The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027582	Escherichia coli strain 2013C-4538 chromosome, complete genome	5680428	74243	110634	5680428	tail,integrase,terminase	Escherichia_phage(50.0%)	45	77342:77358	117896:117912
WP_001299507.1|74243_75710_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138282.1|75778_77356_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
77342:77358	attL	ATTGAGTGGGAATGATT	NA	NA	NA	NA
WP_032277130.1|77548_78805_+|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	98.8	8.3e-236
WP_032277128.1|78807_79467_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	77.2	7.0e-101
WP_032277127.1|79463_80114_-	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	99.1	5.6e-127
WP_001335975.1|80106_80358_-	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	100.0	3.1e-41
WP_000675390.1|80515_80764_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_053878813.1|80813_81755_-	recombinase RecT	NA	A0A0F6TJP0	Escherichia_coli_O157_typing_phage	99.0	2.5e-176
WP_032277125.1|81751_82573_-	exodeoxyribonuclease VIII	NA	A0A2R9YJH7	Escherichia_phage	96.3	2.0e-158
WP_001102253.1|82569_82869_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	97.0	2.5e-45
WP_000836290.1|83177_83762_-	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_001282459.1|83916_84147_+	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_000402895.1|84297_84498_+	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	100.0	2.1e-32
WP_032277123.1|84513_85329_+	primosomal protein	NA	Q286X4	Escherichia_phage	95.3	9.2e-119
WP_032277137.1|85325_86111_+	replication protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	99.2	7.9e-152
WP_001231254.1|86228_86573_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	97.4	1.4e-60
WP_096858528.1|86634_87267_+	hypothetical protein	NA	A0A0F6TJR7	Escherichia_coli_O157_typing_phage	68.5	2.2e-64
WP_106875395.1|87230_87716_+	ead/Ea22-like family protein	NA	A0A0P0ZFW8	Escherichia_phage	75.8	3.8e-56
WP_000403783.1|87693_88050_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
WP_000935422.1|88100_88313_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	100.0	6.6e-37
WP_001224662.1|88346_88529_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_001289353.1|88694_89330_+	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	100.0	1.3e-115
WP_000209152.1|89417_89636_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	100.0	6.6e-32
WP_001229296.1|89637_90003_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	100.0	5.1e-69
WP_106875396.1|89999_90653_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	87.0	2.9e-30
WP_001130062.1|90767_91106_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	86.6	1.4e-49
WP_001124396.1|91123_91336_+	hypothetical protein	NA	Q7Y4V0	Enterobacteria_phage	52.2	2.1e-14
WP_001090120.1|91332_92007_+|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	100.0	9.0e-120
WP_106875397.1|92003_93479_+|terminase	terminase	terminase	A0A0F6TK57	Escherichia_coli_O157_typing_phage	99.2	2.2e-296
WP_001280570.1|93569_93941_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	98.4	3.2e-63
WP_000335899.1|94648_94855_+	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_000852419.1|94869_96549_+|tail	tail protein	tail	G9L6C2	Escherichia_phage	99.5	3.6e-303
WP_000133160.1|96545_96842_+	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
WP_106875398.1|96844_97540_+	peptidase	NA	G9L6C4	Escherichia_phage	98.3	9.6e-93
WP_000216335.1|97554_98541_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	99.7	4.3e-187
WP_000627071.1|98592_99030_+	hypothetical protein	NA	G9L6C6	Escherichia_phage	99.3	6.3e-74
WP_032277054.1|99040_99376_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	99.1	1.7e-55
WP_000424495.1|99426_99750_+	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	98.1	2.6e-53
WP_032277056.1|99749_100355_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	99.0	5.2e-111
WP_096858558.1|100354_102826_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	98.7	0.0e+00
WP_000568023.1|102825_103290_+	hypothetical protein	NA	G9L6D1	Escherichia_phage	100.0	8.4e-85
WP_000336180.1|103289_103829_+	hypothetical protein	NA	A0A193GYJ4	Enterobacter_phage	81.8	1.6e-47
WP_106875399.1|103841_106355_+	hypothetical protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	94.1	0.0e+00
WP_032277360.1|106351_108154_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	97.8	0.0e+00
WP_032277359.1|108159_110634_+	phage protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	99.2	0.0e+00
117896:117912	attR	ATTGAGTGGGAATGATT	NA	NA	NA	NA
>prophage 2
NZ_CP027582	Escherichia coli strain 2013C-4538 chromosome, complete genome	5680428	115990	119562	5680428	holin	Salmonella_phage(42.86%)	7	NA	NA
WP_032276644.1|115990_116395_+	membrane protein	NA	T1SA79	Salmonella_phage	99.3	2.9e-65
WP_016046623.1|116381_116690_+|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	100.0	2.6e-50
WP_032276643.1|116679_117306_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	96.6	1.4e-114
WP_032276642.1|117302_117785_+	DUF2514 domain-containing protein	NA	A0A0F6TK39	Escherichia_coli_O157_typing_phage	91.9	5.0e-72
WP_000755172.1|118004_118544_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	99.4	9.9e-45
WP_000669403.1|118559_119075_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	6.5e-62
WP_001344399.1|119388_119562_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
>prophage 3
NZ_CP027582	Escherichia coli strain 2013C-4538 chromosome, complete genome	5680428	394043	507828	5680428	protease,holin,integrase,terminase,lysis,transposase,tail,capsid,head,portal	Enterobacteria_phage(34.94%)	117	403034:403052	477279:477297
WP_000140570.1|394043_394946_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
WP_001000358.1|395139_396330_-	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_001209922.1|396326_397586_-	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_000857257.1|397575_399204_-	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_000948732.1|399476_400835_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_000779084.1|400839_401916_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_000301050.1|402378_403029_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
403034:403052	attL	TGTAGGCCAGATAAGACGC	NA	NA	NA	NA
WP_000135040.1|403082_403337_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000332036.1|403336_404467_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_001075177.1|404555_406841_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.1e-283
WP_032276943.1|407536_411271_+	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	26.5	2.0e-19
WP_000990754.1|411398_412121_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001281242.1|412267_414895_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
WP_001215756.1|416728_417334_+	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_000533670.1|417348_418419_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
WP_001444001.1|418396_418615_-	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
WP_001281192.1|418720_419065_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
WP_000457736.1|419183_419426_-	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	96.2	3.7e-36
WP_001345188.1|419500_419851_-	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	80.2	3.3e-33
WP_001289868.1|419847_420453_-	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	96.9	1.7e-45
WP_000763358.1|420449_420671_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	95.9	1.6e-33
WP_001444000.1|420769_421051_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|421061_421253_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|421225_421408_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_032284635.1|421407_422085_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	99.6	2.3e-131
WP_000100847.1|422081_422867_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|422872_423169_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372926.1|423223_423388_-	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	98.1	3.2e-23
WP_001198860.1|423356_423521_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000065385.1|423593_423962_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	97.5	3.8e-64
WP_000167595.1|424111_424582_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000930321.1|424715_425054_-	hypothetical protein	NA	K7PJW2	Enterobacteria_phage	99.1	5.8e-59
WP_000256573.1|425056_425362_-	hypothetical protein	NA	K7PJM7	Enterobacteria_phage	99.0	7.0e-48
WP_001095982.1|425676_426327_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	100.0	4.9e-123
WP_000276885.1|426407_426593_+	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	100.0	1.2e-26
WP_000035947.1|426702_426999_+	hypothetical protein	NA	A0A0N7C1W0	Escherichia_phage	96.9	1.3e-46
WP_000185462.1|427031_427970_+	replication protein	NA	C1JJ53	Enterobacteria_phage	99.4	1.1e-171
WP_000788878.1|427966_428668_+	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	99.6	1.7e-129
WP_000145926.1|428664_428955_+	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000229807.1|429027_429234_+	hypothetical protein	NA	G8C7M4	Escherichia_phage	97.1	1.8e-26
WP_000810176.1|429241_429688_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	92.6	3.4e-75
WP_000153270.1|429684_430212_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_001254228.1|430208_430391_+	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_001429269.1|430894_432730_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	0.0e+00
WP_001108084.1|433235_433802_+	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_001223927.1|433776_434379_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
WP_001028854.1|434375_435041_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235460.1|435037_435661_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_001302581.1|435913_436657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|436742_436901_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|436981_437380_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|437522_437738_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075153.1|437737_438235_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	96.4	1.6e-89
WP_001228695.1|438451_438634_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|438724_439018_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001427981.1|439377_439572_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_000235436.1|439966_440476_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001444182.1|440447_442157_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.5	2.9e-239
WP_001238637.1|442169_442376_+|terminase	terminase	terminase	A0A2I6TC92	Escherichia_phage	59.4	1.1e-12
WP_000258991.1|442359_442566_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	60.0	4.2e-12
WP_000827572.1|442562_444155_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	8.4e-185
WP_001254039.1|444144_445650_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000256849.1|445686_446034_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	1.5e-22
WP_000522643.1|446091_446976_+	hypothetical protein	NA	C6ZCY2	Enterobacteria_phage	54.1	6.5e-94
WP_000201528.1|447027_447402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204544.1|447394_447748_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000975037.1|447762_448338_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_000683071.1|448334_448730_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_001143013.1|448737_449490_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_000479086.1|449503_449935_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_000533403.1|449961_450375_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082375.1|450355_452917_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.0	0.0e+00
WP_000847413.1|452913_453243_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	1.3e-52
WP_106875401.1|453242_453941_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194778.1|453946_454690_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	6.6e-148
WP_000090884.1|454626_455259_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_032284631.1|455319_458619_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	95.2	0.0e+00
WP_000839179.1|458647_459052_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|459048_459396_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099160.1|459444_460983_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_001230644.1|461045_461261_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	95.8	2.9e-32
WP_001228241.1|461328_461928_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.4e-100
WP_000279018.1|461992_463306_+|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.3	2.8e-77
WP_001023380.1|463307_463577_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	94.4	7.3e-41
WP_001025665.1|465143_466466_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.5	9.7e-227
WP_001676637.1|467267_471662_+	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_032276988.1|471662_473312_+	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_001225855.1|473316_474093_+	YfaP family protein	NA	NA	NA	NA	NA
WP_032277553.1|474367_477217_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.0	9.2e-41
WP_001061917.1|477302_477953_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
477279:477297	attR	GCGTCTTATCTGGCCTACA	NA	NA	NA	NA
WP_001249127.1|477969_480642_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_032278818.1|481380_482472_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
WP_000406116.1|482583_483639_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000786386.1|483712_484777_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000884922.1|484776_485427_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000422231.1|485502_487146_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000758074.1|487363_489010_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000849214.1|489158_489647_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_001296837.1|489782_489947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000686723.1|490055_490550_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_000557378.1|490539_490803_+	chaperone NapD	NA	NA	NA	NA	NA
WP_032277551.1|490799_493286_+	periplasmic nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_000091291.1|493292_493988_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013509.1|493974_494838_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835177.1|494834_495284_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000528376.1|495293_495896_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888560.1|495914_496532_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
WP_000971723.1|496528_497191_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_001295447.1|497232_497970_+	heme exporter protein CcmC	NA	NA	NA	NA	NA
WP_000186540.1|497966_498176_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001026418.1|498172_498652_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982426.1|498648_500592_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000824439.1|500588_501146_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_001211567.1|501142_502195_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001113637.1|502229_502877_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_001369202.1|506253_507177_-|capsid	phage capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.9	1.2e-13
WP_001229488.1|507339_507828_-|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	41.7	3.9e-24
>prophage 4
NZ_CP027582	Escherichia coli strain 2013C-4538 chromosome, complete genome	5680428	585337	595265	5680428	transposase	Enterobacteria_phage(62.5%)	9	NA	NA
WP_001240401.1|585337_586069_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|586290_587976_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|587972_588692_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950404.1|588738_589209_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.0e-81
WP_000998019.1|589640_591026_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000612591.1|591075_591423_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171523.1|591419_591800_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001342301.1|592131_594132_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001292774.1|594128_595265_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 5
NZ_CP027582	Escherichia coli strain 2013C-4538 chromosome, complete genome	5680428	828817	885724	5680428	holin,integrase,terminase,transposase,tail,plate,head,capsid,portal	Enterobacteria_phage(80.95%)	69	848496:848555	885831:885951
WP_000826451.1|828817_829981_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	8.9e-200
WP_000334586.1|829965_830637_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	5.6e-82
WP_000790504.1|830745_830979_-	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000118901.1|830975_832181_-	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_001295642.1|832367_832781_+	lipoprotein	NA	NA	NA	NA	NA
