The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027351	Escherichia coli strain 2014C-3655 chromosome, complete genome	5442537	780071	834110	5442537	portal,integrase,tail,transposase,terminase,holin,capsid,tRNA,head	Enterobacteria_phage(37.29%)	62	793531:793545	834712:834726
WP_001093921.1|780071_780353_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	95.7	4.1e-42
WP_096910863.1|780433_781646_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
WP_001061339.1|781702_782275_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.9	6.7e-108
WP_001094871.1|782274_783009_-	DUF551 domain-containing protein	NA	S5MC19	Escherichia_phage	98.8	1.4e-139
WP_001014294.1|783011_783203_-	hypothetical protein	NA	G9L660	Escherichia_phage	100.0	9.5e-27
WP_000829413.1|783204_783672_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	72.1	1.1e-36
WP_000145671.1|783818_784292_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	75.5	4.0e-66
WP_001242740.1|784288_784639_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|784629_785166_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_085948186.1|785817_786973_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000135680.1|787450_787813_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000981537.1|788270_788924_-	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	60.8	5.7e-71
WP_001231956.1|789019_789217_+	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	56.9	1.1e-14
WP_000514175.1|789244_789829_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.3	2.1e-56
WP_001087349.1|789825_790992_+	peptidase	NA	A0A1C9IHV9	Salmonella_phage	61.1	3.6e-116
WP_000626861.1|790988_791183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000061545.1|791400_792225_+	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	78.4	1.2e-89
WP_000988265.1|792235_793135_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	94.8	8.8e-139
WP_000203855.1|793131_794532_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.2	6.4e-245
793531:793545	attL	CTGAAGGATGCGCAG	NA	NA	NA	NA
WP_001370224.1|794528_794786_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	71.1	9.5e-22
WP_001370152.1|794837_795827_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	2.3e-193
WP_085947772.1|796265_797478_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_001339373.1|798163_798316_+	restriction endonuclease subunit M	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
WP_000143128.1|799138_801001_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	95.5	0.0e+00
WP_000284522.1|801150_801366_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000731221.1|801370_801715_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000992088.1|801765_802299_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_001056806.1|802569_803139_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|803138_803285_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|803507_803693_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|804218_804533_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|804614_804839_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|805225_805771_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_106914003.1|805745_807671_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.3	0.0e+00
WP_000198151.1|807667_807880_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	95.7	1.6e-27
WP_044722349.1|807876_809478_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	3.2e-309
WP_032212710.1|809458_810778_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	2.6e-232
WP_001299443.1|810787_811120_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_024025845.1|811175_812201_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	9.9e-187
WP_000158902.1|812242_812638_+	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.6e-55
WP_000752996.1|812649_813003_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	1.5e-62
WP_024025847.1|813014_813593_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	6.6e-79
WP_106914004.1|813589_813985_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	93.1	5.7e-66
WP_000235098.1|813992_814745_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000479045.1|814758_815181_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000533440.1|815207_815621_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_032212771.1|815601_818214_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	87.8	0.0e+00
WP_000847401.1|818210_818540_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
WP_001299882.1|818539_819238_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	2.1e-132
WP_001370115.1|819243_819987_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	5.0e-148
WP_077696211.1|819932_820568_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	88.5	1.5e-97
WP_062903627.1|820803_824196_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	86.8	0.0e+00
WP_001230379.1|824262_824862_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.6e-110
WP_106914005.1|824926_826240_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.3	3.9e-79
WP_024174195.1|826241_826505_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	97.2	2.5e-33
WP_077633690.1|827689_827824_+|tail	phage tail protein	tail	A0A0N7BTS3	Escherichia_phage	100.0	2.6e-07
WP_001370116.1|828235_828841_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.5	1.8e-111
WP_001121225.1|829065_829716_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_085948186.1|829972_831129_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001217539.1|831576_831825_-	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000332271.1|831886_832984_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.7	9.5e-212
WP_000543822.1|833072_834110_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
834712:834726	attR	CTGCGCATCCTTCAG	NA	NA	NA	NA
>prophage 2
NZ_CP027351	Escherichia coli strain 2014C-3655 chromosome, complete genome	5442537	1195917	1231747	5442537	integrase,tail,transposase,terminase,holin	Enterobacteria_phage(40.0%)	44	1192885:1192898	1202781:1202794
1192885:1192898	attL	TTCTTCGCCTGGCG	NA	NA	NA	NA
WP_001218283.1|1195917_1197135_+|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	99.5	1.7e-238
WP_000206721.1|1199701_1200322_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	92.7	3.6e-115
WP_001242716.1|1200321_1200684_-	hypothetical protein	NA	K7PH61	Enterobacteria_phage	98.3	5.8e-65
WP_000008189.1|1200674_1201211_-	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	98.9	4.8e-100
WP_001311077.1|1202131_1202824_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	2.9e-121
1202781:1202794	attR	TTCTTCGCCTGGCG	NA	NA	NA	NA
WP_001191671.1|1202921_1203182_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	98.8	1.2e-40
WP_000515839.1|1203174_1203726_+	hypothetical protein	NA	A0A0P0ZE62	Stx2-converting_phage	98.9	2.2e-100
WP_001087356.1|1203722_1204871_+	peptidase	NA	K7PLX4	Enterobacteria_phage	86.9	7.2e-178
WP_000620698.1|1204867_1205092_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	2.8e-38
WP_024025783.1|1205902_1206397_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.8	4.3e-87
WP_000066917.1|1206396_1207050_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210170.1|1207046_1207373_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000767113.1|1207369_1207759_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061444.1|1207778_1208588_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_001223334.1|1208603_1209119_+	hypothetical protein	NA	V5URU3	Shigella_phage	28.7	4.6e-15
WP_001299344.1|1209128_1210118_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.2e-194
WP_001205460.1|1210135_1210477_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001131907.1|1210489_1211038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000868396.1|1211024_1211951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917724.1|1212215_1212419_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000799669.1|1212569_1213628_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	86.7	2.9e-181
WP_001370417.1|1214070_1214502_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	99.3	3.5e-69
WP_000216636.1|1214498_1214666_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	74.5	1.1e-10
WP_032212796.1|1215073_1216924_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.8	0.0e+00
WP_085948186.1|1217046_1218202_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000411802.1|1218637_1218844_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_032212794.1|1218843_1219341_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	3.8e-91
WP_001208681.1|1219557_1219743_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_001303878.1|1220270_1220585_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000074669.1|1220666_1220891_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303046.1|1220932_1221298_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_077760350.1|1221588_1221990_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	97.7	5.6e-61
WP_085947772.1|1221982_1223196_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_001130973.1|1223221_1223917_+	hypothetical protein	NA	Q6H9T2	Enterobacteria_phage	99.6	8.6e-126
WP_001216289.1|1223984_1224608_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	2.5e-68
WP_032212792.1|1224672_1225863_+|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	95.5	4.8e-76
WP_001023428.1|1225864_1226134_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	98.9	2.4e-44
WP_001118085.1|1226244_1226826_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_077633702.1|1226893_1227523_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	8.7e-77
WP_001143789.1|1227604_1228246_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	98.6	1.4e-106
WP_001217539.1|1228406_1228655_-	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000202564.1|1228874_1230461_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|1230853_1231459_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|1231585_1231747_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 3
NZ_CP027351	Escherichia coli strain 2014C-3655 chromosome, complete genome	5442537	1783617	1881285	5442537	portal,integrase,tail,transposase,terminase,tRNA,capsid,head,protease	Enterobacteria_phage(45.0%)	88	1840412:1840458	1872759:1872805
WP_000186631.1|1783617_1784097_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_000365135.1|1784300_1785095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001370330.1|1785232_1785574_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	9.3e-41
WP_000083976.1|1785788_1788293_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.1	1.4e-114
WP_032285565.1|1788554_1789487_+	glutaminase A	NA	NA	NA	NA	NA
WP_000982172.1|1789489_1790782_+	amino acid permease	NA	NA	NA	NA	NA
WP_001026747.1|1790906_1791314_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000970323.1|1791314_1791773_-	NfeD family protein	NA	NA	NA	NA	NA
WP_000904502.1|1791769_1792687_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_001157535.1|1792832_1793510_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
WP_001323739.1|1793496_1794276_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_001295322.1|1794338_1795193_-	chaperedoxin	NA	NA	NA	NA	NA
WP_000148959.1|1795253_1796063_-	NADP(+)-dependent aldehyde reductase	NA	NA	NA	NA	NA
WP_001295836.1|1796052_1796676_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|1796646_1797333_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561833.1|1797329_1799744_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014917.1|1800172_1804363_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	44.6	1.3e-22
WP_000879785.1|1804343_1804835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001158006.1|1805836_1806931_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|1806999_1807926_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776388.1|1808155_1808638_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|1808715_1809531_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001370296.1|1809620_1811402_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	26.8	6.0e-38
WP_000943556.1|1811414_1812191_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|1812290_1813169_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401125.1|1813337_1814792_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006887.1|1814851_1816213_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001370313.1|1816269_1817571_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001370319.1|1817592_1818738_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	4.1e-48
WP_000540996.1|1818965_1819751_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001370308.1|1819761_1820997_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703894.1|1821018_1822068_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580865.1|1822384_1824052_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495365.1|1824061_1825321_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_001325209.1|1825331_1826147_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855398.1|1826143_1827037_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815538.1|1827175_1828243_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|1828239_1828749_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212252.1|1828866_1829589_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000256002.1|1829591_1830086_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912345.1|1830259_1831645_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|1831680_1832202_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1832309_1832522_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|1832523_1833390_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776558.1|1833870_1834413_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_001370299.1|1835354_1837964_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691047.1|1837976_1838984_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001396973.1|1838994_1839510_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805418.1|1839512_1840145_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
