The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027313	Escherichia coli strain 2014C-3550 chromosome, complete genome	5549395	723228	731177	5549395	integrase,transposase	Stx2-converting_phage(42.86%)	9	724120:724136	733205:733221
WP_001272558.1|723228_723984_+	lipoprotein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
724120:724136	attL	TCCCTTCGCCCGCTCCA	NA	NA	NA	NA
WP_000935135.1|724270_725878_+|integrase	integrase	integrase	A0A059XK29	uncultured_phage	28.0	4.3e-11
WP_000852869.1|725870_726530_+	DUF4145 domain-containing protein	NA	M1PSB6	Streptococcus_phage	33.9	3.6e-33
WP_000082600.1|727438_728167_+	Rha family transcriptional regulator	NA	B5AX29	Iodobacteriophage	41.2	7.1e-14
WP_000566882.1|728168_728369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071533791.1|728474_728600_-	copper resistance protein	NA	NA	NA	NA	NA
WP_001339397.1|728561_729239_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|729238_729586_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|729605_731177_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
733205:733221	attR	TCCCTTCGCCCGCTCCA	NA	NA	NA	NA
>prophage 2
NZ_CP027313	Escherichia coli strain 2014C-3550 chromosome, complete genome	5549395	883230	890370	5549395		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|883230_883869_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|883865_885128_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|885124_886033_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|886228_886996_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_032276729.1|887046_887703_-	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	3.6e-49
WP_001272924.1|887808_890370_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 3
NZ_CP027313	Escherichia coli strain 2014C-3550 chromosome, complete genome	5549395	962985	1101399	5549395	capsid,lysis,tail,protease,holin,integrase,transposase,terminase,head	Stx2-converting_phage(30.2%)	179	1014330:1014389	1100376:1103074
WP_000577251.1|962985_964704_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	100.0	6.5e-308
WP_000214985.1|964705_966454_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	100.0	0.0e+00
WP_000448925.1|966525_966942_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_001427612.1|966980_968201_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	99.3	3.5e-231
WP_001431537.1|968499_969408_-	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	100.0	2.3e-171
WP_000516611.1|969890_971066_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	91.2	4.6e-204
WP_012817812.1|971020_971230_-	hypothetical protein	NA	I6PBM8	Cronobacter_phage	88.2	1.6e-30
WP_000557643.1|971238_971385_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	90.9	1.7e-20
WP_000457722.1|971388_971631_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	82.5	1.8e-30
WP_000206753.1|971715_972579_-	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	53.6	3.2e-69
WP_000034210.1|972580_972910_-	hypothetical protein	NA	A0A0H4ISY5	Shigella_phage	37.5	1.1e-25
WP_000476199.1|972906_973146_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	96.2	3.7e-36
WP_000158004.1|973138_973342_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	95.5	5.2e-31
WP_000335005.1|973338_974217_-	hypothetical protein	NA	A0A2R2Z314	Escherichia_phage	94.9	1.9e-170
WP_000008174.1|974207_974744_-	HD family hydrolase	NA	A5LH62	Enterobacteria_phage	99.4	2.8e-100
WP_032277355.1|974872_975697_-	DUF2303 domain-containing protein	NA	Q8SBF9	Shigella_phage	98.5	8.6e-149
WP_000135680.1|975762_976125_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_032162095.1|976197_976392_+	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	98.4	1.7e-31
WP_000859462.1|976791_977466_-	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_000649477.1|977556_977757_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000521508.1|977800_978352_+	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
WP_001087337.1|978348_979185_+	hypothetical protein	NA	Q8SBF3	Shigella_phage	98.6	8.7e-149
WP_001444024.1|979189_979414_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	94.6	2.5e-34
WP_000061512.1|979410_980229_+	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	95.6	3.0e-117
WP_001447905.1|980225_980720_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	1.2e-86
WP_001427609.1|980719_981373_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	2.1e-126
WP_000210162.1|981369_981696_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	99.1	1.2e-53
WP_000767105.1|981692_982082_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	2.1e-68
WP_001061413.1|982101_982899_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	7.5e-150
WP_001427606.1|982906_983896_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.6e-194
WP_001205460.1|983913_984255_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001131907.1|984267_984816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000868396.1|984802_985729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032202861.1|986671_986800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032284580.1|986848_988786_+	DUF1737 domain-containing protein	NA	Q6H9W1	Enterobacteria_phage	96.9	0.0e+00
WP_000143462.1|988921_989101_+	DUF1378 domain-containing protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_001290231.1|989141_989414_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284519.1|989490_989706_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731236.1|989710_990055_+	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992122.1|990105_990639_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_001082555.1|990937_991432_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	93.2	9.0e-77
WP_000736096.1|991428_991653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095736.1|992021_992249_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_001365481.1|992290_992656_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	98.3	5.8e-65
WP_000958416.1|992946_993510_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001457603.1|993506_995168_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	100.0	0.0e+00
WP_032284581.1|995231_997169_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.8	0.0e+00
WP_001063106.1|997213_997435_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	98.6	2.2e-35
WP_106918823.1|999961_1000285_+	DNA-packaging protein	NA	A0A0P0ZDE0	Stx2-converting_phage	99.1	5.0e-52
WP_001007905.1|1000295_1000646_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1000642_1001089_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133393.1|1001085_1001430_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275441.1|1001496_1002213_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000710952.1|1002227_1002602_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001234250.1|1002625_1002907_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	93.5	6.9e-42
WP_106918824.1|1002957_1006200_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	92.9	0.0e+00
WP_000807940.1|1006192_1006534_+|tail	tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_032284485.1|1006533_1007232_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.1	4.9e-129
WP_096852293.1|1007242_1007986_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	95.5	6.8e-145
WP_106918825.1|1007883_1008564_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.8	1.6e-113
WP_001230429.1|1012349_1012949_+	Ail/Lom family protein	NA	Q687E7	Enterobacteria_phage	99.0	2.3e-111
WP_106918826.1|1013013_1014333_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	98.2	2.2e-77
WP_106875434.1|1014277_1014421_-	copper resistance protein	NA	NA	NA	NA	NA
1014330:1014389	attL	GTAACCGGCTCATTTAAACCGTCTGGTCTGTTTCCTCCGGCTCTACAAAAATAATGTCCA	NA	NA	NA	NA
WP_106907876.1|1014382_1015060_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	45.2	1.2e-20
WP_000624622.1|1015059_1015407_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|1015426_1016998_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001023483.1|1017035_1017305_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	1.2e-43
WP_001443842.1|1017421_1017697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938124.1|1017759_1019121_-	type III secretion system protein	NA	Q9MBM1	Phage_Gifsy-1	40.2	1.5e-49
WP_095585410.1|1019497_1019650_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.4	4.3e-14
WP_001058323.1|1020245_1021364_+	hydrogenase-1 small chain	NA	NA	NA	NA	NA
WP_000107384.1|1021360_1023154_+	hydrogenase-1 large chain	NA	NA	NA	NA	NA
WP_001186421.1|1023172_1023880_+	Ni/Fe-hydrogenase, b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003671.1|1023876_1024464_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000063972.1|1024460_1024859_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000004899.1|1024855_1025713_+	hydrogenase-1 operon protein HyaF	NA	NA	NA	NA	NA
WP_000460810.1|1027403_1028540_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270305.1|1028552_1028645_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_000399648.1|1028759_1029740_-|transposase	IS110 family transposase IS621	transposase	NA	NA	NA	NA
WP_032251364.1|1029731_1029974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300464.1|1030003_1031302_+	periplasmic AppA protein	NA	NA	NA	NA	NA
WP_032276985.1|1031416_1033597_-	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_000057871.1|1033616_1034063_-	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
WP_001295357.1|1034050_1035190_-	O-antigen capsule outer membrane auxillary protein export channel	NA	NA	NA	NA	NA
WP_000742348.1|1035235_1037332_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001038062.1|1037331_1038078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001247610.1|1038074_1038719_-	lipoprotein GfcB	NA	NA	NA	NA	NA
WP_001295358.1|1038825_1039131_-	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_000087763.1|1039572_1039785_-	cold-shock protein CspH	NA	NA	NA	NA	NA
WP_000066490.1|1040070_1040283_+	cold-shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|1040293_1040482_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001316982.1|1040456_1040687_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001019197.1|1040676_1040850_+	protein GnsA	NA	NA	NA	NA	NA
WP_000818472.1|1040897_1041971_-	electron transporter YccM	NA	NA	NA	NA	NA
WP_106918827.1|1042042_1044787_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_000533665.1|1044881_1045955_-|integrase	integrase	integrase	Q9G075	Enterobacteria_phage	98.9	2.0e-198
WP_001303849.1|1045932_1046151_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_001281197.1|1046268_1046613_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	99.1	2.0e-59
WP_000545713.1|1046641_1046809_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	1.2e-25
WP_000425216.1|1046844_1047156_-	hypothetical protein	NA	Q9G076	Enterobacteria_phage	100.0	2.1e-55
WP_071527593.1|1047088_1047289_-	hypothetical protein	NA	K7PMC6	Enterobacterial_phage	87.3	9.0e-20
WP_000376716.1|1047301_1047580_-	DUF4752 domain-containing protein	NA	K7P6P7	Enterobacteria_phage	98.9	5.4e-47
WP_000208003.1|1047579_1048362_-	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	67.8	1.1e-47
WP_000582235.1|1048372_1049128_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	92.4	7.1e-142
WP_001289864.1|1049129_1049537_-	hypothetical protein	NA	A0A125RPT9	Escherichia_phage	97.8	2.8e-68
WP_000763378.1|1049533_1049755_-	conjugal transfer protein TraR	NA	A0A1I9LJM6	Stx_converting_phage	97.3	8.4e-35
WP_001386642.1|1049853_1050135_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000548528.1|1050145_1050337_-	DUF1382 domain-containing protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_000682304.1|1050309_1050492_-	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	100.0	7.4e-29
WP_000186781.1|1050488_1051169_-	exonuclease	NA	A0A0P0ZCQ7	Stx2-converting_phage	99.1	6.0e-132
WP_000100847.1|1051165_1051951_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995407.1|1051956_1052253_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	5.2e-48
WP_001496530.1|1052221_1052374_-	hypothetical protein	NA	Q08J51	Stx2-converting_phage	98.0	4.7e-21
WP_001130933.1|1052328_1052598_-	host cell division inhibitory peptide Kil	NA	M1FN78	Enterobacteria_phage	95.5	3.6e-40
WP_000065373.1|1052677_1053046_-	lambda prophage-derived protein ea10	NA	M1FPD2	Enterobacteria_phage	99.2	7.6e-65
WP_000248817.1|1053196_1053511_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.0	2.3e-54
WP_000551211.1|1053509_1053695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000198444.1|1053721_1054105_-	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_001133195.1|1054616_1055519_-	hypothetical protein	NA	A4KWU2	Enterobacteria_phage	86.5	2.2e-150
WP_000250473.1|1055688_1056396_-	phage repressor protein C	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_001180318.1|1056474_1056702_+	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000438542.1|1056840_1057137_+	hypothetical protein	NA	Q6H9X8	Enterobacteria_phage	100.0	5.2e-48
WP_000185456.1|1057169_1058108_+	Replication protein O	NA	C1JJ53	Enterobacteria_phage	100.0	2.8e-172
WP_000788839.1|1058104_1058806_+	Replication protein P	NA	Q6H9X6	Enterobacteria_phage	100.0	4.5e-130
WP_000145907.1|1058802_1059093_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	99.0	1.6e-46
WP_001000127.1|1059163_1059442_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000103679.1|1059574_1059790_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001281772.1|1059800_1060037_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000814576.1|1059993_1060440_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_000153280.1|1060436_1060964_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_001254256.1|1060960_1061143_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000211422.1|1061417_1062152_+	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	100.0	1.9e-123
WP_001004024.1|1062226_1062949_+	DNA-binding protein	NA	A0A0N7C231	Escherichia_phage	100.0	7.8e-130
WP_001107963.1|1062948_1063554_+	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
WP_000144759.1|1063550_1063745_+	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_001204852.1|1063737_1064172_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	100.0	3.6e-82
WP_015971135.1|1064160_1064406_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	100.0	5.0e-36
WP_000691354.1|1064678_1065626_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|1065635_1065905_+	Shiga toxin Stx1 subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_012817767.1|1066055_1066283_+	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	100.0	2.6e-39
WP_000142995.1|1066404_1068342_+	DUF1737 domain-containing protein	NA	Q6H9W1	Enterobacteria_phage	99.7	0.0e+00
WP_000143463.1|1068477_1068657_+	DUF1378 domain-containing protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
WP_001290230.1|1068697_1068943_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|1069020_1069236_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_000087733.1|1069240_1069774_+	lysozyme	NA	G9L6J6	Escherichia_phage	100.0	1.0e-102
WP_000661712.1|1070047_1070743_+	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_061326947.1|1070971_1071439_+|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	88.4	8.5e-69
WP_001109019.1|1071615_1072167_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	100.0	4.5e-101
WP_032163683.1|1072394_1072577_+	hypothetical protein	NA	H6WZK4	Escherichia_phage	100.0	4.5e-26
WP_000828068.1|1072512_1072839_+	membrane protein	NA	H6WZK5	Escherichia_phage	99.1	1.5e-56
WP_032277401.1|1072970_1073171_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	95.5	2.8e-29
WP_000829192.1|1073212_1073578_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000958380.1|1073866_1074430_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_033800465.1|1074426_1076088_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.3	0.0e+00
WP_106918828.1|1076151_1077930_+|capsid	phage major capsid protein	capsid	A0A0P0ZE40	Stx2-converting_phage	90.7	0.0e+00
WP_001063025.1|1077974_1078196_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|1080722_1081049_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|1081059_1081410_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1081406_1081853_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1081849_1082194_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_058157545.1|1082259_1082976_+|tail	phage tail protein	tail	B6DZA6	Enterobacteria_phage	95.8	3.0e-121
WP_000710952.1|1082990_1083365_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001234278.1|1083388_1083670_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.9	2.3e-45
WP_106918829.1|1083717_1086960_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.5	0.0e+00
WP_000807940.1|1086952_1087294_+|tail	tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_001335877.1|1087293_1087992_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_001405642.1|1088002_1088746_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	5.6e-147
WP_106918830.1|1088643_1089324_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	92.5	1.1e-106
WP_000839170.1|1092194_1092599_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	2.5e-69