WP_001245684.1|832814_834302_-	alpha-amylase	NA	NA	NA	NA	NA
WP_001015030.1|834379_834745_-	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000287768.1|834744_835155_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_032276835.1|835169_836582_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000079829.1|836836_838411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032276834.1|838575_839295_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_001370462.1|839340_839892_+	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
WP_001317901.1|839979_840780_+	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001128238.1|840884_841871_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_001158220.1|841885_842554_+	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_001272994.1|842550_843303_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
WP_001154265.1|843532_844255_+	transcriptional regulator SdiA	NA	NA	NA	NA	NA
WP_000106474.1|844322_844547_-	DUF2594 family protein	NA	NA	NA	NA	NA
WP_001342215.1|844533_844710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611328.1|845005_845662_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_001283424.1|845658_847491_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_001160187.1|847547_848096_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
848496:848555	attL	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGA	NA	NA	NA	NA
WP_001303543.1|849088_849370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078920.1|849558_849699_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488107.1|849889_850150_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001317900.1|850439_851579_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_000132847.1|851978_853079_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	2.1e-203
WP_032250563.1|853236_854421_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.2	2.2e-222
WP_000290450.1|854420_854933_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665308.1|854987_855353_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000763327.1|855388_855517_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000853454.1|855503_858311_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	96.7	0.0e+00
WP_000979948.1|858323_858812_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	2.6e-84
WP_000954196.1|858968_859541_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000144010.1|859584_860163_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	2.2e-95
WP_106875403.1|860162_862295_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.4	2.7e-130
WP_000071738.1|862297_862828_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	4.3e-93
WP_001111967.1|862820_863717_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.9e-154
WP_000213447.1|863720_864071_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001271909.1|864067_864649_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	1.2e-101
WP_032276831.1|864645_865281_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
WP_001342220.1|865273_865741_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	94.8	6.7e-82
WP_000202144.1|865764_867642_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	82.2	1.1e-305
WP_000780555.1|867780_868188_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	4.2e-64
WP_000072343.1|868184_868577_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	98.5	2.9e-70
WP_001342221.1|868573_868897_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000864911.1|868899_869100_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	7.9e-32
WP_000063100.1|869099_869594_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_106875404.1|869695_870496_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	88.7	1.3e-125
WP_024219921.1|870541_871594_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.6	4.9e-189
WP_001262655.1|871617_872454_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_000613774.1|872608_874360_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
WP_000087812.1|874359_875406_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_001289969.1|875896_876487_-	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	50.7	1.8e-31
WP_000211289.1|876550_876862_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.2e-47
WP_000686499.1|876866_877826_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.0e-181
WP_001272083.1|877902_880743_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.6	0.0e+00
WP_000564221.1|880739_881129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000985152.1|881452_881656_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	9.5e-25
WP_000021647.1|881742_881856_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	2.4e-09
WP_000357025.1|881852_882095_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	3.4e-37
WP_000158976.1|882106_882385_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.2	6.9e-34
WP_000742491.1|882395_882746_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.0	1.2e-48
WP_000014504.1|882767_882971_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|883042_883180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786769.1|883269_883674_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_000290352.1|883689_884340_+	membrane protein	NA	NA	NA	NA	NA
WP_000865208.1|884369_884717_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001342226.1|884722_885724_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.2	9.3e-105
885831:885951	attR	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTT	NA	NA	NA	NA
>prophage 6
NZ_CP027582	Escherichia coli strain 2013C-4538 chromosome, complete genome	5680428	969760	1051332	5680428	holin,protease,tRNA,integrase,terminase,lysis,tail,capsid,head,portal	Escherichia_phage(33.87%)	96	962031:962045	982786:982800
962031:962045	attL	TCCGGCGCTTCAGGT	NA	NA	NA	NA
WP_000916763.1|969760_969991_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000204699.1|970129_970504_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879280.1|970507_971380_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976492.1|971392_971734_+	YebY family protein	NA	NA	NA	NA	NA
WP_001189091.1|972126_973203_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	5.3e-98
WP_001443927.1|973168_973450_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
WP_001356607.1|973556_973745_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_042853000.1|973737_973932_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_000166317.1|973988_974798_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	6.8e-106
WP_000105101.1|974790_977442_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	77.6	0.0e+00
WP_001307773.1|977540_977816_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	96.7	3.0e-42
WP_001427414.1|977889_978060_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
WP_000560218.1|978059_978281_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	1.8e-37
WP_001427316.1|978701_978854_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	2.3e-07
WP_001303511.1|979140_979419_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|979420_979612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169687.1|979632_980004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|980102_980405_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|980401_980827_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001444941.1|980849_981812_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.5	2.7e-69
WP_000450872.1|982585_983347_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	67.2	3.9e-79
982786:982800	attR	ACCTGAAGCGCCGGA	NA	NA	NA	NA
WP_000603384.1|983379_983661_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|983657_983885_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|983877_984189_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|984316_984535_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|984536_985094_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|985327_985540_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|985659_986004_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|986125_986398_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_032284663.1|986399_987449_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	3.4e-110
WP_001217413.1|987461_987836_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.4e-34
WP_000762928.1|987832_988654_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_032284665.1|989824_991675_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.6	0.0e+00
WP_000411802.1|992122_992329_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075132.1|992328_992826_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092325.1|992822_993260_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_000881326.1|993409_994027_+	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_001307652.1|994214_994409_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453587.1|994797_995343_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027379.1|995317_997243_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198153.1|997239_997446_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_024026143.1|997442_999044_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	2.1e-308
WP_000123251.1|999024_1000344_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_001365129.1|1000353_1000686_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000063258.1|1000741_1001767_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_000158897.1|1001808_1002204_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000752994.1|1002215_1002569_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000975096.1|1002580_1003159_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683137.1|1003155_1003551_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_032325228.1|1003558_1004311_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	95.6	1.3e-130
WP_000479045.1|1004324_1004747_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000533440.1|1004773_1005187_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_106875406.1|1005167_1007780_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	91.0	0.0e+00
WP_000847280.1|1007776_1008106_+|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_032284485.1|1008105_1008804_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.1	4.9e-129
WP_106875407.1|1008814_1009558_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_072148784.1|1009503_1010136_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	2.9e-104
WP_106875408.1|1010381_1013774_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	84.7	0.0e+00
WP_001230428.1|1013841_1014441_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_032284483.1|1014505_1015819_+|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	99.5	1.3e-77
WP_001023379.1|1015820_1016090_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
WP_000491545.1|1016230_1017106_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	7.2e-162
WP_001121225.1|1017330_1017981_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000812724.1|1018935_1019592_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_001296140.1|1019592_1019784_-	YebW family protein	NA	NA	NA	NA	NA
WP_001295499.1|1019888_1020125_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000057024.1|1020242_1021682_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001299674.1|1021761_1024395_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001207284.1|1024363_1025647_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001043882.1|1025776_1026274_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_000431370.1|1026370_1027069_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001427396.1|1027088_1029137_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000984517.1|1029328_1030210_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001127210.1|1030255_1031629_-	MFS transporter	NA	NA	NA	NA	NA
WP_001262174.1|1031805_1032597_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001211011.1|1032739_1032979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714550.1|1033137_1033281_+	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001006866.1|1033355_1033643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295496.1|1034311_1034455_+	YobF family protein	NA	NA	NA	NA	NA
WP_001062678.1|1034467_1034677_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_000010107.1|1034842_1035652_+	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001296134.1|1035648_1036215_-	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000156255.1|1036643_1037102_-	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_000228655.1|1037156_1038008_-	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000406926.1|1038020_1038821_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000150551.1|1038883_1039855_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000394983.1|1040317_1041874_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
WP_001295494.1|1041877_1043476_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000624298.1|1043606_1044971_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000456725.1|1045154_1045733_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000854972.1|1045736_1047098_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000457334.1|1047171_1047351_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001307845.1|1047470_1047830_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|1048192_1048537_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128847.1|1048668_1050579_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001221003.1|1050636_1051332_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP027582	Escherichia coli strain 2013C-4538 chromosome, complete genome	5680428	1263191	1329293	5680428	protease,holin,integrase,terminase,lysis,transposase,tail,capsid,head,portal	Enterobacteria_phage(32.76%)	78	1277818:1277832	1286119:1286133
WP_001260840.1|1263191_1264013_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|1264112_1264196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|1264288_1264624_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|1265020_1266274_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019545.1|1266380_1267274_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|1267408_1268629_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|1268753_1269449_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|1269401_1270694_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|1270852_1271467_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|1271509_1272364_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|1272365_1272983_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001342196.1|1272993_1275417_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
1277818:1277832	attL	CCTGCAGCCAGCGCC	NA	NA	NA	NA
WP_001307224.1|1278101_1278407_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|1278514_1279225_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138576.1|1279227_1279788_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|1279822_1280164_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|1280298_1280625_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|1280830_1282045_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|1282056_1283076_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_072095801.1|1283133_1283244_+	transporter	NA	NA	NA	NA	NA
WP_001206148.1|1283263_1284559_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
WP_001368608.1|1284578_1284815_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048585.1|1284899_1287371_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.0	1.9e-58
1286119:1286133	attR	CCTGCAGCCAGCGCC	NA	NA	NA	NA
WP_001098307.1|1287464_1287656_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1287652_1287841_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133037.1|1288408_1288618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|1288618_1289257_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000379562.1|1289268_1289421_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	7.8e-08
WP_000362153.1|1289686_1290106_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391950.1|1290206_1290488_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000693888.1|1290471_1290897_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095674.1|1290919_1291888_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	52.7	1.8e-73
WP_000790459.1|1291894_1292635_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.1	6.2e-114
WP_000450862.1|1292664_1293435_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.6	3.7e-85
WP_001141099.1|1293450_1293843_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_024182342.1|1293839_1294136_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.9	2.3e-48
WP_001018050.1|1294132_1294414_+	DUF4752 family protein	NA	A0A222YWQ2	Escherichia_phage	80.9	1.8e-34