1840412:1840458	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001370298.1|1840471_1841635_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	9.8e-199
WP_000446905.1|1841490_1841862_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000488407.1|1841833_1842112_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763385.1|1842159_1842378_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_001443983.1|1842476_1842758_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_087661054.1|1842814_1844027_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_029594360.1|1844085_1844610_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.7	2.2e-89
WP_106914003.1|1844584_1846510_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.3	0.0e+00
WP_000198151.1|1846506_1846719_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	95.7	1.6e-27
WP_001370283.1|1846715_1848317_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.2e-308
WP_000123282.1|1848297_1849617_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	95.7	6.3e-226
WP_001358596.1|1849626_1849959_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	1.4e-54
WP_024233962.1|1850013_1851039_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.2	3.3e-190
WP_000158902.1|1851080_1851476_+	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.6e-55
WP_000752996.1|1851487_1851841_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	1.5e-62
WP_032212787.1|1851852_1852431_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	86.5	2.3e-79
WP_024200945.1|1852427_1852823_+	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	99.2	5.0e-70
WP_001370356.1|1852830_1853571_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.2	5.0e-132
WP_000479147.1|1853586_1854009_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	1.9e-72
WP_000459457.1|1853990_1854425_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840238.1|1854417_1856979_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.7	0.0e+00
WP_000847371.1|1856975_1857305_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	93.6	2.1e-53
WP_001152565.1|1857304_1858003_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	3.6e-132
WP_000194780.1|1858008_1858752_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090891.1|1858688_1859321_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000515724.1|1859381_1862723_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.8	0.0e+00
WP_085947772.1|1862743_1863956_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_001230348.1|1864125_1864725_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_077633707.1|1866887_1867859_+|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	89.3	2.1e-37
WP_000885574.1|1867858_1868443_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	1.2e-101
WP_000239881.1|1868497_1869166_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937500.1|1869222_1869528_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226375.1|1869711_1871196_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|1871382_1872336_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177464.1|1872848_1873610_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
1872759:1872805	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224569.1|1873792_1874683_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_000662369.1|1874683_1877656_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383947.1|1877642_1879880_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420919.1|1880148_1881285_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP027351	Escherichia coli strain 2014C-3655 chromosome, complete genome	5442537	2221277	2235698	5442537	tRNA,transposase,protease	Stx2-converting_phage(30.0%)	12	NA	NA
WP_000188139.1|2221277_2223224_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|2223296_2223521_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|2223843_2224164_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|2224194_2226471_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001066422.1|2226596_2228153_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.0	8.3e-161
WP_000631725.1|2228172_2228520_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|2228516_2229191_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001040187.1|2229872_2230091_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|2230375_2231080_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202187.1|2231121_2232843_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.9e-21
WP_001043587.1|2232843_2234610_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_000537420.1|2234732_2235698_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
>prophage 5
NZ_CP027351	Escherichia coli strain 2014C-3655 chromosome, complete genome	5442537	2320555	2432645	5442537	portal,integrase,tail,transposase,terminase,holin,capsid,head,protease	Enterobacteria_phage(34.26%)	141	2340226:2340244	2388681:2388699
WP_000156526.1|2320555_2322316_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877158.1|2322501_2322954_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750419.1|2323028_2324081_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|2324437_2324947_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000841914.1|2325165_2325795_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875061.1|2325757_2327920_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|2327929_2328376_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001295354.1|2328498_2330553_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
WP_000424181.1|2330584_2331043_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|2331138_2331801_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|2331973_2332387_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|2332431_2332749_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|2332806_2333997_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048233.1|2334091_2334370_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|2334366_2334696_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375136.1|2334786_2335446_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
WP_001370339.1|2335853_2336873_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.4	2.9e-85
WP_000273151.1|2336850_2337093_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_032212635.1|2337160_2339596_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.7	2.7e-57
WP_001098749.1|2339676_2339880_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449182.1|2339882_2340065_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
2340226:2340244	attL	CACCGCATCACAAAATTCA	NA	NA	NA	NA
WP_000394568.1|2340810_2341200_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	39.3	1.9e-21
WP_000379585.1|2341211_2341364_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_000948459.1|2341679_2342156_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|2342279_2342576_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693884.1|2342598_2343024_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262384.1|2343095_2344166_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	62.2	8.2e-59
WP_001151153.1|2344206_2344629_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	1.1e-64
WP_001266134.1|2344625_2344922_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	3.4e-47
WP_001209480.1|2344918_2345380_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403777.1|2345357_2345714_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_000935420.1|2345764_2345977_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_042350895.1|2346062_2346227_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000224233.1|2346228_2346492_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000207986.1|2346502_2347372_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_001278454.1|2347487_2347592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902696.1|2347780_2347993_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
WP_001341388.1|2348160_2348439_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265133.1|2348440_2349490_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_000904103.1|2349502_2349862_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	1.8e-34
WP_000640048.1|2349870_2350401_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917767.1|2350642_2350840_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000024329.1|2350991_2352068_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	87.1	3.8e-181
WP_001443281.1|2352663_2352990_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	62.9	5.1e-36
WP_032212642.1|2353289_2355236_+	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	96.9	0.0e+00
WP_032210570.1|2355372_2355552_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	96.6	3.2e-24
WP_001290233.1|2355592_2355838_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	90.1	2.2e-15
WP_000284506.1|2355914_2356130_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087730.1|2356134_2356668_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	98.9	3.9e-102
WP_001056806.1|2356938_2357508_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2357507_2357654_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2357881_2358067_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000373410.1|2358543_2359020_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	99.4	9.5e-84
WP_001077625.1|2359016_2361140_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102415.1|2361136_2361349_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974564.1|2361348_2362851_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|2362795_2364820_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|2364907_2365234_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281348.1|2365226_2365508_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	100.0	2.1e-46
WP_000974958.1|2365510_2366134_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	100.0	8.9e-106
WP_000682716.1|2366146_2366545_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235098.1|2366552_2367305_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000479043.1|2367318_2367741_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532075.1|2367767_2368076_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_106875770.1|2368119_2370765_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.5	0.0e+00
WP_000847306.1|2370761_2371091_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001365123.1|2371090_2371789_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	98.7	1.8e-131
WP_032316709.1|2371799_2372543_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	96.7	8.0e-146
WP_077698919.1|2372488_2373121_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	95.7	1.6e-102
WP_106914013.1|2373369_2376846_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.9	0.0e+00
WP_106914014.1|2376912_2377512_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.0	1.7e-109
WP_106914015.1|2377570_2378659_+|tail	phage tail protein	tail	Q687E6	Enterobacteria_phage	100.0	6.4e-59
WP_096910863.1|2378710_2379923_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
WP_001023407.1|2380204_2380474_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_077631973.1|2380619_2380700_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.5e-07
WP_000938124.1|2382241_2383603_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	40.2	1.5e-49
WP_095585410.1|2383979_2384132_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.4	4.3e-14
WP_001299351.1|2384414_2385434_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|2385411_2385654_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034468.1|2385721_2388193_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	8.5e-59
WP_001098307.1|2388286_2388478_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|2388474_2388663_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|2389236_2389422_+	hypothetical protein	NA	NA	NA	NA	NA
2388681:2388699	attR	TGAATTTTGTGATGCGGTG	NA	NA	NA	NA
WP_000394511.1|2389608_2389998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|2390139_2390295_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|2390571_2390859_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|2390858_2391050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|2391077_2391479_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|2391587_2391860_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|2391843_2392269_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|2392475_2392931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072097015.1|2393009_2394134_+	DNA-binding protein	NA	V5URT9	Shigella_phage	68.4	2.2e-131
WP_000788752.1|2394130_2394871_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	85.0	2.0e-117
WP_000450862.1|2394896_2395667_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.6	3.7e-85
WP_001151233.1|2395682_2396096_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160651.1|2396447_2397221_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|2397586_2397724_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001013642.1|2397768_2397981_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_072145984.1|2398148_2398427_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265133.1|2398428_2399478_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_001217436.1|2399490_2399862_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|2399851_2400223_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265267.1|2400374_2401193_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917739.1|2401479_2401677_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	95.4	5.7e-27
WP_000261909.1|2401814_2402528_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000466957.1|2402975_2403407_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_153244796.1|2403756_2403900_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	97.4	3.7e-15
