The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	0	4200	5168350	tRNA	Tupanvirus(100.0%)	3	NA	NA
WP_000779792.1|261_870_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_062881735.1|967_2359_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000582429.1|2355_4200_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.9e-15
>prophage 2
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	29926	31468	5168350		Staphylococcus_phage(100.0%)	1	NA	NA
WP_062882403.1|29926_31468_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	1.1e-16
>prophage 3
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	36787	37783	5168350		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182650.1|36787_37783_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 4
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	42006	42219	5168350		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|42006_42219_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 5
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	59195	61180	5168350		Planktothrix_phage(100.0%)	2	NA	NA
WP_001196486.1|59195_60179_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
WP_062882409.1|60175_61180_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G9BWD6	Planktothrix_phage	33.7	3.7e-21
>prophage 6
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	108932	109580	5168350		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|108932_109580_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 7
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	114461	116597	5168350		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_062882701.1|114461_114887_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.1e-51
WP_062882700.1|114899_116189_-	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	7.1e-174
WP_000008953.1|116243_116597_-	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	7.4e-25
>prophage 8
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	119942	121985	5168350		Indivirus(100.0%)	1	NA	NA
WP_001295214.1|119942_121985_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	3.4e-45
>prophage 9
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	136362	142259	5168350		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000149164.1|136362_139098_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
WP_001216257.1|139097_140222_+	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_032203651.1|140294_140570_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	50.0	3.7e-16
WP_000593555.1|140566_140926_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_062882695.1|141045_141447_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_062882694.1|141452_142259_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	5.9e-17
>prophage 10
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	150151	154283	5168350		Dickeya_phage(50.0%)	4	NA	NA
WP_062882691.1|150151_150817_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	52.7	2.4e-56
WP_000130621.1|151037_151283_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_096851618.1|151384_153583_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.3	2.0e-120
WP_000964718.1|153656_154283_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 11
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	157286	160105	5168350		Planktothrix_phage(50.0%)	3	NA	NA
WP_000617723.1|157286_157955_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	36.0	6.1e-28
WP_001042003.1|157947_159006_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|159250_160105_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 12
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	165838	167321	5168350		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_062882687.1|165838_166606_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.1	1.1e-12
WP_000416895.1|166607_167321_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
>prophage 13
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	170862	172673	5168350		Planktothrix_phage(50.0%)	2	NA	NA
WP_000907798.1|170862_171933_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
WP_000073596.1|171929_172673_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	3.7e-10
>prophage 14
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	192683	195131	5168350		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|192683_195131_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 15
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	205134	206361	5168350		Ralstonia_phage(100.0%)	1	NA	NA
WP_062882682.1|205134_206361_+	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	59.5	2.2e-132
>prophage 16
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	210739	213133	5168350		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_062882681.1|210739_213133_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 17
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	219163	220042	5168350		Sodalis_phage(100.0%)	1	NA	NA
WP_024225872.1|219163_220042_-	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.1e-69
>prophage 18
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	226605	230372	5168350		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|226605_227325_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253696.1|227321_228674_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001365409.1|228749_230372_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
>prophage 19
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	247347	248184	5168350		Vibrio_phage(100.0%)	1	NA	NA
WP_000742154.1|247347_248184_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.7	5.4e-66
>prophage 20
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	272413	281953	5168350		Acinetobacter_phage(25.0%)	9	NA	NA
WP_000601849.1|272413_272977_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.2	3.5e-61
WP_062882667.1|273062_274283_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_062882666.1|274348_276439_-	hypothetical protein	NA	H9YQA8	environmental_Halophage	99.3	6.5e-76
WP_000242755.1|276489_277122_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001148908.1|277423_277828_+	OsmC family protein	NA	NA	NA	NA	NA
WP_062882665.1|277882_278752_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_000907085.1|278805_279024_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_000057379.1|279017_280040_-	hydrolase	NA	NA	NA	NA	NA
WP_000634790.1|280039_281953_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	5.6e-74
>prophage 21
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	287522	293096	5168350		uncultured_Caudovirales_phage(33.33%)	7	NA	NA
WP_001209710.1|287522_287909_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	5.6e-18
WP_000820720.1|287908_288268_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_000903377.1|288275_288563_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|288688_289063_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|289159_289630_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|289726_291841_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_000031783.1|291911_293096_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 22
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	312973	314445	5168350	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_062881637.1|312973_313921_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	39.5	3.2e-06
WP_000114986.1|313935_314445_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	1.1e-18
>prophage 23
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	324781	328934	5168350		Planktothrix_phage(50.0%)	3	NA	NA
WP_062882451.1|324781_325540_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.1	2.8e-29
WP_032359671.1|326659_327841_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000738579.1|327908_328934_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
>prophage 24
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	335437	336322	5168350		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258900.1|335437_336322_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.1e-24
>prophage 25
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	347642	348686	5168350		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|347642_348686_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 26
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	365179	367704	5168350	protease	uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_000497723.1|365179_366247_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001365000.1|366336_367704_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
>prophage 27
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	371669	378699	5168350	transposase,protease	Pseudomonas_phage(33.33%)	6	NA	NA
WP_000366129.1|371669_372167_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
WP_062882440.1|372210_373539_-	anaerobic C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_101974043.1|373587_374861_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.3	1.3e-175
WP_000523845.1|375293_376085_+	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_062882507.1|376206_377100_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_062882506.1|377208_378699_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	3.7e-09
>prophage 28
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	388315	403109	5168350		Staphylococcus_phage(25.0%)	17	NA	NA
WP_062882510.1|388315_389245_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	34.2	2.2e-15
WP_000809774.1|389340_391677_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299134.1|391906_392560_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000047099.1|392556_393285_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000620405.1|393281_393914_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|394126_394399_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|394395_395250_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000183676.1|395295_395787_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|395904_396192_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000809051.1|396214_397648_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|397695_398421_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000669785.1|398427_398985_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000030537.1|398953_399529_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030005.1|399525_400092_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_001295557.1|400112_401099_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_062882503.1|401112_402090_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000438245.1|402299_403109_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 29
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	407177	408655	5168350		Vibrio_phage(50.0%)	2	NA	NA
WP_000445402.1|407177_407456_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	69.8	8.4e-16
WP_001047336.1|407683_408655_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 30
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	415283	418156	5168350	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107467.1|415283_417218_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_062882502.1|417307_418156_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	2.0e-23
>prophage 31
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	421358	427997	5168350		Dickeya_phage(50.0%)	4	NA	NA
WP_000207684.1|421358_422702_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_024226825.1|423332_423785_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031057.1|423812_425300_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133044.1|425324_427997_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
>prophage 32
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	433478	435368	5168350		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|433478_435368_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 33
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	441195	448987	5168350		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
WP_001445994.1|441195_441498_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	1.1e-13
WP_000449031.1|441548_441992_+	YhbP family protein	NA	NA	NA	NA	NA
WP_000037607.1|441971_442490_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	5.8e-10
WP_000084526.1|442617_443253_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_062882495.1|443325_444366_+	permease	NA	NA	NA	NA	NA
WP_000646033.1|444478_445054_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158034.1|445063_445654_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000246865.1|445673_446069_-	YraN family protein	NA	NA	NA	NA	NA
WP_062882494.1|446026_448063_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000809274.1|448126_448987_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	42.9	3.6e-49
>prophage 34
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	471995	473141	5168350		Streptococcus_phage(100.0%)	1	NA	NA
WP_001364980.1|471995_473141_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.7e-50
>prophage 35
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	481293	483402	5168350		Tetraselmis_virus(100.0%)	1	NA	NA
WP_062881746.1|481293_483402_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	40.6	8.1e-151
>prophage 36
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	510419	511385	5168350		Escherichia_phage(100.0%)	1	NA	NA
WP_001098805.1|510419_511385_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 37
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	524233	540418	5168350	tRNA	Herpes_simplex_virus(16.67%)	12	NA	NA
WP_096851607.1|524233_527326_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	1.0e-157
WP_000212443.1|527510_528494_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_000450589.1|528712_529045_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_122994986.1|529086_530577_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.4	3.7e-33
WP_000094697.1|530883_532404_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	53.0	6.2e-36
WP_000018003.1|532557_533181_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001065814.1|533457_534222_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000228940.1|534475_534982_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_027661955.1|535059_536901_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000918817.1|537095_538841_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_001144069.1|538951_539167_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264369.1|539404_540418_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	3.7e-109
>prophage 38
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	546799	548038	5168350	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_062882470.1|546799_548038_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	7.7e-93
>prophage 39
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	553175	554609	5168350		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_062882467.1|553175_554609_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	2.0e-39
>prophage 40
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	564124	571309	5168350		Staphylococcus_phage(25.0%)	8	NA	NA
WP_001076997.1|564124_564778_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
WP_000469266.1|565038_565209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295627.1|565266_566040_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000188373.1|566155_566971_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_000442859.1|567008_568169_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000831543.1|568174_568846_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000735278.1|568993_570475_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917130.1|570679_571309_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	33.0	4.6e-17
>prophage 41
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	578325	589148	5168350		Stx_converting_phage(25.0%)	9	NA	NA
WP_001364958.1|578325_578718_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
WP_000183486.1|578770_579253_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_062881426.1|579798_582057_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
WP_000965712.1|582289_583027_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_000059395.1|583101_584514_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000095154.1|584624_586844_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000848528.1|586886_587144_-	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000691598.1|587194_588121_-	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000013149.1|588320_589148_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
>prophage 42
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	595224	596109	5168350		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018760.1|595224_596109_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 43
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	618328	619501	5168350		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524972.1|618328_619501_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	4.2e-40
>prophage 44
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	623010	626927	5168350	transposase,integrase	Stx2-converting_phage(60.0%)	5	612926:612939	630156:630169
612926:612939	attL	ACTGGCGCAAAGTG	NA	NA	NA	NA
WP_101975615.1|623010_624549_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.4	2.5e-298
WP_000612591.1|624598_624946_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|624942_625323_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_062881820.1|625608_626631_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	8.6e-199
WP_158638453.1|626657_626927_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	E5AGD0	Erwinia_phage	48.8	1.6e-16
630156:630169	attR	CACTTTGCGCCAGT	NA	NA	NA	NA
>prophage 45
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	653636	654791	5168350		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|653636_654791_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 46
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	667491	668169	5168350		Bacillus_virus(100.0%)	1	NA	NA
WP_000956893.1|667491_668169_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	4.9e-09
>prophage 47
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	686176	687409	5168350		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|686176_687409_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 48
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	695937	701310	5168350		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_024226236.1|695937_698811_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	4.8e-263
WP_062882111.1|699076_699820_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_062882117.1|699876_701310_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.3	4.4e-31
>prophage 49
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	705234	720625	5168350	tRNA	Brevibacillus_phage(14.29%)	14	NA	NA
WP_000806638.1|705234_706131_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
WP_024226239.1|706154_706865_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_024226240.1|706870_708604_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	5.4e-60
WP_001701073.1|708694_709792_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_062882114.1|709802_711320_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_024226241.1|711362_711911_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_120795390.1|711965_712037_+	protein YqfH	NA	NA	NA	NA	NA
WP_001010156.1|712033_712159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024177763.1|712160_713609_-	purine permease	NA	Q9KX94	Enterobacteria_phage	26.2	1.4e-24
WP_096851573.1|714044_715964_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_062881652.1|715963_716452_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_095585788.1|716487_717855_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	72.4	1.5e-158
WP_062881650.1|717890_719207_-	guanine deaminase	NA	NA	NA	NA	NA
WP_001280215.1|719224_720625_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 50
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	741305	742061	5168350		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|741305_742061_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 51
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	751533	754028	5168350		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_096851594.1|751533_752295_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	2.2e-18
WP_096851593.1|752609_754028_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
>prophage 52
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	763659	770432	5168350		Moraxella_phage(33.33%)	6	NA	NA
WP_000895624.1|763659_764373_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_000082188.1|764441_765131_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564489.1|765815_766346_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_062881493.1|766358_768605_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000204658.1|768755_769631_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816232.1|769637_770432_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 53
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	775909	791186	5168350	tRNA	Klosneuvirus(16.67%)	9	NA	NA
WP_062881491.1|775909_778798_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.9	9.6e-70
WP_062881490.1|778790_782333_+	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.8	1.2e-08
WP_062881489.1|782332_784159_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	1.3e-24
WP_000237947.1|784220_785552_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000016907.1|785783_787037_+	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000678646.1|787506_788604_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000117728.1|788680_789487_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000184246.1|789537_789981_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_024231426.1|789980_791186_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.2	3.0e-73
>prophage 54
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	802712	803468	5168350		Bacillus_phage(100.0%)	1	NA	NA
WP_001364919.1|802712_803468_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 55
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	808326	809175	5168350		Vibrio_phage(100.0%)	1	NA	NA
WP_000100421.1|808326_809175_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	1.0e-40
>prophage 56
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	816709	820824	5168350		Hokovirus(50.0%)	2	NA	NA
WP_062881482.1|816709_819466_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	8.3e-55
WP_000046790.1|819522_820824_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	2.0e-38
>prophage 57
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	824856	829765	5168350		Only_Syngen_Nebraska_virus(33.33%)	4	NA	NA
WP_000210878.1|824856_826494_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_024226273.1|826581_827880_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	5.7e-131
WP_101975616.1|828814_828955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001199979.1|829093_829765_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
>prophage 58
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	834707	835493	5168350		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_062881969.1|834707_835493_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	1.4e-20
>prophage 59
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	850840	852053	5168350	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
WP_085952403.1|850840_852053_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
>prophage 60
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	860076	862109	5168350		Hokovirus(50.0%)	2	NA	NA
WP_001090361.1|860076_861504_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
WP_001173673.1|861503_862109_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
>prophage 61
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	865221	868937	5168350		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_001295182.1|865221_865983_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|865976_866603_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272601.1|866742_867882_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|867944_868937_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
>prophage 62
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	874152	881292	5168350		Escherichia_phage(80.0%)	5	NA	NA
WP_001279007.1|874152_874791_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	4.1e-82
WP_062881979.1|874787_876050_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	9.8e-136
WP_062881980.1|876046_876955_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	6.6e-118
WP_062881981.1|877150_877918_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	9.7e-70
WP_062881982.1|878730_881292_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	1.3e-30
>prophage 63
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	900755	901769	5168350		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001397354.1|900755_901769_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	2.3e-26
>prophage 64
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	909244	910210	5168350		Tetraselmis_virus(100.0%)	1	NA	NA
WP_062881986.1|909244_910210_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.6	4.0e-36
>prophage 65
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	915676	921236	5168350	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_000132231.1|915676_916174_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
WP_062881988.1|916253_917315_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	2.0e-113
WP_000140506.1|917557_918058_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_062881989.1|918185_920816_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|921050_921236_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 66
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	934286	939582	5168350		Bacillus_virus(25.0%)	4	NA	NA
WP_000985494.1|934286_935489_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777969.1|935844_936804_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_000080944.1|938929_939340_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	2.7e-18
WP_001223227.1|939336_939582_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 67
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	943518	947643	5168350		Clostridium_phage(50.0%)	4	NA	NA
WP_000522428.1|943518_943968_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.6e-06
WP_062881996.1|943968_944631_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001295173.1|944651_946052_-	GABA permease	NA	NA	NA	NA	NA
WP_001364906.1|946362_947643_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	7.1e-33
>prophage 68
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	960941	962453	5168350		unidentified_phage(100.0%)	1	NA	NA
WP_062882002.1|960941_962453_+	recombinase family protein	NA	H7BUV7	unidentified_phage	25.2	9.0e-11
>prophage 69
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	966197	1053358	5168350	tRNA,plate,terminase,integrase,tail,head,capsid,lysis,portal	Salmonella_phage(60.0%)	94	975462:975506	1010491:1010535
WP_096851740.1|966197_966332_+	PapI protein	NA	A0A0N7BTS3	Escherichia_phage	88.5	2.5e-05
WP_001254221.1|966579_966762_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	98.3	1.3e-28
WP_062881838.1|967265_969038_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	98.8	0.0e+00
WP_095585894.1|970328_970928_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	96.5	3.1e-108
WP_101975617.1|971079_972393_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.0	5.9e-75
WP_001101698.1|972394_972664_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	4.9e-45
WP_062882638.1|972774_973356_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	55.3	2.1e-48
WP_074434107.1|973428_974058_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	2.1e-78
WP_062882639.1|974139_974781_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	98.6	4.8e-107
WP_062882640.1|974941_975190_-	DinI family protein	NA	A5LH55	Enterobacteria_phage	98.8	5.4e-38
975462:975506	attL	TGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_096851621.1|975622_976654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021534483.1|976656_977676_-|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	94.0	6.4e-186
WP_021534482.1|977679_978309_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	55.0	6.1e-62
WP_000102105.1|978432_978675_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_096851623.1|978707_979217_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	94.1	7.3e-82
WP_000956176.1|979224_979521_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
WP_001747374.1|979638_979980_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	97.3	6.6e-55
WP_001244228.1|980047_980281_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_000752613.1|980280_980508_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000145290.1|980504_980807_+	DUF3850 domain-containing protein	NA	A0A0A8WI22	Clostridium_phage	42.1	9.8e-10
WP_096851624.1|980803_981661_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.8	7.8e-161
WP_096851625.1|981657_984072_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.8	0.0e+00
WP_001154434.1|984225_984414_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|984424_984658_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_096851626.1|984979_986872_+	NTPase KAP	NA	NA	NA	NA	NA