WP_001002668.1|1294653_1294965_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	82.5	9.0e-51
WP_000256992.1|1295092_1295311_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	91.7	5.2e-29
WP_032244186.1|1295312_1295849_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	55.2	1.7e-60
WP_000787530.1|1295848_1296244_+	hypothetical protein	NA	A0A193GYM6	Enterobacter_phage	62.0	8.6e-38
WP_000128514.1|1296478_1296691_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	9.6e-28
WP_001341388.1|1296858_1297137_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265151.1|1297138_1298188_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	3.2e-108
WP_001217425.1|1298200_1298560_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.7	4.6e-38
WP_001064874.1|1298556_1299225_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	8.7e-59
WP_032284474.1|1299928_1301779_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000411802.1|1302226_1302433_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075132.1|1302432_1302930_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092325.1|1302926_1303364_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_000881326.1|1303513_1304131_+	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_001307652.1|1304318_1304513_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453587.1|1304901_1305447_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027379.1|1305421_1307347_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198153.1|1307343_1307550_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_024026143.1|1307546_1309148_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	2.1e-308
WP_000123251.1|1309128_1310448_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_001365129.1|1310457_1310790_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000063258.1|1310845_1311871_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_000158897.1|1311912_1312308_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000752994.1|1312319_1312673_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000975096.1|1312684_1313263_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683137.1|1313259_1313655_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_032325228.1|1313662_1314415_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	95.6	1.3e-130
WP_000479045.1|1314428_1314851_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000533440.1|1314877_1315291_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081793.1|1315271_1317884_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	91.1	0.0e+00
WP_000847280.1|1317880_1318210_+|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_032284485.1|1318209_1318908_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.1	4.9e-129
WP_106875410.1|1318918_1319662_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	95.1	4.4e-144
WP_123058126.1|1319607_1320240_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	2.9e-104
WP_106875412.1|1320475_1323952_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	97.2	0.0e+00
WP_001230429.1|1324018_1324618_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.3e-111
WP_094282965.1|1324682_1325996_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	2.8e-77
WP_001023998.1|1325997_1326267_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	94.4	2.3e-42
WP_122988840.1|1326377_1326455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122993102.1|1326669_1327683_+	peptidase M85	NA	NA	NA	NA	NA
WP_097451673.1|1328136_1329293_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	7.5e-66
>prophage 8
NZ_CP027582	Escherichia coli strain 2013C-4538 chromosome, complete genome	5680428	1528796	1584896	5680428	holin,tRNA,integrase,terminase,tail,capsid,portal,head	Escherichia_phage(45.45%)	70	1526508:1526522	1584057:1584071
1526508:1526522	attL	CAGAAAAAAGCGCGC	NA	NA	NA	NA
WP_000837924.1|1528796_1529930_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001295593.1|1530070_1530505_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001143784.1|1531445_1532087_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|1532168_1532798_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131657.1|1532870_1533446_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	1.8e-89
WP_001023379.1|1533558_1533828_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
WP_106875415.1|1533829_1535143_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.3	2.8e-77
WP_001233130.1|1535207_1535807_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	97.5	1.8e-108
WP_106875416.1|1535874_1539351_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.6	0.0e+00
WP_123058126.1|1539596_1540229_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	2.9e-104
WP_024236318.1|1540174_1540918_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	1.9e-147
WP_106875417.1|1540923_1541622_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.0	2.6e-130
WP_000847304.1|1541621_1541951_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_000082320.1|1541947_1544527_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.3	0.0e+00
WP_000533431.1|1544507_1544921_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000479086.1|1544947_1545379_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_106875418.1|1545392_1546145_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	94.0	3.4e-128
WP_000683137.1|1546152_1546548_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_106875419.1|1546544_1547123_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.7e-79
WP_000752994.1|1547134_1547488_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000158897.1|1547499_1547895_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000063258.1|1547936_1548962_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001365129.1|1549017_1549350_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000123251.1|1549359_1550679_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_024026143.1|1550659_1552261_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	2.1e-308
WP_000198153.1|1552257_1552464_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027379.1|1552460_1554386_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_032284653.1|1554360_1554906_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.4	4.3e-80
WP_001300236.1|1555300_1555525_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_001303878.1|1555606_1555921_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1556448_1556634_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|1556855_1556969_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_000992045.1|1557189_1557723_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.6	8.1e-100
WP_071528021.1|1557834_1558095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193281.1|1558042_1558594_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	2.3e-36
WP_000411802.1|1558598_1558805_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000143050.1|1559252_1561103_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.0	0.0e+00
WP_000762928.1|1562273_1563095_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001217413.1|1563091_1563466_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.4e-34
WP_001341382.1|1564530_1564809_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_000018421.1|1564976_1565189_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_001278454.1|1565378_1565483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207986.1|1565598_1566468_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_000224233.1|1566478_1566742_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_042350895.1|1566743_1566908_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000935420.1|1566993_1567206_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_000403777.1|1567256_1567613_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_001209480.1|1567590_1568052_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_001266134.1|1568048_1568345_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	3.4e-47
WP_001151124.1|1568341_1568764_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.8	2.0e-64
WP_000450674.1|1568779_1569541_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_000788968.1|1569563_1570310_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	2.4e-110
WP_000899746.1|1570316_1571174_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000693802.1|1571186_1571609_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	6.9e-70
WP_001072343.1|1571605_1571860_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233320.1|1571939_1572359_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001427316.1|1572657_1572810_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	2.3e-07
WP_000560223.1|1573230_1573452_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|1573451_1573622_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|1573696_1573972_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_000105150.1|1574073_1576674_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	3.0e-248
WP_000166313.1|1576666_1577476_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_001443846.1|1577531_1577681_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_001302840.1|1577718_1577907_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|1578006_1578222_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040851.1|1578223_1579459_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.3	3.0e-238
WP_001157401.1|1579510_1580446_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.1e-144
WP_000123745.1|1580574_1581948_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|1582425_1583409_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|1583663_1584896_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
1584057:1584071	attR	GCGCGCTTTTTTCTG	NA	NA	NA	NA
>prophage 9
NZ_CP027582	Escherichia coli strain 2013C-4538 chromosome, complete genome	5680428	1661438	1737525	5680428	protease,holin,integrase,terminase,transposase,tail,capsid,head	Stx2-converting_phage(38.46%)	82	1675217:1675244	1737662:1737689
WP_000422045.1|1661438_1662488_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559281.1|1662707_1663466_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_001278906.1|1663462_1664053_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|1664092_1664965_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001342101.1|1665065_1665686_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|1665682_1666564_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|1666701_1666746_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194584.1|1666837_1668400_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|1668399_1669995_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001342102.1|1669998_1671357_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.3	1.5e-36
WP_000209520.1|1671368_1672562_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443067.1|1672561_1673368_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|1673748_1673928_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|1674013_1674514_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079509.1|1674559_1675066_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
1675217:1675244	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_000147167.1|1675567_1675786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144877.1|1678548_1679139_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|1679322_1679970_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|1680106_1680253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|1680680_1680959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000938103.1|1682126_1682696_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|1682761_1683673_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|1683779_1683902_-	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001023357.1|1687847_1688117_-|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	100.0	3.8e-45
WP_001339397.1|1688177_1688855_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|1688854_1689202_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|1689221_1690793_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000216552.1|1690825_1692139_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.4	6.9e-76
WP_001228278.1|1692290_1692890_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	95.5	5.9e-107
WP_000902073.1|1692957_1694007_-	DUF1983 domain-containing protein	NA	Q9EYE7	Enterobacteria_phage	100.0	4.5e-195
WP_000099160.1|1694029_1695568_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|1695616_1695964_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839170.1|1695960_1696365_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	2.5e-69
WP_158707426.1|1699235_1699868_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	90.4	4.3e-92
WP_000194723.1|1699813_1700557_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_001335877.1|1700567_1701266_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_000807940.1|1701265_1701607_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_097453978.1|1701599_1704842_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	89.7	0.0e+00
WP_001513217.1|1704889_1705099_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000710952.1|1705194_1705569_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_058157545.1|1705583_1706300_-|tail	phage tail protein	tail	B6DZA6	Enterobacteria_phage	95.8	3.0e-121
WP_000133388.1|1706365_1706710_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|1706706_1707153_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|1707149_1707500_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|1707510_1707837_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|1710201_1710423_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_106875421.1|1710467_1712405_-|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	98.6	0.0e+00
WP_106875422.1|1712468_1714130_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	98.7	0.0e+00
WP_000958380.1|1714126_1714690_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000829192.1|1714978_1715344_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_001428130.1|1715385_1715571_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	92.3	1.3e-20
WP_000347013.1|1715700_1715841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|1716197_1716422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|1716486_1716693_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|1716920_1717067_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|1717066_1717636_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992092.1|1717906_1718440_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.9	2.5e-101
WP_000731221.1|1718490_1718835_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000284522.1|1718839_1719055_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000023141.1|1719204_1721058_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	96.6	0.0e+00
WP_032284729.1|1722582_1723272_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	5.3e-59
WP_000140002.1|1723268_1723634_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001265290.1|1723634_1724690_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	4.9e-88
WP_010917803.1|1724691_1724970_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|1725039_1725297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961821.1|1725517_1725730_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001449026.1|1726008_1726767_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|1727465_1727630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157825328.1|1728393_1728936_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|1728847_1729888_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705622.1|1729859_1730411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|1730394_1730622_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|1730698_1731106_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|1731370_1731670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|1731742_1731961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032277386.1|1732369_1732603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001342117.1|1732596_1732764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449172.1|1733163_1733352_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199480.1|1733348_1733537_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048478.1|1733632_1736104_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|1736168_1736417_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|1736394_1737525_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
1737662:1737689	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 10
NZ_CP027582	Escherichia coli strain 2013C-4538 chromosome, complete genome	5680428	1841609	1857817	5680428	protease,tRNA,terminase,capsid,portal,head	uncultured_Caudovirales_phage(90.0%)	20	NA	NA