WP_032212763.1|2403885_2405823_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.7	0.0e+00
WP_000143462.1|2405958_2406138_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_001290231.1|2406178_2406451_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284518.1|2406527_2406743_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731198.1|2406747_2407092_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	1.4e-57
WP_000992152.1|2407142_2407676_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.0	6.2e-100
WP_012816791.1|2408194_2408380_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001302717.1|2408864_2409179_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|2409260_2409485_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_000235436.1|2409887_2410397_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001370721.1|2410368_2412297_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	1.8e-261
WP_000259002.1|2412280_2412487_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831794.1|2412483_2414076_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	2.1e-183
WP_001254023.1|2414065_2415571_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.8e-99
WP_000256807.1|2415607_2415955_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
WP_000522623.1|2416012_2417041_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000201512.1|2417092_2417476_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204559.1|2417468_2417822_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	67.5	3.3e-41
WP_000975030.1|2417836_2418370_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	5.0e-57
WP_000683065.1|2418366_2418762_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	6.7e-59
WP_001143019.1|2418769_2419522_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.2	1.4e-126
WP_000479115.1|2419535_2419967_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
WP_000533420.1|2419993_2420407_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	7.8e-42
WP_000847298.1|2422962_2423292_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_032212654.1|2423291_2423990_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.8	5.8e-130
WP_024174194.1|2423995_2424739_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	1.4e-142
WP_000090917.1|2424675_2425308_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_101329699.1|2425368_2428848_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
WP_001233099.1|2428915_2429515_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	97.0	1.1e-108
WP_106914016.1|2429579_2430899_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.7	9.1e-76
WP_001023455.1|2430900_2431170_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_000767049.1|2431391_2431934_+	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.0	9.3e-51
WP_106420821.1|2431878_2432073_+	hypothetical protein	NA	A0A2R2Z347	Escherichia_phage	84.6	4.1e-09
WP_001131653.1|2432063_2432645_+	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	64.2	5.1e-63
>prophage 6
NZ_CP027351	Escherichia coli strain 2014C-3655 chromosome, complete genome	5442537	2551723	2637535	5442537	integrase,tail,transposase,holin,head,protease	Stx2-converting_phage(28.57%)	114	2561156:2561215	2643770:2646479
WP_000074974.1|2551723_2552842_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	2.6e-84
WP_000003742.1|2552810_2553080_-	excisionase	NA	NA	NA	NA	NA
WP_000048560.1|2553141_2555613_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_000560212.1|2555736_2555958_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	82.2	4.3e-31
WP_001331716.1|2556363_2556528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2556670_2556970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2557322_2557601_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2557602_2557794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169687.1|2557814_2558186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2558283_2558586_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693944.1|2558582_2559008_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095671.1|2559030_2559993_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_001151187.1|2560033_2560456_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	3.9e-65
WP_000935423.1|2560561_2560774_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	97.1	5.6e-36
WP_000209148.1|2560806_2561025_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	91.7	5.2e-29
WP_001370098.1|2561026_2561185_+	hypothetical protein	NA	A0A220NQU8	Salmonella_phage	75.6	2.2e-13
2561156:2561215	attL	CGTAAGCGCACCGTGAAGGACGTGGGGTAAAAATTAGTTTACAGATTGAGTGACATTCCA	NA	NA	NA	NA
WP_001066422.1|2561188_2562745_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.0	8.3e-161
WP_000631725.1|2562764_2563112_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|2563108_2563783_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_136865621.1|2563788_2564007_+	hypothetical protein	NA	S4TNB5	Salmonella_phage	70.8	7.6e-12
WP_000208016.1|2564017_2564887_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	79.2	8.5e-123
WP_001278454.1|2565002_2565107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024174193.1|2565295_2565508_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	97.1	2.5e-28
WP_000756560.1|2565625_2565973_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	81.7	9.2e-44
WP_000046991.1|2566093_2566366_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.1	1.9e-12
WP_001265272.1|2566367_2567417_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.1e-108
WP_001121083.1|2567429_2567804_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.1	6.4e-35
WP_000762899.1|2567800_2568622_+	hypothetical protein	NA	K7P7B9	Enterobacteria_phage	61.9	8.2e-83
WP_000917750.1|2568847_2569045_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935558.1|2569195_2570254_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	90.1	3.8e-189
WP_001344632.1|2571140_2571272_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_032212668.1|2571714_2573565_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	97.1	0.0e+00
WP_000411804.1|2574011_2574218_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_106914017.1|2574262_2575476_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	1.1e-168
WP_000138558.1|2575786_2576059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003112.1|2576218_2576752_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	2.1e-100
WP_001208682.1|2577398_2577605_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|2577669_2577894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|2578250_2578391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032208049.1|2578520_2578634_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	85.7	2.9e-07
WP_000125984.1|2579389_2579716_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|2579726_2580077_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|2580073_2580520_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2580516_2580861_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275483.1|2580926_2581643_+|tail	tail protein	tail	B6DZA6	Enterobacteria_phage	99.6	2.1e-127
WP_000710949.1|2581657_2582032_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001453698.1|2582127_2582337_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212947.1|2582388_2585631_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.6	0.0e+00
WP_000807954.1|2585623_2585965_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_032212666.1|2585964_2586663_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_124983447.1|2587363_2587993_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	94.2	1.5e-97
WP_106914018.1|2588233_2591710_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	98.0	0.0e+00
WP_024174257.1|2591778_2592354_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	55.6	1.2e-59
WP_032212660.1|2592418_2593732_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.5	1.4e-79
WP_032212659.1|2593733_2594003_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	97.8	7.1e-44
WP_012817749.1|2594128_2594881_-	type III effector	NA	NA	NA	NA	NA
WP_001370123.1|2595996_2597115_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107384.1|2597111_2598905_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|2598923_2599631_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003671.1|2599627_2600215_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000063978.1|2600211_2600610_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000004899.1|2600606_2601464_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000263584.1|2601597_2603142_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000460789.1|2603153_2604290_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270305.1|2604302_2604395_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_001297112.1|2604474_2605773_+	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000208650.1|2605887_2608068_-	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_000057871.1|2608087_2608534_-	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_001295357.1|2608521_2609661_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000742335.1|2609706_2611803_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001038062.1|2611802_2612549_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_001247610.1|2612545_2613190_-	lipoprotein GfcB	NA	NA	NA	NA	NA
WP_001295358.1|2613296_2613602_-	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_000087763.1|2614043_2614256_-	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_000066490.1|2614541_2614754_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|2614764_2614953_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001309400.1|2614927_2615158_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|2615147_2615321_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818477.1|2615369_2616443_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001399304.1|2616514_2619259_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.2	4.6e-37
WP_000533662.1|2619353_2620427_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9G075	Enterobacteria_phage	99.7	1.3e-200
WP_001303849.1|2620404_2620623_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545745.1|2620662_2620830_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_000022062.1|2620918_2621200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208006.1|2621314_2622112_-	DUF550 domain-containing protein	NA	A0A075B8H2	Enterobacteria_phage	41.1	5.7e-49
WP_000582238.1|2622122_2622878_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	92.8	4.2e-142
WP_001289864.1|2622879_2623287_-	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	97.8	2.8e-68
WP_000763386.1|2623283_2623505_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	98.6	6.4e-35
WP_001443983.1|2623603_2623885_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000548546.1|2623895_2624087_-	DUF1382 family protein	NA	A0A0P0ZC49	Stx2-converting_phage	100.0	4.3e-27
WP_032204932.1|2624059_2624242_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	98.3	2.2e-28
WP_000186740.1|2624241_2624919_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100845.1|2624915_2625701_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000995439.1|2625706_2626003_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372922.1|2626057_2626222_-	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	96.3	9.3e-23
WP_001198859.1|2626190_2626355_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	98.1	9.0e-26
WP_001132915.1|2626427_2626796_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	96.7	1.1e-63
WP_000213975.1|2626981_2627182_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_072097037.1|2627930_2628386_-	antitermination protein	NA	J3JZZ6	Escherichia_phage	96.1	6.8e-63
WP_096910866.1|2628734_2629553_-	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	46.2	3.3e-36
WP_001274756.1|2629719_2630433_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000437875.1|2630533_2630734_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251069.1|2630852_2631146_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000185425.1|2631178_2632078_+	replication protein	NA	K7P7F0	Enterobacteria_phage	99.0	6.0e-172
WP_000788869.1|2632074_2632776_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145926.1|2632772_2633063_+	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_063077928.1|2633158_2633578_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	99.3	2.2e-76
WP_001254222.1|2633574_2633757_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	100.0	1.9e-29
WP_000566869.1|2633753_2633924_+	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	96.4	3.5e-25
WP_001108066.1|2633916_2634537_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	2.0e-94
WP_001028836.1|2634533_2635199_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	3.2e-130
WP_000750155.1|2635410_2636370_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|2636708_2636831_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097237.1|2636845_2637535_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