WP_032344223.1|987355_987649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096211030.1|987694_988720_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.1	2.1e-173
WP_001098462.1|988719_990486_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000216248.1|990628_991462_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	8.2e-123
WP_024046822.1|991478_992537_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
WP_096851627.1|992540_993191_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	94.0	4.7e-110
WP_106879232.1|993286_993751_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.1e-76
WP_000868175.1|993750_993954_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|993957_994173_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001341072.1|994192_994666_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
WP_000730948.1|994667_995045_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	39.2	1.1e-15
WP_024225818.1|995041_995470_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.2	4.2e-46
WP_001039936.1|995565_995997_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	1.3e-71
WP_024225817.1|995989_996436_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.1e-62
WP_000993752.1|996504_997083_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	8.8e-92
WP_000177597.1|997079_997439_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.7	2.8e-51
WP_000268279.1|997425_998334_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.1	1.3e-142
WP_001086824.1|998326_998932_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	93.0	1.8e-111
WP_021546685.1|1000352_1000793_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.7	4.7e-53
WP_061352336.1|1000764_1001316_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	91.8	1.1e-91
WP_000905030.1|1001940_1002507_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	3.2e-86
WP_000046120.1|1002649_1003822_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.1e-204
WP_001207660.1|1003831_1004347_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281009.1|1004401_1004704_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|1004718_1004838_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_096851630.1|1004830_1007992_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	59.6	1.8e-308
WP_000980416.1|1007988_1008474_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	8.3e-67
WP_096851631.1|1008470_1009571_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.5	3.4e-177
WP_000980501.1|1009639_1009858_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	77.8	7.5e-28
WP_000391795.1|1009884_1010367_-	hypothetical protein	NA	Q19UP0	Mannheimia_phage	34.3	2.7e-17
WP_000162571.1|1011067_1011550_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1010491:1010535	attR	TGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000600190.1|1011681_1012158_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|1012147_1012438_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|1012499_1012841_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|1012989_1014651_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|1014736_1015615_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001364786.1|1015737_1016331_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_077879218.1|1016385_1017672_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|1017692_1018484_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_062882641.1|1018650_1020012_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|1020148_1020397_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|1020415_1020964_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|1020994_1021762_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|1021803_1022151_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589825.1|1022227_1022710_-	OmpA family protein	NA	NA	NA	NA	NA
WP_074434108.1|1022725_1023952_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|1023941_1024460_-	YfiR family protein	NA	NA	NA	NA	NA
WP_000976004.1|1024609_1024975_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168045.1|1025184_1026255_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225221.1|1026265_1027387_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200116.1|1027429_1028590_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|1028689_1028737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|1028840_1029182_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|1029452_1030190_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079107.1|1030324_1031305_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_062882642.1|1031301_1032033_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|1032162_1034736_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_062882028.1|1040515_1041814_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001300818.1|1041810_1042134_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949248.1|1042179_1043535_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_062882029.1|1043648_1046309_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001300438.1|1046340_1047039_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|1047107_1047527_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|1047733_1048771_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_062882030.1|1048818_1049508_-	uracil-DNA glycosylase	NA	A0A1L2JU97	Alcelaphine_gammaherpesvirus	51.5	1.3e-54
WP_000627807.1|1049810_1050194_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189207.1|1050249_1050837_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001445929.1|1050939_1051821_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219195.1|1052029_1053358_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 70
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1059130	1062873	5168350		Tupanvirus(50.0%)	3	NA	NA
WP_096851521.1|1059130_1060930_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|1060945_1061920_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|1062192_1062873_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 71
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1066332	1066593	5168350		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|1066332_1066593_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 72
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1070712	1082002	5168350		Bacillus_phage(50.0%)	7	NA	NA
WP_024226035.1|1070712_1074600_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	1.3e-130
WP_001298980.1|1075157_1076585_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	2.3e-16
WP_001215861.1|1076749_1077463_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001364808.1|1077452_1078787_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717694.1|1078847_1079186_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_062882035.1|1079230_1080421_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919159.1|1080748_1082002_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 73
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1087758	1089270	5168350		Staphylococcus_phage(100.0%)	1	NA	NA
WP_062882036.1|1087758_1089270_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	8.7e-14
>prophage 74
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1104406	1110863	5168350		Faustovirus(20.0%)	8	NA	NA
WP_062882042.1|1104406_1105621_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|1105648_1106035_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|1106051_1106375_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_062882043.1|1106470_1106986_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196636.1|1107002_1108853_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.4	8.0e-102
WP_001124469.1|1108854_1109190_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523616.1|1109201_1109402_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000133602.1|1109579_1110863_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.2e-34
>prophage 75
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1120747	1121179	5168350		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|1120747_1121179_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 76
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1130009	1136306	5168350		Escherichia_phage(60.0%)	6	NA	NA
WP_000937929.1|1130009_1131380_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.8	4.0e-42
WP_001299507.1|1131541_1133008_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_062882050.1|1133076_1134654_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001392461.1|1134748_1135261_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	91.8	5.0e-38
WP_000669402.1|1135303_1135819_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.0e-62
WP_001344399.1|1136132_1136306_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
>prophage 77
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1142741	1146743	5168350		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_001028618.1|1142741_1143380_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	4.0e-29
WP_062882052.1|1143379_1144417_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.0	6.9e-71
WP_001295473.1|1144741_1145368_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198328.1|1145453_1146743_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
>prophage 78
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1167986	1168700	5168350		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|1167986_1168700_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 79
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1186634	1187585	5168350		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|1186634_1187585_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 80
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1206345	1211274	5168350		Deep-sea_thermophilic_phage(33.33%)	6	NA	NA
WP_062882344.1|1206345_1207206_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
WP_000406000.1|1207419_1207845_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_001399260.1|1207831_1208281_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000838944.1|1208341_1208917_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001364787.1|1209012_1209912_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_001315775.1|1209969_1211274_-	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
>prophage 81
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1214750	1230120	5168350		Streptococcus_phage(33.33%)	15	NA	NA
WP_062882342.1|1214750_1215542_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	3.0e-18
WP_000290222.1|1215712_1216729_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000458420.1|1216728_1217562_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000852686.1|1217561_1218437_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000021036.1|1218426_1219524_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_062882341.1|1219657_1220569_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.6	1.7e-57
WP_000719925.1|1220571_1220940_-	YfeK family protein	NA	NA	NA	NA	NA
WP_062882340.1|1221044_1221896_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000522247.1|1221937_1222447_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000623136.1|1222487_1224215_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000487600.1|1224259_1224517_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034402.1|1224900_1225872_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000254839.1|1226056_1226818_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_096851517.1|1227047_1228034_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_062882338.1|1228104_1230120_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.3	3.2e-149
>prophage 82
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1233458	1347207	5168350	tRNA,plate,tail,integrase,transposase,holin,protease	Enterobacteria_phage(53.19%)	103	1273353:1273369	1300475:1300491
WP_000695657.1|1233458_1234874_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_024226072.1|1234924_1235317_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000472021.1|1235318_1235678_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_062881724.1|1236297_1238487_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_000376337.1|1238536_1239739_-	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_000186380.1|1240074_1241313_+	Mn(2+) uptake NRAMP transporter MntH	NA	NA	NA	NA	NA
WP_000490072.1|1241453_1241780_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_062881725.1|1241894_1243151_-	ion channel protein	NA	NA	NA	NA	NA
WP_062881726.1|1243354_1244320_+	glucokinase	NA	NA	NA	NA	NA
WP_000038456.1|1244539_1244866_+	fructose-like phosphotransferase enzyme IIB component 1	NA	NA	NA	NA	NA
WP_062881727.1|1244887_1246135_+	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_106879234.1|1246149_1247235_+	aminopeptidase	NA	NA	NA	NA	NA
WP_024226596.1|1247234_1248272_+	aminopeptidase	NA	NA	NA	NA	NA
WP_062881729.1|1248296_1250792_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_001295458.1|1251664_1252399_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
WP_062881730.1|1252413_1254111_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000785931.1|1254487_1255726_+	alanine transaminase	NA	NA	NA	NA	NA
WP_010723117.1|1255790_1255862_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_000484404.1|1256217_1257138_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
WP_000639883.1|1257490_1257733_+	YfdY family protein	NA	NA	NA	NA	NA
WP_000867637.1|1257809_1258085_-	colanic acid biosynthesis lipoprotein YpdI	NA	NA	NA	NA	NA
WP_000825599.1|1258380_1259013_+	YfdX family protein	NA	NA	NA	NA	NA
WP_000106759.1|1259525_1260776_+	formyl-CoA transferase	NA	NA	NA	NA	NA
WP_062881731.1|1260829_1262524_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	4.7e-24
WP_000955028.1|1262593_1263538_+	transporter YfdV	NA	NA	NA	NA	NA
WP_085949012.1|1263670_1264365_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_074465645.1|1264436_1265531_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_074433971.1|1265586_1269180_-	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	1.3e-36
WP_000991370.1|1269184_1269799_-	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_024226601.1|1270214_1271378_+	multidrug efflux MFS transporter periplasmic adaptor subunit EmrK	NA	NA	NA	NA	NA
WP_001018714.1|1271377_1272916_+	multidrug efflux MFS transporter permease subunit EmrY	NA	NA	NA	NA	NA
1273353:1273369	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001344440.1|1274817_1275813_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_024231033.1|1275820_1277254_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	9.1e-29
WP_064234920.1|1279797_1280499_+	Replication protein P	NA	A0A1U9AJJ8	Stx1_converting_phage	100.0	3.4e-130
WP_000145931.1|1280495_1280786_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_001000127.1|1280856_1281135_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000103679.1|1281267_1281483_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001281772.1|1281493_1281730_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000814576.1|1281686_1282133_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_000153269.1|1282129_1282657_+	phage N-6-adenine-methyltransferase	NA	H6WZI7	Escherichia_phage	99.4	1.2e-100
WP_074433983.1|1282653_1282794_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	1.0e-14
WP_101974057.1|1282829_1283525_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	97.8	3.1e-131
WP_062882575.1|1283885_1284620_+	antirepressor	NA	A0A0N7C203	Escherichia_phage	99.6	5.5e-123
WP_001004008.1|1284694_1285417_+	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	99.6	3.9e-129
WP_001108006.1|1285416_1286022_+	recombination protein NinG	NA	Q8VNP2	Enterobacteria_phage	100.0	1.9e-97
WP_000144764.1|1286018_1286213_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204862.1|1286205_1286640_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	99.3	1.8e-81
WP_001356551.1|1286888_1287041_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000142777.1|1289824_1290004_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.4e-24
WP_001290217.1|1290044_1290317_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
WP_000284506.1|1290393_1290609_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_101974059.1|1290995_1291727_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	99.6	4.2e-123
WP_101975621.1|1291793_1292393_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.0	8.2e-109
WP_101974060.1|1292457_1293771_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.9	4.8e-77
WP_001101698.1|1293772_1294042_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	4.9e-45
WP_101974061.1|1294147_1295029_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	89.4	1.1e-144
WP_001247930.1|1295259_1295958_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_062881455.1|1296054_1297221_-|integrase	prophage integrase IntS	integrase	Q716F9	Shigella_phage	98.7	1.6e-220
WP_062881454.1|1297532_1298465_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	2.1e-167
WP_000776768.1|1298758_1299514_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_062881453.1|1299695_1300754_-	hypothetical protein	NA	NA	NA	NA	NA
1300475:1300491	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001296861.1|1301119_1302460_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_001296869.1|1302831_1303116_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_062881452.1|1303296_1304607_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_062881451.1|1304606_1306751_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_001195819.1|1306953_1307439_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_062881450.1|1308113_1308677_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_157911462.1|1311422_1311662_+	fimbrial protein	NA	NA	NA	NA	NA
WP_062881449.1|1311658_1312183_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001323815.1|1312184_1313042_+	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_062881448.1|1313163_1313715_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001298774.1|1313880_1314813_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000918470.1|1314847_1315933_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001043819.1|1315936_1316761_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000447361.1|1316760_1317570_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_001089241.1|1317569_1318118_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000559764.1|1318151_1318430_+	YfcL family protein	NA	NA	NA	NA	NA
WP_062881447.1|1318550_1320557_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817183.1|1320715_1321936_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000127772.1|1322244_1323423_+	MFS transporter	NA	NA	NA	NA	NA
WP_000615813.1|1323419_1324415_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_001539236.1|1324683_1325577_-	type VI secretion-associated protein	NA	NA	NA	NA	NA
WP_001173929.1|1325581_1325914_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_000078920.1|1326176_1326317_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_062881446.1|1326508_1326769_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_085952403.1|1328771_1329985_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_106879235.1|1330133_1330457_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.9	3.2e-43
WP_000005431.1|1330614_1331799_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	8.1e-225
WP_000290450.1|1331798_1332311_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665314.1|1332365_1332731_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_001391627.1|1332766_1332895_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	95.2	1.5e-15
WP_062881740.1|1332881_1335689_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	95.8	0.0e+00
WP_000979946.1|1335701_1336190_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	8.8e-85
WP_000954205.1|1336346_1336919_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000144022.1|1336962_1337541_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	2.9e-95
WP_000108515.1|1337540_1340003_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	97.2	8.1e-110
WP_000071702.1|1340005_1340536_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	5.1e-94
WP_001111955.1|1340528_1341425_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.1e-154
WP_001435533.1|1341428_1341779_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	2.7e-59
WP_085952403.1|1341852_1343065_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_074434101.1|1344158_1345316_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.3	1.7e-22
WP_001289165.1|1345381_1346395_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_106879236.1|1346394_1347207_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 83
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1351792	1353310	5168350		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|1351792_1353310_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 84
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1357521	1359382	5168350		Planktothrix_phage(50.0%)	2	NA	NA
WP_001293612.1|1357521_1358295_+	histidine ABC transporter ATP-binding protein HisP	NA	G9BWD6	Planktothrix_phage	38.1	2.4e-23
WP_001625563.1|1358491_1359382_+	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	43.9	1.2e-66
>prophage 85
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1369940	1373168	5168350		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001203389.1|1369940_1370591_+	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	34.3	5.2e-08
WP_001012899.1|1370677_1372510_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000813862.1|1372568_1373168_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 86
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1409519	1412534	5168350		Enterobacteria_phage(50.0%)	2	NA	NA
WP_096851524.1|1409519_1410482_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A0A075B8F6	Enterobacteria_phage	32.6	2.8e-34
WP_001297077.1|1411931_1412534_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
>prophage 87
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1416138	1420454	5168350	transposase	Oenococcus_phage(50.0%)	4	NA	NA
WP_062882628.1|1416138_1417344_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	27.7	1.0e-25
WP_062882607.1|1417400_1418690_+	MFS transporter	NA	NA	NA	NA	NA
WP_000992988.1|1418707_1419511_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_000140587.1|1419551_1420454_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	55.2	1.1e-69
>prophage 88
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1426347	1440533	5168350		Pseudomonas_phage(33.33%)	8	NA	NA
WP_062882604.1|1426347_1427424_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_000301049.1|1427886_1428537_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000135040.1|1428590_1428845_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_024177745.1|1428844_1429975_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	4.3e-175
WP_062882603.1|1430208_1432494_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.4	4.3e-283
WP_062882602.1|1433189_1436909_+	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	24.1	3.1e-20
WP_062882601.1|1437036_1437759_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_001281242.1|1437905_1440533_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
>prophage 89
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1450127	1452977	5168350		Hokovirus(100.0%)	1	NA	NA
WP_000876014.1|1450127_1452977_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
>prophage 90
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1457139	1462829	5168350		Enterobacteria_phage(33.33%)	5	NA	NA
WP_062882597.1|1457139_1458243_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.6	3.6e-118
WP_062882596.1|1458353_1459409_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_062882595.1|1459482_1460460_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.7e-18
WP_000884916.1|1460459_1461110_+	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
WP_024226453.1|1461185_1462829_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	1.2e-13
>prophage 91
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1471597	1472215	5168350		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|1471597_1472215_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 92
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1483919	1491568	5168350		Vibrio_phage(50.0%)	7	NA	NA
WP_062882591.1|1483919_1484927_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
WP_096851528.1|1485065_1485350_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000578083.1|1485474_1487235_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	1.9e-100
WP_001234850.1|1487384_1488080_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_062882590.1|1488107_1489298_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	6.4e-20
WP_000202798.1|1489630_1489975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194928.1|1489978_1491568_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
>prophage 93
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1497322	1501622	5168350		Clostridioides_phage(50.0%)	4	NA	NA
WP_000241011.1|1497322_1497889_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_001296828.1|1498299_1499013_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000198791.1|1499051_1500038_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_024226444.1|1500155_1501622_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	5.1e-43
>prophage 94
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1516118	1516976	5168350		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|1516118_1516976_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 95
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1521046	1524832	5168350		Acinetobacter_phage(50.0%)	3	NA	NA
WP_062882581.1|1521046_1523038_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
WP_024231156.1|1523069_1523906_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001139613.1|1524163_1524832_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 96
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1528526	1530047	5168350		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255039.1|1528526_1530047_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 97
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1536055	1649463	5168350	tRNA,terminase,integrase,tail,head,capsid,transposase,lysis,holin,protease	Enterobacteria_phage(38.67%)	115	1533766:1533782	1616432:1616448
1533766:1533782	attL	GAATTATTTAGAGTATA	NA	NA	NA	NA
WP_000968208.1|1536055_1536751_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_001295452.1|1536747_1537146_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_062882626.1|1537385_1538336_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_000691708.1|1538723_1538807_-	protein YohP	NA	NA	NA	NA	NA
WP_001078129.1|1539030_1540467_+	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_000079520.1|1540519_1541281_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001296821.1|1541410_1541989_-	DedA family protein	NA	NA	NA	NA	NA
WP_001295454.1|1542158_1542746_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_001295432.1|1542919_1543852_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_062882579.1|1543889_1545605_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_000871510.1|1545800_1548098_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_001131274.1|1548349_1549267_+	glycine betaine ABC transporter substrate-binding protein OsmF	NA	NA	NA	NA	NA
WP_000220837.1|1549273_1550431_+	glycine betaine ABC transporter permease YehY	NA	NA	NA	NA	NA
WP_062882576.1|1550423_1551350_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G9BWD6	Planktothrix_phage	35.1	3.3e-24
WP_000783120.1|1551354_1552086_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1552066_1552174_-	protein YohO	NA	NA	NA	NA	NA
WP_029208472.1|1552233_1552935_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.9e-102
WP_000063648.1|1552955_1554242_-|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1554275_1554530_-	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1554548_1554683_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1554686_1554929_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_095585854.1|1555016_1555277_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	82.3	1.5e-43
WP_021351746.1|1555767_1556538_-	ead/Ea22-like family protein	NA	Q6H9Z5	Enterobacteria_phage	98.8	6.2e-141
WP_000763383.1|1556534_1556756_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001443983.1|1556854_1557136_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000548537.1|1557146_1557338_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149544.1|1557310_1557493_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000611716.1|1557489_1558170_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000100847.1|1558166_1558952_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1558957_1559254_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_000372941.1|1559329_1559473_-	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_001198861.1|1559441_1559606_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_072617038.1|1559678_1560047_-	DUF2528 family protein	NA	A0A1U9AJB3	Stx1_converting_phage	100.0	2.0e-65
WP_001502698.1|1560197_1560668_-	hypothetical protein	NA	A0A1U9AJ69	Stx1_converting_phage	100.0	1.7e-88
WP_101974067.1|1560712_1561926_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.0	8.4e-169
WP_000198444.1|1562039_1562423_-	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_096851726.1|1563078_1564125_-	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	99.4	1.3e-205
