0	4.9e-100
WP_000759934.1|4109827_4110637_-	cytolethal distending toxin type III/V nuclease subunit CdtB	NA	G1BEM4	Escherichia_phage	100.0	4.0e-151
WP_001284793.1|4110633_4111410_-	cytolethal distending toxin type V subunit CdtA	NA	G1BEM3	Escherichia_phage	100.0	7.9e-136
WP_050867561.1|4112196_4113231_-|portal	phage portal protein	portal	Q7Y4E8	Escherichia_virus	99.7	9.3e-201
WP_000156872.1|4113230_4115003_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_001085953.1|4115176_4116031_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
WP_064579179.1|4116089_4117163_+|capsid	phage major capsid protein, P2 family	capsid	Q778Z0	Enterobacteria_phage	99.4	9.7e-201
WP_053294230.1|4117166_4117910_+|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	98.8	2.7e-125
WP_000988633.1|4118009_4118519_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846409.1|4118518_4118722_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_064579185.1|4118725_4119007_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	98.9	4.8e-43
WP_001144101.1|4119006_4119504_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_001712252.1|4119518_4119944_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	96.5	8.6e-60
WP_042028227.1|4119931_4120357_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	97.2	9.4e-67
WP_001300730.1|4120328_4120502_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000917190.1|4120464_4120932_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	97.4	9.7e-81
WP_001001780.1|4120924_4121377_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_050877437.1|4121443_4122079_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	2.9e-112
WP_000127163.1|4122075_4122423_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121496.1|4122427_4123336_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	2.8e-161
WP_001285340.1|4123328_4123940_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	100.0	1.7e-117
WP_047087886.1|4123936_4125667_+|tail	phage tail fiber protein	tail	A0A0M3ULH6	Salmonella_phage	64.3	3.1e-84
WP_047087885.1|4125666_4126104_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	42.0	7.3e-22
WP_069907206.1|4126227_4127418_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	4.0e-224
WP_064550152.1|4127430_4127949_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	4.2e-93
WP_001031303.1|4128005_4128281_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|4128313_4128433_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_106901640.1|4128425_4130873_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.6	0.0e+00
WP_064550148.1|4130887_4131367_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_000882958.1|4131366_4132530_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.7	1.6e-204
WP_000468308.1|4132610_4132829_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001076742.1|4133065_4133968_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4132941:4132987	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591795.1|4134148_4135111_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001045689.1|4135430_4136420_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000708998.1|4136526_4137282_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|4137336_4138104_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802226.1|4138211_4138811_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155272.1|4138911_4139352_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|4139563_4139863_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323556.1|4139889_4140318_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796320.1|4140322_4141069_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|4141165_4142176_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|4142311_4143820_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|4143842_4144688_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|4145113_4145359_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|4145443_4145929_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001307494.1|4146021_4146948_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293343.1|4147014_4148346_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|4148355_4148886_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 290
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4153950	4158075	4997979		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_106901641.1|4153950_4158075_+	DUF4329 domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.5	3.5e-25
>prophage 291
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4171126	4178373	4997979		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424845.1|4171126_4171789_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_001174083.1|4171800_4174302_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004446.1|4174610_4175690_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|4175704_4176025_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000184827.1|4176075_4178373_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 292
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4190490	4191705	4997979		Oenococcus_phage(100.0%)	1	NA	NA
WP_000690946.1|4190490_4191705_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.6	4.5e-45
>prophage 293
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4198455	4200300	4997979		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591355.1|4198455_4200300_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 294
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4208806	4211859	4997979		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|4208806_4209757_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|4210674_4211859_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 295
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4215975	4224304	4997979		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|4215975_4220004_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|4220080_4224304_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 296
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4233519	4235282	4997979		Klosneuvirus(50.0%)	3	NA	NA
WP_000362392.1|4233519_4234191_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000940106.1|4234233_4234824_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|4235009_4235282_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 297
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4240650	4242240	4997979		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187566.1|4240650_4242240_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 298
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4257616	4261300	4997979		Dickeya_phage(100.0%)	1	NA	NA
WP_000096011.1|4257616_4261300_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 299
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4266950	4267742	4997979		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001130548.1|4266950_4267742_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.5	2.4e-47
>prophage 300
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4283549	4284665	4997979		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|4283549_4284665_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 301
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4293880	4294489	4997979		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|4293880_4294489_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 302
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4301085	4303633	4997979		Escherichia_phage(50.0%)	2	NA	NA
WP_000918363.1|4301085_4302501_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001147328.1|4302553_4303633_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
>prophage 303
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4307839	4311452	4997979		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357740.1|4307839_4310662_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|4310915_4311452_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 304
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4315269	4316619	4997979		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|4315269_4316619_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 305