2643770:2646479	attR	TGGAATGTCACTCAATCTGTAAACTAATTTTTACCCCACGTCCTTCACGGTGCGCTTACGGATGTTGTCAAGATATTGTGTCATTTATAACCTGAATCAGGGGAGGCCGGAATGTTATCTGGCATTTTTAGCAGAGCCTGAATGCCATAATCACGGCTCCCGGCGTTGGCCGTCAGTGGGTGACACTGGCGGCTTTTTTGTTTTTCTTTACTTTCATTTTCTGTCGGCGGTGACGGAGACATACATCAGATGGAAAAAATCACAACAGGTGTGTCATACACCACGTCAGCGGTGGGGACGGGATACTGGTTACTGCAGCTGCTGGACAAAGTCTCTCCGTCCCAGTGGGTGGCAATAGGTGTGCTGGGAAGTCTGCTGTTTGGCCTGCTGACGTATCTGACAAACCTTTATTTCAAGATTAAAGAAGATAAGCGCAAGGCTGCGAGAGGTGAATAATGCCTCCATCATTACGAAAAGCCGTTGCTGCTGCTATTGGTGGTGGGGCTGTTGCCATAGCGTCTGTGCTCATCACTGGTCCGAGTGGTGACGATGGCCTGGAAGGTGTCAGCTACATACCATACGAAGATATCGTTGGCGTATGGACTGTATGTCACGGACACACCGGAAAAGACATCATGCCCGGTAAAACGTATACCGAAGCAGAATGCAAAGCCCTCCTGAATAAAGACCTTGCCACGGTCGCCAGACAAATAAACCCGTACATCAACGTCGATATACCGGAAACAACGCGCGGCGCTCTTTACTCGTTCGTTTACAACGTGGGCGCTGGCAATTTCAGAACATCGACGCTTCTTCGCAAAATAAACCAGGGCGATATCAAAGGCGCATGTGATCAGCTACGGCGCTGGACATACGCTGGCGGTAAGCAATGGAAAGGGCTGATGACTCGCCGTGAGATTGAGCGTGAAGTCTGTTTGTGGGGGCAACAATGAGCAGAGTAACCGCGATTATCTACGTTCTGGTCATCTGCCTCATCGTCTGCCTTTCATGGGCTGTTAATCATTACCGTGATAACGCCATCGCCTACAAAGAGCAGCGCGATAAAGCCACATCCATCATCGCTGATATGCAGAAGCGGCAACGTGATGTAGCAGAACTTGACGCCAGATACACAAAGGAGCTTGCTGATGCTAATGCGACTATCGAAAGTCTCCGTGCTGATGTTTCTGCTGGGCGTAAGCGCCTGCAAGTCTCCGCCACCTGTGCAAAGTCAACGACCGGAGCCAGCAGCATGGGCGATGGAGAAAGCCCAGGACTTACAGCAGATGCTGAACTCAATTATTACCGTCTCCGAGGTGGAATCGACAAGATAACCGCGCAGGTTAACTACCTGCAGGAATACATCAGGACGCAGTGCTTAAAATAATTTTAATTTCACTGAAATTTAACAAGTGACTTTCAGGAAAATGCCTCGCAGATGCGGGGCATTTTTGTACCGGTATTTCACCGCGCACCGCAGCGCACAATAAACACCGAACCTGACCCTTTGGAATGGGCCTTTGAGGATACCAGTTAGTGCTGGCGAGCCTCGGTGGGCTGGTTTCCTGTGCGGCAAAGGTTCATTTCAAAGAAGCAGGCAACGCCATGAATGAATTAATTGCGAATCATGACTTCGACTTTCGCCAGTTAGTTACCGCAGCAGAAGGTCAACCGGTAACTGACACCTTCCAGATTGCCAGGGCATTTGGTAAACGCCATCAGCATGTGATTAGGGCTATTAAATGTTTGAGATGTTCTGAGGAATTCTCGACAACCCATTTTTGGGCCGTCGAGAAAATCAATGACTTAGGTATTTTTGACAAGAAACAGATTTACTACCGCATGGACTTTAGTGGCTTCGTTATGCTGGTTATGGGATTTAACGGGGCAAAAGCCGATGCTGTTAAAGAAGCCTATATCAATGCGTTTAACTGGATGTCAGTAGAACTCCGTAAGTACAGCGAAAGTTATGAAGCAGAACGTAACGCCGTAATGCTGGAGTACATGAAAGAGAAGGATGTCGCCAGCATGTCAGGCCGTCTGCTCAATCGCTGGGGGAGAACGAAAAAACTCAATTGCTTGCAAAGCTGGAACGTCTGGAGAGACAGGGACAGTTTTTATTACCGGGATTCGATAAAGGTATTCAAGCCTGACACATTATGCGCTGTATCGTCGCCGTATTCCCGCATTAACCATGACCGTAGCCCGACGGGGAATTCCTTCTGCGTGAGTGTGCGGGAATAATCAAAAACGATGCACACCGGGTTTTACTGTGCTGACAGACGCAGGGTTACCCTCATAGTCGCTTTTCCGGTGCGATGGTGGAAGAAACCGGGATGTTCATCCATCATCACTTTGGATTGATGTATATGCTCTCTTTTCTGACGTTAGTCTCCGACGGCAGGCTTCAATGACCCAGGCTGAGAAATTCCCAGACCCTTTTTGCTCAAGAGCGATGTTAATTTGTTCAATCATTTGGTTAGGAAAGCGGATGTTGCGGGTTGTTGTTCTGCGGGTTCTGTTCTTCGTTGACATGAGGTTGCCCCGTATTCAGTGTCGCTGATTTGTATTGTCTGAAGTTGTTTTTACGTTAAGTTGACGCAGATCAATTAATACGATACCTGCGTCATAATTGATTATTTGACGTGGTTTGATGGCGTAGATGCACGTTGTGACATGTAGATGATAATTATTATCATTTTACGGGTCC	NA	NA	NA	NA
>prophage 7
NZ_CP027351	Escherichia coli strain 2014C-3655 chromosome, complete genome	5442537	2641201	2684815	5442537	portal,tail,lysis,transposase,terminase,holin,capsid,tRNA,head	Enterobacteria_phage(36.11%)	45	NA	NA
WP_001341423.1|2641201_2641876_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|2641872_2642220_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001066422.1|2642239_2643796_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.0	8.3e-161
WP_000411802.1|2644018_2644225_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_001135302.1|2644224_2644722_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.6	1.4e-90
WP_000092313.1|2644718_2645156_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	96.6	4.2e-70
WP_001307652.1|2646109_2646304_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_001429103.1|2646731_2647238_+	DNA-packaging protein	NA	O64316	Escherichia_phage	47.9	1.5e-34
WP_001299181.1|2647209_2649138_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	1.8e-261
WP_000259002.1|2649121_2649328_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831794.1|2649324_2650917_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	2.1e-183
WP_001254023.1|2650906_2652412_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.8e-99
WP_000256807.1|2652448_2652796_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
WP_106901544.1|2652911_2653883_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.8	1.6e-106
WP_000201512.1|2653934_2654318_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204559.1|2654310_2654664_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	67.5	3.3e-41
WP_000975030.1|2654678_2655212_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	5.0e-57
WP_000683065.1|2655208_2655604_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	6.7e-59
WP_001143019.1|2655611_2656364_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.2	1.4e-126
WP_000479115.1|2656377_2656809_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
WP_000533420.1|2656835_2657249_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	7.8e-42
WP_000082371.1|2657229_2659809_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.6	0.0e+00
WP_000847298.1|2659805_2660135_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_032212654.1|2660134_2660833_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.8	5.8e-130
WP_032212652.1|2660838_2661582_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	5.6e-147
WP_122994837.1|2661527_2662160_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	93.3	3.1e-98
WP_106914019.1|2662395_2665872_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	98.0	0.0e+00
WP_024174257.1|2665940_2666516_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	55.6	1.2e-59
WP_085948186.1|2667690_2668847_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001370649.1|2669162_2669432_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	98.9	1.4e-44
WP_001131642.1|2669545_2670121_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001118085.1|2670411_2670993_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_012816780.1|2671060_2671696_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_001299273.1|2671823_2672882_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144080.1|2672956_2673607_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132165.1|2673789_2674380_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_000799399.1|2674653_2675517_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531590.1|2675500_2676637_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.2	2.1e-28
WP_000359448.1|2676886_2678113_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|2678161_2679283_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000735415.1|2679358_2680819_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|2680818_2681490_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|2681657_2683028_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|2683031_2683673_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001370675.1|2683708_2684815_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP027351	Escherichia coli strain 2014C-3655 chromosome, complete genome	5442537	2792478	2803937	5442537	transposase	Escherichia_phage(50.0%)	17	NA	NA
WP_000394552.1|2792478_2792886_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_085948186.1|2792962_2794119_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001171901.1|2794175_2794394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|2794466_2794766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|2795030_2795438_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|2795514_2795742_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705623.1|2795725_2796277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|2796248_2797289_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157830737.1|2797200_2797743_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000450692.1|2797776_2798511_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.7	7.7e-109
WP_122368318.1|2798507_2798672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|2799370_2800129_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|2800407_2800620_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001217394.1|2800840_2801098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|2801167_2801446_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_106914021.1|2801447_2802440_+	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	47.3	5.6e-78
WP_085947772.1|2802724_2803937_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
>prophage 9
NZ_CP027351	Escherichia coli strain 2014C-3655 chromosome, complete genome	5442537	2908865	2995670	5442537	portal,integrase,tail,transposase,terminase,tRNA,holin,protease	Escherichia_phage(44.26%)	90	2909717:2909733	2998961:2998977
WP_000628065.1|2908865_2910098_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2909717:2909733	attL	GTTTTTTGCGCTGATAA	NA	NA	NA	NA
WP_000387388.1|2910352_2911336_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001296046.1|2911611_2911785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123758.1|2911814_2913188_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157421.1|2913316_2914252_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	2.2e-145
WP_000040852.1|2914303_2915539_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|2915540_2915756_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|2915834_2916044_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|2916036_2916231_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000595429.1|2916287_2917097_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	69.9	2.2e-104
WP_000102191.1|2917089_2919759_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	59.6	2.0e-194
WP_001427414.1|2919839_2920010_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
WP_000560223.1|2920009_2920231_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001169149.1|2920655_2920808_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	57.4	2.1e-08
WP_001253182.1|2921188_2921653_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	69.5	1.2e-54
WP_000171139.1|2921757_2922033_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	65.9	1.4e-23
WP_000702023.1|2922016_2922439_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	5.3e-70
WP_000899743.1|2922451_2923309_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	94.4	4.0e-80
WP_000788989.1|2923315_2924062_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	2.8e-114
WP_001370676.1|2924083_2924845_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	2.0e-120
WP_001151266.1|2924860_2925277_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	86.2	1.6e-58
WP_001275735.1|2925273_2925747_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	74.8	2.9e-64
WP_001204666.1|2926069_2926648_+	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	100.0	2.6e-104
WP_000156213.1|2926607_2927705_-	hypothetical protein	NA	A0A0U2S621	Escherichia_phage	99.7	9.5e-212
WP_085947598.1|2928258_2929421_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_000813257.1|2929523_2929679_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	4.2e-17
WP_000119356.1|2929890_2930070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000818166.1|2930088_2930574_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000940340.1|2931035_2931635_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	93.5	1.2e-107
WP_000228018.1|2931634_2931925_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	90.6	1.5e-47
WP_000640170.1|2931921_2932476_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.5	1.8e-70
WP_106914022.1|2934017_2935964_+	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	97.2	0.0e+00
WP_000142777.1|2936100_2936280_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.4e-24
WP_001290233.1|2936320_2936566_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	90.1	2.2e-15
WP_000284506.1|2936642_2936858_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087730.1|2936862_2937396_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	98.9	3.9e-102
WP_001056806.1|2937666_2938236_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2938235_2938382_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2938609_2938795_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348566.1|2939310_2939787_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	96.2	2.2e-80
WP_001077633.1|2939783_2941907_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.9	0.0e+00
WP_000102415.1|2941903_2942116_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974578.1|2942115_2943618_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	99.4	4.5e-289
WP_001114424.1|2943562_2945587_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_024025855.1|2945674_2946001_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	99.1	2.3e-49
WP_001281345.1|2945993_2946275_+	DNA breaking-rejoining protein	NA	S5MDP9	Escherichia_phage	98.9	2.7e-46
WP_044862705.1|2946277_2946901_+|tail	tail protein	tail	Q8VNN3	Enterobacteria_phage	99.5	2.6e-105
WP_000682719.1|2946913_2947312_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	98.5	2.9e-70
WP_000235098.1|2947319_2948072_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000479045.1|2948085_2948508_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000533440.1|2948534_2948948_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_032212771.1|2948928_2951541_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	87.8	0.0e+00
WP_000847401.1|2951537_2951867_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
WP_001299882.1|2951866_2952565_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	2.1e-132
WP_001370115.1|2952570_2953314_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	5.0e-148
WP_077696211.1|2953259_2953895_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	88.5	1.5e-97
WP_106914023.1|2954130_2957607_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	95.7	0.0e+00
WP_001230496.1|2957673_2958273_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	1.3e-109
WP_032212694.1|2958337_2959651_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.2	5.3e-76
WP_001023356.1|2959652_2959922_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
WP_122988840.1|2960032_2960110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122993102.1|2960324_2961338_+	peptidase M85	NA	NA	NA	NA	NA
WP_085948186.1|2961386_2962543_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001295593.1|2963397_2963832_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837940.1|2963972_2965106_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	59.1	6.3e-118
WP_000628168.1|2965471_2968996_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_001295715.1|2969269_2969536_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001295716.1|2969532_2969955_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_000762229.1|2970065_2971055_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_000900919.1|2971262_2973902_+	YdbH family protein	NA	NA	NA	NA	NA
WP_000698141.1|2973898_2974084_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_001296730.1|2974091_2974418_+	YdbL family protein	NA	NA	NA	NA	NA