WP_096851725.1|1564118_1564580_-	hypothetical protein	NA	G9L674	Escherichia_phage	99.3	1.9e-76
WP_029793531.1|1564646_1564988_-	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	98.2	2.8e-61
WP_000250473.1|1565048_1565756_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_001180318.1|1565834_1566062_+	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000438542.1|1566200_1566497_+	hypothetical protein	NA	Q6H9X8	Enterobacteria_phage	100.0	5.2e-48
WP_000185454.1|1566529_1567468_+	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
WP_101974068.1|1567464_1568166_+	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.1	8.4e-129
WP_000145931.1|1568162_1568453_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000736913.1|1568526_1568967_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_096851738.1|1568963_1569491_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	98.9	2.3e-99
WP_000335902.1|1569672_1570722_+	hypothetical protein	NA	Q9T208	Enterobacteria_phage	100.0	1.3e-181
WP_101974069.1|1570873_1571596_+	DNA-binding protein	NA	O48426	Enterobacteria_phage	96.7	3.6e-127
WP_101974070.1|1571595_1572201_+	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	99.0	8.1e-96
WP_001028864.1|1572197_1572869_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	96.9	1.6e-129
WP_096851751.1|1572859_1573348_+	antiterminator	NA	Q5TJL7	Enterobacteria_phage	99.4	7.7e-89
WP_101974071.1|1574425_1576276_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_000411802.1|1576568_1576775_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_001135289.1|1576774_1577272_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	97.0	2.4e-90
WP_000092313.1|1577268_1577706_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	96.6	4.2e-70
WP_000839224.1|1577908_1578406_+	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|1578402_1578660_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095736.1|1579122_1579350_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279804.1|1579391_1579757_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	4.0e-66
WP_000958372.1|1580045_1580609_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.5	3.3e-83
WP_101974072.1|1580605_1582267_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	98.6	0.0e+00
WP_106879237.1|1582330_1584268_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	98.9	0.0e+00
WP_001063096.1|1584312_1584534_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000125988.1|1587060_1587387_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_101975674.1|1587396_1587747_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	1.0e-58
WP_000573391.1|1587743_1588190_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1588186_1588531_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275466.1|1588596_1589313_+|tail	tail protein	tail	B6DZA6	Enterobacteria_phage	99.6	2.8e-127
WP_000710949.1|1589327_1589702_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001513217.1|1589797_1590007_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000807964.1|1593289_1593631_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001152185.1|1593630_1594329_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.7	3.1e-131
WP_101975778.1|1594339_1595083_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	96.3	7.5e-144
WP_122997399.1|1595028_1595661_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	95.7	3.5e-102
WP_101974076.1|1595896_1599373_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.6	0.0e+00
WP_001230412.1|1599439_1600039_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	100.0	1.0e-111
WP_101974060.1|1600103_1601417_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.9	4.8e-77
WP_001101698.1|1601418_1601688_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	4.9e-45
WP_096851743.1|1601798_1602380_+	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	60.0	4.3e-54
WP_096851744.1|1602711_1603956_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	91.1	2.0e-229
WP_072148138.1|1604608_1605019_-	secretion protein EspV	NA	Q6H9S1	Enterobacteria_phage	99.3	5.5e-72
WP_085949012.1|1605805_1606499_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_062882067.1|1606697_1608383_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.3	8.1e-303
WP_000598641.1|1608379_1609099_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_062882068.1|1609145_1609616_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.6e-81
WP_062882069.1|1609655_1610117_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	2.4e-76
WP_062882070.1|1610241_1611639_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	67.0	2.9e-237
WP_062882071.1|1611635_1612772_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.2e-162
WP_096851674.1|1612764_1615044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024226433.1|1615054_1616143_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636938.1|1616448_1616766_-	hypothetical protein	NA	NA	NA	NA	NA
1616432:1616448	attR	GAATTATTTAGAGTATA	NA	NA	NA	NA
WP_001343818.1|1620215_1620458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295427.1|1624402_1626436_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_062882073.1|1626567_1627677_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_024177741.1|1627939_1628221_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|1628512_1629055_+	fimbrial protein	NA	NA	NA	NA	NA
WP_024184427.1|1629135_1629810_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_085949012.1|1631220_1631915_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_062881463.1|1633095_1634130_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153074.1|1634211_1634550_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_024231052.1|1634771_1635617_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1635736_1636009_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195589.1|1636231_1637020_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822274.1|1637016_1637817_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001351455.1|1637881_1638700_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
WP_000434038.1|1638751_1639498_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062881585.1|1640433_1641438_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	2.2e-13
WP_071796522.1|1641434_1642646_-	MFS transporter	NA	NA	NA	NA	NA
WP_062881586.1|1642967_1644020_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000289788.1|1644327_1645182_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000182904.1|1646487_1646940_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_062881587.1|1646970_1647255_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_024226538.1|1647258_1648614_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_085949012.1|1648769_1649463_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
>prophage 98
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1653397	1658310	5168350	tRNA	Bacillus_phage(66.67%)	6	NA	NA
WP_062882551.1|1653397_1654759_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	1.6e-216
WP_001220181.1|1654861_1655158_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001307279.1|1655159_1655456_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000929408.1|1655664_1655997_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137873.1|1656187_1656910_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
WP_000675150.1|1656906_1658310_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 99
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1667513	1682561	5168350	tail,terminase,integrase	Enterobacteria_phage(35.71%)	21	1658736:1658751	1678870:1678885
1658736:1658751	attL	TACCCGACGATAACCA	NA	NA	NA	NA
WP_032204680.1|1667513_1668587_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	95.8	9.7e-193
WP_001303849.1|1668564_1668783_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_001281190.1|1668889_1669234_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	99.1	1.5e-59
WP_062881863.1|1670295_1671255_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|1671592_1671715_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|1671729_1672419_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_158638458.1|1672602_1673346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|1673431_1673590_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_134792477.1|1673670_1673904_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	4.0e-11
WP_100224537.1|1674583_1674814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062881662.1|1674972_1675506_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	95.5	2.4e-99
WP_001303555.1|1675661_1675844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|1675856_1675988_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|1676215_1676401_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|1676927_1677242_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|1677323_1677548_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_062881478.1|1677942_1678440_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.5	1.0e-11
WP_021351651.1|1679888_1680260_+	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
1678870:1678885	attR	TGGTTATCGTCGGGTA	NA	NA	NA	NA
WP_106879238.1|1680388_1681213_-	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.2	9.8e-153
WP_000950982.1|1681436_1682318_-	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_074433962.1|1682423_1682561_-|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	95.6	3.7e-17
>prophage 100
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1690597	1691950	5168350		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469735.1|1690597_1691950_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.6	4.6e-06
>prophage 101
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1696615	1707268	5168350		Catovirus(20.0%)	8	NA	NA
WP_053904481.1|1696615_1697257_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	4.2e-34
WP_001234767.1|1697348_1697930_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_096851596.1|1697951_1699805_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001339006.1|1700255_1701839_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_000978094.1|1702497_1703637_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000482901.1|1703642_1704086_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_001543932.1|1704088_1706251_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000654503.1|1706428_1707268_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
>prophage 102
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1711511	1718305	5168350		Synechococcus_phage(25.0%)	6	NA	NA
WP_000048190.1|1711511_1712633_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
WP_000043590.1|1712635_1713601_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	1.3e-87
WP_000479841.1|1713603_1714083_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_045903815.1|1714079_1715303_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_053904478.1|1715305_1716742_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.6	5.1e-48
WP_024226081.1|1716934_1718305_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.6	2.9e-32
>prophage 103
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1725371	1731404	5168350		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000183032.1|1725371_1726265_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
WP_024226088.1|1726637_1727723_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.8	3.6e-102
WP_024226089.1|1727722_1728622_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	1.5e-29
WP_024226090.1|1728679_1729570_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	63.7	1.4e-104
WP_096851598.1|1729559_1730825_+	O177 family O-antigen flippase	NA	NA	NA	NA	NA
WP_024226092.1|1730837_1731404_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.8	1.9e-54
>prophage 104
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1734703	1742512	5168350		Klosneuvirus(50.0%)	7	NA	NA
WP_024226096.1|1734703_1735738_+	UDP-N-acetylglucosamine 4,6-dehydratase/5-epimerase	NA	A0A1V0SJP4	Klosneuvirus	33.8	1.3e-37
WP_024226097.1|1735739_1736846_+	capsular polysaccharide biosynthesis protein CapF	NA	NA	NA	NA	NA
WP_032204450.1|1736842_1737973_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	47.3	2.4e-101
WP_045903811.1|1737972_1739181_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_024226100.1|1739171_1739579_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_000043483.1|1739690_1741097_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
WP_053904475.1|1741345_1742512_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	51.9	8.5e-110
>prophage 105
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1749951	1750851	5168350		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|1749951_1750851_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 106
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1760029	1849633	5168350	plate,tail,integrase,head,transposase,holin,protease	Escherichia_phage(40.3%)	105	1774945:1774961	1859081:1859097
WP_001254932.1|1760029_1761181_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001200891.1|1761671_1762730_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|1762901_1763231_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_158638995.1|1763389_1763857_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_085952403.1|1763923_1765136_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_000973176.1|1767116_1767662_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_024226617.1|1767658_1768402_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_024226619.1|1768413_1769493_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986346.1|1769554_1770490_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011483.1|1770946_1771864_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011017.1|1771965_1772916_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122985555.1|1773033_1774677_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
1774945:1774961	attL	TTTTTTGATTTCTGTGT	NA	NA	NA	NA
WP_000532912.1|1775305_1776022_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|1776364_1777819_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_062882557.1|1777920_1779237_-	shikimate transporter	NA	NA	NA	NA	NA
WP_062882558.1|1779551_1780604_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_101974093.1|1784161_1785375_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.0	3.5e-167
WP_001515476.1|1789743_1790541_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000693883.1|1791480_1791906_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_101975632.1|1791977_1793048_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.7	8.5e-64
WP_101974178.1|1793054_1793801_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	82.8	1.8e-113
WP_000450617.1|1793822_1794539_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
WP_000603384.1|1794571_1794853_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|1794849_1795077_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|1795069_1795381_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_044809747.1|1795477_1795726_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	78.6	2.2e-23
WP_000104474.1|1795727_1796285_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|1796518_1796731_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|1796850_1797195_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_062882007.1|1797316_1797589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265233.1|1797590_1798640_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.4e-110
WP_001217447.1|1798652_1799012_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_062882008.1|1799020_1799575_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	66.9	6.8e-65
WP_101974095.1|1799799_1799997_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	95.4	7.5e-27
WP_000301785.1|1800131_1800845_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000528251.1|1801598_1802336_-	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
WP_001310452.1|1802289_1802490_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_115801860.1|1802604_1803069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001114104.1|1803107_1803353_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000144787.1|1803388_1803571_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_010917876.1|1803717_1805757_-	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000904930.1|1805856_1806417_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917875.1|1806638_1806842_+|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000420351.1|1806921_1807443_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_000469162.1|1807477_1808389_-|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000301577.1|1808388_1808949_-	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_001146835.1|1808939_1810022_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000763330.1|1810021_1810459_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_000980532.1|1810451_1811066_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000098807.1|1811055_1812180_-|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000146116.1|1812163_1813513_-	DMT family permease	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000113523.1|1813499_1815575_-	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	3.7e-71
WP_000213225.1|1815701_1816178_-	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000015473.1|1816192_1816558_-|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000606747.1|1816566_1818069_-|tail	tail protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000848437.1|1818065_1818311_-	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000627431.1|1818311_1818872_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_001104956.1|1818868_1819288_-	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_001002052.1|1819284_1819713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001142982.1|1819756_1820704_-|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_000850822.1|1820703_1821828_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.9	2.9e-78
WP_032311117.1|1822004_1822478_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	1.7e-37
WP_000046901.1|1822599_1823931_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.8	3.9e-151
WP_000532592.1|1823914_1825504_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	1.4e-168
WP_001057665.1|1825503_1827168_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	8.1e-231
WP_000360581.1|1827167_1827749_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001279082.1|1827751_1828042_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	4.7e-25
WP_000270159.1|1828038_1828347_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_000342747.1|1828327_1828555_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001122256.1|1828564_1828783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801859.1|1828766_1829195_-	endopeptidase	NA	NA	NA	NA	NA
WP_001125304.1|1829229_1829730_-	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_000852377.1|1829801_1830227_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001214366.1|1830296_1830806_-	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	41.9	1.1e-26
WP_000378480.1|1830802_1831099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086886.1|1831088_1831286_-	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_001310453.1|1831278_1831611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310341.1|1831626_1831977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633440.1|1831991_1832303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973023.1|1832299_1832851_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000465562.1|1832854_1833370_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
WP_000578573.1|1833369_1833903_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	66.7	5.9e-66
WP_050863685.1|1833906_1834449_-	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	39.4	4.9e-28
WP_001129553.1|1834546_1835077_-	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000049306.1|1835088_1835382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049432.1|1835386_1835659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|1835655_1835937_-	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_001057199.1|1835938_1836193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000257930.1|1836205_1836427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000129790.1|1836429_1837362_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_001512118.1|1837433_1839524_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	47.4	4.0e-166
WP_001310454.1|1839525_1839774_-	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_001056416.1|1839941_1840526_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	39.8	4.2e-17
WP_074434003.1|1840802_1841057_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	98.8	1.0e-36
WP_101975633.1|1841534_1843472_+	DUF1737 domain-containing protein	NA	A0A0P0ZBP4	Stx2-converting_phage	96.7	0.0e+00
WP_000143462.1|1843607_1843787_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_001290230.1|1843827_1844073_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|1844150_1844366_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_062881865.1|1844370_1844904_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	97.7	1.3e-100
WP_001056883.1|1845178_1845748_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	99.5	1.5e-104
WP_000455406.1|1845747_1845897_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_129014757.1|1846124_1846310_+	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	4.9e-20
WP_001302717.1|1846835_1847150_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_085952403.1|1847216_1848429_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_001079070.1|1849102_1849633_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	99.1	1.6e-55
1859081:1859097	attR	ACACAGAAATCAAAAAA	NA	NA	NA	NA
>prophage 107
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1853951	1866423	5168350		Bacillus_phage(28.57%)	12	NA	NA
WP_001339045.1|1853951_1854623_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_024226228.1|1854622_1855981_+	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.2	8.7e-05
WP_000218207.1|1856088_1856940_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000824375.1|1857531_1858695_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.2	7.2e-109
WP_001313057.1|1859261_1859627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024226227.1|1859666_1860362_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.4	8.1e-07
WP_106879240.1|1860428_1861847_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	2.3e-101
WP_000786005.1|1861827_1862298_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.0e-33
WP_062882157.1|1862286_1863207_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_062882158.1|1863379_1864297_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009307.1|1864375_1864558_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_077879202.1|1864728_1866423_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
>prophage 108
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1880441	1881110	5168350		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_062882169.1|1880441_1881110_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	9.6e-82
>prophage 109
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1892771	1893524	5168350		Planktothrix_phage(100.0%)	1	NA	NA
WP_001272991.1|1892771_1893524_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G9BWD6	Planktothrix_phage	41.4	6.0e-32
>prophage 110
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1905514	1907029	5168350		Staphylococcus_phage(100.0%)	1	NA	NA
WP_062882181.1|1905514_1907029_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 111
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1917113	1922757	5168350		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_062882184.1|1917113_1918775_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.5	1.6e-08
WP_062882185.1|1918820_1920422_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.6	4.4e-16
WP_062882186.1|1920440_1921301_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036371.1|1921303_1922353_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|1922367_1922757_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
>prophage 112
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1928011	1929745	5168350	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025322.1|1928011_1929745_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
>prophage 113
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1936361	1938412	5168350		Synechococcus_phage(50.0%)	3	NA	NA
WP_000019588.1|1936361_1937105_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|1937145_1937541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000639274.1|1937593_1938412_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
>prophage 114
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1942430	1949496	5168350		Bacillus_virus(50.0%)	9	NA	NA
WP_001295503.1|1942430_1942952_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_024226333.1|1942953_1943556_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_074434035.1|1943626_1943692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|1943830_1944442_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|1944450_1945461_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571478.1|1945609_1946395_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|1946391_1947147_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_024226335.1|1947225_1948158_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|1948173_1949496_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 115
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1953496	1954972	5168350		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|1953496_1954972_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 116
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1963027	1967497	5168350		Klebsiella_phage(33.33%)	7	NA	NA
WP_000944256.1|1963027_1963690_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011652.1|1963713_1964370_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|1964471_1964702_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168747.1|1964840_1965215_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879280.1|1965218_1966091_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976472.1|1966103_1966445_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812722.1|1966840_1967497_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	1.5e-55
>prophage 117
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1974993	1977042	5168350		Moraxella_phage(100.0%)	1	NA	NA
WP_001315679.1|1974993_1977042_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 118
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1982372	1982582	5168350		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|1982372_1982582_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 119
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	1993640	2001746	5168350	tRNA	Pandoravirus(33.33%)	8	NA	NA
WP_000854983.1|1993640_1995002_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	1.5e-41
WP_000457334.1|1995075_1995255_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001307845.1|1995374_1995734_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|1996095_1996440_-	RidA family protein	NA	NA	NA	NA	NA
WP_062881511.1|1996571_1998482_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	7.7e-92
WP_001220994.1|1998539_1999235_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290576.1|1999274_1999856_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_077879183.1|2000060_2001746_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	2.0e-35
>prophage 120
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2016497	2017988	5168350		Bacillus_phage(100.0%)	1	NA	NA
WP_000766132.1|2016497_2017988_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 121
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2024392	2025247	5168350		Indivirus(100.0%)	1	NA	NA
WP_062881521.1|2024392_2025247_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	5.6e-10
>prophage 122
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2037503	2038145	5168350		Tupanvirus(100.0%)	1	NA	NA
WP_062881525.1|2037503_2038145_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.3	1.4e-18
>prophage 123
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2043069	2045031	5168350		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235802.1|2043069_2045031_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 124
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2050629	2051283	5168350		Planktothrix_phage(100.0%)	1	NA	NA
WP_062881528.1|2050629_2051283_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.7	3.8e-14
>prophage 125
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2058047	2059268	5168350		Klosneuvirus(100.0%)	1	NA	NA
WP_062881534.1|2058047_2059268_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.8	3.2e-27
>prophage 126
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2066744	2142349	5168350	tRNA,plate,terminase,tail,integrase,head,capsid,transposase,holin,portal	Enterobacteria_phage(75.51%)	83	2096353:2096377	2130091:2130115
WP_062881537.1|2066744_2067572_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	1.6e-73
WP_062881538.1|2067773_2068112_+	osmotically-inducible lipoprotein OsmE	NA	NA	NA	NA	NA