WP_001297484.1|1841609_1842716_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|1842751_1843393_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|1843396_1844767_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265481.1|1844934_1845606_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|1845605_1847066_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133415.1|1847681_1847963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127884.1|1847976_1849638_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.2	2.2e-276
WP_000113646.1|1849621_1849978_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	80.5	3.6e-51
WP_001145906.1|1850266_1850707_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	73.3	1.9e-62
WP_000134114.1|1850706_1851003_-	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	2.4e-32
WP_001020669.1|1850999_1851338_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	53.6	1.7e-31
WP_001398592.1|1851334_1852510_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	80.2	4.8e-185
WP_000504047.1|1852547_1853120_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.6e-61
WP_001137338.1|1853159_1854317_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.6	8.1e-137
WP_001132080.1|1854608_1854833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233311.1|1854958_1855231_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126670.1|1855243_1855654_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001368652.1|1855663_1855852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080642.1|1855965_1856217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000833614.1|1856419_1857817_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.0	4.3e-116
>prophage 11
NZ_CP027582	Escherichia coli strain 2013C-4538 chromosome, complete genome	5680428	1861249	1936393	5680428	holin,protease,integrase,terminase,lysis,tail,capsid,head	Enterobacteria_phage(24.29%)	93	1865486:1865500	1936941:1936955
WP_000085269.1|1861249_1862479_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.6	1.1e-131
WP_000456506.1|1862727_1863849_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359438.1|1863994_1865224_-	peptidase T	NA	NA	NA	NA	NA
WP_000531601.1|1865473_1866610_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
1865486:1865500	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799399.1|1866593_1867457_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_001132165.1|1867730_1868321_-	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_001144080.1|1868503_1869154_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001299273.1|1869228_1870287_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_012816780.1|1870414_1871050_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_001118085.1|1871117_1871699_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_001131642.1|1871989_1872565_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001023435.1|1872678_1872948_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	97.8	2.4e-44
WP_044723507.1|1872949_1874263_-|tail	tail fiber protein	tail	H6WZM9	Escherichia_phage	98.2	2.8e-77
WP_001216290.1|1874328_1874952_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_106875424.1|1875020_1878497_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.8	0.0e+00
WP_158707427.1|1878742_1879375_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	91.4	6.7e-93
WP_000194723.1|1879320_1880064_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_001335877.1|1880074_1880773_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_000807940.1|1880772_1881114_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_000212980.1|1881106_1884349_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	92.0	0.0e+00
WP_001513217.1|1884396_1884606_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000710952.1|1884701_1885076_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_058157545.1|1885090_1885807_-|tail	phage tail protein	tail	B6DZA6	Enterobacteria_phage	95.8	3.0e-121
WP_000133388.1|1885873_1886218_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|1886214_1886661_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|1886657_1887008_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|1887017_1887344_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063025.1|1889795_1890017_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_106875421.1|1890061_1891999_-|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	98.6	0.0e+00
WP_106875426.1|1892062_1893724_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	98.9	0.0e+00
WP_000958380.1|1893720_1894284_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001427183.1|1894576_1894942_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	97.5	9.9e-65
WP_000095736.1|1894983_1895211_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000736096.1|1895579_1895804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001427182.1|1895800_1896295_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	97.4	1.4e-74
WP_032140280.1|1896296_1896383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003120.1|1896937_1897471_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.9	3.6e-100
WP_000138558.1|1897630_1897903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411814.1|1898158_1898365_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_000874393.1|1898812_1900663_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.8	0.0e+00
WP_000261909.1|1901430_1902144_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303877.1|1902238_1902478_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000265267.1|1902764_1903583_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|1903734_1904106_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|1904095_1904467_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265140.1|1904479_1905529_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	3.4e-110
WP_001341388.1|1905530_1905809_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001013636.1|1905976_1906189_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_000955173.1|1906233_1906371_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|1906736_1907510_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_106875427.1|1907861_1908275_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.3	3.7e-60
WP_000450992.1|1908290_1909061_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788750.1|1909082_1909829_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_001205823.1|1909835_1910927_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|1911005_1911461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|1911666_1912092_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|1912075_1912348_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|1912456_1912858_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|1912885_1913077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|1913076_1913364_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|1913640_1913796_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|1913937_1914327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|1914513_1914699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|1915272_1915461_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|1915457_1915649_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_032278809.1|1915742_1918214_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|1918281_1918524_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|1918501_1919521_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_001427258.1|1920337_1920769_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	96.5	6.2e-66
WP_000762928.1|1921334_1922156_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001217410.1|1922152_1922527_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_106875428.1|1922539_1923589_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	2.2e-109
WP_000191872.1|1923590_1923863_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|1923984_1924329_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_001013638.1|1924448_1924661_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	3.1e-26
WP_000104474.1|1924894_1925452_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683607.1|1925453_1925672_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	73.6	6.2e-22
WP_001365112.1|1925774_1926110_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.4	2.0e-48
WP_000699809.1|1926102_1926330_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|1926326_1926608_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_032284689.1|1926640_1927402_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.9	1.9e-73
WP_000788758.1|1927423_1928170_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.4	9.0e-113
WP_001262372.1|1928176_1929247_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	66.2	4.5e-65
WP_000693928.1|1929318_1929744_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|1929727_1930051_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|1930175_1930652_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000379610.1|1930970_1931123_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.7e-07
WP_001358566.1|1931612_1931801_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001365098.1|1931797_1931989_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048279.1|1932082_1934554_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_000003742.1|1934615_1934885_+	excisionase	NA	NA	NA	NA	NA
WP_000074973.1|1934853_1935972_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	2.0e-84
WP_001427255.1|1936048_1936393_-	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	34.7	1.9e-09
1936941:1936955	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 12
NZ_CP027582	Escherichia coli strain 2013C-4538 chromosome, complete genome	5680428	2105736	2283055	5680428	holin,protease,integrase,terminase,transposase,tail,capsid,head	Escherichia_phage(31.13%)	210	2229166:2229225	2282130:2282194
WP_000998025.1|2105736_2107269_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	7.1e-298
WP_000233452.1|2108025_2110386_-	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_000282084.1|2110540_2111104_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000335695.1|2111924_2113358_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000579535.1|2113576_2113774_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001303889.1|2114000_2114297_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_096949893.1|2115408_2117226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000279872.1|2117412_2118615_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
WP_001297190.1|2119240_2119696_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001307105.1|2120507_2121431_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	9.2e-91
WP_001199164.1|2121914_2123186_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_000154411.1|2123191_2124319_-	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_000497942.1|2124376_2125207_-	FTR1 family protein	NA	NA	NA	NA	NA
WP_001018496.1|2125872_2127381_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000979516.1|2127539_2127749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001341463.1|2127803_2131766_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000191700.1|2131805_2132444_-	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_001297176.1|2132731_2133823_+	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_001307708.1|2133822_2134515_+	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_021534122.1|2134526_2134913_+	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_001341462.1|2134920_2135721_+	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001001171.1|2135730_2136321_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001028095.1|2136331_2136826_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001240628.1|2136846_2138175_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	1.0e-231
WP_001273658.1|2138257_2138431_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001151437.1|2138803_2139400_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001143120.1|2139420_2139648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044313.1|2139685_2140927_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_000097601.1|2141218_2142478_-	YccE family protein	NA	NA	NA	NA	NA
WP_000420629.1|2142737_2143658_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
WP_000024561.1|2143657_2143963_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209869.1|2144055_2144655_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001062101.1|2144651_2147198_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	1.0e-70
WP_001230242.1|2147197_2148370_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120112.1|2148499_2149192_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264955.1|2149164_2150193_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001121564.1|2150664_2151318_+	EspJ family T3SS effector ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_001002867.1|2151330_2152029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001131653.1|2152229_2152811_-	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	64.2	5.1e-63
WP_106420821.1|2152801_2152996_-	hypothetical protein	NA	A0A2R2Z347	Escherichia_phage	84.6	4.1e-09
WP_000767050.1|2152940_2153483_-	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
WP_001023995.1|2153704_2153974_-|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	7.1e-44
WP_000279023.1|2153975_2155190_-	short-chain dehydrogenase	NA	B6DZB7	Enterobacteria_phage	95.8	6.6e-81
WP_001230429.1|2155254_2155854_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.3e-111
WP_106875429.1|2155920_2159397_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	97.2	0.0e+00
WP_096844540.1|2159632_2160265_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	3.5e-102
WP_106875431.1|2160210_2160954_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	4.1e-150
WP_001357740.1|2160964_2161663_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000807964.1|2161662_2162004_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_106875432.1|2161996_2165239_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	94.8	0.0e+00
WP_122993730.1|2165289_2165499_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	92.8	2.6e-30
WP_000710952.1|2165594_2165969_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275441.1|2165983_2166700_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000133393.1|2166766_2167111_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|2167107_2167554_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2167550_2167901_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2167910_2168237_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063096.1|2170601_2170823_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_106875433.1|2170867_2172805_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.1	0.0e+00
WP_001399867.1|2172868_2174530_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_000958380.1|2174526_2175090_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000829192.1|2175378_2175744_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_032277401.1|2175785_2175986_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	95.5	2.8e-29
WP_000828068.1|2176117_2176444_-	TonB family protein	NA	H6WZK5	Escherichia_phage	99.1	1.5e-56
WP_001109019.1|2176789_2177341_-	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	100.0	4.5e-101
WP_071529499.1|2177579_2177765_-	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	96.7	1.3e-17
WP_001280922.1|2177987_2178119_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	90.7	8.5e-11
WP_000661712.1|2178213_2178909_-	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_000087733.1|2179182_2179716_-	lysozyme	NA	G9L6J6	Escherichia_phage	100.0	1.0e-102
WP_001072901.1|2179720_2179936_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290230.1|2180013_2180259_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143463.1|2180299_2180479_-	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
WP_000142995.1|2180614_2182552_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	99.7	0.0e+00
WP_000752026.1|2183051_2183321_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|2183330_2184278_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_001204852.1|2184784_2185219_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	100.0	3.6e-82
WP_000144759.1|2185211_2185406_-	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_001107963.1|2185402_2186008_-	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
WP_001004024.1|2186007_2186730_-	DNA-binding protein	NA	A0A0N7C231	Escherichia_phage	100.0	7.8e-130
WP_000211422.1|2186804_2187539_-	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	100.0	1.9e-123