WP_000612626.1|1092595_1092943_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099160.1|1092991_1094530_+|transposase	IS66 family transposase ISEc22	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000902073.1|1094552_1095602_+	DUF1983 domain-containing protein	NA	Q9EYE7	Enterobacteria_phage	100.0	4.5e-195
WP_001228278.1|1095669_1096269_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	95.5	5.9e-107
WP_000216552.1|1096420_1097734_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.4	6.9e-76
WP_000381395.1|1097766_1099338_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|1099357_1099705_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_106907876.1|1099704_1100382_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	45.2	1.2e-20
WP_001023357.1|1100442_1100712_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	100.0	3.8e-45
WP_001443976.1|1100856_1101399_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	67.2	1.1e-62
1100376:1103074	attR	TGGACATTATTTTTGTAGAGCCGGAGGAAACAGACCAGACGGTTTAAATGAGCCGGTTACGAATGACATGAACATATTAAAAAAAATTATGCAGCGTCTGTGCGGTTGCGGAAAGCATGATGACCGTGAAGACGGGGAGTTACTTACAGCACAGCTGCGACTGGGACCGGCAGACATTCTGGAGTCAGATGAGAATGGCATTATCCCGGAGCAGGACAGGGTAATCACGCAGGTGGTGATACTGGATGCGGATAAAAAGCAGATACAGTGTGTGGTAAGACCGCTGCAAATCCTGCGTGCTGACGGGACGTGGGAAAATATTGGCGGGATGAAGTAACCCGACAGCTTCACAAAACCGGAGTCCGGCTCCGGTTTTTGTTGTCATGTAAGGCAGATGTTTGTTAAAGCTATTTAAGTCTGGAGTTTAAATTAAAATAGGGAGTTTTATAATGCCGTTAAATTCGGAGATTAGATCAAGCTCATGTTTAATGGATTGAATGTCCTTCGAGCTCAAGTAGCATCTAGCGGTCGAGGGGAGTTTACATTAGGTAATGAGACTGTCAGCATTGTATTTAATGAAACCGATGGGCGTTTTCTATCCAGCGGCAGTAGTGGGGGATTGCTTACTGAGTTATTCCTTTATGGGTTTAATAACGGCCCTGAAGCTCTTCGCGATAGGATGCTCAGTATGCTTTCGGACTCAGGTGAAGCACAATCGCAAGAGAGTATTCAGGACAAAATATCTCAATGTAAGTTTCCTGTTAGTTCAGGAAATTTCCAGTGCCCGCCAGAGTCTATTCAGTGTCCAATTACACTAGAGAGACCCGAAGAAGGAGTGTTTGTCAAAAATTCAGATAGTTCGGCAGTATGCTGCTTATTTGATTTTGATGCATTTTCTCGTTTAGCTAGTGAAGGCTCATATCATCCACTGACCCGAGAACCAATAACGGCATCAATGATTATAAGTCCTGATAAATGTGTTTATGATCCTATCAAGGGAAACTTCATTATAAAAGATAGTTAAAATATTTTTCTCTGAGAGAGTATTGGCTGTCAGTAATTTGTAAAAAAACGCCGCAGACATCCAGAATATAAGAAGGTGTCTGTGGTTGGCAGGTTTCAGATGACTTGAAGGCGTCTTTATGTAAATGCATTTTTCTGTGGAGATGTTGTCGGAAAATATTGGATTAAAAACATAATCCAAGTCAAATAGTAAGTTTGTTTTTTTTGAGATTAGGTGTGTATTTAGAATTTTTATGATGTGTTTATTTTGTGGGGTATTTTAGAAAAAAATATATTAATCCTTATTAATAATAGCTGCCATCCATTTCAGCTATTATTTTAAAATAAACAAGTTAAAGCTTAGACTCTTGTTTCTTGGATTATATCAAAGATATCAACATGATTTGATGGATTATGATGTGGTAAGCCATTGCTTTCGATATCGATTACCACATCCTCTGGATTTGGATGCCGCTGTCCAACAGGGATACCTTCTTCCATTGCGCGTATATCAGCACCTGTGGCATGTTCAATATCTGCTTTATTGGGGAAAATAGCTCCTTCTCTTGCGTGCCACCATATACGAGGATAGTCAGTGAATCTAGCTACTTCAAACTCGGCCTTGTTTAAATCGGCAGCCCCCAGTGTCGCACCAGCCCACCATAAAATAGTGTCTGGCTTTAATCCAGGGGTATTATACTGTATGGCATGCCCTGCTGCTTGCCCAACCATTGCACCGATATGAGGACTTAACATTGGATCTGTACTAGCAAATCTGGATACTGCAAATCCCCCTAAAGCACCAAGCGCATTTGCGGCAGCATTGGTAAGAACGGCATATTTAGTATTAGGGTTATCTAAATCCCACTTGAAATGTGCGCCAAACTCCAGCCCTAGAGTTGCCTGTAATGGAGATGCACCATATTTAAAATCTGCTTCTCCCGGTCTGATAACCCACTCCTCCGTGTAATTTGCTTTCGGCCCATCAGGAGTAAGTGGTGTTTCTCCAACAAGCTTCCATCCATTTTCAGTTTTGACTATAGGAAGTTCTACACCATGATTACGAACCACTTGAGCTGTTAATCCAAACCATGGTATTGGGCCTTTTGGCTCGGTGGTTACCGTCGAAGTAGTGGCTGATGTTCCAGTCGATGCAATAGTCGACACTGCAGTGGTTGATATATTACTGTTGCTTAATGCATTTTTTAACGGGCCAGGAAGGTCTTTAAAATTAAAACCTATTTCATCATGCAGAGGGAATATCTGTAAAAAATAATTACCTGATGTAGGATGAATATCTGGTTTTACAATGTTTAGCTGGACACCATATTTACCAGAGATGCCTGAAACGGAACTAGGTATCTCTAATGCCATTTGGGTAACATTGAATAAACCAAACATATCCAATGTTTTTTTCCTATGGATCCTTCTTCAAGGTGAGGAGCTATATATTCGTCTAGCCCTGAGAGCAGACCTTTATCTTTTATCAAGCTCAGTAGAGCTGTTGTTTCACCGCATTCCGGTGCATGTTGCTGTATATCATCTGGAATATTAACAACAAATCCAGCTTGGCATCCTAGAGGTAATTCGGATTGCGGTATTTGTGTAGAGGGTATTTGTTCTGTTTGATGATGTTGATTGTTTTGTGAGGTGATTCCAGATTGTATGGTCGGTTGAATGTTCATAATAAATCCTTA	NA	NA	NA	NA
>prophage 4
NZ_CP027313	Escherichia coli strain 2014C-3550 chromosome, complete genome	5549395	1203663	1290187	5549395	capsid,tRNA,lysis,tail,portal,protease,holin,terminase,head	Escherichia_phage(44.12%)	107	NA	NA
WP_000628065.1|1203663_1204896_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1205150_1206134_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001443847.1|1206408_1206582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123745.1|1206611_1207985_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157401.1|1208113_1209049_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.1e-144
WP_000040851.1|1209100_1210336_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.3	3.0e-238
WP_000079604.1|1210337_1210553_-	Rac prophage; conserved protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|1210652_1210841_-	DUF1187 domain-containing protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001443846.1|1210878_1211028_-	restriction alleviation protein, Lar family	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_000166313.1|1211083_1211893_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_000105150.1|1211885_1214486_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	3.0e-248
WP_000632297.1|1214587_1214863_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1214937_1215108_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|1215107_1215329_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001427316.1|1215749_1215902_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	2.3e-07
WP_071528017.1|1215960_1216164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233320.1|1216200_1216620_-	transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001072343.1|1216699_1216954_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693802.1|1216950_1217373_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	6.9e-70
WP_000899746.1|1217385_1218243_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788968.1|1218249_1218996_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	78.5	2.4e-110
WP_023442183.1|1218967_1219780_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	5.7e-121
WP_001151124.1|1219795_1220218_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	92.8	2.0e-64
WP_001266134.1|1220214_1220511_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	3.4e-47
WP_001209480.1|1220507_1220969_+	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403777.1|1220946_1221303_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_000935420.1|1221353_1221566_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_042350895.1|1221651_1221816_+	sugar acetyltransferase inhibitor	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000224233.1|1221817_1222081_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000207986.1|1222091_1222961_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_001278454.1|1223076_1223181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018421.1|1223370_1223583_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_001341382.1|1223750_1224029_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_001217413.1|1225093_1225468_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.4e-34
WP_000762928.1|1225464_1226286_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_000143050.1|1227456_1229307_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	99.0	0.0e+00
WP_000075191.1|1229585_1229747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024164617.1|1229745_1229961_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000193281.1|1229965_1230517_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	94.0	2.3e-36
WP_071528021.1|1230464_1230725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992045.1|1230836_1231370_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.6	8.1e-100
WP_000675931.1|1231590_1231704_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001082637.1|1231705_1232173_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	93.5	2.2e-72
WP_001096930.1|1232255_1232396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303878.1|1232638_1232953_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|1233034_1233259_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_032284653.1|1233653_1234199_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.4	4.3e-80
WP_001027379.1|1234173_1236099_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198153.1|1236095_1236302_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001443752.1|1236298_1237900_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_000123236.1|1237880_1239200_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	9.0e-233
WP_001299443.1|1239209_1239542_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000063258.1|1239597_1240623_+|capsid	minor capsid protein E	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001695575.1|1240664_1241060_+	DNA packaging protein	NA	A0A2R9YJP4	Escherichia_phage	93.9	8.2e-57
WP_000752994.1|1241071_1241425_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000975096.1|1241436_1242015_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683124.1|1242011_1242407_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	91.6	3.7e-65
WP_032284487.1|1242414_1243167_+|tail	tail fiber protein	tail	Q687F6	Enterobacteria_phage	98.8	2.4e-134
WP_000479045.1|1243180_1243603_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000533440.1|1243629_1244043_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081793.1|1244023_1246636_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	91.1	0.0e+00
WP_000847280.1|1246632_1246962_+|tail	tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_032284485.1|1246961_1247660_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.1	4.9e-129
WP_106918831.1|1247670_1248414_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.0	2.3e-148
WP_046424625.1|1248311_1248992_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.8	4.8e-113
WP_106918832.1|1249237_1252630_+|tail	phage tail protein	tail	A0A0P0ZCI5	Stx2-converting_phage	85.0	0.0e+00
WP_001230428.1|1252697_1253297_+	Ail/Lom family protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_032284483.1|1253361_1254675_+|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	99.5	1.3e-77
WP_000870508.1|1254637_1254946_+	hypothetical protein	NA	B6ETG7	Enterobacteria_phage	96.1	9.9e-50
WP_000491545.1|1255086_1255962_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	7.2e-162
WP_010917822.1|1256186_1256558_-	DUF1076 domain-containing protein	NA	A0A0P0ZBX1	Stx2-converting_phage	99.2	1.7e-67
WP_000812724.1|1257791_1258448_+	serine/threonine-protein phosphatase 1	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_001296140.1|1258448_1258640_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
WP_001295499.1|1258744_1258981_-	DUF1480 domain-containing protein	NA	NA	NA	NA	NA
WP_000057024.1|1259098_1260538_-	ribosomal RNA small subunit methyltransferase F	NA	NA	NA	NA	NA
WP_001299674.1|1260617_1263251_-	MCE family protein	NA	NA	NA	NA	NA
WP_001207284.1|1263219_1264503_-	paraquat-inducible membrane protein A	NA	NA	NA	NA	NA
WP_001043882.1|1264632_1265130_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_000431370.1|1265226_1265925_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001427396.1|1265944_1267993_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000984517.1|1268184_1269066_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001127210.1|1269111_1270485_-	MFS transporter	NA	NA	NA	NA	NA
WP_001262174.1|1270661_1271453_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001211011.1|1271595_1271835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714550.1|1271993_1272137_+	PhoP regulon feedback inhibition membrane protein MgrB	NA	NA	NA	NA	NA
WP_001006866.1|1272211_1272499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001308705.1|1272999_1273206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295496.1|1273167_1273311_+	DUF2527 domain-containing protein	NA	NA	NA	NA	NA
WP_001062678.1|1273323_1273533_+	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_000010107.1|1273698_1274508_+	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_000457277.1|1274504_1275125_-	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_015953171.1|1275067_1275313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000156255.1|1275499_1275958_-	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_000228655.1|1276012_1276864_-	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000406926.1|1276876_1277677_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000150551.1|1277739_1278711_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_001322972.1|1278681_1278876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001389137.1|1278976_1279186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295494.1|1280732_1282331_-	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000624298.1|1282461_1283826_-	L-serine dehydratase 1	NA	NA	NA	NA	NA
WP_000456725.1|1284009_1284588_-	coenzyme A pyrophosphatase	NA	NA	NA	NA	NA
WP_000854972.1|1284591_1285953_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000457334.1|1286026_1286206_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001307845.1|1286325_1286685_-	DUF1889 domain-containing protein	NA	NA	NA	NA	NA
WP_001295493.1|1287047_1287392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000128847.1|1287523_1289434_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001221003.1|1289491_1290187_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP027313	Escherichia coli strain 2014C-3550 chromosome, complete genome	5549395	1519153	1614505	5549395	capsid,lysis,tail,portal,holin,integrase,transposase,terminase,plate,head	Escherichia_phage(29.25%)	141	1508223:1508241	1602201:1602219
1508223:1508241	attL	CGCCGAACAGCGAGAACTG	NA	NA	NA	NA
WP_000598292.1|1519153_1519480_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_071527567.1|1519516_1519705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295394.1|1519685_1520900_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|1520911_1521931_+	starvation-sensing protein RspB	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_072095801.1|1521988_1522099_+	transporter	NA	NA	NA	NA	NA
WP_001206148.1|1522118_1523414_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
WP_000005551.1|1523433_1523685_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.9e-15
WP_000048585.1|1523754_1526226_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.0	1.9e-58
WP_001098307.1|1526319_1526511_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
WP_000413705.1|1526507_1526696_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133037.1|1527263_1527473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|1527473_1528112_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000379562.1|1528123_1528276_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	7.8e-08
WP_000379972.1|1528442_1528850_-	transcriptional regulator	NA	B1B6L9	Salmonella_phage	58.7	3.1e-14
WP_000920571.1|1528933_1529164_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705369.1|1529147_1529699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001183993.1|1530499_1531165_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	3.5e-84
WP_000537580.1|1531199_1531970_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	69.2	1.3e-85
WP_077775684.1|1531970_1532378_+	DUF977 domain-containing protein	NA	A0A088CBK9	Shigella_phage	62.6	2.3e-38
WP_001266133.1|1532374_1532671_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	5.8e-47
WP_000403783.1|1533020_1533377_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
WP_000935422.1|1533427_1533640_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	100.0	6.6e-37
WP_001224662.1|1533673_1533856_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_001289350.1|1534021_1534741_+	hypothetical protein	NA	A0A077SLK5	Escherichia_phage	64.8	3.4e-69
WP_000403779.1|1534718_1535075_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	95.8	4.3e-57
WP_000063625.1|1535123_1535336_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_000555106.1|1535536_1536250_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	86.1	1.2e-34
WP_001278450.1|1536365_1536470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303296.1|1536458_1536614_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	94.6	2.4e-12
WP_000967408.1|1536658_1536871_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_000042395.1|1536973_1537291_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001217944.1|1537283_1537655_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001452497.1|1537878_1538106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012817785.1|1538159_1538429_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	3.0e-10
WP_106873513.1|1538430_1539480_+	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	57.3	6.1e-115
WP_001047111.1|1539493_1540246_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	98.8	2.6e-136
WP_032316669.1|1540331_1540541_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	98.4	6.3e-24
WP_001339373.1|1540555_1540708_+	restriction endonuclease subunit M	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
WP_000735807.1|1541088_1541313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000498121.1|1541365_1541575_+	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	65.2	2.5e-20
WP_001299632.1|1541764_1542196_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	98.6	7.8e-69
WP_001339372.1|1542497_1542626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000023191.1|1542674_1544525_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000075191.1|1544803_1544965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024164617.1|1544963_1545179_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000193281.1|1545183_1545735_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	94.0	2.3e-36