WP_096851533.1|2068410_2068731_+	PTS N,N'-diacetylchitobiose transporter subunit IIB	NA	NA	NA	NA	NA
WP_085949012.1|2069030_2069724_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_000968919.1|2070999_2071350_+	PTS N,N'-diacetylchitobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_001297656.1|2071360_2072200_+	transcriptional regulator ChbR	NA	NA	NA	NA	NA
WP_000078722.1|2072304_2073657_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_062881540.1|2073669_2074428_+	chitin disaccharide deacetylase	NA	NA	NA	NA	NA
WP_062881541.1|2074685_2076947_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	3.0e-143
WP_001241561.1|2077129_2077393_+	cell division activator CedA	NA	NA	NA	NA	NA
WP_062881542.1|2078489_2079881_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_001297653.1|2080013_2080604_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_062881543.1|2080766_2081435_-	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_000222172.1|2081581_2082118_+	membrane protein	NA	NA	NA	NA	NA
WP_062881544.1|2082158_2083019_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_000146160.1|2083124_2083415_-	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_000251738.1|2083515_2084445_-	6-phosphofructokinase II	NA	NA	NA	NA	NA
WP_062881545.1|2084732_2085491_+	YdiY family protein	NA	NA	NA	NA	NA
WP_001142445.1|2085543_2085651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949012.1|2086082_2086777_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_001144202.1|2089018_2090947_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
WP_001700733.1|2090950_2091493_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|2091589_2091787_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|2091839_2092196_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|2092318_2092363_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_062881547.1|2092645_2093629_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_062881548.1|2093643_2096031_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|2096035_2096335_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
2096353:2096377	attL	GGCCGCTCTGCGGCCTTTTTTCTTT	NA	NA	NA	NA
WP_000078916.1|2096638_2096779_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488099.1|2096969_2097230_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001761908.1|2097348_2098785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078183892.1|2098968_2100078_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	4.1e-194
WP_078345373.1|2100235_2101420_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.5	2.0e-223
WP_000290462.1|2101419_2101932_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000651572.1|2101987_2102362_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_000333503.1|2102370_2102526_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000853433.1|2102512_2105320_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	94.9	0.0e+00
WP_047085907.1|2105332_2105821_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	2.0e-84
WP_000954196.1|2105977_2106550_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000144010.1|2106593_2107172_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	2.2e-95
WP_032276832.1|2107171_2109304_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.4	2.7e-130
WP_000071738.1|2109306_2109837_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	4.3e-93
WP_001111967.1|2109829_2110726_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.9e-154
WP_000213447.1|2110729_2111080_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001271909.1|2111076_2111658_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	1.2e-101
WP_000356339.1|2111654_2112290_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_000920594.1|2112282_2112750_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000780560.1|2112887_2113295_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	4.2e-64
WP_000072327.1|2113291_2113684_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000104350.1|2113680_2114004_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864901.1|2114006_2114207_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063101.1|2114206_2114701_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.8	2.7e-89
WP_000632338.1|2114802_2115603_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	88.7	9.9e-126
WP_001055104.1|2115648_2116701_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
WP_001262657.1|2116724_2117561_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.9	3.0e-149
WP_000613775.1|2117715_2119467_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.6	0.0e+00
WP_000087812.1|2119466_2120513_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_001390707.1|2120999_2121269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211277.1|2121633_2121945_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	5.0e-41
WP_000686499.1|2121949_2122909_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.0e-181
WP_050941416.1|2122985_2125808_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.6	0.0e+00
WP_000599382.1|2125814_2126180_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_000153690.1|2126321_2126567_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	86.4	1.0e-33
WP_000985159.1|2126563_2126767_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	88.1	1.0e-26
WP_000021668.1|2126853_2126967_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	1.2e-08
WP_000514281.1|2126963_2127206_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	4.4e-37
WP_044711780.1|2127217_2127505_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	2.3e-32
WP_000917795.1|2127515_2127854_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	86.2	8.9e-52
WP_001151412.1|2127868_2128147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021112.1|2128242_2128554_+	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	49.5	8.3e-20
WP_050941415.1|2128642_2129578_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	50.8	4.3e-80
WP_000416308.1|2129588_2129984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000956529.1|2130173_2131154_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
2130091:2130115	attR	GGCCGCTCTGCGGCCTTTTTTCTTT	NA	NA	NA	NA
WP_062881549.1|2131216_2131768_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029466.1|2131767_2132517_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_062881550.1|2132594_2133059_+	endopeptidase	NA	S5MM68	Bacillus_phage	34.6	1.0e-10
WP_001299570.1|2133305_2134019_+	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_000175614.1|2134081_2135518_+	YdiU family protein	NA	NA	NA	NA	NA
WP_001270809.1|2135521_2135713_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082226.1|2135844_2136891_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_000368046.1|2137047_2137881_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_062881551.1|2138213_2140592_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.6	2.1e-171
WP_000553693.1|2140648_2142349_-	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	2.1e-32
>prophage 127
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2160941	2166025	5168350		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_000367160.1|2160941_2161310_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
WP_000089364.1|2161318_2162806_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_062882140.1|2162815_2163562_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	3.8e-10
WP_106879243.1|2163536_2164808_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000144589.1|2164804_2166025_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	1.7e-92
>prophage 128
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2174313	2176580	5168350		Escherichia_phage(50.0%)	3	NA	NA
WP_001349911.1|2174313_2174982_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
WP_062882138.1|2174978_2175764_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_000587555.1|2175767_2176580_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 129
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2182079	2190872	5168350		Orpheovirus(20.0%)	9	NA	NA
WP_062882137.1|2182079_2182721_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.4	7.4e-23
WP_000098896.1|2182760_2183909_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_096851554.1|2184200_2185412_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000269501.1|2185524_2186457_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190982.1|2186453_2187479_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000102278.1|2187777_2187867_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_062882136.1|2188032_2189202_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007283.1|2189347_2189929_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000101193.1|2190056_2190872_-	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 130
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2199674	2201173	5168350		Indivirus(50.0%)	2	NA	NA
WP_000250656.1|2199674_2200571_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
WP_062882143.1|2200651_2201173_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.2	5.1e-46
>prophage 131
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2208084	2209359	5168350	tRNA	Pectobacterium_phage(100.0%)	1	NA	NA
WP_062882132.1|2208084_2209359_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	42.0	6.7e-84
>prophage 132
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2229231	2231043	5168350		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945878.1|2229231_2231043_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	100.0	0.0e+00
>prophage 133
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2240938	2242240	5168350		Bacillus_phage(100.0%)	1	NA	NA
WP_062882122.1|2240938_2242240_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	4.2e-17
>prophage 134
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2260001	2264566	5168350		Escherichia_phage(100.0%)	4	NA	NA
WP_062881713.1|2260001_2260616_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	5.1e-29
WP_000526488.1|2260658_2261513_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2261514_2262132_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_096851557.1|2262142_2264566_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.5	3.7e-208
>prophage 135
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2269448	2363683	5168350	terminase,integrase,tail,transposase,holin,portal,protease	Enterobacteria_phage(34.29%)	105	2273890:2273949	2371627:2372392
WP_001364742.1|2269448_2269775_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	5.8e-24
WP_001295394.1|2269980_2271195_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_074433967.1|2271206_2271794_+	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001171554.1|2271882_2272263_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612594.1|2272259_2272607_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	1.8e-60
2273890:2273949	attL	GGTAGTGCATCCAATTAGTAGAACATGTGTTTTTCGATAAACGCTCCGATCACTTTTTCG	NA	NA	NA	NA
WP_085949012.1|2273903_2274598_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_000938103.1|2275123_2275693_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_001303943.1|2276855_2277134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|2277561_2277708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|2277844_2278492_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|2278675_2279266_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_074433998.1|2282033_2282252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113671.1|2282738_2283869_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.1	1.7e-102
WP_000113189.1|2283846_2284095_-	excisionase	NA	NA	NA	NA	NA
WP_000102168.1|2284159_2286604_-	exonuclease	NA	V5UQJ3	Shigella_phage	58.3	8.4e-176
WP_000092782.1|2286696_2286885_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|2286881_2287070_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001302137.1|2287467_2287632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171938.1|2287635_2287854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|2288013_2288169_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001003379.1|2288358_2288766_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000476986.1|2288843_2289071_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705370.1|2289054_2289606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020565.1|2289577_2290618_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.2	6.7e-90
WP_157837342.1|2290529_2291072_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	2.9e-84
WP_096851718.1|2291106_2291865_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	68.4	1.2e-80
WP_000215514.1|2291924_2292110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211435.1|2292457_2293006_+	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	75.4	1.4e-41
WP_000882662.1|2293220_2293433_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000042395.1|2293535_2293853_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001217944.1|2293845_2294217_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001452497.1|2294440_2294668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024177817.1|2294721_2294991_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	52.5	2.7e-11
WP_001265189.1|2294992_2296042_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.4e-110
WP_000904171.1|2296054_2296429_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	4.2e-34
WP_000762902.1|2296425_2297247_+	hypothetical protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
WP_000917733.1|2297473_2297671_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
WP_000483509.1|2297822_2298881_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	2.6e-206
WP_106879244.1|2299475_2301422_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.8	0.0e+00
WP_000143464.1|2301556_2301736_+	DUF1378 family protein	NA	G9L6J3	Escherichia_phage	100.0	1.3e-25
WP_001290212.1|2301776_2302049_+	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000284518.1|2302125_2302341_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001041949.1|2302344_2303136_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_001092902.1|2303647_2304181_+	lysozyme	NA	G9L6J6	Escherichia_phage	96.6	2.1e-100
WP_012816791.1|2304699_2304885_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000373407.1|2305359_2305836_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_001077625.1|2305832_2307956_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102414.1|2307952_2308165_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974564.1|2308164_2309667_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_129014759.1|2309611_2311636_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_001097065.1|2311723_2312050_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|2312042_2312324_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974960.1|2312326_2312950_+	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	99.5	2.5e-100
WP_000682716.1|2312962_2313361_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_078321047.1|2313491_2314121_+	Ig domain-containing protein	NA	Q687F6	Enterobacteria_phage	99.5	8.7e-109
WP_000479062.1|2314134_2314557_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000532073.1|2314583_2314892_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000918276.1|2314935_2317581_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.4	0.0e+00
WP_000847298.1|2317577_2317907_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_080025938.1|2317906_2318605_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	1.5e-130
WP_106879245.1|2318615_2319359_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.4	1.7e-148
WP_096851774.1|2319304_2319934_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	2.3e-101
WP_106879246.1|2320174_2323651_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.5	0.0e+00
WP_101974156.1|2323717_2324317_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.0	5.9e-107
WP_101974170.1|2324381_2325695_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	3.6e-80
WP_001101699.1|2325696_2325966_+|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	98.9	1.9e-44
WP_001131657.1|2326078_2326654_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	1.8e-89
WP_101975638.1|2326726_2327356_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.8	4.6e-78
WP_001143784.1|2327437_2328079_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001261939.1|2328240_2328489_-	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001278450.1|2329312_2329417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902693.1|2329606_2329819_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	6.8e-26
WP_072184779.1|2329986_2330265_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	4.8e-11
WP_001265156.1|2330266_2331316_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.9e-108
WP_096851745.1|2331328_2331688_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.1	6.8e-34
WP_096851746.1|2331684_2332374_+	antiterminator	NA	I6PDF8	Cronobacter_phage	47.6	2.7e-55
WP_000917733.1|2332586_2332784_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
WP_101974173.1|2335439_2337290_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000411802.1|2337737_2337944_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_001208680.1|2338652_2338838_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001303878.1|2339364_2339679_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000074669.1|2339760_2339985_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303046.1|2340026_2340392_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_095585824.1|2340680_2341151_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.1	1.3e-77
WP_053274549.1|2342323_2343772_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.4	8.4e-06
WP_106879247.1|2343784_2343964_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_000414564.1|2344001_2344925_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062881679.1|2345141_2346485_+	VOC family protein	NA	NA	NA	NA	NA
WP_062881680.1|2346709_2348365_+	glucan biosynthesis protein	NA	NA	NA	NA	NA
WP_001296778.1|2348504_2348729_+	YdcH family protein	NA	NA	NA	NA	NA
WP_000140884.1|2348791_2349328_+	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_062881681.1|2349322_2350303_-	LbetaH domain-containing protein	NA	NA	NA	NA	NA
WP_074433957.1|2350426_2351419_+	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_000586728.1|2351415_2352009_+	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001261013.1|2352311_2352980_+	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_074433958.1|2353511_2354720_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.5	3.2e-208
WP_071796541.1|2354759_2355974_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_062881684.1|2356026_2356563_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024177737.1|2356635_2358597_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.9	9.2e-24
WP_000494244.1|2358688_2358919_-	YncJ family protein	NA	NA	NA	NA	NA
WP_032195248.1|2359140_2359317_+	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	56.1	5.2e-11
WP_077879189.1|2359362_2359779_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	4.8e-31
WP_000760615.1|2359857_2361264_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000047456.1|2361508_2362654_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_062881686.1|2362717_2363683_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.4	2.6e-27
2371627:2372392	attR	CGAAAAAGTGATCGGAGCGTTTATCGAAAAACACATGTTCTACTAATTGGATGCACTACCAGTATCGGTATCTACAAGTTGTACAATTTTATCTCTATTAATGTTCACTGTTTTTTGTCCACGCTTTTATATGTAAAGGTGATTTGCTTTTTCTGTATGCTCGTCCAATATAATAATTTTCAAATATATAAATCCGATTATTCTGAAAATATGTTTAAGACTTTTCAATCTTCTTAACTTTAGTGAGTTAAATTCTCTGTATATTTGACAGCTAGTTGGCTGATTTTAAATGCCTTATAACAATTGGCAATATTCTTATTTGGCAATTATAAAAATAGCAACCAGACTTAATAAGTCAAACCAAACGCAATTAAGGAGTCAGTATGAAATTTCAGGCCATTGTATTAGCAAGTTTTCTTGTCATGCCTTATGCGTTGGCAGATGACCAGGGCGGTTTAAAACAGGATGCAGCGCCACCGCCGCCTCATGCAATAGAAGATGGCTATCGCGGAACCGATGATGCAAAAAAAATGACCGTTGATTTCGCAAAAAACATGCACGATGGCGCTTCGGTTTCACTACGCGGTAATTTGATTTCTCACAAAGGAGAGGACCGTTACGTTTTTCGCGATAAGAGCGGTGAAATTAATGTCGTTATTCCTGCGGCCGTCTTTGATGGACGAGAAGTGCAGCCGGACCAGATGATCAACATTAGCGGCAGTCTGGATAAGAAAAGCGCGCCGGCCGTCGTTCGGGTCACTCATTT	NA	NA	NA	NA
>prophage 136
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2367063	2367873	5168350		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000867982.1|2367063_2367873_+	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.0	7.7e-17
>prophage 137
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2372656	2373547	5168350		Bacillus_phage(100.0%)	1	NA	NA
WP_000592822.1|2372656_2373547_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.8e-19
>prophage 138
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2376549	2376933	5168350		Streptococcus_phage(100.0%)	1	NA	NA
WP_000091196.1|2376549_2376933_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 139
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2384678	2386097	5168350		Bacillus_phage(100.0%)	1	NA	NA
WP_000558043.1|2384678_2386097_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 140
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2404798	2406071	5168350	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_101974107.1|2404798_2406071_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.3	7.5e-176
>prophage 141
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2428935	2432742	5168350		Bacillus_virus(50.0%)	2	NA	NA
WP_000426277.1|2428935_2430318_+	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
WP_074433598.1|2430342_2432742_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
>prophage 142
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2438027	2438954	5168350		Planktothrix_phage(100.0%)	1	NA	NA
WP_062881440.1|2438027_2438954_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	9.1e-14
>prophage 143
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2442245	2443686	5168350		Tupanvirus(50.0%)	2	NA	NA
WP_000642420.1|2442245_2443256_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	1.2e-24
WP_000781370.1|2443401_2443686_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 144
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2449699	2449990	5168350		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001295648.1|2449699_2449990_+	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.7e-25
>prophage 145
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2456875	2458420	5168350		Escherichia_phage(100.0%)	1	NA	NA
WP_062881444.1|2456875_2458420_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 146
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2462780	2528325	5168350	transposase,head,capsid,tail	Stx2-converting_phage(37.14%)	54	NA	NA
WP_032312347.1|2462780_2463917_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001101836.1|2464447_2464666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062881864.1|2468487_2470146_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.2	8.3e-26
WP_085949012.1|2470725_2471420_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_062881819.1|2471644_2471857_-	YncH family protein	NA	NA	NA	NA	NA
WP_062881818.1|2471932_2472550_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_001295649.1|2472816_2474316_+	L-asparagine permease	NA	NA	NA	NA	NA
WP_000550675.1|2474430_2475492_-	YncE family protein	NA	NA	NA	NA	NA
WP_062881817.1|2475733_2477836_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	1.1e-134
WP_062881816.1|2477871_2478537_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_085949012.1|2479076_2479771_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_062881602.1|2479836_2480307_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_001364659.1|2480350_2482396_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636571.1|2482532_2483279_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000215549.1|2483367_2484054_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214712.1|2484231_2484435_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_062881606.1|2486425_2487076_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	98.6	4.6e-121
WP_062881604.1|2487300_2488176_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.3	2.1e-161
WP_101975641.1|2488316_2488586_-|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	98.9	1.1e-44
WP_101974110.1|2489964_2490564_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	4.2e-105
WP_101974111.1|2490630_2494023_-	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	88.3	0.0e+00
WP_000649829.1|2494156_2494684_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_122994999.1|2494871_2495504_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.0	2.6e-97
WP_101974112.1|2495449_2496193_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	94.7	5.4e-142
WP_101975644.1|2496203_2496902_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	96.6	8.4e-129
WP_000807964.1|2496901_2497243_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001513217.1|2500524_2500734_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_001030063.1|2500829_2501204_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275479.1|2501209_2501926_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_000133388.1|2501992_2502337_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2502333_2502780_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007911.1|2502776_2503127_-|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000125988.1|2503136_2503463_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063096.1|2505989_2506211_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_097469946.1|2506255_2508193_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.8	0.0e+00
WP_001303046.1|2509213_2509579_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000095749.1|2509620_2509848_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_000736096.1|2510216_2510441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|2510526_2510712_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_001043239.1|2510933_2511152_-	hypothetical protein	NA	Q687G2	Enterobacteria_phage	93.3	1.0e-16
WP_000992122.1|2511229_2511763_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_000731236.1|2511813_2512158_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_101974116.1|2512815_2514666_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_000216644.1|2514980_2515148_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	68.6	1.2e-09
WP_000961821.1|2516779_2516992_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_096851637.1|2517069_2518438_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	6.3e-112
WP_001320773.1|2518538_2518688_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|2518759_2518933_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_000428998.1|2519177_2519708_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_062882276.1|2519896_2520898_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000115949.1|2520939_2522379_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_062882275.1|2522575_2523376_-	YdcF family protein	NA	NA	NA	NA	NA
WP_085949012.1|2523556_2524250_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_062882274.1|2524422_2528325_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 147
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2559685	2560675	5168350		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|2559685_2560675_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 148
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2566910	2620203	5168350	tRNA,terminase,tail,integrase,transposase,holin,portal,protease	Escherichia_phage(41.38%)	64	2567545:2567570	2614841:2614866
WP_001364706.1|2566910_2567345_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	4.0e-28
2567545:2567570	attL	AAGAAAGAACAATACAACCTGAACAA	NA	NA	NA	NA
WP_001143784.1|2567925_2568567_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|2568648_2569278_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131659.1|2569350_2569926_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_101974067.1|2570093_2571307_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.0	8.4e-169
WP_106879252.1|2571312_2571621_-|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	97.7	4.0e-43
WP_000279065.1|2571622_2572945_-|tail	tail fiber protein	tail	Q687E6	Enterobacteria_phage	98.6	2.0e-75
WP_001228289.1|2573009_2573609_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_106879253.1|2573676_2577150_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.4	0.0e+00
WP_072065989.1|2577385_2578018_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	98.1	5.8e-105
WP_101975636.1|2577963_2578707_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	1.5e-147
WP_080025938.1|2578717_2579416_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	1.5e-130
WP_000847298.1|2579415_2579745_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918276.1|2579741_2582387_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.4	0.0e+00
WP_000532073.1|2582430_2582739_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479062.1|2582765_2583188_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_078321047.1|2583201_2583831_-	Ig domain-containing protein	NA	Q687F6	Enterobacteria_phage	99.5	8.7e-109
WP_000682716.1|2583961_2584360_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974960.1|2584372_2584996_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	99.5	2.5e-100