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4322201	4324160	4997979		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078239.1|4322201_4324160_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 306
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4333443	4335591	4997979		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|4333443_4335591_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 307
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4340836	4342822	4997979		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001307516.1|4340836_4342822_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	5.5e-149
>prophage 308
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4346807	4348357	4997979		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611419.1|4346807_4347488_-	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.1	3.2e-08
WP_001039799.1|4347598_4348357_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	3.6e-16
>prophage 309
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4353961	4354750	4997979		Cedratvirus(100.0%)	1	NA	NA
WP_001193391.1|4353961_4354750_-	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	8.5e-13
>prophage 310
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4359589	4361092	4997979		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296882.1|4359589_4361092_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	7.0e-56
>prophage 311
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4382288	4385500	4997979	tRNA	Catovirus(50.0%)	2	NA	NA
WP_001295074.1|4382288_4383806_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_106901644.1|4384042_4385500_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	3.1e-48
>prophage 312
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4399776	4401760	4997979		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|4399776_4400070_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|4400113_4401760_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 313
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4407550	4408084	4997979		Morganella_phage(100.0%)	1	NA	NA
WP_001238378.1|4407550_4408084_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 314
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4413004	4413982	4997979		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|4413004_4413982_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 315
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4421410	4421956	4997979		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|4421410_4421956_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 316
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4425871	4438902	4997979	tRNA,protease	Vibrio_phage(20.0%)	11	NA	NA
WP_000990321.1|4425871_4427209_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122499.1|4427218_4429066_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_001280345.1|4429058_4430009_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|4430094_4430403_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|4430478_4431759_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|4431844_4433104_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|4433106_4434111_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|4434192_4434390_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|4434493_4435792_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|4435996_4436422_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076316.1|4436460_4438902_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
>prophage 317
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4442836	4444000	4997979		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943991.1|4442836_4444000_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
>prophage 318
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4486036	4492694	4997979		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_000055072.1|4486036_4486567_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000265933.1|4486876_4487833_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205793.1|4488142_4489645_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-11
WP_001339490.1|4489658_4490681_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000595986.1|4490667_4491663_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|4491695_4492694_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 319
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4496936	4499697	4997979		Vibrio_phage(100.0%)	2	NA	NA
WP_001106222.1|4496936_4497401_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	1.1e-52
WP_000187778.1|4497558_4499697_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
>prophage 320
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4503335	4509792	4997979	transposase	Paramecium_bursaria_Chlorella_virus(66.67%)	7	NA	NA
WP_001181332.1|4503335_4504283_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	6.0e-13
WP_001387276.1|4504467_4504521_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471866.1|4504661_4507358_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001118337.1|4507402_4507858_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000047539.1|4507923_4508310_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|4508382_4508844_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|4508856_4509792_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 321
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4518070	4531538	4997979	tRNA	Klosneuvirus(20.0%)	10	NA	NA
WP_000416382.1|4518070_4520926_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_001188289.1|4520925_4521408_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|4521502_4523014_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|4523280_4524381_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|4524380_4525463_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001369951.1|4525623_4527126_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	1.4e-83
WP_001389176.1|4527255_4528275_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.1e-44
WP_001003201.1|4529259_4529445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000276816.1|4529461_4530064_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_001293292.1|4530056_4531538_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	31.5	2.5e-58
>prophage 322
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4551697	4552678	4997979		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000991446.1|4551697_4552678_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	55.9	9.4e-102
>prophage 323
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4556040	4557717	4997979		Escherichia_phage(100.0%)	2	NA	NA
WP_000790583.1|4556040_4556643_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_000044711.1|4557120_4557717_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 324
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4567982	4569443	4997979		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208185.1|4567982_4569443_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	1.2e-49
>prophage 325
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4576011	4576566	4997979		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151854.1|4576011_4576566_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 326
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4584066	4585011	4997979	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000181113.1|4584066_4585011_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	1.3e-60
>prophage 327
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4605077	4610442	4997979		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000919567.1|4605077_4606742_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_000410127.1|4606790_4608152_-	MFS transporter	NA	NA	NA	NA	NA
WP_000091572.1|4608366_4609281_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106030.1|4609419_4610442_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
>prophage 328
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4613668	4614948	4997979		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|4613668_4614406_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098824.1|4614408_4614948_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 329