WP_071528021.1|1545682_1545943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|1545997_1547211_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000992045.1|1547366_1547900_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.6	8.1e-100
WP_000675931.1|1548120_1548234_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001082637.1|1548235_1548703_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	93.5	2.2e-72
WP_001096930.1|1548785_1548926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303878.1|1549168_1549483_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|1549564_1549789_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_032284653.1|1550183_1550729_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.4	4.3e-80
WP_001027379.1|1550703_1552629_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198153.1|1552625_1552832_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_024026143.1|1552828_1554430_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	2.1e-308
WP_000123251.1|1554410_1555730_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_001365129.1|1555739_1556072_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000063258.1|1556127_1557153_+|capsid	minor capsid protein E	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_000158897.1|1557194_1557590_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000752994.1|1557601_1557955_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000975096.1|1557966_1558545_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683137.1|1558541_1558937_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_032325228.1|1558944_1559697_+|tail	tail fiber protein	tail	Q687F6	Enterobacteria_phage	95.6	1.3e-130
WP_000479086.1|1559710_1560142_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_000533431.1|1560168_1560582_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000082320.1|1560562_1563142_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.3	0.0e+00
WP_000847304.1|1563138_1563468_+|tail	tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_106918834.1|1563467_1564166_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	98.3	1.1e-131
WP_096852293.1|1564176_1564920_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	95.5	6.8e-145
WP_106918825.1|1564817_1565498_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.8	1.6e-113
WP_032277260.1|1569695_1570328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023277510.1|1570442_1570841_-	hypothetical protein	NA	Q6QIE8	Burkholderia_phage	55.9	3.9e-30
WP_032277261.1|1570812_1571265_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.5	2.8e-24
WP_001297463.1|1571254_1571470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000631814.1|1571459_1571690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032277262.1|1571686_1572370_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	3.4e-34
WP_000763554.1|1572366_1572582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032277263.1|1572596_1572893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032277264.1|1572902_1573175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050437916.1|1573231_1573453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140141.1|1573463_1573994_-	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	67.9	1.1e-59
WP_021519401.1|1574021_1574291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032277266.1|1574293_1575460_-	phage-like protein	NA	A4JWN1	Burkholderia_virus	59.7	5.7e-122
WP_032277268.1|1575470_1577252_-|integrase	integrase	integrase	Q6QIE0	Burkholderia_phage	68.5	1.8e-228
WP_032277269.1|1577255_1578170_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.0	1.7e-73
WP_000047759.1|1578180_1578489_-	IclR family transcriptional regulator	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
WP_000123378.1|1578541_1578730_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_032277270.1|1578823_1579180_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_032277272.1|1579296_1580061_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	63.6	2.2e-98
WP_032277273.1|1580250_1580466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032277274.1|1580464_1580869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016235481.1|1580844_1581573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000793146.1|1581703_1582054_+	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_001104440.1|1582056_1582797_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_032277276.1|1582780_1583431_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.0	4.7e-09
WP_000175097.1|1583427_1583754_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_000227704.1|1583753_1584065_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	60.6	4.0e-30
WP_023892598.1|1584067_1584616_+	DUF3486 domain-containing protein	NA	A4JWJ3	Burkholderia_virus	47.3	1.7e-36
WP_032277278.1|1584612_1585929_+|terminase	terminase	terminase	A0A2P9JZI8	Alteromonadaceae_phage	63.5	9.8e-147
WP_032277279.1|1585928_1587422_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	60.5	1.0e-168
WP_032277280.1|1587402_1588224_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	4.5e-97
WP_000135514.1|1588226_1588685_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_032277281.1|1588899_1590015_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	1.2e-97
WP_032277283.1|1590029_1590983_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	3.1e-65
WP_000537460.1|1590992_1591331_+	DUF2190 domain-containing protein	NA	NA	NA	NA	NA
WP_000271672.1|1591332_1591779_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	53.0	2.2e-34
WP_001101807.1|1591778_1592243_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	52.3	2.8e-40
WP_032143918.1|1592239_1592494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032277284.1|1592483_1593911_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	76.7	5.4e-215
WP_000034292.1|1593910_1594432_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
WP_000110115.1|1594434_1594716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023277505.1|1594813_1595149_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001148841.1|1595093_1595231_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_032277285.1|1595323_1597789_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	42.8	9.1e-170
WP_032277286.1|1597788_1598673_+	phage P2 GpU family protein	NA	A4JWL1	Burkholderia_virus	47.0	9.8e-50
WP_010989167.1|1598669_1598885_+	membrane protein	NA	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
WP_000807996.1|1598872_1600027_+	hypothetical protein	NA	Q6QIA2	Burkholderia_phage	47.3	4.2e-85
WP_000148270.1|1600023_1600551_+|plate	phage baseplate assembly protein V	plate	Q6QIA1	Burkholderia_phage	46.5	2.6e-21
WP_000859112.1|1600607_1600955_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	61.5	1.7e-34
WP_032277287.1|1600945_1602049_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	54.0	4.6e-105
WP_000852584.1|1602041_1602620_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
1602201:1602219	attR	CAGTTCTCGCTGTTCGGCG	NA	NA	NA	NA
WP_106918835.1|1602622_1603705_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	49.8	2.6e-60
WP_001298743.1|1603715_1604177_+|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	55.8	4.8e-40
WP_032277291.1|1604187_1604691_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	54.0	1.0e-43
WP_032277290.1|1604690_1605308_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.4	1.5e-65
WP_032277289.1|1605314_1605773_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	56.6	6.0e-43
WP_032277343.1|1605801_1606335_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	58.2	3.1e-43
WP_077756598.1|1606345_1606783_-|tail	phage tail protein	tail	Q9MCR6	Enterobacteria_phage	61.2	9.8e-43
WP_023892613.1|1606884_1607457_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
WP_106918836.1|1607476_1608094_+	Ail/Lom family protein	NA	Q687E7	Enterobacteria_phage	95.8	1.8e-103
WP_106875415.1|1608158_1609472_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.3	2.8e-77
WP_001023379.1|1609473_1609743_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
WP_001131657.1|1609855_1610431_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	1.8e-89
WP_001443810.1|1610503_1611133_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001143784.1|1611214_1611856_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_069198002.1|1611886_1612054_+|capsid	capsid protein	capsid	NA	NA	NA	NA
WP_001295593.1|1612796_1613231_-	universal stress protein F	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837924.1|1613371_1614505_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
>prophage 6
NZ_CP027313	Escherichia coli strain 2014C-3550 chromosome, complete genome	5549395	1759450	1864730	5549395	capsid,tail,portal,lysis,holin,integrase,transposase,terminase,head	Escherichia_phage(33.87%)	116	1742845:1742860	1863708:1863723
1742845:1742860	attL	GCCACCAAACTGCGTT	NA	NA	NA	NA
WP_085948178.1|1759450_1760663_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000520676.1|1760930_1761845_-	fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_032277316.1|1761903_1762407_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000876763.1|1762419_1762950_-	fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000123648.1|1762963_1765615_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000554020.1|1765656_1766376_-	fimbrial chaperone protein FimC	NA	NA	NA	NA	NA
WP_001296758.1|1766727_1767291_-	fimbrial protein	NA	NA	NA	NA	NA
WP_072097595.1|1768007_1768232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001125458.1|1768242_1769565_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_001296726.1|1769564_1769831_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_012817779.1|1771372_1775230_-	autotransporter barrel domain-containing lipoprotein	NA	NA	NA	NA	NA
WP_000154339.1|1777429_1778383_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001194888.1|1778631_1780167_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	1.7e-20
WP_000911171.1|1780160_1781189_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001222721.1|1781188_1782181_+	autoinducer 2 import system permease LsrD	NA	NA	NA	NA	NA
WP_000172466.1|1782192_1783215_+	autoinducer 2 ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000774200.1|1783241_1784111_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_072097594.1|1784064_1784571_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001341531.1|1784574_1785489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854640.1|1785695_1787147_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_001341530.1|1787291_1787423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000878965.1|1787373_1788321_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	9.6e-19
WP_001296740.1|1788899_1790288_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000366496.1|1790388_1791270_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032277320.1|1791347_1791806_+	putative protein YneK	NA	NA	NA	NA	NA
WP_001341528.1|1791754_1792462_+	putative protein YneK	NA	NA	NA	NA	NA
WP_000210799.1|1792611_1793802_+	sugar efflux transporter	NA	NA	NA	NA	NA
WP_000885033.1|1793826_1794492_-	stress protection protein MarC	NA	NA	NA	NA	NA
WP_000843419.1|1794703_1795138_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000091199.1|1795157_1795541_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803659.1|1795572_1795791_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000012618.1|1795847_1797287_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	1.1e-29
WP_001022772.1|1797311_1798985_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_001296721.1|1799040_1799352_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_001375402.1|1799379_1800702_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_000722571.1|1800816_1801128_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000577179.1|1801326_1802025_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000087216.1|1802069_1802969_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_001054196.1|1803163_1804351_+	transporter	NA	NA	NA	NA	NA
WP_000901367.1|1804477_1804573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000671731.1|1806712_1807105_-	TIGR00156 family protein	NA	NA	NA	NA	NA
WP_001024559.1|1807380_1807899_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_001341522.1|1807943_1809989_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_071525612.1|1809895_1810114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000636571.1|1810125_1810872_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032277378.1|1810960_1811647_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214712.1|1811824_1812028_+	protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527750.1|1812063_1813524_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.3	5.6e-42
WP_000347482.1|1813612_1814896_-	MFS transporter	NA	NA	NA	NA	NA
WP_096845570.1|1814955_1815246_+	DinI family protein	NA	B6DZC1	Enterobacteria_phage	82.0	2.6e-20
WP_097451673.1|1815297_1816453_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	7.5e-66
WP_000701369.1|1816907_1817894_-	peptidase M85	NA	NA	NA	NA	NA
WP_001341980.1|1817922_1818114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077759586.1|1818323_1818632_-|tail	phage tail protein	tail	B6ETG7	Enterobacteria_phage	95.1	3.4e-50
WP_032284465.1|1818594_1819908_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	9.7e-78
WP_001230496.1|1819972_1820572_-	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	1.3e-109
WP_046424625.1|1824360_1825041_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.8	4.8e-113
WP_024236318.1|1824938_1825682_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	1.9e-147
WP_106918838.1|1825687_1826386_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	96.6	2.2e-129
WP_000847280.1|1826385_1826715_-|tail	tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_000081793.1|1826711_1829324_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	91.1	0.0e+00
WP_000533440.1|1829304_1829718_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479045.1|1829744_1830167_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_032284487.1|1830180_1830933_-|tail	tail fiber protein	tail	Q687F6	Enterobacteria_phage	98.8	2.4e-134
WP_000683124.1|1830940_1831336_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	91.6	3.7e-65
WP_000975096.1|1831332_1831911_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000752994.1|1831922_1832276_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_001695575.1|1832287_1832683_-	DNA packaging protein	NA	A0A2R9YJP4	Escherichia_phage	93.9	8.2e-57
WP_000063258.1|1832724_1833750_-|capsid	minor capsid protein E	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001299443.1|1833805_1834138_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000123236.1|1834147_1835467_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	9.0e-233
WP_001443752.1|1835447_1837049_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_000198153.1|1837045_1837252_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027379.1|1837248_1839174_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453587.1|1839148_1839694_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_000583869.1|1839833_1839935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001307652.1|1840082_1840277_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_032158834.1|1840356_1840497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000881326.1|1840464_1841082_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_000092325.1|1841231_1841669_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_000075132.1|1841665_1842163_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_024164617.1|1842162_1842378_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000075198.1|1842376_1842538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000143049.1|1842816_1844667_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000762928.1|1845837_1846659_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001217413.1|1846655_1847030_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.4e-34
WP_032284663.1|1847042_1848092_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	3.4e-110
WP_000191872.1|1848093_1848366_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|1848487_1848832_-	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|1848951_1849164_-	Hok/Gef family protein	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|1849397_1849955_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|1849956_1850175_-	hypothetical protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|1850302_1850614_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|1850606_1850834_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|1850830_1851112_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450872.1|1851144_1851906_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	67.2	3.9e-79
WP_001444941.1|1852679_1853642_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.5	2.7e-69
WP_000693943.1|1853664_1854090_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|1854086_1854389_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_106918839.1|1854423_1854858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135107.1|1854842_1855070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|1855071_1855350_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001427316.1|1855636_1855789_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	2.3e-07