WP_001281350.1|2584998_2585280_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|2585272_2585599_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114424.1|2585686_2587711_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974564.1|2587655_2589158_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102414.1|2589157_2589370_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_001077626.1|2589366_2591490_-|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000348565.1|2591486_2591963_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_136745577.1|2591995_2592223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|2592479_2592665_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001092902.1|2593183_2593717_-	lysozyme	NA	G9L6J6	Escherichia_phage	96.6	2.1e-100
WP_001041949.1|2594228_2595020_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_000284518.1|2595023_2595239_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001290212.1|2595315_2595588_-	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000143464.1|2595628_2595808_-	DUF1378 family protein	NA	G9L6J3	Escherichia_phage	100.0	1.3e-25
WP_106879254.1|2595942_2597889_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.6	0.0e+00
WP_000640110.1|2598590_2599133_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.3	3.9e-73
WP_000228017.1|2599129_2599420_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	8.2e-46
WP_000940305.1|2599419_2600019_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	1.0e-106
WP_071525388.1|2600090_2600342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000902698.1|2600578_2600791_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.2e-17
WP_000418464.1|2600913_2602035_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_001138877.1|2602021_2602672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014164.1|2602826_2603057_-	hypothetical protein	NA	A0A2R2Z315	Escherichia_phage	76.8	4.1e-16
WP_001151116.1|2603053_2603476_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.8e-63
WP_000450718.1|2603491_2604253_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.7	1.0e-116
WP_000788984.1|2604275_2605022_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	4.8e-114
WP_001356605.1|2605028_2605817_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.0	5.1e-42
WP_000702017.1|2605894_2606317_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	5.9e-69
WP_001033914.1|2606313_2606556_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000410105.1|2606652_2607072_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_000379547.1|2607378_2607531_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000887681.1|2607942_2608791_+	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	60.8	5.9e-60
WP_000560226.1|2608837_2609059_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	6.9e-37
WP_001427414.1|2609058_2609229_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
WP_000102194.1|2609309_2611979_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	61.3	4.2e-205
WP_000166315.1|2611971_2612781_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_042853000.1|2612837_2613032_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_001356607.1|2613024_2613213_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_000079604.1|2613312_2613528_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040845.1|2613529_2614765_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.3	1.1e-237
WP_096851542.1|2614816_2615752_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	99.2	1.2e-146
2614841:2614866	attR	AAGAAAGAACAATACAACCTGAACAA	NA	NA	NA	NA
WP_024226008.1|2615880_2617254_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	1.5e-52
WP_001296046.1|2617283_2617457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387388.1|2617732_2618716_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_024226007.1|2618970_2620203_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	4.0e-17
>prophage 149
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2624974	2625490	5168350		Streptococcus_phage(100.0%)	1	NA	NA
WP_096851541.1|2624974_2625490_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	43.4	6.4e-25
>prophage 150
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2645862	2646945	5168350		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057998.1|2645862_2646945_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 151
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2660947	2662213	5168350		Klosneuvirus(100.0%)	1	NA	NA
WP_062881847.1|2660947_2662213_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	3.5e-24
>prophage 152
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2673517	2679169	5168350		Bacillus_virus(50.0%)	5	NA	NA
WP_000573407.1|2673517_2674324_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_000968838.1|2674391_2674745_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|2675106_2675895_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_062881854.1|2676039_2677167_+	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_062881855.1|2677234_2679169_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
>prophage 153
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2686984	2687575	5168350		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|2686984_2687575_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 154
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2692499	2697791	5168350	protease	Tupanvirus(33.33%)	4	NA	NA
WP_001297122.1|2692499_2695097_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
WP_001031530.1|2695476_2695728_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422045.1|2695763_2696813_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_062881751.1|2697032_2697791_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	2.6e-06
>prophage 155
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2702723	2705681	5168350		Acinetobacter_phage(100.0%)	2	NA	NA
WP_062881753.1|2702723_2704319_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	2.9e-52
WP_001612893.1|2704322_2705681_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
>prophage 156
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2717339	2719354	5168350		Planktothrix_phage(100.0%)	2	NA	NA
WP_000994905.1|2717339_2718344_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	35.6	8.0e-24
WP_062881631.1|2718340_2719354_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.6e-14
>prophage 157
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2727762	2737654	5168350		Citrobacter_phage(25.0%)	10	NA	NA
WP_000068079.1|2727762_2728380_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
WP_001287378.1|2728984_2729398_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_062881633.1|2729541_2730450_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	8.2e-60
WP_000193447.1|2730651_2731665_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_001295622.1|2731756_2732662_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_001307143.1|2732774_2733233_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555849.1|2733282_2734125_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_021529090.1|2734731_2735409_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000571699.1|2735408_2736119_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_062881634.1|2736115_2737654_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
>prophage 158
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2752480	2756488	5168350		Cafeteria_roenbergensis_virus(50.0%)	5	NA	NA
WP_000811065.1|2752480_2753335_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_001257044.1|2753370_2754180_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000200378.1|2754183_2754576_-	SirB family protein	NA	NA	NA	NA	NA
WP_062881374.1|2754572_2755406_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_024226915.1|2755405_2756488_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 159
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2759623	2762375	5168350		Tupanvirus(50.0%)	2	NA	NA
WP_001298109.1|2759623_2760571_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|2760695_2762375_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
>prophage 160
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2789044	2904279	5168350	tRNA,terminase,tail,integrase,head,capsid,transposase,lysis,holin,protease	Enterobacteria_phage(30.49%)	133	2883887:2883907	2908035:2908055
WP_062881467.1|2789044_2790313_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|2790312_2790732_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_101974122.1|2791020_2791714_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_062881475.1|2791878_2792790_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|2792996_2793458_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284270.1|2793534_2794194_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001297679.1|2794265_2794559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062881471.1|2794800_2795202_+	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
WP_001056859.1|2795321_2795690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062881472.1|2796212_2796908_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|2796931_2797744_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|2797747_2798014_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_001131446.1|2798763_2798883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001328621.1|2798843_2799029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122462.1|2799129_2799303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000726974.1|2799304_2799649_+	glycine zipper family protein	NA	NA	NA	NA	NA
WP_001295611.1|2799658_2799988_+	YmgD family protein	NA	NA	NA	NA	NA
WP_077879182.1|2800044_2802366_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	43.3	1.8e-90
WP_062881474.1|2803092_2803311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065752.1|2805295_2805544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000888772.1|2805656_2805923_-	biofilm/acid-resistance regulator AriR	NA	NA	NA	NA	NA
WP_000858002.1|2805951_2806224_-	two-component-system connector protein YmgA	NA	NA	NA	NA	NA
WP_000554153.1|2806266_2806503_-	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
WP_096851686.1|2806816_2808028_+	blue light-responsive regulator BluF	NA	NA	NA	NA	NA
WP_000332308.1|2808232_2808964_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|2809184_2809589_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_062881502.1|2809641_2809752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062881503.1|2810284_2810605_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	64.7	1.1e-38
WP_000539892.1|2810672_2810825_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
WP_001298108.1|2811304_2811742_+	acetyltransferase	NA	NA	NA	NA	NA
WP_096851685.1|2811998_2812352_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001171554.1|2812634_2813015_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2813011_2813359_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_101974169.1|2813408_2814947_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	6.5e-299
WP_032205137.1|2815301_2816255_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_062881457.1|2816441_2817926_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000937499.1|2818109_2818415_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_000239870.1|2818471_2819140_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|2819637_2819820_+	general stress protein	NA	NA	NA	NA	NA
WP_062881458.1|2819898_2820399_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_062881459.1|2820435_2820942_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488336.1|2820960_2821851_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_062881460.1|2821970_2822552_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	1.5e-102
WP_095585866.1|2822551_2825623_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	1.9e-68
WP_095585867.1|2825687_2826209_-|tail	phage tail tape measure protein	tail	A0A291AWV3	Escherichia_phage	100.0	2.2e-41
WP_000198149.1|2827658_2827865_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_062881689.1|2827861_2829787_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453622.1|2829761_2830307_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	3.1e-94
WP_062881690.1|2830695_2830890_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	3.7e-26
WP_001031427.1|2831054_2831261_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|2831546_2831957_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|2832248_2832542_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_012738274.1|2832632_2832815_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	100.0	1.7e-17
WP_001180491.1|2833031_2833508_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.8	1.0e-85
WP_000544528.1|2833494_2833800_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_000088653.1|2834940_2835177_+	excisionase	NA	NA	NA	NA	NA
WP_062881691.1|2835166_2836309_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	99.4	1.2e-204
WP_062881692.1|2836422_2837673_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	1.9e-22
WP_001248692.1|2837844_2838498_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476089.1|2838507_2838969_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001297484.1|2839022_2840129_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|2840164_2840806_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_062881693.1|2840809_2842180_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	3.2e-108
WP_001265481.1|2842348_2843020_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_062881694.1|2843019_2844480_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001295435.1|2844555_2845677_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359446.1|2845725_2846952_-	peptidase T	NA	NA	NA	NA	NA
WP_000531601.1|2847201_2848338_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_062881695.1|2848321_2849185_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.2	2.0e-10
WP_001144080.1|2850227_2850878_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001299273.1|2850952_2852011_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_012816780.1|2852138_2852774_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_001118085.1|2852841_2853423_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_001023452.1|2853534_2853804_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_101975648.1|2853805_2855119_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	7.4e-78
WP_032271866.1|2855183_2855807_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.9	8.7e-69
WP_106879256.1|2855875_2859352_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.1	0.0e+00
WP_130069576.1|2859598_2860231_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	88.9	2.6e-97
WP_053921656.1|2860176_2860920_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	99.6	9.2e-150
WP_001298836.1|2860930_2861629_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	1.7e-129
WP_000807940.1|2861628_2861970_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_001453698.1|2865254_2865464_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030048.1|2865559_2865934_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	2.3e-64
WP_001275508.1|2865939_2866656_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133393.1|2866714_2867059_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|2867055_2867502_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2867498_2867849_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2867858_2868185_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063096.1|2870711_2870933_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_101975660.1|2870977_2872915_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.2	0.0e+00
WP_072617034.1|2872978_2874640_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.8	0.0e+00
WP_000958387.1|2874636_2875200_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_000279796.1|2875491_2875857_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000095736.1|2875898_2876126_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2876555_2876741_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2876968_2877115_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_101975661.1|2877114_2877666_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	96.3	2.3e-97
WP_000992168.1|2877936_2878470_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	99.4	4.3e-101
WP_000731236.1|2878520_2878865_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000411811.1|2878869_2879076_-|holin	holin	holin	O48430	Enterobacteria_phage	100.0	1.8e-31
WP_106879257.1|2879519_2881370_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_001359877.1|2881940_2882372_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	3.6e-66
WP_000762928.1|2882937_2883759_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_106879258.1|2883781_2884129_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.3	2.1e-32
2883887:2883907	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_101975664.1|2884141_2885191_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	7.7e-110
WP_000191872.1|2885192_2885465_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2885586_2885931_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_101975665.1|2886050_2886263_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	98.6	8.6e-29
WP_000104474.1|2886496_2887054_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_096848963.1|2887055_2887274_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	70.8	3.1e-21
WP_001289673.1|2887401_2887713_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|2887705_2887933_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_096851728.1|2887929_2888211_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	3.6e-30
WP_106879259.1|2888243_2888960_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.8	2.3e-73
WP_000788759.1|2888981_2889728_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	1.4e-113
WP_001262372.1|2889734_2890805_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	66.2	4.5e-65
WP_000693928.1|2890876_2891302_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|2891285_2891609_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|2891733_2892210_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000379610.1|2892528_2892681_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.7e-07
WP_001358566.1|2893170_2893359_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001365098.1|2893355_2893547_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048280.1|2893640_2896112_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_000003742.1|2896173_2896443_+	excisionase	NA	NA	NA	NA	NA
WP_101975666.1|2896411_2897530_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	2.9e-83
WP_096851754.1|2897606_2897951_-	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	35.5	4.3e-09
WP_000824186.1|2898051_2898255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000580316.1|2898563_2899358_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_062881759.1|2899354_2900401_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_062881760.1|2900556_2901378_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.0	1.5e-20
WP_000291257.1|2901393_2902305_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_062881761.1|2902333_2903578_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_062881762.1|2903577_2904279_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	4.1e-35
2908035:2908055	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 161
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2911568	2911826	5168350		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|2911568_2911826_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 162
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2924157	2925800	5168350		Streptococcus_virus(50.0%)	2	NA	NA
WP_001267941.1|2924157_2925162_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
WP_001257000.1|2925158_2925800_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 163
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2929072	2930254	5168350		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|2929072_2929309_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_001008535.1|2929519_2930254_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
>prophage 164
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2942611	2943553	5168350		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001365096.1|2942611_2943553_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	6.2e-10
>prophage 165
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2959402	2959648	5168350		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|2959402_2959648_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 166
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2964309	2965230	5168350		Morganella_phage(100.0%)	1	NA	NA
WP_062881781.1|2964309_2965230_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	6.6e-57
>prophage 167
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2974538	2975072	5168350		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|2974538_2975072_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 168
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2979205	2980039	5168350		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|2979205_2980039_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 169
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	2984871	3085954	5168350	terminase,tail,integrase,transposase,holin,protease	Enterobacteria_phage(25.71%)	104	3059956:3059971	3077452:3077467
WP_085949012.1|2984871_2985566_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_004015384.1|2985642_2986014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001061095.1|2986015_2986429_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_000258765.1|2986478_2987543_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	1.1e-90
WP_001199453.1|2987886_2989158_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_000154413.1|2989163_2990291_-	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_001018495.1|2991847_2993356_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_085949012.1|2993714_2994408_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_001365086.1|2994552_2998515_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004993148.1|2998554_2999193_-	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_001352489.1|2999480_3000572_+	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_001307100.1|3000571_3001264_+	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_062882336.1|3001275_3001662_+	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_001307099.1|3001669_3002470_+	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001001183.1|3002479_3003070_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001028096.1|3003080_3003575_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
WP_001365093.1|3003595_3004924_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	2.8e-234
WP_001273658.1|3005006_3005180_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_062882335.1|3005552_3006149_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001143120.1|3006169_3006397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044273.1|3006434_3007676_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_062882334.1|3007966_3009226_-	YccE family protein	NA	NA	NA	NA	NA
WP_000420617.1|3009486_3010407_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
WP_062882333.1|3010406_3010712_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209866.1|3010804_3011404_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_062882332.1|3011400_3013947_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.5	1.2e-71
WP_062882331.1|3013946_3015119_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120112.1|3015248_3015941_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264919.1|3015913_3016942_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_074434056.1|3017024_3019769_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_000818470.1|3019840_3020914_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|3020962_3021136_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_021292990.1|3021125_3021356_-	protein YmcE	NA	NA	NA	NA	NA
WP_071528578.1|3021330_3021519_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|3021529_3021742_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_085949012.1|3022083_3022777_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_000087763.1|3022873_3023086_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_001295358.1|3023527_3023833_+	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_062882329.1|3023939_3024584_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_000742345.1|3025325_3027422_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001343234.1|3027467_3028607_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000057871.1|3028594_3029041_+	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_000208650.1|3029060_3031241_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_024226935.1|3031355_3032654_-	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000270305.1|3032733_3032826_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_000460803.1|3032838_3033975_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_062882328.1|3033986_3035531_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_062882327.1|3035664_3036522_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000063978.1|3036518_3036917_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_062882326.1|3036913_3037501_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186423.1|3037497_3038205_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_062882325.1|3038223_3040017_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|3040013_3041132_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_096248247.1|3042845_3043115_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	95.5	7.8e-43
WP_062882369.1|3044494_3045118_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.4	1.3e-69
WP_101975669.1|3045186_3046869_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	98.8	7.0e-307
WP_000235436.1|3047691_3048201_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_032243757.1|3048603_3048828_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303878.1|3048909_3049224_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|3049751_3049937_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|3050158_3050272_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|3050492_3051026_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|3051185_3051458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411814.1|3051713_3051920_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_101974181.1|3053587_3054812_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.1e-176
WP_158639000.1|3054787_3055084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106879260.1|3055796_3057010_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	98.6	5.5e-168
WP_062881813.1|3057402_3058176_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|3058541_3058679_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001013642.1|3058723_3058936_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_074433979.1|3059103_3059382_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265133.1|3059383_3060433_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
3059956:3059971	attL	GGCGGAAAAAATCCGC	NA	NA	NA	NA
WP_001217436.1|3060445_3060817_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|3060806_3061178_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265267.1|3061329_3062148_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917737.1|3062434_3062632_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000887453.1|3063257_3063530_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3063638_3064040_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3064067_3064259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3064258_3064546_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3064822_3064978_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_032205089.1|3065119_3065509_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	30.0	1.5e-05
WP_032205087.1|3065695_3065881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3066454_3066643_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3066639_3066831_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_106879261.1|3066924_3069360_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	6.4e-59
WP_000273151.1|3069427_3069670_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3069647_3070667_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_062882278.1|3071074_3071734_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	48.5	6.2e-41
WP_000904442.1|3071824_3072154_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000048252.1|3072150_3072429_-	acylphosphatase	NA	NA	NA	NA	NA
WP_062882280.1|3072523_3073714_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_001295356.1|3073771_3074089_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001343235.1|3074133_3074547_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_060616790.1|3074719_3075382_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424181.1|3075477_3075936_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420537.1|3075967_3078022_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
3077452:3077467	attR	GGCGGAAAAAATCCGC	NA	NA	NA	NA