WP_001067509.1|2974589_2975495_-	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_000138618.1|2975730_2977230_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000535469.1|2977287_2979561_-	primary-amine oxidase	NA	NA	NA	NA	NA
WP_001186507.1|2979808_2981854_-	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000191073.1|2982138_2983068_+	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_000073393.1|2983079_2983367_+	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_001072831.1|2983375_2984122_+	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_001189197.1|2984136_2984634_+	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_000206362.1|2984641_2985712_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001292357.1|2985708_2986476_+	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000969780.1|2986475_2987264_+	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_000973382.1|2987265_2988693_+	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000018416.1|2988682_2989105_+	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_001206188.1|2989104_2990310_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000632286.1|2990336_2991650_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_000039890.1|2991750_2992701_+	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_001123454.1|2992682_2993273_+	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_085948186.1|2994513_2995670_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
2998961:2998977	attR	GTTTTTTGCGCTGATAA	NA	NA	NA	NA
>prophage 10
NZ_CP027351	Escherichia coli strain 2014C-3655 chromosome, complete genome	5442537	3152326	3283362	5442537	portal,integrase,tail,transposase,terminase,capsid,holin,head,protease	Enterobacteria_phage(31.78%)	149	3218543:3218560	3270576:3270593
WP_085948186.1|3152326_3153483_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001022785.1|3154595_3156269_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_001296721.1|3156324_3156636_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_001370581.1|3156663_3157986_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_000722571.1|3158100_3158412_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000577184.1|3158610_3159309_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000087216.1|3159353_3160253_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_001054189.1|3160447_3161635_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000901367.1|3161761_3161857_+	protein MgtS	NA	NA	NA	NA	NA
WP_032285594.1|3162075_3162945_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.8e-19
WP_085948186.1|3163012_3164168_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000671731.1|3164487_3164880_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_001024746.1|3165155_3165674_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_001370614.1|3165717_3167763_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636571.1|3167899_3168646_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000215549.1|3168734_3169421_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214712.1|3169598_3169802_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000347482.1|3171387_3172671_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_106914037.1|3172730_3173045_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	81.9	2.7e-26
WP_122993102.1|3173415_3174429_-	peptidase M85	NA	NA	NA	NA	NA
WP_122988840.1|3174643_3174721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023386.1|3174831_3175101_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	95.5	6.0e-43
WP_032212629.1|3175102_3176416_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
WP_001230471.1|3176480_3177080_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	9.7e-110
WP_032212631.1|3177147_3180621_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	98.0	0.0e+00
WP_136865629.1|3180861_3181491_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	95.2	4.4e-105
WP_032212700.1|3181436_3182180_-|tail	phage tail protein	tail	H6WZM4	Escherichia_phage	98.0	2.3e-148
WP_032212713.1|3182190_3182889_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000847298.1|3182888_3183218_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_106914025.1|3183214_3185827_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	91.1	0.0e+00
WP_000533440.1|3185807_3186221_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479045.1|3186247_3186670_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000235098.1|3186683_3187436_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_106914004.1|3187443_3187839_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	93.1	5.7e-66
WP_024025847.1|3187835_3188414_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	6.6e-79
WP_000753019.1|3188425_3188779_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000158899.1|3188790_3189186_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.0e-55
WP_024025845.1|3189227_3190253_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	9.9e-187
WP_001299443.1|3190308_3190641_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_054626527.1|3190650_3191970_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	1.3e-231
WP_000198153.1|3193547_3193754_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027230.1|3193750_3195676_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|3195650_3196196_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|3196582_3196807_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|3196888_3197203_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|3197728_3197914_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|3198136_3198283_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|3198282_3198852_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992167.1|3199122_3199656_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
WP_000731236.1|3199706_3200051_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000411802.1|3200055_3200262_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000023191.1|3200709_3202560_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000466957.1|3203038_3203470_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000301797.1|3203920_3204634_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917748.1|3204769_3204967_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	95.4	1.5e-27
WP_000640035.1|3205191_3205746_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217447.1|3205754_3206114_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_001265229.1|3206126_3207176_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|3207177_3207450_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|3207571_3207916_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|3208035_3208248_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104475.1|3208481_3209039_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.3	2.4e-33
WP_000683609.1|3209040_3209259_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|3209386_3209698_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|3209690_3209918_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|3209914_3210196_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|3210228_3210945_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000139447.1|3210978_3211440_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_001262401.1|3211432_3212500_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	85.3	1.9e-84
WP_000693878.1|3212568_3212994_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|3212977_3213220_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|3213611_3213950_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|3214242_3214395_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|3214406_3215045_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|3215045_3215255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|3215819_3216008_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|3216004_3216193_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102122.1|3216285_3218748_+	exonuclease	NA	V5UQJ3	Shigella_phage	47.7	2.3e-125
3218543:3218560	attL	GGCAGGGGATCCCCTGCC	NA	NA	NA	NA
WP_085948186.1|3218926_3220082_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000086528.1|3220288_3220876_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	6.1e-24
WP_000836768.1|3221192_3221426_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|3221494_3221608_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_048258936.1|3223574_3223838_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.8	5.4e-12
WP_085948186.1|3223830_3224987_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001370405.1|3225043_3225565_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.9	2.3e-91
WP_072004194.1|3225564_3228519_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	80.7	6.0e-67
WP_001230525.1|3228583_3229183_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.0	8.8e-111
WP_000515486.1|3229249_3232648_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.6	0.0e+00
WP_001399694.1|3232708_3233356_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	1.2e-110
WP_000140752.1|3233253_3233997_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.5e-147
WP_001152409.1|3234002_3234701_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	2.3e-134
WP_000447255.1|3234710_3235040_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	8.6e-60
WP_000372036.1|3235039_3238105_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.7	0.0e+00
WP_001161009.1|3238076_3238406_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001370402.1|3238414_3238801_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	4.9e-62
WP_000211089.1|3238861_3239605_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	96.8	4.0e-129
WP_001079398.1|3239616_3240018_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000677106.1|3240014_3240593_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001283147.1|3240604_3240880_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.1e-44
WP_001097046.1|3240872_3241196_-	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	100.0	8.5e-52
WP_077633710.1|3243254_3244835_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	1.1e-288
WP_001072975.1|3244762_3244975_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000133409.1|3246457_3246739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000860401.1|3246996_3248886_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	51.5	9.4e-183
WP_000126660.1|3249544_3249967_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001399692.1|3249963_3250209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000833609.1|3250496_3252323_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.7	2.0e-129
WP_001261504.1|3252319_3252619_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001113138.1|3252625_3252946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024200973.1|3252938_3253202_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000179578.1|3253339_3253645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000130338.1|3253702_3253900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038673.1|3254020_3254599_-	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	65.4	4.9e-58
WP_000229066.1|3254658_3254883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000114064.1|3254875_3256114_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	35.1	6.6e-60
WP_001399690.1|3256231_3257203_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.7	3.1e-182
WP_000421825.1|3257277_3257817_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_001031431.1|3258369_3258576_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_000035577.1|3258876_3259287_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
WP_001019140.1|3259438_3259612_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|3259783_3259939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|3260018_3260084_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|3260086_3260275_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|3260285_3260498_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|3260859_3261357_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|3261353_3261887_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_024025755.1|3262199_3262415_-|holin	holin	holin	A5LH82	Enterobacteria_phage	93.0	5.5e-31
WP_000066485.1|3263168_3263384_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	7.7e-25
WP_000087756.1|3263684_3263897_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|3263951_3264041_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000203370.1|3264667_3264853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001047121.1|3266013_3266766_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	96.8	2.1e-133
WP_001265275.1|3266779_3267829_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.9	2.5e-113
WP_012775982.1|3267830_3268109_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_096910863.1|3268381_3269594_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
WP_001296941.1|3270868_3271105_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
3270576:3270593	attR	GGCAGGGGATCCCCTGCC	NA	NA	NA	NA
WP_000997984.1|3271262_3272801_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	3.0e-296
WP_000612591.1|3272850_3273198_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001066422.1|3273379_3274936_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.0	8.3e-161
WP_000631725.1|3274955_3275303_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|3275299_3275974_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000836078.1|3276215_3276782_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	30.2	1.5e-11
WP_001370501.1|3276793_3278008_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_001295395.1|3278213_3278540_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
WP_000705196.1|3278674_3279016_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|3279050_3279611_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_024025734.1|3279613_3280324_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|3280431_3280737_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041709.1|3280935_3283362_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.0e-214