WP_000560218.1|1856209_1856431_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	98.6	1.8e-37
WP_001427414.1|1856430_1856601_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
WP_001307773.1|1856674_1856950_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	96.7	3.0e-42
WP_000105101.1|1857048_1859700_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	77.6	0.0e+00
WP_000166317.1|1859692_1860502_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	6.8e-106
WP_042853000.1|1860558_1860753_+	restriction alleviation and modification enhancement protein	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_001356607.1|1860745_1860934_+	DUF1187 domain-containing protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_001443927.1|1861040_1861322_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
WP_001189091.1|1861287_1862364_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	5.3e-98
WP_000976492.1|1862756_1863098_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000879280.1|1863110_1863983_-	copper resistance protein D	NA	NA	NA	NA	NA
1863708:1863723	attR	GCCACCAAACTGCGTT	NA	NA	NA	NA
WP_000204699.1|1863986_1864361_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|1864499_1864730_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
>prophage 7
NZ_CP027313	Escherichia coli strain 2014C-3550 chromosome, complete genome	5549395	1911004	2005672	5549395	capsid,tRNA,portal,tail,holin,integrase,transposase,terminase,plate	Enterobacteria_phage(70.83%)	104	1948539:1948598	1985874:1985994
WP_000564746.1|1911004_1911976_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176770.1|1912140_1914570_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
WP_001214304.1|1914594_1915695_-	cytochrome c	NA	NA	NA	NA	NA
WP_001185741.1|1916082_1916829_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001300190.1|1916842_1917409_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025336.1|1917624_1919358_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
WP_001297434.1|1919534_1920023_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001259583.1|1920142_1920535_-	flagellar biosynthesis protein FlhE	NA	NA	NA	NA	NA
WP_000067000.1|1920534_1922613_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278954.1|1922605_1923754_-	flagellar biosynthetic protein FlhB	NA	NA	NA	NA	NA
WP_000983609.1|1923955_1924600_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|1924610_1925000_-	two-component system response regulator	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036378.1|1925014_1926064_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204335.1|1926066_1926927_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483235.1|1926945_1928550_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	1.2e-13
WP_001342228.1|1928595_1930257_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|1930401_1930905_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001300654.1|1930925_1932890_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|1932894_1933821_-	motility protein B	NA	NA	NA	NA	NA
WP_000906335.1|1933817_1934705_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|1934831_1935410_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|1935412_1935763_-	flagellar transcriptional activator FlhD	NA	NA	NA	NA	NA
WP_000122426.1|1936542_1936971_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|1936977_1938402_-	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_001295645.1|1938376_1939177_-	trehalose-6-phosphate phosphatase	NA	NA	NA	NA	NA
WP_000100203.1|1939343_1940330_-	arabinose ABC transporter permease	NA	NA	NA	NA	NA
WP_001187810.1|1940344_1941859_-	arabinose import ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548675.1|1941928_1942918_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000179469.1|1943714_1944218_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_032277036.1|1944296_1944548_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_042352411.1|1944614_1944806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001237869.1|1945011_1945335_+	lipoprotein, function unknown	NA	NA	NA	NA	NA
WP_000917208.1|1945505_1946003_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|1946040_1946280_-	DUF2492 domain-containing protein	NA	NA	NA	NA	NA
WP_000797573.1|1946470_1947682_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847902.1|1947743_1948409_-	YecA family protein	NA	NA	NA	NA	NA
1948539:1948598	attL	AAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCT	NA	NA	NA	NA
WP_001342226.1|1948765_1949767_-|integrase	integrase	integrase	Q94N03	Haemophilus_virus	58.2	9.3e-105
WP_000865208.1|1949772_1950120_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290352.1|1950149_1950800_-	membrane protein	NA	NA	NA	NA	NA
WP_000786769.1|1950815_1951220_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_001308719.1|1951295_1951502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|1951518_1951722_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000742491.1|1951743_1952094_+	DUF4761 domain-containing protein	NA	A0A0A7NV42	Enterobacteria_phage	81.0	1.2e-48
WP_000158976.1|1952104_1952383_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.2	6.9e-34
WP_000357025.1|1952394_1952637_+	hypothetical protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	3.4e-37
WP_000985152.1|1952833_1953037_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	9.5e-25
WP_000091214.1|1953033_1953252_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	50.8	8.6e-08
WP_000564221.1|1953360_1953750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001272083.1|1953746_1956587_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.6	0.0e+00
WP_000686499.1|1956663_1957623_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.0e-181
WP_000211289.1|1957627_1957939_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.2e-47
WP_001289969.1|1958002_1958593_+	hypothetical protein	NA	Q8HAA6	Salmonella_phage	50.7	1.8e-31
WP_000087812.1|1959083_1960130_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000613774.1|1960129_1961881_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
WP_001262655.1|1962035_1962872_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_024219921.1|1962895_1963948_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.6	4.9e-189
WP_000632311.1|1963993_1964794_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	1.5e-126
WP_000063100.1|1964895_1965390_+|capsid	phage capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000864911.1|1965389_1965590_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	7.9e-32
WP_001342221.1|1965592_1965916_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000072343.1|1965912_1966305_+	M15 family peptidase	NA	A0A0A7NQ86	Enterobacteria_phage	98.5	2.9e-70
WP_000780555.1|1966301_1966709_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	4.2e-64
WP_000202144.1|1966847_1968725_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	82.2	1.1e-305
WP_001342220.1|1968748_1969216_+|tail	tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	94.8	6.7e-82
WP_032276831.1|1969208_1969844_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
WP_001271909.1|1969840_1970422_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	1.2e-101
WP_000213447.1|1970418_1970769_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111967.1|1970772_1971669_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.9e-154
WP_000071738.1|1971661_1972192_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	4.3e-93
WP_032276832.1|1972194_1974327_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.4	2.7e-130
WP_000144010.1|1974326_1974905_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	2.2e-95
WP_001369310.1|1974948_1975425_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_077252105.1|1975677_1976172_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	3.1e-85
WP_000853454.1|1976178_1978986_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	96.7	0.0e+00
WP_000333796.1|1978972_1979209_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	3.9e-22
WP_000665308.1|1979136_1979502_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000290450.1|1979556_1980069_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_032250563.1|1980068_1981253_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.2	2.2e-222
WP_000132847.1|1981410_1982511_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	2.1e-203
WP_001317900.1|1982910_1984050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000488107.1|1984339_1984600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078920.1|1984790_1984931_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_001160187.1|1986393_1986942_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
1985874:1985994	attR	AAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA	NA	NA	NA	NA
WP_001283424.1|1986998_1988831_-	excinuclease ABC subunit C	NA	NA	NA	NA	NA
WP_000611328.1|1988827_1989484_-	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_001302039.1|1989625_1989742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000106474.1|1989942_1990167_+	DUF2594 domain-containing protein	NA	NA	NA	NA	NA
WP_001154265.1|1990234_1990957_-	transcriptional regulator SdiA	NA	NA	NA	NA	NA
WP_001272994.1|1991186_1991939_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
WP_001158220.1|1991935_1992604_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001128238.1|1992618_1993605_-	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_001317901.1|1993709_1994510_-	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001370462.1|1994597_1995149_-	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
WP_032276834.1|1995194_1995914_-	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_000079829.1|1996078_1997653_-	flagellin FliC	NA	NA	NA	NA	NA
WP_032276835.1|1997907_1999320_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287768.1|1999334_1999745_+	flagella export chaperone FliS	NA	NA	NA	NA	NA
WP_001015030.1|1999744_2000110_+	flagellar protein FliT	NA	NA	NA	NA	NA
WP_001245684.1|2000187_2001675_+	alpha-amylase	NA	NA	NA	NA	NA
WP_001295642.1|2001708_2002122_-	lipoprotein	NA	NA	NA	NA	NA
WP_000118901.1|2002308_2003514_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_000790504.1|2003510_2003744_+	SirA-like protein	NA	NA	NA	NA	NA
WP_000334586.1|2003852_2004524_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	5.6e-82
WP_000826451.1|2004508_2005672_-|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	93.0	8.9e-200
>prophage 8
NZ_CP027313	Escherichia coli strain 2014C-3550 chromosome, complete genome	5549395	2239229	2249157	5549395	transposase	Enterobacteria_phage(62.5%)	9	NA	NA
WP_001292774.1|2239229_2240366_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_001342301.1|2240362_2242363_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001171523.1|2242694_2243075_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|2243071_2243419_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998019.1|2243468_2244854_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000950404.1|2245285_2245756_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.0e-81
WP_000598641.1|2245802_2246522_-	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_001295431.1|2246518_2248204_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2248425_2249157_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
>prophage 9
NZ_CP027313	Escherichia coli strain 2014C-3550 chromosome, complete genome	5549395	2326664	2422220	5549395	capsid,tail,portal,lysis,holin,integrase,transposase,terminase,head	Enterobacteria_phage(40.54%)	106	2357197:2357215	2431436:2431454
WP_001229488.1|2326664_2327153_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	41.7	3.9e-24
WP_001369202.1|2327315_2328239_+|capsid	phage capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.9	1.2e-13
WP_032146851.1|2331327_2331585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001113637.1|2331616_2332264_+	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_001211567.1|2332298_2333351_-	cytochrome c biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_000824439.1|2333347_2333905_-	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_000982426.1|2333901_2335845_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_001026418.1|2335841_2336321_-	cytochrome c-type biogenesis protein CcmE	NA	NA	NA	NA	NA
WP_000186540.1|2336317_2336527_-	heme exporter protein D	NA	NA	NA	NA	NA
WP_001295447.1|2336523_2337261_-	heme exporter protein C	NA	NA	NA	NA	NA
WP_000971723.1|2337302_2337965_-	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000525587.1|2337961_2338585_-	cytochrome c biogenesis ATP-binding export protein CcmA	NA	G3M9Y6	Bacillus_virus	25.5	2.0e-12
WP_000528376.1|2338597_2339200_-	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000835177.1|2339209_2339659_-	nitrate reductase cytochrome C550 subunit	NA	NA	NA	NA	NA
WP_000013509.1|2339655_2340519_-	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000091291.1|2340505_2341201_-	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_032277551.1|2341207_2343694_-	periplasmic nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_000557378.1|2343690_2343954_-	protein NapD	NA	NA	NA	NA	NA
WP_000686723.1|2343943_2344438_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_000041385.1|2344537_2344711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000849214.1|2344846_2345335_+	ecotin	NA	NA	NA	NA	NA
WP_000758074.1|2345483_2347130_-	malate:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000422231.1|2347347_2348991_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000884922.1|2349066_2349717_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000786386.1|2349716_2350781_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406116.1|2350854_2351910_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865576.1|2352021_2353113_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
WP_077221234.1|2353393_2353621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001347251.1|2353595_2353835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001249127.1|2353851_2356524_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_001061917.1|2356540_2357191_+	DNA-binding response regulator	NA	NA	NA	NA	NA
2357197:2357215	attL	TGTAGGCCAGATAAGACGC	NA	NA	NA	NA
WP_032277553.1|2357276_2360126_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.0	9.2e-41
WP_001225855.1|2360400_2361177_-	DUF2135 domain-containing protein	NA	NA	NA	NA	NA
WP_032276988.1|2361181_2362831_-	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_000536535.1|2362831_2367346_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_001025664.1|2368027_2369350_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.7	2.5e-227
WP_001443833.1|2370043_2370577_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	42.0	6.4e-28
WP_001023380.1|2370916_2371186_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	94.4	7.3e-41
WP_000279018.1|2371187_2372501_-|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.3	2.8e-77
WP_001228241.1|2372565_2373165_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.4e-100
WP_096071218.1|2373232_2373514_-	host specificity protein J	NA	Q9LA64	Enterobacterial_phage	97.5	3.9e-37
WP_000099160.1|2373510_2375049_-|transposase	IS66 family transposase ISEc22	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|2375097_2375445_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|2375441_2375846_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_032284631.1|2375874_2379174_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	95.2	0.0e+00
WP_001443770.1|2379234_2379906_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.1	1.2e-103
WP_000194778.1|2379803_2380547_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	6.6e-148
WP_001152619.1|2380552_2381251_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_032277397.1|2381250_2381580_-|tail	tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	94.5	4.4e-56
WP_000082375.1|2381576_2384138_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.0	0.0e+00
WP_000533403.1|2384118_2384532_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479086.1|2384558_2384990_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_001143013.1|2385003_2385756_-|tail	tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_000683071.1|2385763_2386159_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_000975037.1|2386155_2386731_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_001204544.1|2386745_2387099_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000012985.1|2387091_2387514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522643.1|2387517_2388402_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	54.1	6.5e-94
WP_000256849.1|2388459_2388807_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	1.5e-22
WP_001254039.1|2388843_2390349_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000827572.1|2390338_2391931_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	8.4e-185
WP_000258991.1|2391927_2392134_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	60.0	4.2e-12
WP_000235436.1|2394017_2394527_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001427981.1|2394921_2395116_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_000738423.1|2395475_2395769_+	hypothetical protein	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001082740.1|2395800_2396262_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	98.7	9.2e-76