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4622841	4625717	4997979		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175943.1|4622841_4624431_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|4624823_4625429_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|4625555_4625717_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 330
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4631352	4632675	4997979		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|4631352_4632675_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 331
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4639418	4644773	4997979		Enterococcus_phage(33.33%)	3	NA	NA
WP_000093810.1|4639418_4640651_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_000046749.1|4640957_4642625_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409451.1|4642835_4644773_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 332
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4648056	4650170	4997979		Bacillus_phage(50.0%)	2	NA	NA
WP_001188659.1|4648056_4648746_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_001219604.1|4648745_4650170_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	1.2e-09
>prophage 333
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4663217	4672286	4997979		Cyanophage(20.0%)	9	NA	NA
WP_000130182.1|4663217_4664171_+	transaldolase	NA	A0A127KNC6	Cyanophage	32.7	7.4e-11
WP_001094682.1|4664285_4664873_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|4664907_4665474_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102379.1|4665622_4666336_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843568.1|4666361_4666766_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|4667142_4669059_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|4669147_4670278_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000935262.1|4670381_4670591_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_000681360.1|4671119_4672286_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	7.5e-90
>prophage 334
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4679319	4682136	4997979	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286851.1|4679319_4682136_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.1e-77
>prophage 335
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4686542	4687691	4997979		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|4686542_4687691_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 336
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4693161	4698822	4997979		Hepacivirus(50.0%)	4	NA	NA
WP_001297614.1|4693161_4694715_-	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.4	4.7e-31
WP_000349932.1|4694788_4696006_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|4696134_4697277_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787111.1|4697307_4698822_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 337
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4706716	4708116	4997979		Bacillus_phage(50.0%)	2	NA	NA
WP_000624375.1|4706716_4707196_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000257186.1|4707273_4708116_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
>prophage 338
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4715860	4721283	4997979		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117010.1|4715860_4718767_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_000035656.1|4718931_4721283_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.8e-37
>prophage 339
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4727615	4728314	4997979		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916291.1|4727615_4728314_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.8e-23
>prophage 340
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4741016	4742741	4997979		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425668.1|4741016_4742741_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.9e-36
>prophage 341
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4768714	4769758	4997979		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|4768714_4769758_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 342
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4774003	4774555	4997979		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|4774003_4774555_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 343
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4783182	4784607	4997979		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|4783182_4784607_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 344
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4792256	4793807	4997979		Mamastrovirus(100.0%)	1	NA	NA
WP_001189608.1|4792256_4793807_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
>prophage 345
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4797883	4800158	4997979		uncultured_virus(50.0%)	3	NA	NA
WP_000683335.1|4797883_4798420_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|4798460_4799123_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|4799231_4800158_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 346
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4803420	4804323	4997979		Sodalis_phage(100.0%)	1	NA	NA
WP_000339945.1|4803420_4804323_+	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	5.7e-61
>prophage 347
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4814228	4821034	4997979	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174643.1|4814228_4815647_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937432.1|4815685_4816612_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|4816648_4817104_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396036.1|4817281_4817986_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294700.1|4818000_4818531_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001378710.1|4818604_4821034_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.3	3.9e-40
>prophage 348
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4826277	4827075	4997979		Planktothrix_phage(100.0%)	1	NA	NA
WP_001315242.1|4826277_4827075_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	1.0e-13
>prophage 349
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4832986	4833331	4997979		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|4832986_4833331_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 350
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4837260	4838685	4997979	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|4837260_4838685_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 351
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4850568	4914397	4997979	transposase,tRNA,plate,protease	Flavobacterium_phage(11.11%)	53	NA	NA
WP_001295562.1|4850568_4851327_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
WP_000922446.1|4851339_4852197_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001295561.1|4852208_4853561_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|4853590_4856023_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|4856144_4856630_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139284.1|4856633_4857659_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|4857763_4858219_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|4858222_4859011_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139667.1|4859010_4860159_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|4860155_4860752_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|4860788_4864271_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|4864283_4865243_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|4865341_4867483_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|4867539_4867929_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176578.1|4867993_4869292_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|4869340_4869601_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|4869587_4869788_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|4869953_4870499_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|4870495_4870918_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|4870931_4871642_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000399648.1|4871891_4872872_