WP_062882281.1|3078144_3078591_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_074434046.1|3078600_3080763_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_032186268.1|3080725_3081355_-	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000288710.1|3081573_3082083_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_062882317.1|3082439_3083480_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877161.1|3083555_3084008_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_062882282.1|3084193_3085954_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
>prophage 170
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3090621	3092529	5168350		Tupanvirus(100.0%)	1	NA	NA
WP_062882284.1|3090621_3092529_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	3.7e-54
>prophage 171
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3108463	3119596	5168350	tRNA	Bacillus_virus(20.0%)	8	NA	NA
WP_062882290.1|3108463_3109231_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	2.2e-29
WP_062882291.1|3109437_3112050_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	5.3e-19
WP_001307697.1|3112315_3113518_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_024226767.1|3113686_3115087_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	6.9e-82
WP_062882293.1|3115688_3116777_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.0	1.2e-97
WP_000462687.1|3116961_3118152_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_001109487.1|3118373_3119021_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_042966393.1|3119047_3119596_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	5.4e-06
>prophage 172
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3134301	3138842	5168350		Bacillus_phage(100.0%)	3	NA	NA
WP_000551270.1|3134301_3136050_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_024226769.1|3136086_3138351_-	ComEC family protein	NA	NA	NA	NA	NA
WP_062882301.1|3138557_3138842_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	1.9e-10
>prophage 173
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3143928	3145017	5168350		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057136.1|3143928_3145017_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	4.5e-81
>prophage 174
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3149115	3152330	5168350		Tetraselmis_virus(100.0%)	2	NA	NA
WP_001292815.1|3149115_3151398_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
WP_000111043.1|3151589_3152330_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 175
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3158637	3175268	5168350	tRNA	Escherichia_phage(25.0%)	10	NA	NA
WP_062882307.1|3158637_3159255_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	8.6e-77
WP_062882308.1|3159265_3161710_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	5.0e-221
WP_000886683.1|3161948_3163241_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_062882309.1|3163331_3164675_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	4.8e-80
WP_001295343.1|3164685_3165297_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_106879263.1|3165451_3169519_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	2.1e-86
WP_000228473.1|3169653_3170148_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3170691_3171657_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_062882311.1|3171779_3173546_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_001202175.1|3173546_3175268_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	9.9e-22
>prophage 176
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3179589	3181760	5168350		Klebsiella_phage(33.33%)	4	NA	NA
WP_001220314.1|3179589_3179811_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	3.2e-10
WP_062882313.1|3179873_3180350_-	RadC family protein	NA	NA	NA	NA	NA
WP_000214398.1|3180365_3180851_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	2.6e-12
WP_001234682.1|3180941_3181760_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.4	1.0e-45
>prophage 177
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3191465	3191891	5168350		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000422760.1|3191465_3191891_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	89.7	1.5e-43
>prophage 178
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3204822	3206678	5168350		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502842.1|3204822_3205461_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.5	1.9e-55
WP_062882322.1|3205445_3206678_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.1	3.8e-60
>prophage 179
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3222747	3272366	5168350	transposase,protease	Stx2-converting_phage(21.05%)	45	NA	NA
WP_001223350.1|3222747_3224838_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001053349.1|3225351_3225738_-	protein TerF	NA	NA	NA	NA	NA
WP_000301248.1|3226159_3226735_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_000116680.1|3226803_3227382_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000255079.1|3227430_3228471_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007449.1|3228493_3228949_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054789.1|3228971_3230129_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000254140.1|3230128_3230710_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001035166.1|3231032_3232091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280118.1|3232100_3233243_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_047088719.1|3233235_3234009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182418.1|3234010_3235090_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_000797372.1|3235089_3236046_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506898.1|3236056_3237265_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|3237282_3237750_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042916.1|3238010_3238340_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957249.1|3238326_3238707_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_095585846.1|3239610_3241224_-|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.2	2.0e-165
WP_000624701.1|3241254_3241605_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000435663.1|3241601_3242027_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_000397130.1|3244364_3245036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135715.1|3245906_3246047_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_000803992.1|3246348_3246612_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001021388.1|3247823_3248441_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_062882318.1|3248452_3249127_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_000966485.1|3249127_3249592_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_000065682.1|3249601_3251305_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_000612150.1|3251297_3251618_-	urease subunit beta	NA	NA	NA	NA	NA
WP_000424145.1|3251626_3251929_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_000886249.1|3251938_3252718_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000591995.1|3253597_3255217_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000024297.1|3255309_3255669_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_101974067.1|3256044_3257257_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.0	8.4e-169
WP_001304211.1|3257667_3257958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062882370.1|3257981_3258233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028913479.1|3258280_3258886_-	conjugal transfer protein TraT	NA	NA	NA	NA	NA
WP_001171554.1|3260277_3260658_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3260654_3261002_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000233452.1|3263350_3265711_-	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_074433978.1|3265865_3266222_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_085949012.1|3266281_3266975_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_000934041.1|3267172_3269449_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3269479_3269800_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3270122_3270347_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188180.1|3270419_3272366_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
>prophage 180
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3281662	3283381	5168350		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_062882554.1|3281662_3283381_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	8.9e-31
>prophage 181
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3286968	3289706	5168350		Roseobacter_phage(50.0%)	4	NA	NA
WP_001255167.1|3286968_3287799_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|3287795_3288119_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_062881402.1|3288244_3288760_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|3288977_3289706_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 182
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3293042	3302191	5168350		Streptococcus_phage(25.0%)	11	NA	NA
WP_001149681.1|3293042_3294170_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	7.9e-28
WP_000389260.1|3294210_3294699_-	YbjO family protein	NA	NA	NA	NA	NA
WP_062881401.1|3294758_3295604_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105417.1|3295600_3296554_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_096851644.1|3296563_3297697_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.1e-29
WP_000126069.1|3297791_3298904_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_001364519.1|3299253_3299730_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|3299817_3300720_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_062881400.1|3300780_3301503_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|3301486_3301774_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|3301933_3302191_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
>prophage 183
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3310755	3311958	5168350		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|3310755_3311958_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 184
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3324066	3325938	5168350		Planktothrix_phage(100.0%)	1	NA	NA
WP_001296993.1|3324066_3325938_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
>prophage 185
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3329153	3337495	5168350		Synechococcus_phage(33.33%)	6	NA	NA
WP_062882525.1|3329153_3329816_-	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.6	7.4e-26
WP_001295295.1|3329946_3330846_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_062882524.1|3330851_3333284_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_000114244.1|3333429_3334245_+	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_062882523.1|3334396_3335662_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_062882522.1|3335902_3337495_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	2.0e-61
>prophage 186
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3342492	3347695	5168350		Escherichia_phage(33.33%)	7	NA	NA
WP_001295296.1|3342492_3343008_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|3343060_3343126_-	protein YliM	NA	NA	NA	NA	NA
WP_062882521.1|3343360_3344227_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|3344525_3345029_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|3345431_3346178_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|3346316_3346976_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_062882520.1|3346972_3347695_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	3.3e-35
>prophage 187
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3351235	3366004	5168350		Erwinia_phage(14.29%)	12	NA	NA
WP_000710619.1|3351235_3351496_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_062882519.1|3351759_3354042_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990176.1|3354083_3354761_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000146352.1|3354834_3355101_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_062882518.1|3355365_3355626_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000386542.1|3357038_3358001_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_062882529.1|3358028_3360179_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.0	1.4e-41
WP_001145127.1|3360298_3360781_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	2.6e-36
WP_000007101.1|3361012_3362377_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001361582.1|3362605_3363277_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_062882517.1|3363279_3364275_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996107.1|3364267_3366004_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
>prophage 188
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3376601	3377510	5168350		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|3376601_3377510_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 189
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3383991	3399386	5168350	transposase,integrase,holin,tail	Enterobacteria_phage(41.18%)	23	3385907:3385921	3399460:3399474
WP_024225839.1|3383991_3385281_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.2e-18
WP_000767391.1|3385339_3385816_+	kinase inhibitor	NA	NA	NA	NA	NA
3385907:3385921	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_052915805.1|3386319_3386973_+	EspJ family T3SS effector ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_000354291.1|3386985_3387207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002868.1|3387290_3387671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062881704.1|3387670_3387916_-|tail	phage tail protein	tail	Q687E6	Enterobacteria_phage	98.5	2.4e-30
WP_000284515.1|3388140_3388356_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_033816266.1|3388498_3388897_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3388977_3389136_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3389222_3389966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|3390218_3390842_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_095585803.1|3390838_3391504_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	98.6	7.2e-130
WP_032205168.1|3391656_3391839_+	hypothetical protein	NA	A0A1I9LJN0	Stx_converting_phage	98.3	7.2e-24
WP_095585804.1|3391835_3392516_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	97.3	5.6e-130
WP_000682294.1|3392512_3392674_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	96.0	7.7e-22
WP_000129285.1|3392666_3393224_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_001386642.1|3393234_3393516_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_096851764.1|3393614_3393872_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	97.1	2.0e-32
WP_101974067.1|3393877_3395090_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.0	8.4e-169
WP_074433965.1|3396057_3396666_+	ead/Ea22-like family protein	NA	Q9MCR3	Enterobacteria_phage	96.4	5.0e-21
WP_000789829.1|3396796_3397495_+	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	81.9	1.5e-101
WP_001303965.1|3397731_3398031_+	hypothetical protein	NA	G9L655	Escherichia_phage	100.0	2.4e-53
WP_000533642.1|3398315_3399386_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
3399460:3399474	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 190
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3409960	3416532	5168350		Planktothrix_phage(33.33%)	7	NA	NA
WP_000891692.1|3409960_3411019_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
WP_000604034.1|3411021_3411711_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000113008.1|3411710_3412484_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|3412648_3412798_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001147439.1|3412926_3413715_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_062881422.1|3413782_3415255_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_062881421.1|3415515_3416532_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.4e-79
>prophage 191
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3420885	3424405	5168350		Klebsiella_phage(33.33%)	4	NA	NA
WP_001109196.1|3420885_3421938_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
WP_000784351.1|3422253_3422634_+	periplasmic protein	NA	NA	NA	NA	NA
WP_062881417.1|3422747_3423689_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	1.7e-23
WP_062881416.1|3423685_3424405_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.2	1.2e-21
>prophage 192
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3460060	3460852	5168350		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114025.1|3460060_3460852_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	28.8	3.7e-08
>prophage 193
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3464230	3467172	5168350		Acinetobacter_phage(50.0%)	2	NA	NA
WP_001032694.1|3464230_3465712_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
WP_000207136.1|3465753_3467172_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	1.6e-62
>prophage 194
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3480968	3481646	5168350		Bacillus_phage(100.0%)	1	NA	NA
WP_000186076.1|3480968_3481646_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
>prophage 195
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3493215	3497028	5168350	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_062882572.1|3493215_3494880_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.9	0.0e+00
WP_032204152.1|3495081_3497028_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
>prophage 196
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3501794	3503459	5168350		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337087.1|3501794_3503459_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.1	1.0e-84
>prophage 197
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3507554	3508634	5168350		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|3507554_3508634_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 198
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3516529	3520062	5168350		Planktothrix_phage(50.0%)	3	NA	NA
WP_000631376.1|3516529_3517255_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	5.8e-32
WP_096851569.1|3517372_3518308_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_062882148.1|3518391_3520062_+	molecular chaperone HscC	NA	E5EQT9	Bathycoccus_sp._RCC1105_virus	35.3	1.7e-74
>prophage 199
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3525117	3527700	5168350	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_024226883.1|3525117_3527700_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	8.9e-184
>prophage 200
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3534710	3537149	5168350		Synechococcus_phage(50.0%)	2	NA	NA
WP_001231428.1|3534710_3535799_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_062882153.1|3535937_3537149_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	8.9e-102
>prophage 201
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3541964	3542611	5168350		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000939749.1|3541964_3542348_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|3542401_3542611_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 202
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3558036	3560151	5168350		Morganella_phage(50.0%)	2	NA	NA
WP_000278505.1|3558036_3558465_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
WP_062881936.1|3558585_3560151_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.9e-44
>prophage 203
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3563261	3565084	5168350		Streptococcus_phage(50.0%)	2	NA	NA
WP_062881938.1|3563261_3564482_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.5	8.8e-57
WP_000502945.1|3564454_3565084_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
>prophage 204
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3579715	3586532	5168350	transposase	Klosneuvirus(50.0%)	3	NA	NA
WP_000140647.1|3579715_3580531_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
WP_085949012.1|3581915_3582609_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_062881627.1|3582650_3586532_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.6	3.4e-62
>prophage 205
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3597964	3601108	5168350		Leptospira_phage(100.0%)	1	NA	NA
WP_062881623.1|3597964_3601108_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	21.7	9.8e-60
>prophage 206
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3616516	3619647	5168350	tRNA	Enterococcus_phage(50.0%)	4	NA	NA
WP_062881669.1|3616516_3617383_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.2	1.3e-30
WP_000190288.1|3617384_3617597_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143552.1|3617704_3618226_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_062881668.1|3618261_3619647_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 207
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3631841	3632987	5168350		Streptococcus_phage(100.0%)	1	NA	NA
WP_062881437.1|3631841_3632987_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.7	1.4e-48
>prophage 208
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3639178	3640960	5168350		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001096881.1|3639178_3640960_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
>prophage 209
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3654013	3654700	5168350		Planktothrix_phage(100.0%)	1	NA	NA
WP_045177281.1|3654013_3654700_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.1	1.0e-33
>prophage 210
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3657836	3658514	5168350		Bacillus_virus(100.0%)	1	NA	NA
WP_001157535.1|3657836_3658514_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 211
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3663053	3666114	5168350		uncultured_virus(50.0%)	2	NA	NA
WP_062882204.1|3663053_3665558_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.1	2.2e-115
WP_062882228.1|3665772_3666114_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	76.9	2.3e-39
>prophage 212
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3674359	3682817	5168350		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
WP_000801832.1|3674359_3675319_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	1.1e-14
WP_001250105.1|3675315_3676278_-	ferrochelatase	NA	NA	NA	NA	NA
WP_001220233.1|3676409_3677054_-	adenylate kinase	NA	NA	NA	NA	NA
WP_000678201.1|3677234_3679109_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001195025.1|3679218_3679824_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|3679823_3680153_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000122013.1|3680205_3682137_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000127356.1|3682265_3682817_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 213
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3689825	3692975	5168350		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|3689825_3692975_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 214
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3701812	3705359	5168350		Bacillus_phage(100.0%)	2	NA	NA
WP_062882211.1|3701812_3703594_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	2.0e-41
WP_062882212.1|3703586_3705359_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	3.4e-49
>prophage 215
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3708681	3709377	5168350		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817229.1|3708681_3709377_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 216
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3712505	3717552	5168350	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_001043542.1|3712505_3712778_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_062882214.1|3712986_3715341_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.3	3.6e-224
WP_024226518.1|3715528_3716803_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.6	2.3e-132
WP_000122253.1|3716928_3717552_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 217
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3741259	3750240	5168350	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_001021161.1|3741259_3741730_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_096851559.1|3741818_3742922_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	1.4e-53
WP_000543535.1|3742925_3743375_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001295327.1|3743525_3744065_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_001295328.1|3744363_3745248_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000974813.1|3745424_3745772_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_000046637.1|3745900_3746872_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934822.1|3746882_3748730_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|3748757_3749090_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667319.1|3749112_3750240_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 218
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3757192	3767164	5168350		Bacillus_phage(60.0%)	7	NA	NA
WP_062882220.1|3757192_3758488_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.7e-26
WP_062882221.1|3758545_3759235_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_001221319.1|3759424_3760627_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000698942.1|3760623_3763767_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_062882231.1|3763892_3765077_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001219312.1|3765219_3766128_-	fructokinase	NA	NA	NA	NA	NA
WP_001298537.1|3766252_3767164_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
>prophage 219
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3771452	3772568	5168350		Bacillus_phage(100.0%)	1	NA	NA
WP_062882224.1|3771452_3772568_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.5e-18
>prophage 220
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3779983	3781141	5168350		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830741.1|3779983_3781141_+	OXA-12 family class D beta-lactamase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 221
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3788079	3788847	5168350		Planktothrix_phage(100.0%)	1	NA	NA
WP_062882227.1|3788079_3788847_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	3.8e-26
>prophage 222
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3794917	3796027	5168350		Synechococcus_phage(100.0%)	1	NA	NA
WP_062882255.1|3794917_3796027_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.8	8.9e-32
>prophage 223
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3799217	3801178	5168350		Micromonas_sp._RCC1109_virus(50.0%)	2	NA	NA
WP_001013499.1|3799217_3800231_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
WP_000044314.1|3800227_3801178_-	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
>prophage 224
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3806588	3810868	5168350		Enterobacteria_phage(50.0%)	2	NA	NA
WP_024226502.1|3806588_3807671_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	98.9	5.4e-191
WP_062882250.1|3807793_3810868_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	98.3	0.0e+00
>prophage 225
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3815407	3816307	5168350		Lactobacillus_phage(100.0%)	1	NA	NA
WP_032206730.1|3815407_3816307_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
>prophage 226
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3819396	3821283	5168350		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000010285.1|3819396_3821283_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	7.0e-53
>prophage 227
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3836197	3837067	5168350		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001299025.1|3836197_3837067_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
>prophage 228
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3843112	3843964	5168350		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001174461.1|3843112_3843964_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.2e-47
>prophage 229
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3848456	3884276	5168350	transposase,plate,integrase	Enterobacteria_phage(40.0%)	30	3848442:3848501	3865325:3866091
3848442:3848501	attL	TGGTAGTGCATCCAATTAGTAGAACATGTGTTTTTCGATAAACGCTCCGATCACTTTTTC	NA	NA	NA	NA
WP_085949012.1|3848456_3849151_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_000150119.1|3849662_3850298_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3850355_3851024_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_085952403.1|3851209_3852423_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_062882561.1|3852474_3852627_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000772643.1|3853055_3854270_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	9.7e-133
WP_000893278.1|3854625_3855879_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_001285288.1|3855890_3856994_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000174677.1|3858374_3858776_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189543.1|3858833_3860078_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|3860169_3860628_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293016.1|3860888_3862346_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_062882562.1|3862402_3863017_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_085949012.1|3864674_3865368_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_001226164.1|3865620_3866676_-	DNA polymerase IV	NA	NA	NA	NA	NA