WP_001254256.1|2187813_2187996_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153280.1|2187992_2188520_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000814576.1|2188516_2188963_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_001281772.1|2188919_2189156_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|2189166_2189382_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001000127.1|2189514_2189793_-	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000145907.1|2189863_2190154_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	99.0	1.6e-46
WP_000788839.1|2190150_2190852_-	Replication protein P	NA	Q6H9X6	Enterobacteria_phage	100.0	4.5e-130
WP_000185456.1|2190848_2191787_-	replication protein	NA	C1JJ53	Enterobacteria_phage	100.0	2.8e-172
WP_000438542.1|2191819_2192116_-	hypothetical protein	NA	Q6H9X8	Enterobacteria_phage	100.0	5.2e-48
WP_001180318.1|2192254_2192482_-	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250473.1|2192560_2193268_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_001133195.1|2193437_2194340_+	hypothetical protein	NA	A4KWU2	Enterobacteria_phage	86.5	2.2e-150
WP_000198444.1|2194851_2195235_+	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000248817.1|2195445_2195760_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.0	2.3e-54
WP_000065373.1|2195910_2196279_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	7.6e-65
WP_001198858.1|2196351_2196492_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	3.3e-21
WP_000361826.1|2196484_2196628_+	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	97.9	3.5e-18
WP_000995407.1|2196703_2197000_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	5.2e-48
WP_000100847.1|2197005_2197791_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186781.1|2197787_2198468_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	99.1	6.0e-132
WP_000682304.1|2198464_2198647_+	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	100.0	7.4e-29
WP_000548528.1|2198619_2198811_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_001386642.1|2198821_2199103_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763378.1|2199201_2199423_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	97.3	8.4e-35
WP_001289864.1|2199419_2199827_+	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	97.8	2.8e-68
WP_000582235.1|2199828_2200584_+	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	92.4	7.1e-142
WP_000208003.1|2200594_2201377_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	67.8	1.1e-47
WP_000376716.1|2201376_2201655_+	DUF4752 family protein	NA	K7P6P7	Enterobacteria_phage	98.9	5.4e-47
WP_001368678.1|2201812_2202112_+	hypothetical protein	NA	Q9G076	Enterobacteria_phage	100.0	2.4e-53
WP_000545713.1|2202147_2202315_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	1.2e-25
WP_001281197.1|2202343_2202688_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	99.1	2.0e-59
WP_001303849.1|2202805_2203024_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533665.1|2203001_2204075_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9G075	Enterobacteria_phage	98.9	2.0e-198
WP_001444338.1|2204169_2206914_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_000818472.1|2206985_2208059_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|2208106_2208280_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001316982.1|2208269_2208500_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|2208474_2208663_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|2208673_2208886_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_000087763.1|2209171_2209384_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_001295358.1|2209825_2210131_+	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_001247610.1|2210237_2210882_+	lipoprotein GfcB	NA	NA	NA	NA	NA
WP_001038062.1|2210878_2211625_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000742348.1|2211624_2213721_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001295357.1|2213766_2214906_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000057871.1|2214893_2215340_+	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_032276985.1|2215359_2217540_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_001300464.1|2217654_2218953_-	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000399648.1|2219216_2220197_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000270305.1|2220311_2220404_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_000460810.1|2220416_2221553_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_071527988.1|2221564_2223061_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000004899.1|2223243_2224101_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000063972.1|2224097_2224496_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000003671.1|2224492_2225080_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186421.1|2225076_2225784_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107384.1|2225802_2227596_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|2227592_2228711_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
2229166:2229225	attL	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCA	NA	NA	NA	NA
WP_095585410.1|2229306_2229459_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.4	4.3e-14
WP_000938124.1|2229835_2231197_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	40.2	1.5e-49
WP_001023483.1|2231651_2231921_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	1.2e-43
WP_000381395.1|2231958_2233530_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|2233549_2233897_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|2233896_2234574_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_106875435.1|2234623_2235943_-|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	98.4	7.5e-78
WP_001230428.1|2236007_2236607_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_096844540.1|2240392_2241025_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	3.5e-102
WP_001405642.1|2240970_2241714_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	5.6e-147
WP_001335877.1|2241724_2242423_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_000807940.1|2242422_2242764_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_097453978.1|2242756_2245999_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	89.7	0.0e+00
WP_001513217.1|2246046_2246256_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000710952.1|2246351_2246726_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_058157545.1|2246740_2247457_-|tail	phage tail protein	tail	B6DZA6	Enterobacteria_phage	95.8	3.0e-121
WP_000133388.1|2247522_2247867_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2247863_2248310_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2248306_2248657_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|2248667_2248994_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|2251358_2251580_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_106875421.1|2251624_2253562_-|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	98.6	0.0e+00
WP_106875426.1|2253625_2255287_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	98.9	0.0e+00
WP_000958380.1|2255283_2255847_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001375434.1|2256139_2256505_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	5.3e-66
WP_001448509.1|2256546_2256771_+	YlcI/YnfO family protein	NA	A0A0P0ZE23	Stx2-converting_phage	76.1	2.9e-19
WP_001302717.1|2256852_2257167_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2257692_2257878_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000455402.1|2258105_2258255_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	98.0	9.1e-17
WP_001056883.1|2258254_2258824_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	99.5	1.5e-104
WP_106875436.1|2259098_2259632_-	lysozyme	NA	G9L6J6	Escherichia_phage	98.9	3.9e-102
WP_001072901.1|2259636_2259852_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290230.1|2259929_2260175_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143463.1|2260215_2260395_-	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
WP_106875437.1|2260530_2262468_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.9	0.0e+00
WP_000466957.1|2262945_2263377_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000301785.1|2263826_2264540_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917770.1|2264674_2264872_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640048.1|2265113_2265644_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904103.1|2265652_2266012_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	1.8e-34
WP_001265113.1|2266024_2267071_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.5	1.4e-108
WP_001342259.1|2267072_2267345_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	5.2e-10
WP_001260977.1|2267480_2267738_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_000220601.1|2267743_2268043_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	100.0	1.8e-51
WP_000206830.1|2268247_2268592_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	1.7e-58
WP_001229296.1|2268588_2268954_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	100.0	5.1e-69
WP_000209152.1|2268955_2269174_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	100.0	6.6e-32
WP_001289353.1|2269261_2269897_-	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	100.0	1.3e-115
WP_001224662.1|2270062_2270245_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000935422.1|2270278_2270491_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	100.0	6.6e-37
WP_000403783.1|2270541_2270898_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
WP_001209480.1|2270875_2271337_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_001266133.1|2271333_2271630_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	5.8e-47
WP_001040234.1|2271626_2272019_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	62.6	1.0e-38
WP_000450641.1|2272034_2272760_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.4	1.2e-77
WP_072096947.1|2272793_2273336_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.5	1.8e-78
WP_000729535.1|2273247_2274258_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	88.8	4.9e-170
WP_000693932.1|2274344_2274782_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	55.0	1.6e-29
WP_001172789.1|2274778_2275039_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	64.8	4.8e-21
WP_000578360.1|2275165_2275558_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	39.6	1.7e-14
WP_001022415.1|2275604_2275964_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	93.3	3.6e-59
WP_000692026.1|2275966_2276269_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	43.3	3.7e-17
WP_024182289.1|2276682_2276883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171921.1|2276975_2277194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331716.1|2277197_2277362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2277762_2277951_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2277947_2278136_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048499.1|2278230_2280681_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
WP_000273151.1|2280748_2280991_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|2280968_2281988_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375138.1|2282395_2283055_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
2282130:2282194	attR	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCAAATAA	NA	NA	NA	NA
>prophage 13
NZ_CP027582	Escherichia coli strain 2013C-4538 chromosome, complete genome	5680428	2539572	2623930	5680428	holin,protease,integrase,terminase,lysis,transposase,tail,portal,head	Enterobacteria_phage(45.21%)	104	2540698:2540732	2625364:2625398
WP_000399648.1|2539572_2540553_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
2540698:2540732	attL	GTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCA	NA	NA	NA	NA
WP_001145128.1|2540812_2541295_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
WP_001218655.1|2541414_2543565_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.8	4.8e-42
WP_000386551.1|2543592_2544555_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443534.1|2544695_2545781_+	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000007094.1|2546011_2547376_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001296991.1|2547604_2548276_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_001296990.1|2548278_2549274_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996091.1|2549266_2551003_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	1.3e-18
WP_000070131.1|2550995_2552129_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000469031.1|2552139_2553246_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000871982.1|2553207_2553618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001113363.1|2553750_2554512_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000650337.1|2554508_2555750_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_000045454.1|2555749_2556706_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_000446932.1|2556741_2557455_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000373624.1|2557659_2558364_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000852287.1|2558500_2558953_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000598619.1|2558954_2559200_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000080885.1|2559192_2559678_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000084632.1|2559680_2560193_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_001295301.1|2560214_2561204_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_001295302.1|2561600_2562509_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
WP_000042533.1|2562700_2564722_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_000044868.1|2565300_2565978_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000246805.1|2565970_2566726_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000118840.1|2566712_2567867_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000951213.1|2567863_2568904_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_001443724.1|2568990_2570280_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
WP_000767389.1|2570338_2570815_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_001121571.1|2571318_2571972_+	type III secretion system effector ADP-ribosyltransferase EspJ	NA	NA	NA	NA	NA
WP_000354291.1|2571984_2572206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002868.1|2572289_2572670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001448642.1|2572870_2573446_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	77.5	1.6e-77
WP_001339397.1|2573506_2574184_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|2574183_2574531_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_106875440.1|2574550_2576122_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	2.2e-169
WP_021351651.1|2576596_2576968_+	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_000652081.1|2577091_2577919_-	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.2	3.1e-154
WP_000950982.1|2578142_2579024_-	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_001023459.1|2579129_2579399_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_032284503.1|2579400_2580615_-|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	94.8	4.0e-78
WP_001233130.1|2580679_2581279_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	97.5	1.8e-108
WP_106875441.1|2581346_2584823_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_158707429.1|2585061_2585694_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	5.8e-105
WP_024236318.1|2585639_2586383_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	1.9e-147
WP_001375577.1|2586388_2587087_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	4.7e-132
WP_000847304.1|2587086_2587416_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_000082320.1|2587412_2589992_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.3	0.0e+00
WP_000533431.1|2589972_2590386_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000479086.1|2590412_2590844_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_001143013.1|2590857_2591610_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_032284507.1|2591617_2591986_-	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	88.0	2.4e-50
WP_000099160.1|2591982_2593521_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|2593569_2593917_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|2593913_2594318_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001254029.1|2594395_2594572_-	hypothetical protein	NA	E4WL22	Enterobacteria_phage	56.4	1.1e-08
WP_106875443.1|2594561_2596154_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	1.6e-183
WP_000259002.1|2596150_2596357_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_009442816.1|2596340_2598269_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	2.7e-262
WP_000235451.1|2598240_2598750_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	33.3	1.2e-12