WP_000075153.1|2396258_2396756_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	96.4	1.6e-89
WP_000284524.1|2396755_2396971_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000499454.1|2397592_2397751_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_001299184.1|2397836_2398553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235460.1|2398832_2399456_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_001028854.1|2399452_2400118_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223927.1|2400114_2400717_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
WP_001108084.1|2400691_2401258_-	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_001429269.1|2401757_2403593_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	0.0e+00
WP_001254228.1|2404096_2404279_-	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_000153270.1|2404275_2404803_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_000810176.1|2404799_2405246_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	92.6	3.4e-75
WP_000145926.1|2405532_2405823_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000788878.1|2405819_2406521_-	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	99.6	1.7e-129
WP_000185462.1|2406517_2407456_-	hypothetical protein	NA	C1JJ53	Enterobacteria_phage	99.4	1.1e-171
WP_000035947.1|2407488_2407785_-	hypothetical protein	NA	A0A0N7C1W0	Escherichia_phage	96.9	1.3e-46
WP_000276885.1|2407894_2408080_-	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	100.0	1.2e-26
WP_001095982.1|2408160_2408811_+	LexA family transcriptional repressor	NA	K7PM82	Enterobacteria_phage	100.0	4.9e-123
WP_000256573.1|2409125_2409431_+	hypothetical protein	NA	K7PJM7	Enterobacteria_phage	99.0	7.0e-48
WP_000930321.1|2409433_2409772_+	hypothetical protein	NA	K7PJW2	Enterobacteria_phage	99.1	5.8e-59
WP_000167595.1|2409905_2410376_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000065385.1|2410525_2410894_+	DUF2528 domain-containing protein	NA	M1FPD2	Enterobacteria_phage	97.5	3.8e-64
WP_001130911.1|2410973_2411264_+	host cell division inhibitory peptide Kil	NA	M1FN78	Enterobacteria_phage	95.5	1.3e-40
WP_071525080.1|2411197_2411350_+	host-nuclease inhibitor protein Gam	NA	Q08J51	Stx2-converting_phage	96.0	1.8e-20
WP_000995439.1|2411318_2411615_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|2411620_2412406_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_032284635.1|2412402_2413080_+	exonuclease	NA	A0A1I9LJM9	Stx_converting_phage	99.6	2.3e-131
WP_001303590.1|2413079_2413262_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000548547.1|2413234_2413426_+	DUF1382 domain-containing protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001444000.1|2413436_2413718_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763358.1|2413816_2414038_+	conjugal transfer protein TraR	NA	A0A0N7C211	Escherichia_phage	95.9	1.6e-33
WP_012817803.1|2414082_2414640_+	hypothetical protein	NA	A0A2D1GLY5	Escherichia_phage	96.3	2.1e-37
WP_001345188.1|2414636_2414987_+	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	80.2	3.3e-33
WP_000457736.1|2415061_2415304_+	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	96.2	3.7e-36
WP_001281192.1|2415422_2415767_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
WP_001444001.1|2415872_2416091_+	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
WP_000533670.1|2416068_2417139_+|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
WP_001215756.1|2417153_2417759_-	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_000012302.1|2417755_2419444_-	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
WP_001281218.1|2419592_2422220_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	1.1e-91
2431436:2431454	attR	GCGTCTTATCTGGCCTACA	NA	NA	NA	NA
>prophage 10
NZ_CP027313	Escherichia coli strain 2014C-3550 chromosome, complete genome	5549395	2797304	2914471	5549395	capsid,tRNA,tail,lysis,protease,holin,integrase,terminase,head	Stx2-converting_phage(22.97%)	135	2834849:2834865	2916008:2916024
WP_001298974.1|2797304_2798042_-|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
WP_000219193.1|2798173_2799508_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001341633.1|2799716_2800598_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|2800700_2801288_+	cysteine/O-acetylserine efflux protein	NA	NA	NA	NA	NA
WP_000627807.1|2801343_2801727_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|2802031_2802721_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|2802768_2803806_-	methyltransferase	NA	NA	NA	NA	NA
WP_001322361.1|2803795_2803999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001098726.1|2804012_2804432_+	thiol disulfide reductase thioredoxin	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_032277139.1|2804500_2805199_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000083007.1|2805230_2807891_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|2808004_2809360_+	phosphatidylserine synthase	NA	NA	NA	NA	NA
WP_001300818.1|2809405_2809729_+	lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|2809725_2811024_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_046671466.1|2811005_2811119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235102.1|2816877_2819451_-	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040115.1|2819580_2820312_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_000079094.1|2820308_2821289_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|2821423_2822161_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_001326155.1|2822190_2822397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|2822431_2822773_+	ribosome-associated inhibitor A	NA	NA	NA	NA	NA
WP_001386991.1|2822876_2822924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200116.1|2823022_2824183_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|2824225_2825347_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168054.1|2825357_2826428_-	phospho-2-dehydro-3-deoxyheptonate aldolase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000976004.1|2826637_2827003_+	lipoprotein	NA	NA	NA	NA	NA
WP_001212391.1|2827152_2827671_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
WP_000969036.1|2827660_2828887_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_000589828.1|2828902_2829385_+	membrane protein	NA	NA	NA	NA	NA
WP_000065253.1|2829461_2829809_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|2829850_2830618_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|2830648_2831197_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|2831215_2831464_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460032.1|2831712_2833074_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|2833240_2834032_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_001307349.1|2834097_2835339_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
2834849:2834865	attL	AGTTCACCAAAGAAACC	NA	NA	NA	NA
WP_001296310.1|2835393_2835987_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_009008281.1|2835983_2836178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059169.1|2836109_2836988_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|2837073_2838735_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|2838883_2839225_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|2839286_2839577_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|2839566_2840043_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
WP_000162574.1|2840174_2840657_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000938111.1|2842410_2843772_+	type III secretion system protein	NA	Q9MBM1	Phage_Gifsy-1	29.6	4.3e-52
WP_001370486.1|2844148_2847550_-	DUF4765 domain-containing protein	NA	A0A0N7KZG3	Stx2-converting_phage	39.3	1.3e-219
WP_001301673.1|2848141_2850490_-	type III secretion system effector HECT-type E3 ubiquitin transferase	NA	NA	NA	NA	NA
WP_001023420.1|2850705_2850975_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_000268987.1|2850976_2852290_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	4.8e-77
WP_001230429.1|2852354_2852954_-	Ail/Lom family protein	NA	Q687E7	Enterobacteria_phage	99.0	2.3e-111
WP_106918844.1|2853020_2856494_-|tail	phage tail protein	tail	A0A0P0ZCI5	Stx2-converting_phage	98.0	0.0e+00
WP_106918825.1|2856739_2857420_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.8	1.6e-113
WP_096852293.1|2857317_2858061_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	95.5	6.8e-145
WP_032284485.1|2858071_2858770_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.1	4.9e-129
WP_000807940.1|2858769_2859111_-|tail	tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_106918824.1|2859103_2862346_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	92.9	0.0e+00
WP_001234250.1|2862396_2862678_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	93.5	6.9e-42
WP_000710952.1|2862701_2863076_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275441.1|2863090_2863807_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000133388.1|2863872_2864217_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2864213_2864660_-	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2864656_2865007_-|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|2865017_2865344_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|2867870_2868092_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173079.1|2868136_2870074_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	100.0	0.0e+00
WP_032284585.1|2870137_2871799_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.5	0.0e+00
WP_000958380.1|2871795_2872359_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001427183.1|2872654_2873020_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	97.5	9.9e-65
WP_000095736.1|2873061_2873289_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000736096.1|2873657_2873882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001427182.1|2873878_2874373_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	97.4	1.4e-74
WP_032140280.1|2874374_2874461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043230.1|2874725_2874938_-	hypothetical protein	NA	A0A0M4S639	Salmonella_phage	60.5	2.7e-06
WP_001003120.1|2875015_2875549_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.9	3.6e-100
WP_032313472.1|2875593_2875776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001360224.1|2875744_2875981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303880.1|2875929_2876274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024182511.1|2876236_2876452_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
WP_000075196.1|2876450_2876612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000874393.1|2876890_2878741_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	95.8	0.0e+00
WP_042853491.1|2878858_2879062_+	hypothetical protein	NA	Q8VNP0	Enterobacteria_phage	96.7	1.8e-28
WP_000261909.1|2879508_2880222_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_032277407.1|2880316_2880556_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	95.9	3.8e-17
WP_000265267.1|2880842_2881661_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|2881812_2882184_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|2882173_2882545_-	endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265140.1|2882557_2883607_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	3.4e-110
WP_001341388.1|2883608_2883887_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001013636.1|2884054_2884267_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_000160654.1|2884814_2885588_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|2885939_2886353_-	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|2886368_2887139_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788750.1|2887160_2887907_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_001205823.1|2887913_2889005_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|2889083_2889539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|2889744_2890170_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|2890153_2890426_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|2890534_2890936_+	hypothetical protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|2890963_2891155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|2891154_2891442_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|2891718_2891874_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000344963.1|2891875_2892004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|2892015_2892405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|2892591_2892777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303875.1|2892778_2893084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|2893350_2893539_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|2893535_2893727_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
WP_032278809.1|2893820_2896292_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|2896359_2896602_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|2896579_2897599_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000466957.1|2898415_2898847_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000762928.1|2899412_2900234_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001217410.1|2900230_2900605_-	endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_106875428.1|2900617_2901667_-	hypothetical protein	NA	U5P0K4	Shigella_phage	54.3	2.2e-109
WP_000191872.1|2901668_2901941_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2902062_2902407_-	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_001013638.1|2902526_2902739_-	type I toxin-antitoxin system hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	3.1e-26
WP_000104474.1|2902972_2903530_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683607.1|2903531_2903750_-	hypothetical protein	NA	A0A2R2Z311	Escherichia_phage	73.6	6.2e-22
WP_001365112.1|2903852_2904188_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.4	2.0e-48
WP_000699809.1|2904180_2904408_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2904404_2904686_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000451006.1|2904718_2905480_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.9	4.9e-74
WP_000788759.1|2905501_2906248_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.8	1.4e-113
WP_001262372.1|2906254_2907325_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	66.2	4.5e-65
WP_000693928.1|2907396_2907822_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|2907805_2908129_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|2908253_2908730_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000379610.1|2909048_2909201_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.7e-07
WP_001358566.1|2909690_2909879_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001365098.1|2909875_2910067_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
WP_000048279.1|2910160_2912632_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_000003742.1|2912693_2912963_+	excisionase	NA	NA	NA	NA	NA
WP_000074973.1|2912931_2914050_+|integrase	integrase	integrase	Q77Z04	Phage_21	44.4	2.0e-84
WP_001427255.1|2914126_2914471_-	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	34.7	1.9e-09
2916008:2916024	attR	AGTTCACCAAAGAAACC	NA	NA	NA	NA
>prophage 11
NZ_CP027313	Escherichia coli strain 2014C-3550 chromosome, complete genome	5549395	3083840	3180444	5549395	capsid,tail,lysis,holin,integrase,transposase,terminase,head	Escherichia_phage(34.29%)	109	3153163:3153179	3185743:3185759
WP_000998025.1|3083840_3085373_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	7.1e-298
WP_000233452.1|3086129_3088490_-	DEAD/DEAH box helicase	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_000282084.1|3088644_3089208_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000335695.1|3090028_3091462_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000579535.1|3091680_3091878_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001303889.1|3092104_3092401_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000282206.1|3093512_3095330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000279869.1|3095516_3096719_-|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
WP_000009226.1|3097344_3098031_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001307105.1|3098611_3099535_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	9.2e-91
WP_001199164.1|3100018_3101290_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_000154411.1|3101295_3102423_-	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_000497942.1|3102480_3103311_-	ferrous iron permease EfeU	NA	NA	NA	NA	NA
WP_071527597.1|3103644_3103902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001018496.1|3103976_3105485_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_001336560.1|3105564_3105756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000979516.1|3105643_3105853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001341463.1|3105907_3109870_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000191700.1|3109909_3110548_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001323060.1|3110778_3111927_+	pyrimidine monooxygenase RutA	NA	NA	NA	NA	NA
WP_001307708.1|3111926_3112619_+	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_001126777.1|3112630_3113017_+	aminoacrylate peracid reductase	NA	NA	NA	NA	NA
WP_001341462.1|3113024_3113825_+	aminoacrylate hydrolase	NA	NA	NA	NA	NA