3865325:3866091	attR	GAAAAAGTGATCGGAGCGTTTATCGAAAAACACATGTTCTACTAATTGGATGCACTACCACATATCGATATAGTGTTCAACGCAGGTAATAAAGCCGACCGGTTTTGCATTAATGACTGCAACCCGCACTTGTGATTTCGCGAGTTTCTCCTTCCAGCGAGATTCGTCAATCTGCGCCCAGGCGGCAATTTGTTGTGGTGAATAATGCTGACTGGCAGTCATCGTAACCGCTCTAATGAAAATAGCGCATAGTTGCTGAAAATCGCCAGGCTGATAGTCTCTTATTTGTATGTTATTCATAATCCCAGCACCAGTTGTCTTTCCATTTGCGGGTCAAGCAACGTCACATGCAGCCCCACCAGTCGCACACCGCGCCCGCCGCGGCGTTCATCCCAGGTTTTACGCGCGGTGGCGATTAAGTCAGCTTTATTCAGCCGCGGCCAGACGTGCTCCTGAGTGGTTTGCTGAAAATCATCAAACTTTAATTTCACCCCCTGGCGAGCAATCAGTAAATCAGGTTTCACCTTTGCCAGACGGCGTTCAAGTTCCGGATACAGCCGCTCGATAATCGCTTCACATTCAGACCAGTGGTGGATATCTTCCGCCATCGTGCGTTCCACGCCGACGGATTTTCGCAACCGTTCGCTGTTAACGTCGCGCTCGTCAATCCCCTGACTACGCTCCCACAAAATGCGGCCAAATTTGCCAAAGCGTTTAAGCAGCATCACCAGATCACACTTTTGTACATCACCGCAGGTTCGTAGCCC	NA	NA	NA	NA
WP_095585890.1|3866746_3867517_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_000729704.1|3868151_3868412_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615979.1|3868414_3868693_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|3868848_3869589_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001365365.1|3869559_3870327_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_062882565.1|3870532_3871111_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	31.4	3.3e-14
WP_000973081.1|3871350_3873795_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000532698.1|3873837_3874311_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_062882566.1|3874464_3875235_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_074434005.1|3876822_3877122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949012.1|3877729_3878423_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_062882454.1|3881570_3882071_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123966.1|3882105_3882330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062882455.1|3882380_3883856_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611742.1|3883862_3884276_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 230
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3899643	3903845	5168350		Bradyrhizobium_phage(33.33%)	5	NA	NA
WP_001297205.1|3899643_3900375_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|3900439_3900907_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297210.1|3900903_3901626_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052727.1|3901659_3902415_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_062882466.1|3902486_3903845_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	1.3e-08
>prophage 231
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3912931	3913963	5168350		Planktothrix_phage(100.0%)	1	NA	NA
WP_096851513.1|3912931_3913963_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	1.2e-35
>prophage 232
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3926640	3930756	5168350		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_062881391.1|3926640_3930123_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	1.1e-208
WP_000569419.1|3930159_3930756_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	3.9e-26
>prophage 233
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3939584	3940343	5168350		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|3939584_3940343_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 234
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3952227	3953652	5168350	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|3952227_3953652_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 235
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3957581	3957926	5168350		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|3957581_3957926_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 236
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3963837	3964635	5168350		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|3963837_3964635_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 237
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3969878	3976684	5168350	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_001365309.1|3969878_3972308_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.3	3.9e-40
WP_062881382.1|3972381_3972912_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396036.1|3972926_3973631_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|3973808_3974264_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000937425.1|3974300_3975227_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_074433907.1|3975265_3976684_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 238
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3986590	3987493	5168350		Sodalis_phage(100.0%)	1	NA	NA
WP_062881883.1|3986590_3987493_-	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	5.7e-61
>prophage 239
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	3990755	3997223	5168350		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_000150637.1|3990755_3991682_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000651599.1|3991790_3992453_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683335.1|3992493_3993030_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_024225963.1|3993235_3995626_+	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_096851508.1|3995672_3997223_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
>prophage 240
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4004966	4006391	5168350		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|4004966_4006391_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 241
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4015005	4015557	5168350		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|4015005_4015557_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 242
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4019791	4020835	5168350		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|4019791_4020835_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 243
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4046814	4048539	5168350		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425668.1|4046814_4048539_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.9e-36
>prophage 244
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4061243	4061942	5168350		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916285.1|4061243_4061942_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.7	6.2e-23
>prophage 245
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4068261	4073683	5168350		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_062881898.1|4068261_4070613_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.3e-37
WP_062881899.1|4070776_4073683_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 246
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4081427	4082827	5168350		Microcystis_phage(50.0%)	2	NA	NA
WP_000257192.1|4081427_4082270_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
WP_000624375.1|4082347_4082827_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 247
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4090721	4096382	5168350		Vibrio_phage(50.0%)	4	NA	NA
WP_000787103.1|4090721_4092236_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
WP_062881903.1|4092266_4093409_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_096851506.1|4093537_4094755_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_001365340.1|4094828_4096382_+	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.4	2.8e-31
>prophage 248
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4101852	4103001	5168350		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|4101852_4103001_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 249
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4107444	4110261	5168350	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_062881909.1|4107444_4110261_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	4.6e-77
>prophage 250
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4117302	4126367	5168350		uncultured_Caudovirales_phage(20.0%)	8	NA	NA
WP_000681368.1|4117302_4118469_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.8	9.2e-88
WP_000935262.1|4118997_4119207_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_062881911.1|4119310_4120441_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000516135.1|4120529_4122446_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_000843568.1|4122822_4123227_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_062881913.1|4124110_4124677_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001295414.1|4124711_4125299_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130189.1|4125413_4126367_-	transaldolase	NA	A0A127KNC6	Cyanophage	30.9	4.8e-10
>prophage 251
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4134627	4175813	5168350	tRNA,tail	Stx2-converting_phage(23.53%)	40	NA	NA
WP_001223181.1|4134627_4135314_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001303782.1|4135713_4135854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|4135949_4136666_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_062881915.1|4136725_4138078_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_062881916.1|4138135_4139560_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	3.6e-09
WP_001188659.1|4139559_4140249_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_000875487.1|4140261_4140735_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|4140945_4141815_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_062881918.1|4141811_4142459_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_024177800.1|4142510_4143023_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000068679.1|4143169_4143496_-	trp operon repressor	NA	NA	NA	NA	NA
WP_062881919.1|4143585_4145523_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.7	2.3e-11
WP_000046749.1|4145733_4147401_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093813.1|4147707_4148940_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
WP_001029692.1|4148960_4150343_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132955.1|4150391_4151360_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_062881920.1|4151465_4152110_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_000105843.1|4152137_4153154_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_062881921.1|4153154_4154486_-	type II toxin-antitoxin system HipA family toxin YjjJ	NA	NA	NA	NA	NA
WP_000224877.1|4154652_4155372_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816471.1|4155428_4156652_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_062881922.1|4156703_4158026_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	6.8e-79
WP_062881923.1|4158192_4158972_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_062881924.1|4159230_4160781_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_077879197.1|4160752_4160905_+	4Fe-4S cluster-binding domain-containing protein	NA	NA	NA	NA	NA
WP_062881925.1|4160911_4161616_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_062881926.1|4161728_4162511_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001299187.1|4162507_4163581_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|4163702_4163864_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295410.1|4163990_4164596_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202564.1|4164988_4166575_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001217539.1|4166794_4167043_+	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_001023420.1|4167411_4167681_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_101974155.1|4167682_4168996_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.2	3.2e-81
WP_106879269.1|4169060_4169660_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.6e-107
WP_106879270.1|4169726_4173206_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	96.2	0.0e+00
WP_122997399.1|4173441_4174074_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	95.7	3.5e-102
WP_101974159.1|4174019_4174763_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.3	9.8e-144
WP_001152185.1|4174773_4175472_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.7	3.1e-131
WP_000807964.1|4175471_4175813_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
>prophage 252
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4179095	4217169	5168350	terminase,tail,integrase,head,capsid,transposase,lysis,holin	Escherichia_phage(42.86%)	52	4190369:4190384	4224383:4224398
WP_001513217.1|4179095_4179305_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000710949.1|4179400_4179775_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001275466.1|4179789_4180506_-|tail	tail protein	tail	B6DZA6	Enterobacteria_phage	99.6	2.8e-127
WP_000133388.1|4180571_4180916_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|4180912_4181359_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_101975674.1|4181355_4181706_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	1.0e-58
WP_000125984.1|4181716_4182043_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|4184569_4184791_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_053904683.1|4184835_4186773_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.5	0.0e+00
WP_096957675.1|4186836_4188498_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.5	0.0e+00
WP_000958416.1|4188494_4189058_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279804.1|4189347_4189713_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	4.0e-66
WP_000095736.1|4189754_4189982_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
4190369:4190384	attL	AAGGGATATCAGTTAA	NA	NA	NA	NA
WP_001283921.1|4190444_4190702_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000839224.1|4190698_4191196_-	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_000092313.1|4191398_4191836_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	96.6	4.2e-70
WP_001135289.1|4191832_4192330_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	97.0	2.4e-90
WP_000284515.1|4192329_4192545_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001290231.1|4192621_4192894_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|4192934_4193114_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_101974160.1|4193250_4195188_-	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	99.1	0.0e+00
WP_085949012.1|4195323_4196017_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_001303568.1|4196205_4196529_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000738080.1|4196825_4197095_-	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_062881835.1|4197106_4198066_-	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	99.7	9.6e-176
WP_001356551.1|4198454_4198607_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204859.1|4198855_4199290_-	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_044164955.1|4199282_4199477_-	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	98.4	1.4e-30
WP_000813671.1|4199473_4200037_-	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
WP_000402092.1|4200044_4200494_-	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_001694414.1|4200493_4201465_-	toprim domain protein	NA	A0A0H4IPK0	Shigella_phage	100.0	1.9e-195
WP_021500588.1|4201454_4202975_-	DEAD/DEAH box helicase	NA	A0A2R2Z335	Escherichia_phage	99.8	8.3e-307
WP_001271434.1|4202968_4203346_-	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	98.4	7.6e-60
WP_001302923.1|4203512_4203707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240875.1|4203877_4204081_-	hypothetical protein	NA	A0A2R2Z333	Escherichia_phage	98.5	9.8e-30
WP_001056250.1|4204176_4204890_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_000939560.1|4204984_4206454_+	SAM-dependent methyltransferase	NA	A0A2L1IV91	Escherichia_phage	99.6	1.9e-284
WP_001064714.1|4206450_4207404_+	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_071526579.1|4207907_4208807_+	hypothetical protein	NA	A0A0P0ZG86	Escherichia_phage	96.2	1.4e-139
WP_000917252.1|4208877_4209090_+	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
WP_000934197.1|4209101_4209383_+	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	100.0	3.0e-45
WP_000995345.1|4209403_4209685_+	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_062882635.1|4209701_4210652_+	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	96.8	2.0e-173
WP_044804878.1|4210648_4211329_+	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	98.2	1.9e-130
WP_074434105.1|4211325_4211502_+	DUF1317 family protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	1.3e-22
WP_000548531.1|4211479_4211671_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_001447493.1|4211681_4211963_+	cell division protein ZapA	NA	Q6H9Z3	Enterobacteria_phage	100.0	3.2e-47
WP_000763383.1|4212061_4212283_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_101974162.1|4212279_4212966_+	ead/Ea22-like family protein	NA	H6WZG2	Escherichia_phage	87.1	3.7e-121
WP_096851707.1|4213468_4213801_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	100.0	1.5e-43
WP_024201788.1|4214868_4215774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001218294.1|4215945_4217169_-|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	98.0	1.3e-233
4224383:4224398	attR	TTAACTGATATCCCTT	NA	NA	NA	NA
>prophage 254
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4306725	4312822	5168350		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_000013046.1|4306725_4307661_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|4307673_4308135_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|4308207_4308594_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_096851601.1|4308799_4311496_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|4311636_4311690_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181324.1|4311874_4312822_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
>prophage 255
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4316460	4319222	5168350		Vibrio_phage(50.0%)	2	NA	NA
WP_000187776.1|4316460_4318599_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001106233.1|4318757_4319222_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	3.8e-53
>prophage 256
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4323404	4324403	5168350		Klosneuvirus(100.0%)	1	NA	NA
WP_000853753.1|4323404_4324403_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 257
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4329360	4329891	5168350		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000055072.1|4329360_4329891_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
>prophage 258
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4358478	4405919	5168350	transposase,protease,tRNA	Ralstonia_phage(11.11%)	47	NA	NA
WP_085949012.1|4358478_4359172_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_106879272.1|4359177_4359792_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4359862_4360312_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4360353_4360581_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4360585_4360900_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|4360906_4361302_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_062882078.1|4361628_4361904_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_096851693.1|4361978_4362530_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_001170827.1|4362626_4363313_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_000949540.1|4363312_4364167_-	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_000056760.1|4364176_4364827_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_096851694.1|4364840_4365305_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218360.1|4365314_4365620_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001350568.1|4365635_4367033_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001301370.1|4367387_4368452_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|4368559_4369315_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569726.1|4369311_4370061_-	esterase	NA	NA	NA	NA	NA
WP_000254642.1|4370242_4370572_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_024225902.1|4370720_4370996_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001299838.1|4371112_4372738_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_062882075.1|4372820_4373972_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.6	3.1e-80
WP_000101670.1|4373974_4374613_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_029785204.1|4374622_4374964_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_101974164.1|4376198_4377350_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000220137.1|4377687_4378089_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4378215_4378947_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_062882710.1|4379127_4381569_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	2.9e-67
WP_001177639.1|4381607_4382033_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4382237_4383536_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4383639_4383837_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4383918_4384923_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4384925_4386185_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_062882709.1|4386270_4387551_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|4387627_4387936_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280345.1|4388021_4388972_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_062882708.1|4388964_4390812_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	3.4e-60
WP_000990262.1|4390821_4392156_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|4392174_4392636_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_001295189.1|4392607_4394155_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_062882707.1|4394153_4395293_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010723271.1|4395275_4395329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|4396193_4396739_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|4396833_4397886_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_000934912.1|4397982_4398951_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_032204757.1|4398972_4402296_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_085949012.1|4403234_4403928_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_000004771.1|4404941_4405919_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 259
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4410839	4411373	5168350		Morganella_phage(100.0%)	1	NA	NA
WP_001238378.1|4410839_4411373_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 260
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4415896	4417880	5168350		Vibrio_phage(50.0%)	2	NA	NA
WP_000729117.1|4415896_4417543_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|4417586_4417880_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 261
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4427082	4433809	5168350	transposase	Enterobacteria_phage(33.33%)	4	NA	NA
WP_085952403.1|4427082_4428296_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_101974166.1|4428861_4430134_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	4.9e-175
WP_001121622.1|4430562_4432212_+	ShET2/EspL2 family type III secretion system effector toxin	NA	NA	NA	NA	NA
WP_000953023.1|4432819_4433809_+	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.5	4.9e-98
>prophage 262
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4458065	4459604	5168350		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000723928.1|4458065_4459604_+	type III secretion system LEE outer membrane ring protein EscC	NA	D0U184	Enterobacteria_phage	28.9	2.0e-10
>prophage 263
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4470377	4470956	5168350		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000491535.1|4470377_4470956_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	78.1	8.6e-79
>prophage 264
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4478899	4482111	5168350	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_000856802.1|4478899_4480357_+	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	1.4e-48
WP_062882010.1|4480593_4482111_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.0e-87
>prophage 265
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4503275	4504778	5168350		Burkholderia_virus(100.0%)	1	NA	NA
WP_001313516.1|4503275_4504778_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	3.1e-56
>prophage 266
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4509615	4510404	5168350		Planktothrix_phage(100.0%)	1	NA	NA
WP_062882014.1|4509615_4510404_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	2.7e-27
>prophage 267
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4528770	4530918	5168350		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|4528770_4530918_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 268
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4540201	4542160	5168350		Staphylococcus_phage(100.0%)	1	NA	NA
WP_096851589.1|4540201_4542160_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.5e-90
>prophage 269
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4547744	4624395	5168350	tRNA,plate,terminase,tail,integrase,transposase,holin	Stx2-converting_phage(29.69%)	81	4555152:4555169	4583142:4583159
WP_000106882.1|4547744_4549094_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
WP_032204070.1|4549639_4550104_-	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_000019358.1|4550189_4550513_+	superoxide response transcriptional regulator SoxS	NA	NA	NA	NA	NA
WP_085949012.1|4551850_4552545_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_001295689.1|4553301_4553583_+	membrane protein	NA	NA	NA	NA	NA
WP_000168305.1|4553681_4554218_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_062881699.1|4554472_4557295_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
4555152:4555169	attL	TTTCCGGTGGTACAGCGG	NA	NA	NA	NA
WP_000155657.1|4557329_4557686_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000270372.1|4557689_4558106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001226928.1|4558216_4558930_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_024225944.1|4560055_4561249_-	aromatic amino acid transaminase	NA	NA	NA	NA	NA
WP_062881698.1|4561501_4562581_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	4.0e-29
WP_000918363.1|4562633_4564049_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_000235516.1|4564131_4565115_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001142084.1|4567459_4570846_+	DUF4765 family protein	NA	A0A0N7KZG3	Stx2-converting_phage	100.0	0.0e+00
WP_085949012.1|4572773_4573468_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_000135680.1|4573561_4573924_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081298.1|4573989_4574814_+	YfdQ family protein	NA	A0A0P0ZBZ4	Stx2-converting_phage	100.0	2.7e-150
WP_000008181.1|4574941_4575478_+	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	100.0	9.7e-101
WP_001242742.1|4575468_4575819_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	100.0	7.0e-60
WP_000556583.1|4576946_4577081_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_001193437.1|4577099_4577354_+	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063646.1|4577387_4578674_+|integrase	site-specific integrase	integrase	A0A0N7KZF5	Stx2-converting_phage	100.0	5.8e-253
WP_001146835.1|4578821_4579904_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000301578.1|4579894_4580455_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	49.1	3.9e-44
WP_000469167.1|4580454_4581366_+	hypothetical protein	NA	C9DGQ8	Escherichia_phage	39.5	6.4e-28
WP_000420351.1|4581400_4581922_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_010917875.1|4582001_4582205_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000904930.1|4582426_4582987_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_000543828.1|4583913_4584951_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
4583142:4583159	attR	TTTCCGGTGGTACAGCGG	NA	NA	NA	NA
WP_000528254.1|4585404_4586142_-	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	79.0	7.5e-104
WP_001444515.1|4586095_4586296_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001114107.1|4586910_4587156_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000221106.1|4587191_4587371_-	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	55.3	6.0e-07
WP_101974169.1|4590184_4591723_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	6.5e-299
WP_000612591.1|4591772_4592120_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4592116_4592497_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_062881456.1|4592595_4592811_+	DinI family protein	NA	Q687E4	Enterobacteria_phage	98.6	1.9e-31
WP_122993102.1|4593182_4594196_-	peptidase M85	NA	NA	NA	NA	NA
WP_122988840.1|4594410_4594488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101700.1|4594598_4594868_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	1.9e-44
WP_101974170.1|4594869_4596183_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	3.6e-80
WP_101974156.1|4596247_4596847_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.0	5.9e-107
WP_106879274.1|4596913_4599427_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	96.2	0.0e+00
WP_101974172.1|4600537_4600801_-	hypothetical protein	NA	A0A0N7KZG0	Stx2-converting_phage	100.0	3.7e-45
WP_000958416.1|4600797_4601361_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001303046.1|4601648_4602014_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000095749.1|4602055_4602283_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_012578895.1|4602707_4602893_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_001043239.1|4603114_4603333_-	hypothetical protein	NA	Q687G2	Enterobacteria_phage	93.3	1.0e-16