>prophage 11
NZ_CP027351	Escherichia coli strain 2014C-3655 chromosome, complete genome	5442537	3582527	3654475	5442537	portal,integrase,tail,transposase,terminase,tRNA,capsid,holin,plate,head	Enterobacteria_phage(65.38%)	83	3618602:3618661	3655160:3655283
WP_001025305.1|3582527_3584261_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	5.7e-86
WP_001341423.1|3584441_3585116_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|3585112_3585460_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001066419.1|3585479_3587036_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
WP_001171554.1|3587184_3587565_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3587561_3587909_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000997984.1|3587958_3589497_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	3.0e-296
WP_001370468.1|3589604_3590093_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259583.1|3590212_3590605_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_001278912.1|3592674_3593823_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983611.1|3594024_3594669_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763874.1|3594679_3595069_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	34.6	1.0e-06
WP_000036378.1|3595083_3596133_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204335.1|3596135_3596996_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483246.1|3597014_3598616_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.9	2.2e-15
WP_001370571.1|3598661_3600323_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	7.6e-11
WP_000147302.1|3600467_3600971_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001355823.1|3600991_3602956_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|3602960_3603887_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906322.1|3603883_3604771_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|3604897_3605476_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|3605478_3605829_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122426.1|3606608_3607037_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001370485.1|3607043_3608468_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001295645.1|3608442_3609243_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100203.1|3609409_3610396_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187811.1|3610410_3611925_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548675.1|3611994_3612984_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000179469.1|3613780_3614284_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|3614362_3614614_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|3614728_3614815_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237866.1|3615077_3615401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|3615571_3616069_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377225.1|3616106_3616346_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797573.1|3616536_3617748_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847902.1|3617809_3618475_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
3618602:3618661	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001300279.1|3618831_3619833_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865386.1|3619838_3620186_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000786769.1|3620881_3621286_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_001673482.1|3621375_3621513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|3621584_3621788_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|3621809_3622160_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159467.1|3622170_3622449_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	5.3e-34
WP_000514274.1|3622460_3622703_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	6.8e-38
WP_000021655.1|3622699_3622813_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_029594336.1|3622927_3623323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985144.1|3623346_3623550_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	5.5e-25
WP_000153711.1|3623546_3623813_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	3.4e-30
WP_000108347.1|3623809_3624109_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	86.9	9.0e-40
WP_122985482.1|3624120_3624738_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	37.8	2.1e-06
WP_000564228.1|3624734_3625124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000686474.1|3628038_3628998_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	6.4e-180
WP_000211270.1|3629002_3629314_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	94.2	4.2e-48
WP_001289970.1|3629377_3629761_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	50.0	9.8e-31
WP_000711111.1|3629852_3630383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000087807.1|3630913_3631960_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.4	6.3e-205
WP_000613773.1|3631959_3633711_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.9	0.0e+00
WP_001262656.1|3633865_3634702_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.6	1.5e-148
WP_001055112.1|3634725_3635778_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.4	2.9e-194
WP_000632364.1|3635823_3636624_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	97.4	3.3e-137
WP_000063078.1|3636726_3637221_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.2	2.3e-88
WP_000864901.1|3637220_3637421_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104342.1|3637423_3637747_+|holin	phage holin, lambda family	holin	A0A0A7NRY9	Enterobacteria_phage	100.0	4.2e-51
WP_000072327.1|3637743_3638136_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780572.1|3638132_3638540_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
WP_000920594.1|3638677_3639145_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000356316.1|3639137_3639773_+|tail	tail protein	tail	A0A0A7NV60	Enterobacteria_phage	99.1	1.5e-113
WP_001271900.1|3639769_3640351_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	1.4e-100
WP_000213447.1|3640347_3640698_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111920.1|3640701_3641598_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	5.7e-154
WP_000071720.1|3641590_3642121_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_000108489.1|3642123_3644124_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	97.6	4.6e-111
WP_000885638.1|3644123_3644741_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	80.9	1.0e-85
WP_001447286.1|3644704_3645250_-	transferase	NA	NA	NA	NA	NA
WP_000853431.1|3645928_3648736_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.7	0.0e+00
WP_000333494.1|3648722_3648878_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	2.0e-22
WP_000665308.1|3648886_3649252_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000290450.1|3649306_3649819_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005425.1|3649818_3651003_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.0	4.4e-223
WP_000132830.1|3651160_3652270_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000488108.1|3652312_3652573_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|3652763_3652904_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_096910863.1|3653261_3654475_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
3655160:3655283	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA	NA	NA	NA	NA
>prophage 12
NZ_CP027351	Escherichia coli strain 2014C-3655 chromosome, complete genome	5442537	3800918	3809208	5442537		Moumouvirus(14.29%)	7	NA	NA
WP_000414659.1|3800918_3802022_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	32.1	2.7e-28
WP_086163603.1|3802021_3802921_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	64.7	1.8e-107
WP_000697837.1|3802887_3803976_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	50.3	2.5e-95
WP_000875590.1|3803978_3805007_-	Vi polysaccharide biosynthesis UDP-N-acetylglucosaminuronic acid C-4 epimerase TviC	NA	E3T4Y8	Cafeteria_roenbergensis_virus	45.1	4.5e-70
WP_000009507.1|3805043_3806324_-	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	A0A218MKK1	uncultured_virus	24.7	2.1e-08
WP_000183035.1|3806745_3807639_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
WP_001115962.1|3807813_3809208_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 13
NZ_CP027351	Escherichia coli strain 2014C-3655 chromosome, complete genome	5442537	3901006	3910448	5442537		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001370574.1|3901006_3902143_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
WP_001370558.1|3902139_3904140_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001295429.1|3904264_3904726_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001370504.1|3904766_3905237_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	1.1e-81
WP_000598641.1|3905283_3906003_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|3905999_3907685_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|3907906_3908638_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|3908697_3908805_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|3908785_3909517_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569358.1|3909521_3910448_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 14
NZ_CP027351	Escherichia coli strain 2014C-3655 chromosome, complete genome	5442537	4121234	4220183	5442537	integrase,tail,transposase,holin,tRNA,capsid,protease	Escherichia_phage(57.95%)	113	4152781:4152805	4220378:4220402
WP_001283581.1|4121234_4122047_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|4122046_4123060_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699121.1|4123125_4124262_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
WP_000615813.1|4124360_4125356_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127745.1|4125352_4126531_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817184.1|4126814_4128035_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683817.1|4128193_4130200_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|4130320_4130599_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089241.1|4130632_4131181_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447367.1|4131180_4131990_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043819.1|4131989_4132814_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|4132817_4133903_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001300582.1|4133937_4134870_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|4135035_4135587_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001370480.1|4135658_4136510_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000844751.1|4136511_4137051_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000714139.1|4137047_4137536_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000018471.1|4137532_4138042_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000482743.1|4138057_4138810_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000033328.1|4141552_4142116_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|4142799_4143285_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426163.1|4143487_4145632_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531955.1|4145631_4146942_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|4147122_4147407_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|4147778_4149119_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000937777.1|4149484_4150543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|4150724_4151480_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|4151773_4152706_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
4152781:4152805	attL	TGTCCTCTTAGTTAAATGGATATAA	NA	NA	NA	NA
WP_000885695.1|4152928_4161304_-	hypothetical protein	NA	A0A0P0ZCC7	Stx2-converting_phage	97.0	0.0e+00
WP_001370495.1|4161372_4162365_-	hypothetical protein	NA	A0A2L1IV65	Escherichia_phage	90.0	3.3e-163
WP_106914028.1|4162437_4163595_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000540396.1|4163916_4164168_-	hypothetical protein	NA	A0A2R2Z351	Escherichia_phage	97.4	5.1e-12
WP_000455646.1|4164177_4164624_-	hypothetical protein	NA	A0A2L1IV89	Escherichia_phage	97.3	1.3e-74
WP_000509480.1|4164626_4165280_-	hypothetical protein	NA	Q08J74	Stx2-converting_phage	96.8	1.1e-109
WP_000035554.1|4165373_4165775_-	hypothetical protein	NA	A0A2L1IV61	Escherichia_phage	97.0	3.9e-70
WP_000682942.1|4166204_4166927_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2L1IV31	Escherichia_phage	76.7	9.0e-102
WP_106914029.1|4167073_4167301_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	85.9	2.2e-30
WP_085948186.1|4167316_4168472_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001369201.1|4168903_4169185_-	hypothetical protein	NA	Q08J78	Stx2-converting_phage	100.0	3.1e-50
WP_000162956.1|4169199_4170468_-	host specificity protein J	NA	Q08J79	Stx2-converting_phage	100.0	9.9e-221
WP_001146329.1|4170464_4172090_-	hypothetical protein	NA	A0A088CBK0	Shigella_phage	99.8	0.0e+00
WP_001370566.1|4172393_4172573_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	2.8e-28
WP_001023433.1|4172710_4172980_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	98.9	6.4e-45
WP_000117996.1|4172981_4174820_-|tail	tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.0e-64
WP_000207919.1|4174816_4175467_-	hypothetical protein	NA	A0A0H4J3F2	Shigella_phage	99.5	3.9e-120
WP_000829203.1|4175466_4176030_-	hypothetical protein	NA	A0A0P0ZGG2	Escherichia_phage	99.5	7.0e-102
WP_001370499.1|4176013_4176475_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	94.8	3.3e-73
WP_001140444.1|4176525_4176915_-	hypothetical protein	NA	V5UT93	Shigella_phage	100.0	9.9e-63
WP_000214470.1|4176969_4178184_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	99.5	1.1e-232
WP_000345010.1|4178207_4179215_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000787524.1|4179372_4181517_-	hypothetical protein	NA	A0A2R2Z346	Escherichia_phage	99.9	0.0e+00