WP_001001171.1|3113834_3114425_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_001028095.1|3114435_3114930_+	FMN reductase	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001240628.1|3114950_3116279_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	1.0e-231
WP_001273658.1|3116361_3116535_-	KGG family protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_012817753.1|3116467_3116698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151437.1|3116907_3117504_+	NAD(P)H dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_001143120.1|3117524_3117752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044313.1|3117789_3119031_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_000097601.1|3119322_3120582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000420629.1|3120841_3121762_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
WP_000024561.1|3121761_3122067_+	chaperone modulatory protein CbpM	NA	NA	NA	NA	NA
WP_000209869.1|3122159_3122759_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001062101.1|3122755_3125302_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	1.0e-70
WP_001230242.1|3125301_3126474_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120112.1|3126603_3127296_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264955.1|3127268_3128297_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001121564.1|3128768_3129422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001002867.1|3129434_3130133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001131653.1|3130333_3130915_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	64.2	5.1e-63
WP_106420821.1|3130905_3131100_-	hypothetical protein	NA	A0A2R2Z347	Escherichia_phage	84.6	4.1e-09
WP_000767050.1|3131044_3131587_-	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
WP_001023995.1|3131808_3132078_-|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	7.1e-44
WP_106918847.1|3132079_3133339_-|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	89.7	2.9e-71
WP_001230429.1|3133403_3134003_-	Ail/Lom family protein	NA	Q687E7	Enterobacteria_phage	99.0	2.3e-111
WP_106875412.1|3134069_3137546_-|tail	phage tail protein	tail	Q687E8	Enterobacteria_phage	97.2	0.0e+00
WP_106918848.1|3137781_3138462_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	96.0	1.3e-110
WP_001405642.1|3138359_3139103_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	5.6e-147
WP_001335877.1|3139113_3139812_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_000807940.1|3139811_3140153_-|tail	tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_106918829.1|3140145_3143388_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.5	0.0e+00
WP_001234278.1|3143435_3143717_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.9	2.3e-45
WP_000710952.1|3143740_3144115_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_058157545.1|3144129_3144846_-|tail	phage tail protein	tail	B6DZA6	Enterobacteria_phage	95.8	3.0e-121
WP_000133388.1|3144911_3145256_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3145252_3145699_-	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3145695_3146046_-|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|3146056_3146383_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|3148909_3149131_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_106918861.1|3149175_3150954_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	91.2	0.0e+00
WP_033800465.1|3151018_3152680_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.3	0.0e+00
WP_000958380.1|3152676_3153240_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
3153163:3153179	attL	GGCGGCAATGGCTGACG	NA	NA	NA	NA
WP_025380422.1|3153528_3153894_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	5.8e-65
WP_001448509.1|3153935_3154160_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	76.1	2.9e-19
WP_001302717.1|3154241_3154556_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001096932.1|3154796_3154937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082648.1|3155019_3155487_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	88.3	2.1e-67
WP_001056883.1|3155643_3156213_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	99.5	1.5e-104
WP_000087714.1|3156487_3157021_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
WP_001072901.1|3157025_3157241_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290230.1|3157318_3157564_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143463.1|3157604_3157784_-	DUF1378 domain-containing protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
WP_106875437.1|3157919_3159857_-	sialate O-acetylesterase	NA	Q6H9W1	Enterobacteria_phage	96.9	0.0e+00
WP_000466957.1|3160334_3160766_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000301785.1|3161215_3161929_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816794.1|3162063_3162384_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.1	2.7e-34
WP_000640048.1|3162502_3163033_-	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904103.1|3163041_3163401_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	1.8e-34
WP_001265113.1|3163413_3164460_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.5	1.4e-108
WP_001342259.1|3164461_3164734_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	5.2e-10
WP_001260977.1|3164869_3165127_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_000220601.1|3165132_3165432_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	100.0	1.8e-51
WP_000206830.1|3165636_3165981_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	1.7e-58
WP_001229296.1|3165977_3166343_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	100.0	5.1e-69
WP_000209152.1|3166344_3166563_-	hypothetical protein	NA	A0A2R2Z311	Escherichia_phage	100.0	6.6e-32
WP_001289353.1|3166650_3167286_-	hypothetical protein	NA	A0A2R2Z315	Escherichia_phage	100.0	1.3e-115
WP_001224662.1|3167451_3167634_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000935422.1|3167667_3167880_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	100.0	6.6e-37
WP_000403783.1|3167930_3168287_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
WP_001209480.1|3168264_3168726_-	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_001266133.1|3168722_3169019_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	5.8e-47
WP_077249748.1|3169015_3169423_-	DUF977 domain-containing protein	NA	A0A088CBK9	Shigella_phage	62.6	1.0e-38
WP_000450641.1|3169423_3170149_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.4	1.2e-77
WP_001164687.1|3170182_3170845_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	89.5	2.2e-78
WP_000693932.1|3171733_3172171_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	55.0	1.6e-29
WP_001172789.1|3172167_3172428_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	64.8	4.8e-21
WP_000578360.1|3172554_3172947_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	39.6	1.7e-14
WP_001022415.1|3172993_3173353_-	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	93.3	3.6e-59
WP_000692026.1|3173355_3173658_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	43.3	3.7e-17
WP_012817750.1|3173993_3174293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171921.1|3174364_3174583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|3175151_3175340_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|3175336_3175525_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
WP_000048499.1|3175619_3178070_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
WP_000273151.1|3178137_3178380_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3178357_3179377_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375138.1|3179784_3180444_+	BAX inhibitor protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
3185743:3185759	attR	CGTCAGCCATTGCCGCC	NA	NA	NA	NA
>prophage 12
NZ_CP027313	Escherichia coli strain 2014C-3550 chromosome, complete genome	5549395	3483209	3534246	5549395	tail,portal,lysis,holin,integrase,transposase,terminase,head	Enterobacteria_phage(47.69%)	72	3531413:3531428	3538484:3538499
WP_001448642.1|3483209_3483785_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	77.5	1.6e-77
WP_001339397.1|3483845_3484523_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|3484522_3484870_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_106875440.1|3484889_3486461_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	2.2e-169
WP_021351651.1|3486935_3487307_+	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_000652081.1|3487430_3488258_-	hypothetical protein	NA	A5LH49	Enterobacteria_phage	98.2	3.1e-154
WP_000950982.1|3488481_3489363_-	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_001023459.1|3489468_3489738_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_032284503.1|3489739_3490954_-|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	94.8	4.0e-78
WP_001233130.1|3491018_3491618_-	Ail/Lom family protein	NA	Q687E7	Enterobacteria_phage	97.5	1.8e-108
WP_032202882.1|3495205_3495424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032284506.1|3495955_3496699_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	1.0e-148
WP_001375577.1|3496704_3497403_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	4.7e-132
WP_000847304.1|3497402_3497732_-|tail	tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_000082320.1|3497728_3500308_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.3	0.0e+00
WP_000533431.1|3500288_3500702_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000479086.1|3500728_3501160_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_001143013.1|3501173_3501926_-|tail	tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_032284507.1|3501933_3502302_-	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	88.0	2.4e-50
WP_000099160.1|3502298_3503837_-|transposase	IS66 family transposase ISEc22	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|3503885_3504233_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839170.1|3504229_3504634_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	2.5e-69
WP_001254029.1|3504711_3504888_-	hypothetical protein	NA	E4WL22	Enterobacteria_phage	56.4	1.1e-08
WP_106875443.1|3504877_3506470_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	1.6e-183
WP_000259002.1|3506466_3506673_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_009442816.1|3506656_3508585_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	2.7e-262
WP_000235451.1|3508556_3509066_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	33.3	1.2e-12
WP_001307652.1|3509461_3509656_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_032158834.1|3509735_3509876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000881326.1|3509843_3510461_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_000092325.1|3510610_3511048_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_000075132.1|3511044_3511542_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_024164617.1|3511541_3511757_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000075198.1|3511755_3511917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|3514358_3514517_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_001299184.1|3514602_3515319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3515530_3516220_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3516234_3516357_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3516695_3517655_+	DUF2219 domain-containing protein	NA	NA	NA	NA	NA
WP_000994516.1|3517866_3518055_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008193.1|3518051_3518414_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	2.7e-62
WP_000002261.1|3518410_3518701_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	2.9e-51
WP_001003989.1|3518700_3519423_-	DNA-binding protein	NA	K7P6K2	Enterobacteria_phage	99.6	5.4e-131
WP_001341811.1|3519415_3519625_-	protein ninF	NA	G9L691	Escherichia_phage	97.1	2.6e-30
WP_000924601.1|3519584_3519986_-	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_001254255.1|3519988_3520165_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000814611.1|3520161_3520572_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	2.1e-71
WP_000344573.1|3520543_3520900_-	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	97.3	2.1e-59
WP_000145926.1|3521196_3521487_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_032278733.1|3521483_3522164_-	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.1	1.4e-125
WP_000438538.1|3523140_3523440_-	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	99.0	4.8e-49
WP_000064150.1|3523578_3523812_-	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	97.4	4.0e-35
WP_000428099.1|3523925_3524630_+	XRE family transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	99.6	4.3e-133
WP_000193240.1|3524898_3525261_+	hypothetical protein	NA	A0A1P8DTD0	Proteus_phage	51.4	6.2e-19
WP_000088201.1|3525867_3526140_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	7.4e-41
WP_000073663.1|3526163_3526703_-	superinfection exclusion protein B	NA	A0A192Y7Z0	Salmonella_phage	44.9	8.1e-39
WP_001341800.1|3527066_3527927_+	hypothetical protein	NA	K7P7J7	Enterobacteria_phage	99.3	2.4e-37
WP_000638547.1|3527951_3528083_+	Regulatory protein CIII	NA	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243354.1|3528067_3528220_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	98.0	1.5e-19
WP_000031370.1|3528476_3529082_+	recombinase	NA	Q9MCQ9	Enterobacteria_phage	100.0	4.1e-108
WP_000951334.1|3529081_3529465_+	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	2.5e-66
WP_001111278.1|3529488_3529782_+	hypothetical protein	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
WP_001214436.1|3529792_3529957_+	DUF2737 domain-containing protein	NA	K7P7R0	Enterobacteria_phage	98.1	4.2e-23
WP_000812206.1|3529953_3530511_+	hypothetical protein	NA	E7C9P6	Salmonella_phage	64.3	3.2e-62
WP_000034231.1|3530507_3531065_+	hypothetical protein	NA	A5VWB3	Enterobacteria_phage	83.6	4.6e-45
WP_000104414.1|3531066_3531684_+	hypothetical protein	NA	Q716F4	Shigella_phage	64.2	5.6e-36
3531413:3531428	attL	CCTGCCGCGCCGCCAT	NA	NA	NA	NA
WP_012817743.1|3531680_3531983_+	restriction alleviation protein, Lar family	NA	Q716F5	Shigella_phage	97.0	9.4e-53
WP_000002107.1|3531975_3532260_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	100.0	1.8e-50
WP_000545733.1|3532332_3532500_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_001281774.1|3532528_3532873_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	4.5e-59
WP_001303849.1|3532979_3533198_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533654.1|3533175_3534246_+|integrase	integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	5.6e-201
3538484:3538499	attR	CCTGCCGCGCCGCCAT	NA	NA	NA	NA
>prophage 13
NZ_CP027313	Escherichia coli strain 2014C-3550 chromosome, complete genome	5549395	3762766	3812470	5549395	capsid,tail,protease,portal,lysis,integrase,transposase,terminase,head	Enterobacteria_phage(58.93%)	66	3762298:3762344	3812484:3812530
3762298:3762344	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201825.1|3762766_3763720_+|protease	outer membrane protease	protease	NA	NA	NA	NA
WP_001226384.1|3763906_3765391_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000937502.1|3765574_3765880_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_041983107.1|3765978_3766605_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001309429.1|3766549_3766687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000279150.1|3767243_3770204_-	membrane protein	NA	A0A2D1UII2	Escherichia_phage	98.3	3.0e-58
WP_001230523.1|3770268_3770868_-	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.8e-108
WP_000515439.1|3770938_3774352_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.2	0.0e+00
WP_000090884.1|3774412_3775045_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_001152557.1|3775730_3776429_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	3.4e-130
WP_000847347.1|3776428_3776758_-|tail	tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_000840236.1|3776754_3779316_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.1	0.0e+00
WP_000459457.1|3779308_3779743_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479169.1|3779724_3780147_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_001342267.1|3780162_3780903_-|tail	tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000683110.1|3780910_3781306_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.9e-70
WP_000985132.1|3781302_3781881_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752961.1|3781871_3782246_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	8.0e-62
WP_000158868.1|3782257_3782653_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000063244.1|3782694_3783720_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
WP_001345004.1|3783775_3784108_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000088640.1|3784117_3784996_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.0	1.7e-147
WP_032284515.1|3785036_3785714_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|3785713_3786061_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|3786080_3787652_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001444138.1|3788124_3789726_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	8.5e-310