WP_001307652.1|2599145_2599340_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000881326.1|2599527_2600145_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_000092325.1|2600294_2600732_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_000075132.1|2600728_2601226_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000411802.1|2601225_2601432_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000499454.1|2604042_2604201_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|2604286_2605030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|2605214_2605904_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|2605918_2606041_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|2606379_2607339_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_000994516.1|2607550_2607739_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008193.1|2607735_2608098_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	2.7e-62
WP_000002261.1|2608094_2608385_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	2.9e-51
WP_001003989.1|2608384_2609107_-	DNA-binding protein	NA	K7P6K2	Enterobacteria_phage	99.6	5.4e-131
WP_001341811.1|2609099_2609309_-	protein ninF	NA	G9L691	Escherichia_phage	97.1	2.6e-30
WP_000924601.1|2609268_2609670_-	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_001254255.1|2609672_2609849_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000814611.1|2609845_2610256_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	2.1e-71
WP_000344573.1|2610227_2610584_-	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	97.3	2.1e-59
WP_000145926.1|2610880_2611171_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_032278733.1|2611167_2611848_-	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.1	1.4e-125
WP_000438538.1|2612824_2613124_-	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	99.0	4.8e-49
WP_000064150.1|2613262_2613496_-	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	97.4	4.0e-35
WP_000428099.1|2613609_2614314_+	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	99.6	4.3e-133
WP_000193240.1|2614582_2614945_+	hypothetical protein	NA	A0A1P8DTD0	Proteus_phage	51.4	6.2e-19
WP_000088201.1|2615551_2615824_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	7.4e-41
WP_000073663.1|2615847_2616387_-	superinfection exclusion protein B	NA	A0A192Y7Z0	Salmonella_phage	44.9	8.1e-39
WP_001341800.1|2616750_2617611_+	hypothetical protein	NA	K7P7J7	Enterobacteria_phage	99.3	2.4e-37
WP_000638547.1|2617635_2617767_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243354.1|2617751_2617904_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	98.0	1.5e-19
WP_000031370.1|2618160_2618766_+	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	100.0	4.1e-108
WP_000951334.1|2618765_2619149_+	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	2.5e-66
WP_001111278.1|2619172_2619466_+	DUF2856 family protein	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
WP_001214436.1|2619476_2619641_+	DUF2737 family protein	NA	K7P7R0	Enterobacteria_phage	98.1	4.2e-23
WP_000812206.1|2619637_2620195_+	hypothetical protein	NA	E7C9P6	Salmonella_phage	64.3	3.2e-62
WP_000034231.1|2620191_2620749_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	83.6	4.6e-45
WP_000104414.1|2620750_2621368_+	hypothetical protein	NA	Q716F4	Shigella_phage	64.2	5.6e-36
WP_012817743.1|2621364_2621667_+	restriction alleviation protein, Lar family	NA	Q716F5	Shigella_phage	97.0	9.4e-53
WP_032278566.1|2621659_2621944_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	98.9	3.5e-49
WP_000545733.1|2622016_2622184_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_001281774.1|2622212_2622557_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	4.5e-59
WP_001303849.1|2622663_2622882_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533654.1|2622859_2623930_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	5.6e-201
2625364:2625398	attR	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
>prophage 14
NZ_CP027582	Escherichia coli strain 2013C-4538 chromosome, complete genome	5680428	2852468	2902172	5680428	protease,integrase,terminase,lysis,transposase,tail,capsid,head,portal	Enterobacteria_phage(58.93%)	65	2852000:2852046	2902186:2902232
2852000:2852046	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201825.1|2852468_2853422_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226384.1|2853608_2855093_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000937502.1|2855276_2855582_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_000239881.1|2855638_2856307_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000279150.1|2856945_2859906_-	membrane protein	NA	A0A2D1UII2	Escherichia_phage	98.3	3.0e-58
WP_001230523.1|2859970_2860570_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.8e-108
WP_000515439.1|2860640_2864054_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.2	0.0e+00
WP_000090884.1|2864114_2864747_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_001152557.1|2865432_2866131_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	3.4e-130
WP_000847347.1|2866130_2866460_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_000840236.1|2866456_2869018_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.1	0.0e+00
WP_000459457.1|2869010_2869445_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479169.1|2869426_2869849_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_001342267.1|2869864_2870605_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000683110.1|2870612_2871008_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.9e-70
WP_000985132.1|2871004_2871583_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752961.1|2871573_2871948_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	8.0e-62
WP_000158868.1|2871959_2872355_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000063244.1|2872396_2873422_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
WP_001345004.1|2873477_2873810_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000088640.1|2873819_2874698_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.0	1.7e-147
WP_001339397.1|2874738_2875416_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|2875415_2875763_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|2875782_2877354_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001444138.1|2877826_2879428_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	8.5e-310
WP_000198149.1|2879424_2879631_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_052922144.1|2879627_2881553_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000453558.1|2881527_2882073_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001427981.1|2882461_2882656_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_106875444.1|2882773_2883986_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_157825797.1|2883952_2884120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000738423.1|2884327_2884621_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|2884711_2884894_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135274.1|2885110_2885608_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
WP_000839596.1|2885607_2885823_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737278.1|2886411_2887494_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	80.6	7.8e-166
WP_001204791.1|2887682_2888066_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971074.1|2888151_2888292_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001099712.1|2888288_2888651_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774477.1|2888647_2888938_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	96.9	6.0e-49
WP_000224914.1|2888930_2889101_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053023.1|2889100_2889556_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.1e-60
WP_072097617.1|2889552_2889654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000520500.1|2889777_2890179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038620.1|2890157_2890574_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_001415151.1|2890873_2891482_-	hypothetical protein	NA	Q9T1Q5	Acyrthosiphon_pisum_secondary_endosymbiont_phage	67.3	1.5e-33
WP_000152742.1|2892234_2892582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000788789.1|2892786_2893488_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	3.8e-129
WP_001342088.1|2893484_2894414_-	replication protein	NA	M1FN81	Enterobacteria_phage	67.0	4.4e-109
WP_001182773.1|2894500_2895040_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_001067458.1|2895109_2895340_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|2895444_2896134_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000066829.1|2896215_2896479_+	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	95.4	4.2e-41
WP_001444023.1|2896614_2896935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206913.1|2897401_2897692_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	82.4	2.5e-26
WP_000995439.1|2897767_2898064_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_001427106.1|2898069_2898855_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.8e-148
WP_000611716.1|2898851_2899532_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000149544.1|2899528_2899711_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000548537.1|2899683_2899875_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001443983.1|2899885_2900167_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000763390.1|2900265_2900484_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
WP_000488407.1|2900531_2900810_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000446905.1|2900781_2901153_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000051902.1|2901008_2902172_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
2902186:2902232	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 15
NZ_CP027582	Escherichia coli strain 2013C-4538 chromosome, complete genome	5680428	3642057	3683292	5680428	transposase,integrase	Stx2-converting_phage(57.14%)	40	3669461:3669475	3683462:3683476
WP_000099160.1|3642057_3643596_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|3643644_3643992_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|3643988_3644393_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_077221339.1|3644842_3645121_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001344112.1|3645754_3645931_+	hemolysin activation protein	NA	NA	NA	NA	NA
WP_001339397.1|3645998_3646676_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|3646675_3647023_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|3647042_3648614_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000221529.1|3649353_3649923_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000271003.1|3650088_3650490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221615.1|3650477_3650912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133395011.1|3651332_3651647_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	99.0	4.5e-50
WP_000612591.1|3651643_3651991_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998019.1|3652040_3653426_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000823243.1|3653664_3655023_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000555341.1|3655755_3656013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283626.1|3657762_3658284_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068905.1|3658280_3659234_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188267.1|3659320_3661645_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879164.1|3661689_3662592_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125190.1|3662588_3663587_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684856.1|3663583_3664540_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|3664540_3665308_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177060.1|3665865_3666123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000227281.1|3667476_3668049_+	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000594911.1|3668097_3668922_-	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
3669461:3669475	attL	CGAAGGCCGGACTCG	NA	NA	NA	NA
WP_000016235.1|3669827_3672161_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.8	0.0e+00
WP_000842358.1|3672175_3672499_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001014979.1|3672495_3672720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761643.1|3672719_3673268_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.8	5.9e-29
WP_001084853.1|3673264_3673525_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	67.5	4.6e-24
WP_000214377.1|3674429_3675182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991130.1|3675178_3675733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001185332.1|3675734_3676007_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	46.9	8.3e-08
WP_000381395.1|3676316_3677888_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|3677907_3678255_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|3678254_3678932_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000091133.1|3679221_3680808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032276966.1|3680946_3681786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000772685.1|3682029_3683292_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.3	2.8e-74
3683462:3683476	attR	CGAAGGCCGGACTCG	NA	NA	NA	NA
>prophage 16
NZ_CP027582	Escherichia coli strain 2013C-4538 chromosome, complete genome	5680428	3704566	3765138	5680428	protease,transposase	Stx2-converting_phage(25.0%)	58	NA	NA
WP_000399685.1|3704566_3705547_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000471889.1|3705774_3708471_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|3708611_3708665_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181312.1|3708849_3709797_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001297258.1|3709915_3711337_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001341327.1|3711386_3713042_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_000187778.1|3713435_3715574_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001106238.1|3715732_3716197_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
WP_000839179.1|3716632_3717037_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|3717033_3717381_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099160.1|3717429_3718968_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_001162171.1|3719272_3720625_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166267.1|3720718_3721270_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|3721425_3722799_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853753.1|3722974_3723973_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000596015.1|3724005_3725001_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001296689.1|3724987_3726010_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205813.1|3726023_3727526_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_000265933.1|3727665_3728622_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|3728931_3729462_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|3729541_3729892_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223208.1|3729885_3730137_-	type II toxin-antitoxin system ChpS family antitoxin	NA	NA	NA	NA	NA
WP_001219160.1|3730348_3730690_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060926.1|3730692_3734472_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|3734468_3736202_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001295196.1|3736407_3737046_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935042.1|3737368_3738712_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|3738773_3738980_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175289.1|3739304_3739862_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000886909.1|3739851_3740592_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589460.1|3740781_3742725_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|3742853_3743234_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560553.1|3743322_3744183_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001296686.1|3744290_3745256_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331456.1|3745363_3746026_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_106875453.1|3746272_3747340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001062220.1|3747438_3747873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000228344.1|3748139_3749543_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|3749851_3750472_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119478.1|3750690_3751329_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000440544.1|3751463_3752672_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	6.4e-209
WP_072097616.1|3752679_3753294_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.1	1.8e-42