WP_000992122.1|4603410_4603944_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_000731236.1|4603994_4604339_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000411809.1|4604343_4604550_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_101974173.1|4604997_4606848_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001344632.1|4607290_4607422_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_062882414.1|4608292_4609351_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	86.7	4.9e-181
WP_000917723.1|4609501_4609705_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	1.8e-31
WP_096851713.1|4609975_4610422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001577385.1|4610506_4610872_-	antitermination protein Q	NA	Q777W5	Enterobacteria_phage	81.8	7.9e-54
WP_062882412.1|4610889_4611879_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	4.7e-194
WP_001072673.1|4611886_4612702_-	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.6	2.9e-149
WP_062882411.1|4612864_4613260_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	96.0	9.1e-64
WP_000066918.1|4613256_4613910_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	99.5	3.3e-127
WP_044806531.1|4614004_4614811_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	88.1	7.9e-123
WP_024185668.1|4614807_4615032_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	94.6	8.5e-35
WP_001542463.1|4615036_4615582_-	ash family protein	NA	Q8SBF3	Shigella_phage	98.9	4.0e-94
WP_071593530.1|4615544_4615724_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	94.9	5.0e-30
WP_000521508.1|4615870_4616422_-	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
WP_000649477.1|4616465_4616666_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_062881953.1|4616756_4617431_+	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	99.1	8.6e-131
WP_000135680.1|4618099_4618462_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081287.1|4618526_4619351_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008232.1|4619478_4620015_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	100.0	7.4e-101
WP_062881955.1|4620005_4620368_+	hypothetical protein	NA	S5MC15	Escherichia_phage	99.2	2.1e-67
WP_062881956.1|4620364_4620568_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	5.2e-31
WP_000476212.1|4620560_4620800_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	100.0	4.4e-37
WP_040092683.1|4620796_4621351_+	ead/Ea22-like family protein	NA	K7PJQ4	Enterobacteria_phage	99.5	4.1e-102
WP_001014289.1|4621352_4621544_+	hypothetical protein	NA	K7PKJ7	Enterobacteria_phage	98.4	1.6e-26
WP_001061345.1|4622553_4623126_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	100.0	2.4e-110
WP_001093917.1|4623162_4623444_+	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	96.8	2.8e-43
WP_062881958.1|4623861_4624395_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	99.4	5.3e-99
>prophage 270
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4628591	4629200	5168350		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|4628591_4629200_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 271
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4638321	4639437	5168350		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|4638321_4639437_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 272
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4665014	4668698	5168350		Dickeya_phage(100.0%)	1	NA	NA
WP_024225949.1|4665014_4668698_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 273
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4684753	4686343	5168350		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_062882156.1|4684753_4686343_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 274
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4691711	4693475	5168350		Bacillus_phage(50.0%)	3	NA	NA
WP_001044510.1|4691711_4691984_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	4.2e-20
WP_062882155.1|4692170_4692761_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362392.1|4692803_4693475_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 275
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4702193	4712504	5168350	transposase	Shigella_phage(33.33%)	4	NA	NA
WP_101974043.1|4702193_4703467_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.3	1.3e-175
WP_062881578.1|4703510_4703963_-	stationary phase growth adaptation protein	NA	NA	NA	NA	NA
WP_000653944.1|4704175_4708399_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
WP_000263098.1|4708475_4712504_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 276
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4716623	4719676	5168350		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|4716623_4717808_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023081.1|4718725_4719676_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 277
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4728180	4730025	5168350		Acinetobacter_phage(100.0%)	1	NA	NA
WP_062881830.1|4728180_4730025_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	3.2e-10
>prophage 278
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4747125	4749423	5168350		Serratia_phage(100.0%)	1	NA	NA
WP_062881826.1|4747125_4749423_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 279
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4753708	4754371	5168350		Synechococcus_phage(100.0%)	1	NA	NA
WP_062881825.1|4753708_4754371_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	2.7e-28
>prophage 280
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4774075	4778579	5168350		Erwinia_phage(50.0%)	5	NA	NA
WP_001293341.1|4774075_4775407_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|4775473_4776400_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_024226852.1|4776492_4776978_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|4777062_4777308_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|4777733_4778579_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 281
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4790153	4795014	5168350		Feldmannia_irregularis_virus(33.33%)	5	NA	NA
WP_001033722.1|4790153_4790852_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|4790848_4792222_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270260.1|4792327_4793002_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166065.1|4793150_4794134_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001295522.1|4794393_4795014_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
>prophage 282
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4809777	4812828	5168350		Escherichia_phage(100.0%)	1	NA	NA
WP_011310337.1|4809777_4812828_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 283
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4820150	4822930	5168350		Escherichia_phage(50.0%)	3	NA	NA
WP_062881799.1|4820150_4820936_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
WP_000621656.1|4820969_4821866_-	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000718892.1|4822033_4822930_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.6e-60
>prophage 284
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4839152	4841623	5168350		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000190577.1|4839152_4840202_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
WP_001188777.1|4840213_4841623_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 285
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4845701	4848488	5168350		uncultured_virus(100.0%)	1	NA	NA
WP_096851586.1|4845701_4848488_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.9	2.4e-70
>prophage 286
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4862126	4862741	5168350		Streptococcus_phage(100.0%)	1	NA	NA
WP_062882372.1|4862126_4862741_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	31.9	1.8e-18
>prophage 287
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4871432	4874719	5168350		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109943.1|4871432_4872209_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
WP_000459594.1|4872211_4872727_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001295260.1|4872730_4873000_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187543.1|4873078_4874719_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	4.8e-42
>prophage 288
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4887131	4888961	5168350		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|4887131_4888961_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 289
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4894736	4898595	5168350		Bacillus_phage(100.0%)	3	NA	NA
WP_000383411.1|4894736_4896899_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.0	1.0e-116
WP_001213584.1|4896982_4897699_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000130691.1|4897698_4898595_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
>prophage 290
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4917083	4923227	5168350		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000612044.1|4917083_4918214_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
WP_001145172.1|4918218_4918893_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000676056.1|4918870_4919752_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_062882388.1|4919770_4920838_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	8.6e-101
WP_000006625.1|4920837_4922100_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_000866672.1|4922096_4923227_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.3	3.9e-27
>prophage 291
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4927269	4932681	5168350		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|4927269_4927599_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047499.1|4927729_4928995_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_062882390.1|4929128_4930613_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001238869.1|4930659_4932681_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
>prophage 292
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4941151	4942798	5168350		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012621.1|4941151_4942798_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	7.4e-67
>prophage 293
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4956189	4962042	5168350		Enterobacteria_phage(33.33%)	5	NA	NA
WP_062882438.1|4956189_4957080_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	2.0e-05
WP_000211858.1|4957104_4958070_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000387752.1|4958074_4959580_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000715936.1|4959587_4960007_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_024226297.1|4960173_4962042_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
>prophage 294
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4965210	4966203	5168350		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845107.1|4965210_4966203_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 295
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4978154	4981516	5168350		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_024226301.1|4978154_4979525_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	1.8e-34
WP_062882435.1|4979686_4981516_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.0	1.6e-131
>prophage 296
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	4987048	4990889	5168350		Cyanophage(50.0%)	4	NA	NA
WP_096851567.1|4987048_4988089_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	4.7e-51
WP_062882432.1|4988175_4989135_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_001251975.1|4989134_4990025_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063125.1|4990115_4990889_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	31.6	1.3e-18
>prophage 297
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	5001877	5003215	5168350		Moraxella_phage(100.0%)	1	NA	NA
WP_062882428.1|5001877_5003215_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.0e-62
>prophage 298
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	5013413	5020782	5168350		Staphylococcus_phage(33.33%)	8	NA	NA
WP_001307474.1|5013413_5013671_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239730.1|5013634_5013994_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|5014010_5014151_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_122994983.1|5014380_5014461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000059111.1|5014757_5016161_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673464.1|5016165_5017266_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000060112.1|5017265_5018339_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000072067.1|5018367_5020782_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
>prophage 299
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	5025423	5026572	5168350		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|5025423_5026572_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 300
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	5030998	5031952	5168350		Cyanophage(50.0%)	2	NA	NA
WP_001243437.1|5030998_5031412_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_001243431.1|5031523_5031952_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
>prophage 301
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	5038304	5047465	5168350		Aeromonas_phage(25.0%)	10	NA	NA
WP_057711583.1|5038304_5040020_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.4	7.3e-41
WP_062882422.1|5040016_5041510_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.0	4.2e-29
WP_000511299.1|5041556_5042006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000703959.1|5042114_5042462_+	YidH family protein	NA	NA	NA	NA	NA
WP_062882421.1|5042451_5042814_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000148053.1|5042810_5043308_+	radical SAM protein	NA	NA	NA	NA	NA
WP_062882420.1|5043315_5044500_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000060506.1|5044918_5045008_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001315912.1|5045572_5045671_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_062882419.1|5045776_5047465_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	4.2e-57
>prophage 302
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	5054768	5056103	5168350		Moraxella_phage(100.0%)	1	NA	NA
WP_074434067.1|5054768_5056103_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.2	2.5e-65
>prophage 303
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	5062470	5068873	5168350		uncultured_Caudovirales_phage(33.33%)	4	NA	NA
WP_062882241.1|5062470_5065365_+	DEAD/DEAH box helicase family protein	NA	A0A2H4J643	uncultured_Caudovirales_phage	54.4	2.2e-287
WP_062882240.1|5065522_5066452_+	Abi family protein	NA	X2L062	Streptococcus_phage	26.3	5.2e-17
WP_101975614.1|5066491_5067112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029785289.1|5067169_5068873_+	site-specific DNA-methyltransferase	NA	A0A0M7Q8J6	Escherichia_phage	96.6	7.0e-254
>prophage 304
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	5081771	5083163	5168350		environmental_Halophage(100.0%)	1	NA	NA
WP_062882236.1|5081771_5083163_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 305
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	5088284	5098296	5168350		Bordetella_phage(25.0%)	7	NA	NA
WP_096851568.1|5088284_5090393_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|5090411_5090687_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_062882234.1|5090741_5091365_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	5.3e-18
WP_000924289.1|5093301_5093919_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_062882233.1|5094210_5095035_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	2.8e-91
WP_000399369.1|5096013_5096220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204829.1|5097903_5098296_-	antitermination protein	NA	A0A088CD47	Shigella_phage	93.6	9.6e-66
>prophage 306
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	5102181	5110992	5168350	integrase	Sodalis_phage(25.0%)	12	5103183:5103196	5112449:5112462
WP_001466564.1|5102181_5102529_-	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	44.6	6.0e-11
WP_000126696.1|5102614_5103064_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000136564.1|5103060_5103510_-	hypothetical protein	NA	NA	NA	NA	NA
5103183:5103196	attL	TGATCGCCCGTGCT	NA	NA	NA	NA
WP_000833607.1|5103797_5105624_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.2	4.4e-129
WP_001186248.1|5105800_5105992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000332807.1|5106036_5106246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920683.1|5106249_5106435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157909385.1|5106427_5106724_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000828536.1|5107564_5108413_-	hypothetical protein	NA	A0A0P0ZAZ7	Stx2-converting_phage	44.2	7.8e-20
WP_000126307.1|5108480_5108696_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001466562.1|5109082_5109664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303105.1|5109729_5110992_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	78.0	1.3e-191
5112449:5112462	attR	TGATCGCCCGTGCT	NA	NA	NA	NA
>prophage 307
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	5114334	5118897	5168350		Xanthomonas_phage(25.0%)	7	NA	NA
WP_077879215.1|5114334_5114790_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.5e-49
WP_000050139.1|5114770_5115991_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_096851616.1|5116162_5116831_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000091955.1|5117047_5117284_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|5117304_5117472_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114533.1|5117569_5118379_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001171866.1|5118417_5118897_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
>prophage 308
NZ_CP027591	Escherichia coli strain 2014C-3011 chromosome, complete genome	5168350	5130828	5141556	5168350		Synechococcus_phage(20.0%)	9	NA	NA
WP_000587764.1|5130828_5131761_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
WP_122994987.1|5132049_5132922_+	protein YibB	NA	NA	NA	NA	NA
WP_106879278.1|5133196_5134393_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	6.4e-36
WP_000646014.1|5134402_5135428_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_000483856.1|5136686_5137646_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214147.1|5137649_5138933_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000116566.1|5138942_5140487_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001156181.1|5140731_5141163_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024392.1|5141304_5141556_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 1
NZ_CP027589	Escherichia coli strain 2014C-3011 plasmid unnamed1	75065	50830	63098	75065	transposase,protease	Stx2-converting_phage(81.82%)	12	NA	NA
WP_101974169.1|50830_52369_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	6.5e-299
WP_001243632.1|52418_52712_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.5e-50
WP_134796773.1|52761_52977_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBP6	Stx2-converting_phage	88.2	2.0e-25
WP_001477293.1|52919_53141_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-34
WP_032205206.1|53374_53740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000789660.1|53750_53942_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	41.3	3.5e-05
WP_062881749.1|54246_58149_-|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	5.5e-238
WP_101974169.1|58591_60130_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	6.5e-299
WP_001243632.1|60179_60473_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.5e-50
WP_001171554.1|60785_61166_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|61162_61510_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_101974169.1|61559_63098_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	6.5e-299
>prophage 1
NZ_CP027590	Escherichia coli strain 2014C-3011 plasmid unnamed2	92449	0	10713	92449	holin,tail	Escherichia_phage(63.64%)	12	NA	NA
WP_106879221.1|0_1407_-	hypothetical protein	NA	A0A1B0V7H1	Salmonella_phage	94.0	2.9e-245
WP_001345482.1|1408_2011_-	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
WP_000580770.1|1997_2441_-	hypothetical protein	NA	A0A077SK09	Escherichia_phage	99.3	2.9e-82
WP_000887652.1|2437_2767_-|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_024177048.1|2657_3032_+	hypothetical protein	NA	A0A077SL44	Escherichia_phage	63.1	1.0e-24
WP_001369353.1|3522_4095_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000144016.1|4138_4717_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	7.7e-96
WP_001000795.1|4716_7566_-|tail	tail protein	tail	Q71TP5	Escherichia_phage	93.9	0.0e+00
WP_001286326.1|7577_8012_-	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	100.0	3.3e-75
WP_001189831.1|8090_8927_-	hypothetical protein	NA	A0A077SLH5	Escherichia_phage	98.9	1.7e-152
WP_000047923.1|8926_10360_-	bleomycin hydrolase	NA	A0A1B0VAD6	Salmonella_phage	100.0	3.7e-272
WP_000002800.1|10356_10713_-	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
>prophage 2
NZ_CP027590	Escherichia coli strain 2014C-3011 plasmid unnamed2	92449	14125	78140	92449	integrase	Escherichia_phage(69.74%)	79	39850:39867	77223:77240
WP_000926345.1|14125_15007_-	hypothetical protein	NA	A0A1B0VBL3	Salmonella_phage	99.7	3.7e-174
WP_023442339.1|15021_15633_-	hypothetical protein	NA	A0A077SLH8	Escherichia_phage	99.5	3.8e-109
WP_000188924.1|15643_16210_-	hypothetical protein	NA	Q1MVL0	Enterobacteria_phage	100.0	6.6e-100
WP_000846124.1|16268_16538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023442338.1|16806_17481_-	hypothetical protein	NA	Q71TC4	Escherichia_phage	92.2	4.0e-19
WP_023442337.1|17880_18102_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	98.6	2.1e-38
WP_023442336.1|18098_19142_+	antirepressor	NA	Q71TN2	Escherichia_phage	98.0	1.7e-186
WP_001187871.1|19306_20107_+	protein kilA	NA	Q1MVK4	Enterobacteria_phage	99.6	5.4e-148
WP_023442335.1|20136_20982_+	hypothetical protein	NA	Q71TB9	Escherichia_phage	97.9	4.0e-149
WP_000934733.1|21150_21855_+	DUF3800 domain-containing protein	NA	Q71TB8	Escherichia_phage	99.6	7.9e-135
WP_000509946.1|22866_23376_-	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	98.8	5.6e-90
WP_000035299.1|23387_23969_-	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	96.9	2.1e-101
WP_000041774.1|24004_24820_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.3	9.8e-113
WP_106879222.1|24829_26419_-	hypothetical protein	NA	A0A1B0V7E4	Salmonella_phage	99.1	2.4e-304
WP_106879223.1|26479_28186_-	hypothetical protein	NA	Q1MVJ5	Enterobacteria_phage	99.6	0.0e+00
WP_023442333.1|28410_29412_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	99.7	6.3e-178
WP_001285362.1|29428_30625_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_023442332.1|30792_31602_-	GIY-YIG nuclease family protein	NA	A0A077SK46	Escherichia_phage	97.8	2.1e-155
WP_023442331.1|31894_32779_-	RepB family plasmid replication initiator protein	NA	A0A077SLP3	Escherichia_phage	99.7	4.7e-161
WP_016246521.1|33113_33506_-	hypothetical protein	NA	Q1MVJ1	Enterobacteria_phage	99.2	1.5e-71
WP_000007769.1|33682_34105_-	hypothetical protein	NA	A0A1B0VCB0	Salmonella_phage	100.0	2.7e-58
WP_001311689.1|34940_35120_-	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	100.0	3.1e-27
WP_001177859.1|35394_35679_+	hypothetical protein	NA	Q71TA2	Escherichia_phage	98.9	1.7e-48
WP_024222318.1|36572_39860_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	98.7	0.0e+00
39850:39867	attL	TATTGCTCTAATAAATTT	NA	NA	NA	NA
WP_000751806.1|41869_42697_+	hypothetical protein	NA	A0A077SLJ6	Escherichia_phage	99.6	2.8e-131
WP_001276599.1|43080_44445_+	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	100.0	2.1e-253
WP_106879224.1|44444_44645_+	hypothetical protein	NA	A0A077SL52	Escherichia_phage	100.0	8.4e-26
WP_106879225.1|44725_45442_+	hypothetical protein	NA	A0A1B0VCH7	Salmonella_phage	99.2	1.3e-137
WP_000535208.1|45487_46120_-	hypothetical protein	NA	Q1MVH8	Enterobacteria_phage	100.0	9.0e-90
WP_000212018.1|46112_47129_-	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	100.0	3.5e-192
WP_000602706.1|47130_47916_-	hypothetical protein	NA	A0A1B0V7N6	Salmonella_phage	99.2	1.8e-143
WP_000896801.1|47902_48631_-	hypothetical protein	NA	A0A077SK19	Escherichia_phage	100.0	9.3e-139
WP_001141902.1|48634_49852_-	hypothetical protein	NA	A0A077SL53	Escherichia_phage	99.5	2.4e-224
WP_000235786.1|49861_50239_-	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_000840929.1|50385_50631_+	hypothetical protein	NA	A0A1B0VDU5	Salmonella_phage	98.8	2.5e-40
WP_000943614.1|50633_51212_+	norphogenetic protein	NA	Q71T85	Escherichia_phage	97.4	2.0e-104
WP_000096176.1|51278_51434_+	hypothetical protein	NA	Q71TJ4	Escherichia_phage	98.0	2.0e-19
WP_012817939.1|51375_52038_+	hypothetical protein	NA	Q71T83	Escherichia_phage	100.0	4.5e-124
WP_023442327.1|51935_52562_+	norphogenetic protein	NA	A0A077SK52	Escherichia_phage	98.6	9.8e-121
WP_024231213.1|52558_53236_+	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	99.6	8.4e-134
WP_023442325.1|53232_53934_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	98.7	1.7e-142
WP_023442324.1|54235_55498_+	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	99.3	1.7e-233
WP_000021755.1|55570_56077_+	hypothetical protein	NA	A0A077SK53	Escherichia_phage	98.8	5.4e-93
WP_000675643.1|56271_56853_+	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	100.0	2.0e-112
WP_023442323.1|56845_57112_+	hypothetical protein	NA	Q1MVG1	Enterobacteria_phage	98.8	4.5e-43
WP_023442322.1|57098_57800_+	ead/Ea22-like family protein	NA	A0A0U2QW67	Escherichia_phage	55.8	7.0e-51
WP_023442321.1|57796_58087_+	DUF4752 family protein	NA	A0A2I6TCB0	Escherichia_phage	82.3	9.1e-37
WP_023442320.1|58753_59113_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	2.3e-58
WP_000935430.1|59158_59371_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	88.6	2.2e-32
WP_000797281.1|59433_59622_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	100.0	2.8e-31
WP_000951706.1|59623_59833_+	hypothetical protein	NA	A0A077SL56	Escherichia_phage	100.0	4.2e-36
WP_023442319.1|59829_60468_+	hypothetical protein	NA	A0A077SK54	Escherichia_phage	94.1	4.4e-92
WP_023442318.1|60464_61052_+	DUF551 domain-containing protein	NA	Q9G077	Enterobacteria_phage	99.5	1.7e-114
WP_000002123.1|61051_61333_+	ASCH domain-containing protein	NA	A0A077SLL0	Escherichia_phage	97.8	1.4e-47
WP_000267997.1|61356_61650_+	hypothetical protein	NA	A0A077SK23	Escherichia_phage	97.9	1.6e-49
WP_000988652.1|61656_62031_+	hypothetical protein	NA	A0A077SL57	Escherichia_phage	100.0	1.2e-68
WP_000057456.1|62012_62702_+	hypothetical protein	NA	A0A077SK55	Escherichia_phage	97.8	8.8e-123
WP_001142389.1|62685_62970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000988220.1|62969_63275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000159954.1|63271_63796_+	toprim domain-containing protein	NA	A0A2D2W4T4	Escherichia_phage	48.5	4.9e-33
WP_001048304.1|63856_64072_-	hypothetical protein	NA	Q1MVE8	Enterobacteria_phage	97.2	4.2e-31
WP_001133672.1|64102_64438_-	hypothetical protein	NA	Q71TH9	Escherichia_phage	98.2	6.5e-63
WP_000506726.1|64612_65002_+	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	99.2	1.4e-69
WP_001190712.1|65074_65296_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216044.1|65295_65676_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	99.2	2.8e-62
WP_024224144.1|65680_65860_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	2.3e-22
WP_023442316.1|65887_66931_+	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	99.1	4.8e-205
WP_001326849.1|67019_67472_+	late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
WP_000124159.1|68749_70234_+	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	99.8	4.3e-292
WP_073972593.1|70317_70794_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	78.8	1.0e-24
WP_106879226.1|70790_71903_+	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	89.5	4.7e-182
WP_023441713.1|71935_72787_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	6.1e-158
WP_000874156.1|72897_73107_-	hypothetical protein	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
WP_000542332.1|73711_73933_+	hypothetical protein	NA	A0A077SLI9	Escherichia_phage	100.0	3.4e-36
WP_001568009.1|73940_74972_+|integrase	tyrosine-type recombinase/integrase	integrase	Q71TG5	Escherichia_phage	99.1	3.2e-193
WP_023441714.1|75022_75334_+	hypothetical protein	NA	Q5XLQ4	Enterobacteria_phage	93.2	4.8e-44
WP_103951623.1|75574_76687_-	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	86.0	1.5e-175
WP_000245704.1|76683_76905_-	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	80.8	3.7e-30
WP_001398228.1|77498_78140_+	hypothetical protein	NA	Q71TG2	Escherichia_phage	98.6	6.3e-115
77223:77240	attR	AAATTTATTAGAGCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP027590	Escherichia coli strain 2014C-3011 plasmid unnamed2	92449	83274	91376	92449	head	Escherichia_phage(50.0%)	8	NA	NA
WP_000747846.1|83274_83523_-	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_023442344.1|83835_85545_+	hypothetical protein	NA	Q1MVN6	Enterobacteria_phage	99.5	0.0e+00
WP_000132937.1|85537_86557_+|head	head processing protein	head	Q71TR6	Escherichia_phage	96.8	4.4e-179
WP_001339174.1|86848_87406_-	lysozyme	NA	Q71TF3	Escherichia_phage	97.3	2.0e-104
WP_000068866.1|87575_88064_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	99.4	8.5e-88
WP_023442342.1|88261_89050_+	hypothetical protein	NA	A0A1B0VDP8	Salmonella_phage	98.1	2.0e-142
WP_001165934.1|89788_90109_-	hypothetical protein	NA	A0A077SLG5	Escherichia_phage	100.0	1.0e-41
WP_094192281.1|90098_91376_-	ddrB domain protein	NA	Q1MVM9	Enterobacteria_phage	99.1	4.9e-236