WP_000143998.1|4181516_4183223_-	hypothetical protein	NA	A0A1U9AJA6	Stx1_converting_phage	99.1	0.0e+00
WP_001086087.1|4183203_4184010_-	hypothetical protein	NA	A0A1U9AJA9	Stx1_converting_phage	99.3	1.1e-132
WP_001109019.1|4184302_4184854_-	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	100.0	4.5e-101
WP_012816791.1|4185081_4185267_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000455406.1|4185494_4185644_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001056887.1|4185643_4186213_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	98.9	2.6e-104
WP_000087714.1|4186487_4187021_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
WP_000284510.1|4187025_4187241_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001290216.1|4187317_4187590_-	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	98.9	3.1e-23
WP_000143462.1|4187630_4187810_-	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_000874429.1|4187945_4189883_-	SASA family carbohydrate esterase	NA	G9L6J1	Escherichia_phage	99.7	0.0e+00
WP_000738068.1|4190369_4190639_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|4190650_4191610_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001356551.1|4191992_4192145_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204859.1|4192393_4192828_-	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_000144767.1|4192820_4193015_-	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_001108009.1|4193011_4193617_-	recombination protein NinG	NA	Q8VNP2	Enterobacteria_phage	98.0	2.4e-95
WP_001004008.1|4193616_4194339_-	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	99.6	3.9e-129
WP_000178727.1|4194413_4195088_-	phage antirepressor Ant	NA	A0A0P0ZDQ5	Stx2-converting_phage	88.8	6.2e-113
WP_000201604.1|4195353_4195719_-	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	96.7	3.7e-43
WP_001254258.1|4195975_4196170_-	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	2.9e-31
WP_000153293.1|4196166_4196694_-	phage N-6-adenine-methyltransferase	NA	G9L688	Escherichia_phage	100.0	9.5e-101
WP_000573864.1|4196690_4197293_-	endonuclease	NA	G9L687	Escherichia_phage	100.0	1.7e-114
WP_001229012.1|4197285_4197702_-	NinB protein	NA	G9L686	Escherichia_phage	100.0	3.9e-73
WP_000103680.1|4197875_4198091_-	hypothetical protein	NA	G9L684	Escherichia_phage	100.0	2.2e-32
WP_000818843.1|4198235_4198442_-	hypothetical protein	NA	G9L683	Escherichia_phage	100.0	2.7e-27
WP_001036028.1|4198514_4198784_-	hypothetical protein	NA	G9L682	Escherichia_phage	100.0	2.9e-45
WP_001248397.1|4198780_4201174_-	DNA helicase	NA	G9L681	Escherichia_phage	99.7	0.0e+00
WP_000431329.1|4201170_4202058_-	hypothetical protein	NA	G9L680	Escherichia_phage	99.7	2.8e-145
WP_001244621.1|4202120_4202393_-	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_000438537.1|4202415_4202715_-	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	100.0	1.3e-49
WP_001180318.1|4202821_4203049_-	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250472.1|4203127_4203835_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	99.6	1.5e-133
WP_000885926.1|4203895_4204237_+	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	99.1	2.5e-62
WP_001189994.1|4204423_4205242_+	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	46.2	3.3e-36
WP_001370067.1|4205690_4206032_+	hypothetical protein	NA	F1C5C1	Cronobacter_phage	66.4	2.5e-30
WP_106914030.1|4206192_4206399_-|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.1	1.3e-32
WP_159031398.1|4206359_4206554_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	7.2e-06
WP_096910863.1|4206519_4207733_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
WP_157910050.1|4208756_4209293_+	hypothetical protein	NA	K7PKU5	Enterobacteria_phage	94.8	1.1e-88
WP_000065353.1|4209473_4209842_+	DUF2528 family protein	NA	A0A1U9AJB3	Stx1_converting_phage	99.2	2.6e-65
WP_001198858.1|4209914_4210055_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	3.3e-21
WP_000361831.1|4210047_4210161_+	host cell division inhibitory peptide Kil	NA	G9L669	Escherichia_phage	100.0	2.7e-13
WP_000613346.1|4210157_4210346_+	hypothetical protein	NA	G9L668	Escherichia_phage	100.0	2.2e-28
WP_000536228.1|4210354_4211035_+	AAA family ATPase	NA	G9L667	Escherichia_phage	100.0	3.4e-127
WP_000073097.1|4211031_4211619_+	hypothetical protein	NA	G9L666	Escherichia_phage	100.0	9.9e-107
WP_001111288.1|4211642_4211939_+	DUF2856 family protein	NA	G9L665	Escherichia_phage	100.0	9.5e-50
WP_001370500.1|4211949_4212114_+	DUF2737 family protein	NA	K7P7R0	Enterobacteria_phage	98.1	9.3e-23
WP_000812196.1|4212110_4212719_+	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	93.6	1.0e-82
WP_000034212.1|4212715_4213123_+	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	100.0	1.3e-70
WP_001014298.1|4213124_4213316_+	hypothetical protein	NA	A0A0P0ZG45	Escherichia_phage	100.0	3.3e-27
WP_000206781.1|4213318_4213768_+	hypothetical protein	NA	V5UT79	Shigella_phage	54.5	7.0e-20
WP_085948186.1|4213808_4214965_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000224734.1|4215049_4215247_+	hypothetical protein	NA	A0A222YWL3	Escherichia_phage	93.4	3.2e-25
WP_000628763.1|4215760_4216636_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	86.1	5.4e-141
WP_000969524.1|4216632_4216893_+	hypothetical protein	NA	A0A077SLR0	Escherichia_phage	98.8	1.9e-41
WP_000002101.1|4216892_4217177_+	ASCH domain-containing protein	NA	A0A0P0ZDM1	Stx2-converting_phage	97.9	7.7e-49
WP_000609349.1|4217225_4217894_+	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	95.2	1.1e-104
WP_001291844.1|4218134_4218347_+	DUF1382 family protein	NA	A0A2R2X2A7	Escherichia_phage	100.0	7.1e-31
WP_000994804.1|4218382_4218769_+	DUF1627 domain-containing protein	NA	A0A2L1IV77	Escherichia_phage	100.0	4.6e-52
WP_000453637.1|4218847_4219030_+	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_001218308.1|4219013_4220183_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	100.0	1.7e-230
4220378:4220402	attR	TGTCCTCTTAGTTAAATGGATATAA	NA	NA	NA	NA
>prophage 15
NZ_CP027351	Escherichia coli strain 2014C-3655 chromosome, complete genome	5442537	4442396	4587978	5442537	portal,integrase,tail,lysis,transposase,terminase,tRNA,capsid,holin,head,protease	Enterobacteria_phage(35.87%)	136	4571687:4571703	4595376:4595392
WP_001370572.1|4442396_4443134_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|4443265_4444600_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001370459.1|4444808_4445690_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|4445792_4446380_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|4446435_4446819_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|4447123_4447813_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|4447860_4448898_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|4449104_4449524_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001370531.1|4449592_4450291_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082964.1|4450322_4452983_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|4453096_4454452_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001300818.1|4454497_4454821_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|4454817_4456116_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|4461889_4464463_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040122.1|4464592_4465324_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079092.1|4465320_4466301_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197674.1|4466435_4467173_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|4467444_4467786_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|4467889_4467937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200116.1|4468035_4469196_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|4469238_4470360_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168045.1|4470370_4471441_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_001370532.1|4471649_4472015_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|4472164_4472683_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000589828.1|4473914_4474397_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|4474473_4474821_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|4474862_4475630_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|4475660_4476209_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|4476227_4476476_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|4476613_4477975_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|4478141_4478933_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_024026167.1|4478953_4480240_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001307957.1|4480294_4480888_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|4481010_4481889_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|4481974_4483636_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|4483784_4484126_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|4484187_4484478_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|4484467_4484944_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|4485075_4485558_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_012602456.1|4486363_4487578_+	type II restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	7.9e-34
WP_001288444.1|4487612_4489046_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.1	4.1e-106
WP_000355482.1|4489452_4490226_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	37.7	4.1e-36
WP_016243792.1|4490295_4490880_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	6.0e-104
WP_096956481.1|4490879_4493840_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	53.6	6.8e-55
WP_001233071.1|4493904_4494504_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
WP_023307636.1|4494574_4498072_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.2	0.0e+00
WP_021538849.1|4498132_4498780_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.8	9.5e-111
WP_032153133.1|4498677_4499421_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.1	4.7e-146
WP_023307632.1|4499426_4500125_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	8.6e-134
WP_000447253.1|4500134_4500464_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_089614926.1|4500463_4503529_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.4	0.0e+00
WP_044862787.1|4503500_4503830_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	99.1	2.2e-55
WP_054626523.1|4503838_4504225_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	99.2	1.2e-65
WP_000211121.1|4504285_4505029_-|tail	tail protein	tail	A5LH35	Enterobacteria_phage	100.0	1.6e-133
WP_001079419.1|4505039_4505441_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_000677112.1|4505437_4506016_-|tail	phage tail protein	tail	A0A291AWZ0	Escherichia_phage	99.5	9.4e-102
WP_001283152.1|4506027_4506303_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	8.6e-45
WP_001097045.1|4506295_4506619_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	100.0	8.5e-52
WP_088529315.1|4506705_4508733_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.8	0.0e+00
WP_000985938.1|4508677_4510186_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.2	2.3e-288
WP_001072975.1|4510185_4510398_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934130.1|4510394_4512497_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.3	0.0e+00
WP_044862709.1|4512496_4512991_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	99.4	2.2e-83
WP_000232224.1|4513444_4513807_-	hypothetical protein	NA	A5LH85	Enterobacteria_phage	99.2	8.9e-66
WP_001228685.1|4513890_4514076_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_000075159.1|4514292_4514790_-	lysozyme	NA	A5LH83	Enterobacteria_phage	100.0	1.3e-91
WP_000839596.1|4514789_4515005_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_096956487.1|4515071_4515446_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	93.5	4.4e-60
WP_001310393.1|4515703_4515937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000484663.1|4516080_4516620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106914034.1|4516834_4517587_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	6.4e-135
WP_044862794.1|4518596_4519406_-	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	99.6	3.0e-154
WP_023307627.1|4519425_4519815_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8SBE7	Shigella_phage	99.2	1.6e-68
WP_023363277.1|4519811_4520138_-	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	99.1	3.5e-53
WP_044862848.1|4520137_4520626_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.9	2.8e-83
WP_000061525.1|4520628_4521447_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	99.6	1.2e-121
WP_000620696.1|4521443_4521668_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_001087357.1|4521664_4522816_-	peptidase	NA	A0A0P0ZE80	Stx2-converting_phage	97.4	1.1e-210
WP_000515841.1|4522812_4523364_-	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	98.4	4.9e-100
WP_001191669.1|4523356_4523617_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_050922063.1|4523714_4524407_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	3.7e-121
WP_000135680.1|4525129_4525492_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_023277820.1|4525557_4526382_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	4.3e-148
WP_023363286.1|4526510_4527047_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.9	4.1e-99
WP_001596853.1|4527037_4527400_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	97.5	1.5e-65
WP_001331173.1|4527396_4527612_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	65.1	1.2e-14
WP_001331174.1|4527671_4527878_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_001596854.1|4527838_4529005_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.2	1.8e-147
WP_001596855.1|4529063_4530797_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_023363292.1|4530876_4531776_+	DNA adenine methylase	NA	A0A0C5AMX6	Cyanophage	23.2	2.5e-08
WP_000938111.1|4533058_4534420_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.6	4.3e-52