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001260712.1|4873952_4875671_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|4875782_4876490_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202335.1|4876486_4876891_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|4877008_4877824_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|4877863_4878517_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|4878509_4879541_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140163.1|4879728_4880301_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997010.1|4886060_4886864_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_000648606.1|4886860_4887775_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|4888015_4888816_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211690.1|4888893_4889664_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|4889711_4891070_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052720.1|4891141_4891897_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001297210.1|4891930_4892653_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|4892649_4893117_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|4893181_4893913_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086142.1|4894451_4895237_+	aminopeptidase	NA	NA	NA	NA	NA
WP_001236649.1|4895373_4895853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908057.1|4895862_4896777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|4896820_4897303_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087745.1|4897326_4898679_-	membrane protein	NA	NA	NA	NA	NA
WP_122985538.1|4898689_4902124_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240530.1|4902232_4903645_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088859.1|4903649_4904393_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_106901648.1|4904389_4907149_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.4	4.7e-82
WP_000343293.1|4907157_4907919_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246416.1|4907923_4909255_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|4909257_4909782_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113703.1|4909778_4911059_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|4911083_4912166_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|4912129_4913980_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|4913983_4914397_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 352
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4918113	4920255	4997979		Ralstonia_phage(100.0%)	1	NA	NA
WP_044527364.1|4918113_4920255_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	8.2e-26
>prophage 353
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4931159	4935078	4997979		Caulobacter_phage(50.0%)	6	NA	NA
WP_000284050.1|4931159_4931738_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|4931943_4932711_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|4932681_4933422_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000615976.1|4933577_4933856_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729704.1|4933858_4934119_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000543895.1|4934304_4935078_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
>prophage 354
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4940129	4941296	4997979		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001316884.1|4940129_4941296_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.7	2.1e-31
>prophage 355
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4945973	4964159	4997979	integrase	Enterobacteria_phage(76.92%)	17	4939629:4939642	4954989:4955002
4939629:4939642	attL	AGTGCGGGTTGCAG	NA	NA	NA	NA
WP_000749882.1|4945973_4947029_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	1.3e-117
WP_001285288.1|4947316_4948420_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893255.1|4948431_4949685_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_001130500.1|4950039_4951206_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.0	2.4e-144
WP_064579183.1|4951276_4952848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012311686.1|4953465_4954038_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	98.9	5.3e-97
WP_000984201.1|4954052_4954298_-	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	100.0	1.8e-41
WP_001283022.1|4954294_4955029_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	97.5	3.3e-128
4954989:4955002	attR	AGTGCGGGTTGCAG	NA	NA	NA	NA
WP_001149156.1|4955591_4955858_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	98.9	6.3e-45
WP_087530358.1|4955854_4956454_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	81.0	3.9e-50
WP_001244665.1|4956446_4956734_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459318.1|4956726_4957182_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_000856729.1|4957317_4957638_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_106901637.1|4957652_4959986_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.5	0.0e+00
WP_001111349.1|4960604_4961015_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000121356.1|4960993_4961950_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667065.1|4961960_4964159_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
>prophage 356
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4983060	4986364	4997979		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001299025.1|4983060_4983930_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
WP_001299021.1|4984088_4984682_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474077.1|4984693_4984930_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046293.1|4985038_4986364_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
>prophage 357
NZ_CP027584	Escherichia coli strain 00-3076 chromosome, complete genome	4997979	4996286	4996850	4997979	integrase	Escherichia_phage(100.0%)	1	4991686:4991699	4997885:4997898
4991686:4991699	attL	TCTCAATCAGATCG	NA	NA	NA	NA
WP_001295805.1|4996286_4996850_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
WP_001295805.1|4996286_4996850_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
4997885:4997898	attR	TCTCAATCAGATCG	NA	NA	NA	NA
>prophage 1
NZ_CP027585	Escherichia coli strain 00-3076 plasmid unnamed, complete sequence	160576	19970	27955	160576	transposase	Stx2-converting_phage(33.33%)	7	NA	NA
WP_011310111.1|19970_20390_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	88.7	2.9e-44
WP_000624657.1|20386_20737_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	6.9e-39
WP_000080208.1|20767_22360_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	2.3e-174
WP_000912970.1|22648_23692_+	subtilase AB5 cytotoxin subunit A	NA	A0A1B0T6A2	Bacillus_phage	28.3	3.5e-06
WP_001373081.1|23708_24134_+	subtilase AB5 cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	45.2	2.1e-26
WP_001212725.1|25184_25607_+	Exc2 family lipoprotein	NA	NA	NA	NA	NA
WP_001223214.1|25867_27955_-	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	32.2	6.8e-09
>prophage 2
NZ_CP027585	Escherichia coli strain 00-3076 plasmid unnamed, complete sequence	160576	87419	96869	160576		Cronobacter_phage(25.0%)	13	NA	NA
WP_000587689.1|87419_88046_-	ParA family plasmid-partitioning AAA ATPase	NA	E5FFJ3	Burkholderia_phage	31.1	2.0e-17
WP_001369986.1|88249_88483_-	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	56.6	2.0e-18
WP_001370040.1|88527_89520_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	59.2	2.3e-100
WP_000109074.1|89519_89957_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	3.7e-26
WP_000618108.1|89953_90202_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	46.7	4.1e-14
WP_077629773.1|90620_91523_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_032236829.1|91526_91832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086114.1|91908_92592_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.1e-30
WP_001104873.1|92592_92814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274419.1|92827_93262_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001276132.1|94026_94560_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	71.8	2.3e-46
WP_000006027.1|94617_94851_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000117306.1|94910_96869_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.4	2.1e-20