WP_001427815.1|3753733_3754528_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|3754598_3755048_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|3755089_3755317_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|3755321_3755636_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|3755642_3756038_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|3756364_3756640_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|3756768_3757455_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_000949511.1|3757454_3758309_-	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_000056760.1|3758318_3758969_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776505.1|3758982_3759447_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218360.1|3759456_3759762_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001295191.1|3761529_3762594_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|3762701_3763457_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569731.1|3763453_3764203_-	esterase	NA	NA	NA	NA	NA
WP_000254642.1|3764384_3764714_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|3764862_3765138_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
>prophage 17
NZ_CP027582	Escherichia coli strain 2013C-4538 chromosome, complete genome	5680428	3776850	3824770	5680428	protease,transposase,tRNA,integrase	Vibrio_phage(20.0%)	45	3790362:3790376	3822423:3822437
WP_001232412.1|3776850_3777855_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|3777857_3779117_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460361.1|3779202_3780483_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|3780559_3780868_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280349.1|3780953_3781904_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122520.1|3781896_3783744_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_000990262.1|3783753_3785088_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|3785106_3785568_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_001307537.1|3785539_3787087_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001294203.1|3787085_3788225_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_100699686.1|3788207_3788261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|3789124_3789670_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|3789764_3790817_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
3790362:3790376	attL	CCGCTGGAAGAGGCG	NA	NA	NA	NA
WP_000934920.1|3790913_3791882_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236850.1|3791903_3795227_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001276180.1|3795255_3795570_-	YjeO family protein	NA	NA	NA	NA	NA
WP_000342867.1|3795566_3795881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001346081.1|3795932_3797435_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004771.1|3797653_3798631_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001192991.1|3798955_3800764_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_063625657.1|3800756_3801491_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000208757.1|3801501_3801897_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_001299198.1|3801907_3802267_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001299193.1|3802329_3803463_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001238378.1|3803551_3804085_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_000118482.1|3804081_3804399_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000239596.1|3804580_3804727_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977757.1|3804837_3804963_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|3805014_3805581_-	elongation factor P	NA	NA	NA	NA	NA
WP_000940530.1|3805622_3806651_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_001008073.1|3807040_3807910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000399648.1|3808158_3809139_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000558209.1|3809391_3809745_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|3809882_3811529_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|3811572_3811866_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000015837.1|3812141_3813398_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267448.1|3813413_3813890_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_001427817.1|3814226_3815663_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961959.1|3815780_3817082_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000883338.1|3817197_3817536_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_106875454.1|3817511_3819209_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001188520.1|3819245_3819821_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001218841.1|3820200_3821466_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_000704132.1|3821582_3823154_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.6	5.8e-295
3822423:3822437	attR	CGCCTCTTCCAGCGG	NA	NA	NA	NA
WP_001375513.1|3823150_3824770_-|transposase	ISL3-like element ISEc38 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP027582	Escherichia coli strain 2013C-4538 chromosome, complete genome	5680428	4239378	4252710	5680428	transposase,integrase	Enterobacteria_phage(66.67%)	15	4239196:4239218	4253195:4253217
4239196:4239218	attL	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
WP_001218979.1|4239378_4240548_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	88.1	1.7e-198
WP_000119815.1|4240567_4242427_+	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	22.4	1.8e-13
WP_000186475.1|4242423_4242849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000446132.1|4243176_4243749_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000638629.1|4243822_4244323_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283024.1|4244319_4245054_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.0	5.7e-128
WP_001149160.1|4245605_4245872_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980227.1|4245868_4246468_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	81.8	6.0e-51
WP_001244665.1|4246460_4246748_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459320.1|4246740_4247196_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	6.1e-64
WP_000381395.1|4247270_4248842_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|4248861_4249209_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|4249208_4249886_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000856729.1|4250041_4250362_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783645.1|4250376_4252710_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
4253195:4253217	attR	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
>prophage 19
NZ_CP027582	Escherichia coli strain 2013C-4538 chromosome, complete genome	5680428	4503981	4605318	5680428	holin,protease,tRNA,integrase,terminase,lysis,transposase,capsid,tail,portal,head,plate	Escherichia_phage(54.17%)	107	4508542:4508601	4604159:4604238
WP_000560983.1|4503981_4504419_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|4504463_4505405_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001162704.1|4505468_4506377_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000897305.1|4506605_4506917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356397.1|4506917_4507208_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001295676.1|4507812_4508031_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001086390.1|4508249_4508492_+	hypothetical protein	NA	NA	NA	NA	NA
4508542:4508601	attL	TGCCGGATGCGGCGTGAACGCCTTATCCGGCCTACAAAGTCATGCAAATTCAATATATTG	NA	NA	NA	NA
WP_000027708.1|4508822_4509752_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829008.1|4509748_4510384_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331377.1|4510380_4511283_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_011310337.1|4511295_4514346_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000753589.1|4514539_4515373_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_001298963.1|4515525_4516566_+	YiiG family protein	NA	NA	NA	NA	NA
WP_000931345.1|4516615_4518364_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_001019489.1|4518363_4519434_-	aminopeptidase	NA	NA	NA	NA	NA
WP_000446023.1|4519423_4520875_-	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000729592.1|4520885_4521332_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000619503.1|4521644_4521959_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_000009269.1|4521955_4523104_-	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_001179751.1|4523175_4524000_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_032277158.1|4524082_4525342_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144123.1|4525338_4526808_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_001341797.1|4527095_4527572_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001341961.1|4527546_4527933_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001369519.1|4527916_4528855_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063496.1|4528851_4529886_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001297064.1|4530170_4530791_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001387204.1|4531088_4532033_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270270.1|4532181_4532856_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|4532997_4534371_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|4534367_4535066_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|4535215_4535716_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_000985246.1|4535902_4536883_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_000777029.1|4536952_4537246_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_001308179.1|4537382_4537655_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000217670.1|4537824_4538325_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|4538388_4538613_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277952.1|4538612_4538915_+	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	2.5e-45
WP_001113270.1|4538914_4539139_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_000027659.1|4539135_4539411_+	DUF5405 family protein	NA	A0A0F7LCM4	Escherichia_phage	100.0	2.3e-45
WP_032277160.1|4539400_4541677_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.9	0.0e+00
WP_106875458.1|4541877_4542822_+	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	76.0	2.1e-143
WP_000142509.1|4542829_4543819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000559725.1|4543808_4544930_-	ParB N-terminal domain-containing protein	NA	Q858T2	Yersinia_virus	62.2	1.2e-97
WP_000038159.1|4545344_4546379_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.4	2.1e-200
WP_032277161.1|4546378_4548151_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_016237183.1|4548324_4549179_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MK3	Enterobacteria_phage	99.6	5.6e-135
WP_016242816.1|4549237_4550311_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.2	4.3e-201
WP_032277162.1|4550314_4551058_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	96.8	1.8e-121
WP_000988633.1|4551157_4551667_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_032277163.1|4551666_4551870_+|tail	tail protein X	tail	M1RZ22	Escherichia_phage	97.0	9.8e-30
WP_000123124.1|4551873_4552155_+|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001144101.1|4552154_4552652_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_032277164.1|4552666_4553092_+	hypothetical protein	NA	Q858W1	Yersinia_virus	88.7	4.2e-59
WP_021548485.1|4553079_4553505_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	95.0	1.2e-64
WP_001440152.1|4553476_4553650_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000917189.1|4553612_4554080_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	98.1	2.5e-81
WP_028985812.1|4554072_4554525_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	1.4e-76
WP_032277166.1|4554591_4555227_+|plate	phage baseplate assembly protein V	plate	A0A0F7LBP2	Escherichia_phage	98.1	4.2e-111
WP_032277167.1|4555223_4555571_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	99.1	8.5e-58
WP_001121474.1|4555575_4556484_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
WP_001285337.1|4556476_4557088_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	4.9e-117
WP_032277171.1|4558419_4559022_+|tail	tail fiber assembly protein	tail	K7P870	Enterobacteria_phage	84.8	2.7e-91
WP_000376436.1|4558993_4559413_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	55.8	1.7e-36
WP_077628649.1|4559416_4559818_-|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	38.4	4.5e-10
WP_000905108.1|4559845_4560439_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	96.4	8.7e-103
WP_001286716.1|4560498_4561689_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_001251408.1|4561701_4562220_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031312.1|4562276_4562552_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|4562584_4562704_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_032277172.1|4562696_4565144_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	93.1	0.0e+00
WP_000978890.1|4565158_4565638_+|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.1e-84
WP_032277174.1|4565637_4566801_+	phage late control D family protein	NA	M1SV93	Escherichia_phage	99.2	1.4e-205
WP_000468308.1|4566882_4567101_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001076742.1|4567337_4568240_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_000591795.1|4568420_4569383_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001045673.1|4569701_4570691_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000708994.1|4570797_4571553_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|4571607_4572375_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802226.1|4572482_4573082_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155257.1|4573182_4573623_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|4573834_4574134_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323556.1|4574160_4574589_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796320.1|4574593_4575340_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|4575436_4576447_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|4576581_4578090_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|4578112_4578958_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|4579382_4579628_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|4579712_4580198_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|4580290_4581217_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293341.1|4581283_4582615_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|4582624_4583155_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_000068834.1|4583247_4584207_-	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000644904.1|4584298_4585324_-	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_001341957.1|4585479_4587678_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_000710769.1|4587880_4588093_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_106875459.1|4588252_4592425_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.0	1.0e-24
WP_000644414.1|4592426_4592663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000797347.1|4593655_4594264_-	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000852812.1|4594447_4594765_-	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_001341952.1|4595041_4596202_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000110785.1|4596204_4598637_+	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_000007523.1|4598985_4599876_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_001297636.1|4600204_4602385_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_001341951.1|4602478_4603384_+	cystine transporter YijE	NA	NA	NA	NA	NA
WP_000647882.1|4603410_4604028_-	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_000399648.1|4604337_4605318_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
4604159:4604238	attR	TGCCGGATGCGGCGTGAACGCCTTATCCGGCCTACAAAGTCATGCAAATTCAATATATTGAAGTTTATTGGTAGATACTG	NA	NA	NA	NA
>prophage 20
NZ_CP027582	Escherichia coli strain 2013C-4538 chromosome, complete genome	5680428	5332782	5340731	5680428	transposase,integrase	Stx2-converting_phage(42.86%)	7	5333674:5333690	5342759:5342775
WP_001272558.1|5332782_5333538_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
5333674:5333690	attL	TCCCTTCGCCCGCTCCA	NA	NA	NA	NA
WP_000935135.1|5333824_5335432_+|integrase	site-specific integrase	integrase	A0A059XK29	uncultured_phage	28.0	4.3e-11
WP_000852869.1|5335424_5336084_+	DUF4145 domain-containing protein	NA	M1PSB6	Streptococcus_phage	33.9	3.6e-33
WP_000082600.1|5336992_5337721_+	Rha family transcriptional regulator	NA	B5AX29	Iodobacteriophage	41.2	7.1e-14
WP_001339397.1|5338115_5338793_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|5338792_5339140_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|5339159_5340731_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
5342759:5342775	attR	TCCCTTCGCCCGCTCCA	NA	NA	NA	NA
>prophage 21