WP_001370516.1|4538788_4541137_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|4541156_4541246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023386.1|4541352_4541622_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	95.5	6.0e-43
WP_032212694.1|4541623_4542937_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.2	5.3e-76
WP_032212696.1|4543001_4543601_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	98.5	1.4e-108
WP_032212697.1|4543667_4547141_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	98.3	0.0e+00
WP_000649829.1|4547274_4547802_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_122994351.1|4547989_4548622_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	94.3	1.2e-97
WP_032212700.1|4548567_4549311_-|tail	phage tail protein	tail	H6WZM4	Escherichia_phage	98.0	2.3e-148
WP_032212666.1|4549321_4550020_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000807954.1|4550019_4550361_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212947.1|4550353_4553596_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.6	0.0e+00
WP_001453698.1|4553647_4553857_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000710949.1|4553952_4554327_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001275483.1|4554341_4555058_-|tail	tail protein	tail	B6DZA6	Enterobacteria_phage	99.6	2.1e-127
WP_000133388.1|4555123_4555468_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|4555464_4555911_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|4555907_4556258_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|4556268_4556595_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|4559121_4559343_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173032.1|4559387_4561325_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.5	0.0e+00
WP_001399696.1|4561388_4563050_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.3	0.0e+00
WP_000958402.1|4563046_4563610_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.4	4.0e-89
WP_000095749.1|4564296_4564524_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_000736096.1|4564892_4565117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047091958.1|4565202_4565388_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.3	1.3e-17
WP_000992122.1|4565905_4566439_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_000731236.1|4566489_4566834_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000411795.1|4566838_4567045_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	2.0e-30
WP_000143014.1|4567337_4569191_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	95.9	0.0e+00
WP_001344632.1|4569633_4569765_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_000101315.1|4570395_4571799_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
4571687:4571703	attL	TTGAAACTTTACAAAAA	NA	NA	NA	NA
WP_101329723.1|4571845_4572736_-	DNA methyltransferase	NA	A0A0P0YLW3	Yellowstone_lake_mimivirus	29.0	4.9e-17
WP_001205467.1|4572787_4573138_-	antitermination protein Q	NA	A0A0P0ZCW0	Stx2-converting_phage	89.1	6.8e-55
WP_001399360.1|4573137_4573380_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	97.5	2.1e-34
WP_001258395.1|4573621_4574482_-	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	97.2	8.6e-160
WP_000844622.1|4574481_4575450_-	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	98.8	2.3e-185
WP_000424040.1|4575451_4577110_-	DEAD/DEAH box helicase	NA	A0A1B5FPA4	Escherichia_phage	98.7	0.0e+00
WP_106914035.1|4579615_4580911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413407.1|4581306_4581720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024174260.1|4581834_4582230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948186.1|4583313_4584469_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001370696.1|4585410_4586544_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000998846.1|4586552_4586774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001234104.1|4586766_4587978_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
4595376:4595392	attR	TTTTTGTAAAGTTTCAA	NA	NA	NA	NA
>prophage 16
NZ_CP027351	Escherichia coli strain 2014C-3655 chromosome, complete genome	5442537	4669551	4676691	5442537		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|4669551_4672113_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141315.1|4672218_4672875_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.8	4.3e-50
WP_001297141.1|4672925_4673693_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|4673888_4674797_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590409.1|4674793_4676056_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.7	4.4e-136
WP_001278994.1|4676052_4676691_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 17
NZ_CP027351	Escherichia coli strain 2014C-3655 chromosome, complete genome	5442537	4900654	4944612	5442537	tRNA,integrase,transposase,protease	Stx2-converting_phage(60.0%)	47	4904575:4904590	4939585:4939600
WP_001370180.1|4900654_4901152_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|4901246_4901954_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222508.1|4902033_4902765_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|4902777_4903728_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|4903836_4904400_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017112.1|4904399_4904846_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
4904575:4904590	attL	TCGGTTTGCCGCTGAA	NA	NA	NA	NA
WP_101329719.1|4905054_4906029_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|4906001_4906706_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|4906723_4907290_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|4907286_4907577_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174739.1|4907584_4908178_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239917.1|4908170_4909307_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000784004.1|4909621_4910608_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000577033.1|4910652_4911156_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000378942.1|4911155_4912457_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_000745214.1|4912512_4913520_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394120.1|4913636_4914683_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|4914858_4915578_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|4915761_4916088_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|4916087_4916807_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001298922.1|4916967_4918020_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|4918047_4918323_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001298916.1|4918387_4919467_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|4919668_4920925_+	nucleoside permease	NA	NA	NA	NA	NA
WP_001370231.1|4920973_4923109_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234502.1|4923506_4924214_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218841.1|4924592_4925858_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_000997985.1|4925974_4927513_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	8.7e-296
WP_001341423.1|4927621_4928296_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|4928292_4928640_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001066419.1|4928659_4930216_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
WP_096855415.1|4930244_4930487_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	8.6e-41
WP_000422707.1|4931991_4932417_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	97.9	2.9e-47
WP_000624681.1|4932413_4932764_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	1.8e-39
WP_077633701.1|4934046_4934214_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000692312.1|4934282_4934504_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_024174207.1|4934666_4935041_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000854916.1|4935087_4935465_+	toxin	NA	NA	NA	NA	NA
WP_000777666.1|4935461_4935950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839246.1|4935961_4936159_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001066422.1|4936419_4937976_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.0	8.3e-161
WP_000631725.1|4937995_4938343_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|4938339_4939014_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_024174206.1|4939110_4939803_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
4939585:4939600	attR	TTCAGCGGCAAACCGA	NA	NA	NA	NA
WP_096910863.1|4940091_4941304_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
WP_000953521.1|4942317_4943682_-	EspK/GogB family type III secretion system effector	NA	Q9MBM1	Phage_Gifsy-1	29.5	7.3e-52
WP_001145628.1|4943973_4944612_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	42.7	9.0e-45
>prophage 18
NZ_CP027351	Escherichia coli strain 2014C-3655 chromosome, complete genome	5442537	5101299	5169548	5442537	tRNA,transposase,protease	Stx2-converting_phage(32.0%)	63	NA	NA
WP_001264365.1|5101299_5102313_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
WP_001144069.1|5102550_5102766_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|5102876_5104622_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437371.1|5104816_5106658_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|5106736_5107243_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001274557.1|5107542_5108388_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000772026.1|5108472_5108670_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001054228.1|5108689_5109178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854687.1|5109174_5109555_-	toxin	NA	NA	NA	NA	NA
WP_072189089.1|5109643_5110012_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692312.1|5110087_5110309_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_001186728.1|5110371_5110848_-	RadC family protein	NA	NA	NA	NA	NA
WP_000855068.1|5110863_5111337_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.5	2.5e-12
WP_001164974.1|5111430_5111676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001243192.1|5112234_5114013_-	reverse transcriptase	NA	A0A0U4J920	Pseudomonas_phage	29.2	5.2e-26
WP_000848829.1|5115125_5115536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348967.1|5115551_5115794_-	DNA polymerase III subunit gamma/tau	NA	NA	NA	NA	NA
WP_077252115.1|5115803_5116034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102649.1|5116363_5117434_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203527.1|5117430_5118336_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_000544707.1|5118332_5120729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069798.1|5120946_5121819_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000282124.1|5122149_5122332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000631725.1|5124354_5124702_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|5124698_5125373_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000301248.1|5125647_5126223_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_000116680.1|5126291_5126870_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000255079.1|5126918_5127959_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007449.1|5127981_5128437_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054789.1|5128459_5129617_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000254140.1|5129616_5130198_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001035166.1|5130520_5131579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280118.1|5131588_5132731_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001040060.1|5132723_5133497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182418.1|5133498_5134578_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_000797372.1|5134577_5135534_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506894.1|5135544_5136753_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|5136770_5137238_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042916.1|5137498_5137828_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957247.1|5137814_5138195_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_001370715.1|5138237_5139779_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	36.8	3.9e-78
WP_001443493.1|5141311_5141983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135714.1|5142849_5142990_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	3.1e-11
WP_000803992.1|5143291_5143555_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000024297.1|5145550_5145910_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000591998.1|5146002_5147622_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000134819.1|5147846_5148122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948186.1|5148260_5149416_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000424145.1|5150559_5150862_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_000612150.1|5150870_5151191_+	urease subunit beta	NA	NA	NA	NA	NA
WP_000065689.1|5151183_5152887_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_000966484.1|5152896_5153361_+	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_001142971.1|5153361_5154036_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_001021388.1|5154047_5154665_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_001034023.1|5157319_5161411_+|protease	serine protease autotransporter EspI	protease	Q9LA58	Enterobacterial_phage	44.6	6.8e-311
WP_077633724.1|5161864_5162113_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	80.2	1.3e-28
WP_001341423.1|5162126_5162801_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|5162797_5163145_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001066419.1|5163164_5164721_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
WP_000612591.1|5164979_5165327_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000997983.1|5165376_5166915_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	3.9e-296
WP_000035067.1|5166981_5167170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233443.1|5167187_5169548_-	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	31.8	2.6e-33