WP_000198149.1|3789722_3789929_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_052922144.1|3789925_3791851_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000453558.1|3791825_3792371_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_000583869.1|3792510_3792612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001427981.1|3792759_3792954_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_106875444.1|3793071_3794284_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000738423.1|3794625_3794919_+	hypothetical protein	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001082740.1|3794950_3795412_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	98.7	9.2e-76
WP_001135274.1|3795408_3795906_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
WP_000839596.1|3795905_3796121_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737278.1|3796709_3797792_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	80.6	7.8e-166
WP_001204791.1|3797980_3798364_-	antitermination protein Q	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971074.1|3798449_3798590_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001099712.1|3798586_3798949_-	hypothetical protein	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774477.1|3798945_3799236_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	96.9	6.0e-49
WP_000224914.1|3799228_3799399_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053023.1|3799398_3799854_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	67.5	3.1e-60
WP_072097617.1|3799850_3799952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000520500.1|3800075_3800477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038620.1|3800455_3800872_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_001415151.1|3801171_3801780_-	hypothetical protein	NA	Q9T1Q5	Acyrthosiphon_pisum_secondary_endosymbiont_phage	67.3	1.5e-33
WP_000152742.1|3802532_3802880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000788789.1|3803084_3803786_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	3.8e-129
WP_000147885.1|3803782_3804802_-	hypothetical protein	NA	M1FN81	Enterobacteria_phage	67.0	4.8e-109
WP_001182773.1|3804798_3805338_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_001067458.1|3805407_3805638_-	antirepressor	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000259990.1|3805676_3806432_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_000066829.1|3806513_3806777_+	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	95.4	4.2e-41
WP_001444023.1|3806912_3807233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233581.1|3807783_3807990_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	82.4	1.8e-26
WP_000995439.1|3808065_3808362_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_001427106.1|3808367_3809153_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.8e-148
WP_000611716.1|3809149_3809830_+	exonuclease	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000149544.1|3809826_3810009_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000548537.1|3809981_3810173_+	DUF1382 domain-containing protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001443983.1|3810183_3810465_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000763390.1|3810563_3810782_+	conjugal transfer protein TraR	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
WP_000488407.1|3810829_3811108_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000446905.1|3811079_3811451_+	DNA-binding protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000051902.1|3811306_3812470_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
3812484:3812530	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 14
NZ_CP027313	Escherichia coli strain 2014C-3550 chromosome, complete genome	5549395	4579722	4672741	5549395	tRNA,tail,protease,integrase,transposase,plate,head	Shigella_phage(33.33%)	110	4659396:4659411	4677157:4677172
WP_000416407.1|4579722_4582578_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786398.1|4582577_4583021_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|4583374_4584886_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584109.1|4585152_4586253_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|4586252_4587335_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001332879.1|4587453_4588956_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	2.1e-84
WP_000061768.1|4589085_4590105_-	aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.9e-44
WP_032276965.1|4590548_4591811_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	40.3	2.8e-74
WP_032276966.1|4592054_4592894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000091133.1|4593032_4594619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071531536.1|4594827_4594947_-	copper resistance protein	NA	NA	NA	NA	NA
WP_001339397.1|4594908_4595586_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|4595585_4595933_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|4595952_4597524_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001185332.1|4597833_4598106_-	transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	46.9	8.3e-08
WP_000991130.1|4598107_4598662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214377.1|4598658_4599411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001084853.1|4600325_4600586_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	67.5	4.6e-24
WP_000761643.1|4600582_4601131_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	64.8	5.9e-29
WP_001014979.1|4601130_4601355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000842358.1|4601351_4601675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016235.1|4601689_4604023_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.8	0.0e+00
WP_000594911.1|4604928_4605753_+	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
WP_000227281.1|4605801_4606374_-	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_001333167.1|4607571_4607985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|4608542_4609310_-	Fe(3+) dicitrate transport ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|4609310_4610267_-	Fe3+ dicitrate ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000125190.1|4610263_4611262_-	iron ABC transporter	NA	NA	NA	NA	NA
WP_000879164.1|4611258_4612161_-	Fe(3+)-dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000188267.1|4612205_4614530_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_001068905.1|4614616_4615570_-	protein FecR	NA	NA	NA	NA	NA
WP_001283626.1|4615566_4616088_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_000555341.1|4617838_4618096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937735.1|4618258_4618450_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.4e-06
WP_000339850.1|4618813_4620187_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000998019.1|4620425_4621811_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000612591.1|4621860_4622208_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_024182357.1|4622204_4622585_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	98.4	7.9e-65
WP_001331630.1|4622703_4622940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001701448.1|4622939_4623461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271003.1|4623361_4623763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077249732.1|4623928_4624534_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000381395.1|4625237_4626809_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|4626828_4627176_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|4627175_4627853_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_077628548.1|4627814_4627928_+	copper resistance protein	NA	NA	NA	NA	NA
WP_001084271.1|4627920_4628061_-	hemolysin activation protein	NA	NA	NA	NA	NA
WP_000528254.1|4628907_4629645_-	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	79.0	7.5e-104
WP_001444515.1|4629598_4629799_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_010917877.1|4630066_4630378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001114104.1|4630416_4630662_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000144787.1|4630697_4630880_-	DUF1378 domain-containing protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_010917876.1|4631026_4633066_-	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000904930.1|4633165_4633726_-	DNA invertase	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_071526725.1|4633739_4633925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010917875.1|4633947_4634151_+|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000420351.1|4634230_4634752_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_000469162.1|4634786_4635698_-|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000301577.1|4635697_4636258_-	DUF2313 domain-containing protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_001303989.1|4636248_4637334_-	hypothetical protein	NA	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000763330.1|4637330_4637768_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_000980532.1|4637760_4638375_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000098807.1|4638364_4639489_-|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_010917874.1|4639472_4640843_-	DMT family permease	NA	C9DGQ2	Escherichia_phage	33.1	1.0e-53
WP_000113523.1|4640808_4642884_-|tail	tail tape measure protein	tail	A0A0C4UQU8	Shigella_phage	37.7	3.7e-71
WP_000213225.1|4643010_4643487_-	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000015473.1|4643501_4643867_-|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000606747.1|4643875_4645378_-|tail	tail protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000848437.1|4645374_4645620_-	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000627431.1|4645620_4646181_-	DUF1834 domain-containing protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_001104956.1|4646177_4646597_-	DUF1320 domain-containing protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_001002057.1|4646593_4646980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001142982.1|4647023_4647971_-|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_000850822.1|4647970_4649095_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.9	2.9e-78
WP_000094808.1|4649271_4649745_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	54.6	2.7e-38
WP_000046901.1|4649866_4651198_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.8	3.9e-151
WP_000532592.1|4651181_4652771_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	1.4e-168
WP_001057665.1|4652770_4654435_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	8.1e-231
WP_000360581.1|4654434_4655016_-	DUF3486 domain-containing protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001279082.1|4655018_4655309_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	4.7e-25
WP_000270159.1|4655305_4655614_-	DUF2730 domain-containing protein	NA	NA	NA	NA	NA
WP_000342747.1|4655594_4655822_-	conjugal transfer protein TraR	NA	NA	NA	NA	NA
WP_010917872.1|4655831_4656278_-	hypothetical protein	NA	B6SD19	Bacteriophage	48.0	1.2e-11
WP_001125304.1|4656496_4656997_-	endolysin	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_000852377.1|4657068_4657494_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001214366.1|4657563_4658073_-	DUF1018 domain-containing protein	NA	A0A0C4UQU3	Shigella_phage	41.9	1.1e-26
WP_000378480.1|4658069_4658366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086886.1|4658355_4658553_-	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_001310453.1|4658545_4658878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310341.1|4658893_4659244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633440.1|4659258_4659570_-	hypothetical protein	NA	NA	NA	NA	NA
4659396:4659411	attL	ACTGAACAATCAGCAC	NA	NA	NA	NA
WP_000973023.1|4659566_4660118_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000465562.1|4660121_4660637_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
WP_000578573.1|4660636_4661170_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	66.7	5.9e-66
WP_000323221.1|4661173_4661716_-	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	2.9e-28
WP_001129553.1|4661813_4662344_-	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000049306.1|4662355_4662649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049432.1|4662653_4662926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|4662922_4663204_-	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_001057199.1|4663205_4663460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000257930.1|4663472_4663694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000129790.1|4663696_4664629_-|transposase	transposase	transposase	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_001512118.1|4664700_4666791_-|integrase	integrase	integrase	A0A2D1GNK9	Pseudomonas_phage	47.4	4.0e-166
WP_001310454.1|4666792_4667041_-	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_001056416.1|4667208_4667793_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	39.8	4.2e-17
WP_106918856.1|4668047_4668299_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000839179.1|4668748_4669153_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|4669149_4669497_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099160.1|4669545_4671084_+|transposase	IS66 family transposase ISEc22	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_001162171.1|4671388_4672741_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
4677157:4677172	attR	ACTGAACAATCAGCAC	NA	NA	NA	NA
>prophage 15
NZ_CP027313	Escherichia coli strain 2014C-3550 chromosome, complete genome	5549395	5443851	5508226	5549395	capsid,tRNA,portal,tail,lysis,holin,integrase,transposase,terminase,plate,head	Escherichia_phage(60.47%)	74	5476889:5476935	5508338:5508384
WP_000560983.1|5443851_5444289_+|tRNA	D-aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_000080791.1|5444285_5445275_+	acetyltransferase	NA	NA	NA	NA	NA
WP_001162704.1|5445338_5446247_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000897305.1|5446475_5446787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356397.1|5446787_5447078_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001452667.1|5447688_5447901_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001375482.1|5448143_5448362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000399648.1|5448590_5449571_-|transposase	IS110 family transposase IS621	transposase	NA	NA	NA	NA
WP_024203112.1|5449562_5449823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027708.1|5449970_5450900_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829008.1|5450896_5451532_-	formate dehydrogenase cytochrome b556(fdo) subunit	NA	NA	NA	NA	NA
WP_000331377.1|5451528_5452431_-	formate dehydrogenase-O iron-sulfur subunit	NA	NA	NA	NA	NA
WP_011310337.1|5452443_5455494_-	formate dehydrogenase O subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_001297067.1|5455497_5455752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000753589.1|5455687_5456521_+	sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_001298963.1|5456673_5457714_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_000931345.1|5457763_5459512_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_001019489.1|5459511_5460582_-	peptidase	NA	NA	NA	NA	NA
WP_000446023.1|5460571_5462023_-	fructose-like PTS system EIIBC component	NA	NA	NA	NA	NA
WP_000729592.1|5462033_5462480_-	PTS fructose transporter subunit EIIA	NA	NA	NA	NA	NA
WP_000619503.1|5462792_5463107_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_000009269.1|5463103_5464252_-	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_001179751.1|5464323_5465148_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_032277158.1|5465230_5466490_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144123.1|5466486_5467956_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_001369519.1|5469064_5470003_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063496.1|5469999_5471034_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001297064.1|5471318_5471939_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001314327.1|5472113_5472221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001166063.1|5472198_5473182_+	2-keto-3-deoxygluconate permease	NA	NA	NA	NA	NA
WP_001270270.1|5473330_5474005_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|5474146_5475520_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|5475516_5476215_-	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|5476364_5476865_+	periplasmic protein CpxP	NA	NA	NA	NA	NA
5476889:5476935	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000985246.1|5477051_5478032_-|integrase	integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_000777029.1|5478101_5478395_-	transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_001308179.1|5478531_5478804_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000217670.1|5478973_5479474_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|5479537_5479762_+	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277952.1|5479761_5480064_+	hypothetical protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	2.5e-45
WP_001113270.1|5480063_5480288_+	hypothetical protein	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_000027659.1|5480284_5480560_+	hypothetical protein	NA	A0A0F7LCM4	Escherichia_phage	100.0	2.3e-45
WP_032277160.1|5480549_5482826_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.9	0.0e+00
WP_001143636.1|5483026_5483971_+	DNA (cytosine-5-)-methyltransferase	NA	Q7Y4B5	Escherichia_virus	76.1	2.5e-144
WP_000142509.1|5483978_5484968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000559725.1|5484957_5486079_-	hypothetical protein	NA	Q858T2	Yersinia_virus	62.2	1.2e-97