NZ_CP027582	Escherichia coli strain 2013C-4538 chromosome, complete genome	5680428	5492420	5499560	5680428		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|5492420_5493059_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|5493055_5494318_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|5494314_5495223_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|5495418_5496186_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_032276729.1|5496236_5496893_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	3.6e-49
WP_001272924.1|5496998_5499560_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 22
NZ_CP027582	Escherichia coli strain 2013C-4538 chromosome, complete genome	5680428	5572175	5677182	5680428	holin,tRNA,integrase,terminase,capsid,tail,head	Stx2-converting_phage(38.24%)	105	5575897:5575911	5587939:5587953
WP_000577251.1|5572175_5573894_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	100.0	6.5e-308
WP_000214985.1|5573895_5575644_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	100.0	0.0e+00
WP_000448925.1|5575715_5576132_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
5575897:5575911	attL	ATATCGCCTTGATCA	NA	NA	NA	NA
WP_001427612.1|5576170_5577391_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	99.3	3.5e-231
WP_001431537.1|5577689_5578598_-	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	100.0	2.3e-171
WP_000516611.1|5579080_5580256_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	91.2	4.6e-204
WP_000557643.1|5580428_5580575_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	90.9	1.7e-20
WP_000457722.1|5580578_5580821_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	82.5	1.8e-30
WP_000206753.1|5580905_5581769_-	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	53.6	3.2e-69
WP_000034210.1|5581770_5582100_-	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	37.5	1.1e-25
WP_000476199.1|5582096_5582336_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	96.2	3.7e-36
WP_000158004.1|5582328_5582532_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	95.5	5.2e-31
WP_000335005.1|5582528_5583407_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	94.9	1.9e-170
WP_000008174.1|5583397_5583934_-	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	99.4	2.8e-100
WP_032277355.1|5584062_5584887_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	98.5	8.6e-149
WP_000135680.1|5584952_5585315_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000859462.1|5585981_5586656_-	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_000649477.1|5586746_5586947_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000521508.1|5586990_5587542_+	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
WP_001087337.1|5587538_5588375_+	hypothetical protein	NA	Q8SBF3	Shigella_phage	98.6	8.7e-149
5587939:5587953	attR	TGATCAAGGCGATAT	NA	NA	NA	NA
WP_001444024.1|5588379_5588604_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	94.6	2.5e-34
WP_000061512.1|5588600_5589419_+	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	95.6	3.0e-117
WP_001447905.1|5589415_5589910_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	1.2e-86
WP_001427609.1|5589909_5590563_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	2.1e-126
WP_000210162.1|5590559_5590886_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	99.1	1.2e-53
WP_000767105.1|5590882_5591272_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	2.1e-68
WP_001061413.1|5591291_5592089_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	7.5e-150
WP_001427606.1|5592096_5593086_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.6e-194
WP_001205460.1|5593103_5593445_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001131907.1|5593457_5594006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000868396.1|5593992_5594919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032284580.1|5596038_5597976_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.9	0.0e+00
WP_000143462.1|5598111_5598291_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_001290231.1|5598331_5598604_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284522.1|5598680_5598896_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000731219.1|5598900_5599245_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	96.5	1.0e-55
WP_000992122.1|5599295_5599829_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_047091958.1|5600347_5600533_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.3	1.3e-17
WP_000736096.1|5600618_5600843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095736.1|5601211_5601439_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_001365481.1|5601480_5601846_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	98.3	5.8e-65
WP_000958416.1|5602135_5602699_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_072617034.1|5602695_5604357_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.8	0.0e+00
WP_032284581.1|5604420_5606358_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.8	0.0e+00
WP_001063106.1|5606402_5606624_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	98.6	2.2e-35
WP_000125984.1|5609150_5609477_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|5609487_5609838_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|5609834_5610281_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133393.1|5610277_5610622_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275441.1|5610688_5611405_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000710952.1|5611419_5611794_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_122993730.1|5611889_5612099_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	92.8	2.6e-30
WP_106875432.1|5612149_5615392_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	94.8	0.0e+00
WP_000807964.1|5615384_5615726_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001357740.1|5615725_5616424_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_106875431.1|5616434_5617178_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	4.1e-150
WP_096844540.1|5617123_5617756_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	3.5e-102
WP_106875462.1|5617991_5621465_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.6	0.0e+00
WP_001427270.1|5621532_5622132_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	1.7e-109
WP_000268987.1|5622196_5623510_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	4.8e-77
WP_001023420.1|5623511_5623781_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_115801847.1|5623887_5623977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|5623996_5626345_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001370486.1|5626936_5630338_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.3	1.3e-219
WP_000938111.1|5630714_5632076_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.6	4.3e-52
WP_000162574.1|5633829_5634312_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600190.1|5634443_5634920_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|5634909_5635200_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|5635261_5635603_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|5635751_5637413_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|5637498_5638377_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|5638499_5639093_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|5639147_5640434_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|5640454_5641246_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460032.1|5641412_5642774_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|5643022_5643271_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|5643289_5643838_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|5643868_5644636_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|5644677_5645025_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589828.1|5645101_5645584_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969036.1|5645599_5646826_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|5646815_5647334_-	YfiR family protein	NA	NA	NA	NA	NA
WP_000976004.1|5647483_5647849_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168054.1|5648058_5649129_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000225221.1|5649139_5650261_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200116.1|5650303_5651464_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|5651562_5651610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|5651713_5652055_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|5652325_5653063_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079094.1|5653197_5654178_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040115.1|5654174_5654906_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|5655035_5657609_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000841103.1|5663462_5664761_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001300818.1|5664757_5665081_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|5665126_5666482_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000083007.1|5666595_5669256_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001341635.1|5669287_5669986_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|5670054_5670474_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|5670680_5671718_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262716.1|5671765_5672455_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000627807.1|5672759_5673143_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189207.1|5673198_5673786_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001341633.1|5673888_5674770_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|5674978_5676313_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001298974.1|5676444_5677182_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP027583	Escherichia coli strain 2013C-4538 plasmid unnamed	88339	6784	86216	88339	integrase,transposase,protease	Stx2-converting_phage(52.17%)	57	11893:11952	69490:72194
WP_001034100.1|6784_10687_-|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_158707430.1|11624_12044_-	DUF1449 family protein	NA	NA	NA	NA	NA
11893:11952	attL	GTAAGCGCCCCATCTGCGACGTCTTGTGAAAATTGTCCTGTCTGGCAACAATCGCGCCCA	NA	NA	NA	NA
WP_001341423.1|11974_12649_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|12645_12993_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_012917687.1|12996_14565_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
WP_106875464.1|14843_16031_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000091308.1|16030_16396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612591.1|16632_16980_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_012917688.1|17029_18568_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.8	1.9e-295
WP_012680945.1|18871_19870_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000550559.1|19943_21665_-	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000975743.1|21758_22865_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001302199.1|22864_23686_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000839950.1|26333_26849_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
WP_000217745.1|26850_29847_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000987096.1|29896_32017_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	1.6e-45
WP_001213545.1|32020_33460_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_000864810.1|33872_34226_-	colicin M immunity protein	NA	NA	NA	NA	NA
WP_032277352.1|34398_35181_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	96.4	5.8e-54
WP_000465041.1|35182_35596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261287.1|36155_36386_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044768.1|36382_36799_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001165114.1|36960_37506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000704534.1|38263_39124_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.3e-09
WP_001066949.1|39251_39638_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001341423.1|39691_40366_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|40362_40710_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_012917687.1|40713_42282_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
WP_000154135.1|42941_43607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000335839.1|43747_44389_-	transcription termination factor NusG	NA	NA	NA	NA	NA
WP_000907857.1|45090_46122_+	replication initiation protein	NA	NA	NA	NA	NA
WP_042842256.1|47081_56582_-	toxin B	NA	NA	NA	NA	NA
WP_001443774.1|56696_56927_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000422675.1|60053_60530_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	90.7	3.0e-45
WP_000937603.1|64500_65688_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000091308.1|65687_66053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012917687.1|66876_68445_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
WP_000631725.1|68448_68796_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|68792_69467_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001341442.1|69520_69748_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	6.2e-33
WP_000361610.1|69910_70888_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_085953785.1|71693_72906_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	2.5e-168
69490:72194	attR	TGGGCGCGATTGTTGCCAGACAGGACAATTTTCACAAGACGTCGCAGATGGGGCGCTTACTTCCCTCGCGCCATTGTTGTCGCCATTTGAACAACAGATTGGCGTTAATGCCATTTTCAAGAGCAAGTTTTGAGATGGATATCCCGGGTTCACAGGAGGCAGCAACGAGCTGCTGTTTAAATTCGGGAGGATAATTAGGGCAGCCTTTTCGCCTGCCGGGAGTCACATTTTTCTGCATATCTGACACTTTGGTTCCCACTACTTATTTGGTGGACACCACTTTGTCTAATTCGTCAGATTCTGACCAGACGGTTCAGGCTGTACGCTTACATATAAACTGCAGTGAGCAGACCACTCACTGCACCTGATAATATAAGCTGTAGTCAGTAAAGGAGCACTCTTCACTGACTACAGTTTATGTTCAGCGGGATTTGAAGAGTTTTTCCAGGTCATCCAGCGTGATGCCCAGTTTTTCAAGCAGGGCAAGTTTCTCCGCCATCTCCGGACTGACTTTTTCCGCAGGTGAAGGTGGCAACGGATTTTCCTTACTCTCATCATTCGGCGCTTTTAACCGGGGACGCCGGTAGTGAATACAGAAGAATTTTGTCCGCCCCCGCTGGATCTCCGTGTAATCAAGATATCCAATCTCGCGCAACTGCTCCATTGCCCGTCTGACCGTCTGGTTCTGGGAAAATACAGGAGACTTCAGATTGAGGCGGGCACGCAGCCGCGCCAGCGATATCGGTGCCGGATCCCGGGGCAGGCTCTCTATAAAGGTGTAAAGTGCCTGGGCGGACTCCCGTCGCTTCAGGGCATTGATGGCCTTGAGCTGCAGCAGCACTTTCCGGTCAAACTGGTACAGTTCAAAAAGGCGGGGATCAGCCTGTAACTGAACAATATCCCGTTCAGTATCGTAGTAGGCTGACTGTACCAGATGGGTGATATATTCCCGGGTGTGCTTCTCATCGGTGCGGGAAAAGGAGATCACGGTACCGGCAATGCGTTTCAGGGAAGGGCTGATGCGCTCACGCAGCCTGCGGGATGACTGGCTTGAAGGTATACCACACAGTTTTGCAAACTCGACAAAAGGCAGTTCAACTTTGTCACCAATTACGTTATGGCGGGCAAAGGAATGAATGATTCCCACCCAGGTCTTGAAATCGTTATCCATATCCAGGCGGGGGCCGGTGATCTCAACCTTATCAAATCCCTCAGCACGGGCCAGGGAAAGACGTGTCAGCTCTTCCGTGGCATCAGTACGTGACAGTGTATTTTTTTTACTGTTCTTCAGTGATTTAAGGGTCGGTACAAAAACGCCCAGACGCATCAGCGCCACAGGTTGTACGGTGTTGTTATTGTTTGGTGTCAGTGTCACCAGCTCACCGGACGACTTATCCACCTCGCCGAACAGTTTTTTGATGTCTGAATTTTCGTTTTCCAGAAAGCCTCCTGCCTGTGGACAGTAAAAGAATAAACAGAAAATTGAGTGTCAGAACCCCGTCAACTGACTGAAGAAAAACCTGCAGTCTGTATTTAACAGCTGAGCCTGGCGTACTGACCATAATTTATGTCATTAACTTACTACAGTATATACATTACTGAATACAGCTTATCATGATCCTGCTACAGTTTATCAGAAACATGCCACAGCTTATGTGATCGTGGTCCCGGAGCATGAGTGACAAGGTTTGCAGCGATATGGGGATCTTTAATGGATCATTTCTTGATCATTTATGGATCTGTTTACTGGATCGGGCCGCCGGATATGTGGATAAATCATTCCGGGAAAACAGTTTACACAACTGTTTTATGAGGAAGCTTCAGGGCGTATCTGCTCACTGTAACTACAGATACATTGCGCTTCCTCGCCGGTTCGCGGGCTTCGCCCGGTCACCGGTCTGCGGCGAGCACCGACAACATACAGACAGAAGTCGCCTGATATACCGATAATGTATATATACCCCTCCTATACTGCGTACTCTCTGAGGATGTGCAATGTGATTTATGCAGTGGCGTTCGTCAGGAATGTGTAGTGGATCATAAAATCAGGACACCGGAATAACCTGTTTCCATTTTTCTTCATGCGGCAAGGCGATAAACCACCATTGTTTGTATGAGGTCGATAAACGTTGTAATAAGCATTTATCCACTGAACCGCCCCGGGAATCCTGGAGACCAAACTCCCTGAGAAAGAGGTAAACAGGATGACTAAAAATACACGTTTTTCCCCCGAGGTCCGTCAACGGGCAGTTCGTATGGTTCTGGAAAGTCAGGGCGAATATGACTCACAATGGGCGGCAATTTGTTCCATTGCCCCAAAGATTGGCTGTACACCAGAGACTCTGCGTGTGTGGGTTCGTCAGCATGAGCGGGATACCGGGAGTGGTGATGGTGGACTCACCACCGCTGAACGTCAGCGTCTGAAAGAGCTGGAACGTGAAAATCGTGAACTGCGCCGCAGTAACGATATCCTTCGCCAGGCTTCCGCTTATTTTGCGAAGGCGGAGTTCGACCGCCTCTGGAAAAAATAATGCCGCTGCTGGATAAGCTGCGTGAGCAGTACGGGGTCGGACCGGTATGCAGTGAACTGCATATTGCCCCGTCAACGTATTACCACTGTCAGCAACAGCGACATCATCCTGATAAACGCAGTGCCCGTGCTCAGCGCGATGACTGGCTGAAGAGAGAGATACAGCGCGTATACG	NA	NA	NA	NA
WP_000592771.1|73077_75288_+	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_001172748.1|75331_75721_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_000445934.1|76681_77077_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_000921957.1|77076_78036_-	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	40.9	5.4e-62
WP_077249722.1|78308_79211_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000086167.1|79594_80278_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.3e-28
WP_001443814.1|80277_80496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274418.1|80507_80942_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001341455.1|80986_81469_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276261.1|81465_82185_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_032313270.1|82461_82779_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	55.8	4.5e-05
WP_000117628.1|83239_83740_+	antirestriction protein ArdA	NA	NA	NA	NA	NA
WP_000218854.1|84467_84902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001247865.1|84994_85261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038351.1|85325_86216_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.8	4.4e-66