WP_000038159.1|5486493_5487528_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.4	2.1e-200
WP_032277161.1|5487527_5489300_-	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_016237183.1|5489473_5490328_+|capsid	capsid scaffolding protein	capsid	Q94MK3	Enterobacteria_phage	99.6	5.6e-135
WP_016242816.1|5490386_5491460_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.2	4.3e-201
WP_032277162.1|5491463_5492207_+|terminase	terminase	terminase	A0A0F7LBP7	Escherichia_phage	96.8	1.8e-121
WP_000988633.1|5492306_5492816_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_032277163.1|5492815_5493019_+|tail	tail protein X	tail	M1RZ22	Escherichia_phage	97.0	9.8e-30
WP_000123124.1|5493022_5493304_+|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001144101.1|5493303_5493801_+	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_032277164.1|5493815_5494241_+	hypothetical protein	NA	Q858W1	Yersinia_virus	88.7	4.2e-59
WP_021548485.1|5494228_5494654_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	95.0	1.2e-64
WP_001440152.1|5494625_5494799_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000917189.1|5494761_5495229_+|tail	tail fiber protein	tail	U5N0S7	Enterobacteria_phage	98.1	2.5e-81
WP_028985812.1|5495221_5495674_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	1.4e-76
WP_032277166.1|5495740_5496376_+|plate	phage baseplate assembly protein V	plate	A0A0F7LBP2	Escherichia_phage	98.1	4.2e-111
WP_032277167.1|5496372_5496720_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	99.1	8.5e-58
WP_001121474.1|5496724_5497633_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
WP_001285337.1|5497625_5498237_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	4.9e-117
WP_000376436.1|5499423_5499843_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	55.8	1.7e-36
WP_000905108.1|5500970_5501564_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	96.4	8.7e-103
WP_001286716.1|5501623_5502814_+|tail	tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_001251408.1|5502826_5503345_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031312.1|5503401_5503677_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|5503709_5503829_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_032277172.1|5503821_5506269_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	93.1	0.0e+00
WP_000978890.1|5506283_5506763_+|tail	tail assembly protein	tail	O64315	Escherichia_phage	99.4	1.1e-84
WP_032277174.1|5506762_5507926_+	phage late control D family protein	NA	M1SV93	Escherichia_phage	99.2	1.4e-205
WP_001218608.1|5507971_5508226_+	transcriptional regulator	NA	M1SNR2	Escherichia_phage	100.0	1.3e-44
5508338:5508384	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
>prophage 1
NZ_CP027315	Escherichia coli strain 2014C-3550 plasmid unnamed2, complete sequence	88840	8993	75115	88840	protease,transposase,integrase	Stx2-converting_phage(63.16%)	49	14101:14160	41819:44524
WP_001034100.1|8993_12896_-|protease	serine protease EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_096852301.1|13833_14178_-	DUF1449 domain-containing protein	NA	NA	NA	NA	NA
14101:14160	attL	CGTAAGCGCCCCATCTGCGACGTCTTGTGAAAATTGTCCTGTCTGGCAACAATCGCGCCC	NA	NA	NA	NA
WP_001341423.1|14183_14858_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|14854_15202_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_012917687.1|15205_16774_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
WP_000937603.1|17052_18240_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000091308.1|18239_18605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612591.1|18841_19189_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_012917688.1|19238_20777_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.8	1.9e-295
WP_012680945.1|21080_22079_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000550559.1|22152_23874_-	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000975743.1|23967_25074_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_001302199.1|25073_25895_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_071525077.1|26495_26675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000520917.1|28567_29059_+	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_000217745.1|29060_32057_+	enterohemolysin	NA	NA	NA	NA	NA
WP_000987096.1|32106_34227_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	30.2	1.6e-45
WP_001213545.1|34230_35670_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000864810.1|36082_36436_-	colicin M immunity protein	NA	NA	NA	NA	NA
WP_032277352.1|36608_37391_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	96.4	5.8e-54
WP_000465041.1|37392_37806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012680949.1|37919_38114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012680950.1|38074_38278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077248527.1|38250_38388_+	toxin-antitoxin system, antitoxin component, AbrB family protein	NA	NA	NA	NA	NA
WP_001261287.1|38365_38596_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044768.1|38592_39009_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_001165114.1|39170_39716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000704534.1|40473_41334_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.3e-09
WP_001066949.1|41461_41848_+	recombinase	NA	NA	NA	NA	NA
WP_001341423.1|41901_42576_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|42572_42920_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_012917687.1|42923_44492_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
WP_001368562.1|45038_45188_-	hypothetical protein	NA	NA	NA	NA	NA
41819:44524	attR	CGTAAGCGCCCCATCTGCGACGTCTTGTGAAAATTGTCCTGTCTGGCAACAATCGCGCCCATCTATATAGATGGACACGAACGATGAATTCCCAGACAAAAAAAGATATTCCCTGCTTCCGTTCTTATTTGCCTGATGCTCTGCGTTTAAGATTTGAAGATAAACTGACCATCCGGGCCATCGCTCAGCGTCTAGGTCTCAGTCATTCCACAATACATACGCTTTTTCAGCGATTTATTGCATCCGGTATCGCATGGCCATTGCCCGATTCAGTTTCATTAGCTCAGCTTGATGCCATCCTTTATGCCAACAGAAAGAAGGAATTAACAGAGCCTCAAATCAGCGAAGGCACATGGCGAAAAGAACGGCGAGCCAGCTACAGCCGTGAATTTAAGGTCCGTCTGGCTAAGCAGGCATTACAGCCCGGTGCTGTTGTTGCCCGGATCGCCAGAGAGCACGGTATCAATGATAACCTGCTGTTTAAATGGAAAAGCCAGTACGAGGACGGCTTACTGAGCGATGATGACATACAGGAATGCATGCCTGTCCCGGTGGCTCTGACTGATACGCCAGAGCCGACCAGACCAGTTACAAATCCCTTCTGGCGTAACAAGCCTGATGAGTGCCCTGAGAGTGATCCCGGAAACGTCCCACGGTGCGAGCTGCATCTTAAATCAGGTGTGGTAAAACTGTTTGACCCTCTCACTCCGGAAATGTTACGGGCGCTAATCCGCGAAATGAAAGGAGGTACCCGATGATAACGCTGCCAACCGGTACCAGAATCTGGATCATCGCTGGCATCACAGATATGCGTTGTGGCTTCAACGGCCTGGCTTCGAAGGTGCAGAACACGCTGAAAGATGACCCGTTCTCCGGGCATATCTTCGTCTTCCGGGGCCGCAGTGGCAAAATGGTGAAAATACTGTGGGCCGATCGTGACGGGTTATGCCTGTTCGCCAAACGCCTGGAACGGGGCCGCTTCGTCTGGCCGGTAACCCGGGAAGGGAAAGTGCACCTGACGCCAGCTCAGTTATCCATGCTACTGGAGGGGATCGCGTGGCAACATCCCAAACGGACAGAACGGCCTGGCATCCGGATATAACCCGTGATAAAACAGGGGAATGAACAACACACTCCCCGACGACATCGAGCAACTGAAGGCCCTGCTGATCGCACAGCAGGCTGTTATCGTCTGTCTGGTGAAATAACCGGCTATGCCCGCGAGATCAGCTCACTCAGAGCGCTGGTCGCTAAACTGCAGAGAATGTTGTTCGGTCGCAGCAGCGAGAAAAGCCGCGAGAAGATAGAAAAGAAGATCGCACGGGCAGAAACGCGTATAACCGAGCTCCAGAACAGGCTTGGTGAGGCGCAGTTGCAACTCACCTCAATGGCCGGAGAGACAGCGCCGAAAACATCAGACTCTCCCGTCCGCAAAGCACTTCCGGCAACACTTCCCCGTGACAGGCAGGTTATCTCCCCGGCAGAAACCGAATGCCCCGTCTGCAGCGGCAAACTGAAACCGCTGGGAGAAAGCATCTCTGAACAACTGGATATCATCAACACCGCGTTCAGGGTAATCGAAACGGTTCGCCCAAAACTGGCCTGCAGCCGGTGCGACTGTATAGTTCAGGCTCCGCAGCCACCAAAACCCATCGAGCGCAGTTACGCCAGTCCGGCTCTGCTGGCCCGCATAATCATGGCTAAGTTCGCCGAGCATCTGCCGCTGTACCGTCAGTCGGAAATCTATGCCCGCCAGGGCGTGGAGCTGCACCGCAATACGATGGGGCGCTGGGTTGACATCATGGGAGAGCAGCTTCGCCCGCTGTATGATGAACTGAAGCACTATGTGCTGATGGCGGGTAAAGTGCATGCCGATGACACGCCGGTAAATGTACTGGAGCCGGGTCAGGGTAAAACCCGTACCGGACGGCTGTGGGTCTATGTTCGTGACGATCGCAACGCCGGTTCGACCATGCCGGCAGCGGTGTGGTTCTCATACTCTCCCGACCGCAAAGGCATCCACCCACAGCAACATCTGGCGGACTACAGAGGTATCCTGCAGGCCGATGCATATGCGGGTTACAATGCTCTTTACGAAAGCGGTCAGGTAACCGAAGCGGCTTGTATGGCACATGCCCGACGCAAGATCCACGATGTACATGTCCGCCATCCAACGACAGTAACGGGAGAAGCGCTCCGTCGTATCGGGGAACTGTACGCTATCGAGGCTGAGATCCGCGGCAGTCCGGCAGAAGAGCGACTGGCGGTCAGAAAAGCCAGAACGGTACCGCTAATGCAGTCGTTGTATGAGTGGCTCCAGGGGCAGATGAGCACGCTGTCGCGCCACTCGGATACAGCGAAAGCGTTCACCTATCTGCTGAAGCAATGGGACGCTCTGAACGAATACTGCCGCAATGGCTGGGTGGAGATCGACAATAACCTGTGTGAAAACGCCCTCCGGGTAGTTGCACTGGGGCGGCGTAACTACATGTTCTTCGGCTCTGATGGTGGAGGCGAGAGTGCGGCAGTGATGTACAGCCTGATCGGTAGCTGCAAACTTAACGGAATCGAGCCGGAAACGTGGCTACGCCACGTGATCAGTGTAATCAACACCTGGCCTGCCAACCGCGTGAAAGAGTTGTTGCCCTGGAATGTCACTCAATCTGTAAACTAATTTTTACCCCACGTCCTTCACGGTGCGCTTAC	NA	NA	NA	NA
WP_000154135.1|45151_45817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000335839.1|45957_46599_-	transcription termination factor NusG	NA	NA	NA	NA	NA
WP_071527584.1|46885_47116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012917679.1|47223_47313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907857.1|47300_48332_+	replication initiation protein	NA	NA	NA	NA	NA
WP_001443774.1|58905_59136_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000422675.1|62262_62739_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	90.7	3.0e-45
WP_000937603.1|66709_67897_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000091308.1|67896_68262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000499131.1|68189_68573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012917687.1|69085_70654_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
WP_000631725.1|70657_71005_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|71001_71676_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001341442.1|71729_71957_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	6.2e-33
WP_000361610.1|72119_73097_-	repFIB replication protein A	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_085953785.1|73902_75115_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	2.5e-168
>prophage 1
NZ_CP027316	Escherichia coli strain 2014C-3550 plasmid unnamed3, complete sequence	179514	61321	136751	179514	protease,portal,tail,lysis,holin,head,tRNA,integrase,capsid,terminase	Enterobacteria_phage(22.22%)	91	54049:54062	70872:70885
54049:54062	attL	TGGTATGCAGTAAC	NA	NA	NA	NA
WP_000113674.1|61321_62452_-|integrase	integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|62429_62678_-	excisionase	NA	NA	NA	NA	NA
WP_000048478.1|62742_65214_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000199480.1|65309_65498_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
WP_000449172.1|65494_65683_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_032277386.1|66243_66477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|66885_67104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|67176_67476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|67740_68148_-	transcriptional regulator	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|68224_68452_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705622.1|68435_68987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001183995.1|69787_70453_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.9e-85
WP_001449026.1|72079_72838_+	accessory colonization factor AcfC	NA	NA	NA	NA	NA
70872:70885	attR	GTTACTGCATACCA	NA	NA	NA	NA
WP_000961821.1|73116_73329_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001217394.1|73549_73807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|73876_74155_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001265290.1|74156_75212_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	4.9e-88
WP_000140002.1|75212_75578_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_032284729.1|75574_76264_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	5.3e-59
WP_071526446.1|76294_76441_+	antiterminator	NA	NA	NA	NA	NA
WP_100009362.1|76724_76928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000023141.1|77789_79643_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	96.6	0.0e+00
WP_000284522.1|79792_80008_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000731221.1|80012_80357_+	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000992092.1|80407_80941_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.9	2.5e-101
WP_001056806.1|81211_81781_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_001082691.1|81934_82402_+|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	95.5	1.6e-75
WP_000735655.1|82425_82650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303918.1|82646_82865_+	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	73.3	6.4e-11
WP_000347013.1|83006_83147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001428130.1|83276_83462_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	92.3	1.3e-20
WP_000829192.1|83503_83869_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000958380.1|84157_84721_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_033800465.1|84717_86379_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.3	0.0e+00
WP_106918828.1|86442_88221_+|capsid	phage major capsid protein	capsid	A0A0P0ZE40	Stx2-converting_phage	90.7	0.0e+00
WP_001063025.1|88265_88487_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|91013_91340_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|91350_91701_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|91697_92144_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|92140_92485_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000710952.1|93280_93655_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_106918864.1|94011_97254_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.6	0.0e+00
WP_000807940.1|97246_97588_+|tail	tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_001335877.1|97587_98286_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_001405642.1|98296_99040_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	5.6e-147
WP_106918825.1|98937_99618_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.8	1.6e-113
WP_001216290.1|103408_104032_+	membrane protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_106918865.1|104097_105411_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	2.8e-77
WP_001023435.1|105412_105682_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	97.8	2.4e-44
WP_000741395.1|105861_106371_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.7	3.3e-50
WP_001118085.1|106661_107243_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_012816780.1|107310_107946_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_001299273.1|108073_109132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001144080.1|109206_109857_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	42.0	6.6e-27
WP_001132165.1|110039_110630_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_000799399.1|110903_111767_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|111750_112887_-	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_001299275.1|112865_113081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000359438.1|113136_114366_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|114511_115633_-	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
WP_000085269.1|115881_117111_+	DUF4102 domain-containing protein	NA	A0A2H4JB45	uncultured_Caudovirales_phage	55.6	1.1e-131
WP_000953274.1|117475_117664_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	1.5e-13
WP_001502337.1|117716_118994_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000076671.1|118990_119221_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	49.1	4.5e-07
WP_000336141.1|119210_119435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551751.1|119427_119793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204070.1|119785_120007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204967.1|120008_120242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770163.1|120247_120547_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833614.1|120543_121941_+	DNA primase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.0	4.3e-116
WP_001080642.1|122143_122395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001368652.1|122508_122697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126670.1|122706_123117_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233311.1|123129_123402_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001427289.1|123358_123487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000951697.1|123449_123752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001137338.1|124043_125201_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.6	8.1e-137
WP_000504047.1|125240_125813_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.6e-61
WP_000267608.1|125814_127026_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.5	1.9e-189
WP_001020669.1|127022_127361_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	53.6	1.7e-31
WP_000134114.1|127357_127654_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	2.4e-32
WP_001145906.1|127653_128094_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	73.3	1.9e-62
WP_001005703.1|128086_128260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113646.1|128382_128739_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	80.5	3.6e-51
WP_000127884.1|128722_130384_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.2	2.2e-276
WP_000133415.1|130397_130679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735412.1|131294_132755_-	sensor protein PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|132754_133426_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|133593_134964_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|134967_135609_-	lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|135644_136751_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
